Next-Generation Sequencing Approach to Hyperckemia: a 2-Year Cohort Study E352

Volume 5, Number 5, October 2019 Neurology.org/NG

A peer-reviewed clinical and translational neurology open access journal

ARTICLE Next-generation sequencing approach to hyperCKemia: A 2-year cohort study e352

ARTICLE Impaired kidney structure and function in spinal muscular atrophy e353

ARTICLE A family with spinocerebellar ataxia and retinitis pigmentosa att ributed to an ELOVL4 mutation e357

ARTICLE Epidemiology of DYT1 dystonia: Estimating prevalence via genetic ascertainment e358 TABLE OF CONTENTS Volume 5, Number 5, October 2019 Neurology.org/NG

e358 Epidemiology of DYT1 dystonia: Estimating prevalence via genetic ascertainment J. Park, S.M. Damrauer, A. Baras, J.G. Reid, J.D. Overton, and P. Gonzalez-Alegre Open Access

e359 Homozygous pathogenic variant in BRAT1 associated with nonprogressive cerebellar ataxia A. Mahjoub, Z. Cihlarova, M. T´etreault, L. MacNeil, N. Sondheimer, K.W. Caldecott, H. Hanzlikova, and G. Yoon, on behalf of the Care4Rare Canada Consortium Open Access Video Clinical/Scientific Notes

e351 Fatal TTR amyloidosis with neuropathy from domino liver p.Val71Ala transplant R.C. Puffer, R.J. Spinner, H. Bi, R. Sharma, Y. Wang, J.D. Theis, E.D. McPhail, J.J. Poterucha, Z. Niu, and C.J. Klein Open Access

e356 A novel PUS7 mutation causes intellectual disability with autistic and aggressive behaviors H. Darvish, L.J. Azcona, E. Alehabib, F. Jamali, A. Tafakhori, S. Ranji-Burachaloo, J.C. Jen, and C. Pais´an-Ruiz Open Access

e360 Enhancement of cranial nerves, conus medullaris, and nerve roots in POLG mitochondrial disease M. Bayat, Y. Yavarian, A. Bayat, and J. Christensen Open Access

e361 Digital necrosis in an infant with severe spinal muscular atrophy Articles D. Carrasco, P. Magoulas, J.C. Scull, J.A. Jarrell, S.R. Lalani, and M.F. Wangler e352 Next-generation sequencing approach to Open Access hyperCKemia: A 2-year cohort study Correction A. Rubegni, A. Malandrini, C. Dosi, G. Astrea, J. Baldacci, C. Battisti, G. Bertocci, M.A. Donati, M.T. Dotti, A. Federico, F. Giannini, e362 Genomic deletions upstream of lamin B1 lead to S. Grosso, R. Guerrini, S. Lenzi, M.A. Maioli, F. Melani, E. Mercuri, M. Sacchini, S. Salvatore, G. Siciliano, D. Tolomeo, P. Tonin, N. Volpi, atypical autosomal dominant leukodystrophy F.M. Santorelli, and D. Cassandrini Open Access e353 Impaired kidney structure and function in spinal muscular atrophy F.C. Nery, J.J. Siranosian, I. Rosales, M.-O. Deguise, A. Sharma, A.W. Muhtaseb, P. Nwe, A.J. Johnstone, R. Zhang, M. Fatouraei, N. Huemer, C.R.R. Alves, R. Kothary, and K.J. Swoboda Open Access e357 A family with spinocerebellar ataxia and retinitis Cover image pigmentosa attributed to an ELOVL4 mutation Kidney histopathology in patients with SMA type 1. Sections from the fi C. Xiao, E.M. Binkley, J. Rexach, A. Knight-Johnson, P. Khemani, kidneys of SMA cases show medullary calci cations along collecting B.L. Fogel, S. Das, E.M. Stone, and C.M. Gomez ducts. Medullary interstitial fibrosis is also present (trichrome). Open Access See e353 Academy Officers Neurology® is a registered trademark of the American Academy of Neurology (registration valid in the United States). James C. Stevens, MD, FAAN, President Neurology® Genetics (eISSN 2376-7839) is an open access journal published Orly Avitzur, MD, MBA, FAAN, President Elect online for the American Academy of Neurology, 201 Chicago Avenue, Ann H. Tilton, MD, FAAN, Vice President Minneapolis, MN 55415, by Wolters Kluwer Health, Inc. at 14700 Citicorp Drive, Bldg. 3, Hagerstown, MD 21742. Business offices are located at Two Carlayne E. Jackson, MD, FAAN, Secretary Commerce Square, 2001 Market Street, Philadelphia, PA 19103. Production offices are located at 351 West Camden Street, Baltimore, MD 21201-2436. Janis M. Miyasaki, MD, MEd, FRCPC, FAAN, Treasurer © 2019 American Academy of Neurology. Ralph L. Sacco, MD, MS, FAAN, Past President Neurology® Genetics is an official journal of the American Academy of Neurology. Journal website: Neurology.org/ng, AAN website: AAN.com Executive Office, American Academy of Neurology Copyright and Permission Information: Please go to the journal website (www.neurology.org/ng) and click the Permissions tab for the relevant Catherine M. Rydell, CAE article. Alternatively, send an email to [email protected]. Chief Executive Officer General information about permissions can be found here: https://shop.lww.com/ journal-permission. 20l Chicago Ave Disclaimer: Opinions expressed by the authors and advertisers are not Minneapolis, MN 55415 necessarily those of the American Academy of Neurology, its affiliates, or of the Publisher. The American Academy of Neurology, its affiliates, and the Tel: 612-928-6000 Publisher disclaim any liability to any party for the accuracy, completeness, efficacy, or availability of the material contained in this publication (including drug dosages) or for any damages arising out of the use Editorial Office or non-use of any of the material contained in this publication. Patricia K. Baskin, MS, Executive Editor Advertising Sales Representatives: Wolters Kluwer, 333 Seventh Avenue, Kathleen M. Pieper, Senior Managing Editor, Neurology New York, NY 10001. Contacts: Eileen Henry, tel: 732-778-2261, fax: 973-215- 2485, [email protected] and in Europe: Craig Silver, tel: +44 Lee Ann Kleffman, Managing Editor, Neurology® Genetics 7855 062 550 or e-mail: [email protected]. Sharon L. Quimby, Managing Editor, Neurology® Clinical Practice Careers & Events: Monique McLaughlin, Wolters Kluwer, Two Commerce fl Square, 2001 Market Street, Philadelphia, PA 19103, tel: 215-521-8468, fax: 215- Morgan S. Sorenson, Managing Editor, Neurology® Neuroimmunology & Neuroin ammation 521-8801; [email protected]. Andrea Rahkola, Production Editor, Neurology Reprints: Meredith Edelman, Commercial Reprint Sales, Wolters Kluwer, Two Robert J. Witherow, Senior Editorial Associate Commerce Square, 2001 Market Street, Philadelphia, PA 19103, tel: 215-356-2721; Karen Skaja, Senior Editorial Associate [email protected]; [email protected]. Special projects: US & Canada: Alan Moore, Wolters Kluwer, Two Kaitlyn Aman Ramm, Editorial Assistant Commerce Square, 2001 Market Street, Philadelphia, PA 19103, tel: Kristen Swendsrud, Editorial Assistant 215-521-8638, [email protected]. International: Andrew Wible, Senior Manager, Rights, Licensing, and Partnerships, Wolters Kluwer; Justin Daugherty, Editorial Assistant [email protected]. Madeleine Sendek, MPH, Editorial Assistant

Publisher Wolters Kluwer Baltimore, MD

Publishing Staff Kim Jansen, Executive Publisher Jessica Heise, Production Team Leader, Neurology Journals Megen Miller, Production Editor Steve Rose, Editorial Assistant Stacy Drossner, Production Associate

Copyright ª 2019 American Academy of Neurology. Unauthorized reproduction of this article is prohibited. A peer-reviewed clinical and translational neurology open access journal Neurology.org/NG

Neurology® Genetics

Editor Stefan M. Pulst, MD, Dr med, FAAN Vision Neurology®: Genetics will be the premier peer- reviewed journal in the ﬁeld of neurogenetics. Deputy Editor Massimo Pandolfo, MD, FAAN Mission Neurology: Genetics will provide neurologists Associate Editors and clinical research scientists with Alexandra Durr, MD, PhD outstanding peer-reviewed articles, Margherita Milone, MD, PhD editorials, and reviews to elucidate the role Raymond P. Roos, MD, FAAN of genetic and epigenetic variations in Jeﬀery M. Vance, MD, PhD diseases and biological traits of the central Editorial Board and peripheral nervous systems. Hilary Coon, PhD Giovanni Coppola, MD ChantalDepondt, MD, PhD Editorial Tel: 612-928-6400 Brent L. Fogel, MD, PhD, FAAN Inquiries Toll-free: 800-957-3182 (US) AnthonyJ. Griswold, PhD Fax: 612-454-2748 Orhun H. Kantarci, MD [email protected] Julie R. Korenberg, PhD, MD Davide Pareyson, MD Shoji Tsuji, MD,PhD DinekeS. Verbeek,PhD Stay facebook.com/NeurologyGenetics Connected David Viskochil, MD,PhD twitter.com/greenjournal JulianeWinkelmann, MD Juan I. Young, PhD youtube.com/user/NeurologyJournal

Neurology® Journals

Editor-in-Chief Classification of Evidence Robert A. Gross, MD, PhD, FAAN Review Team

Deputy Editor Melissa J. Armstrong, MD Bradford B. Worrall, MD, MSc, FAAN Richard L. Barbano, MD,PhD, FAAN RichardM.Dubinsky,MD,MPH,FAAN Section Editors Jeffrey J. Fletcher, MD, MSc Gary M. Franklin, MD, MPH, FAAN Biostatistics David S. Gloss II, MD,MPH&TM Richard J. Kryscio, PhD John J. Halperin, MD,FAAN Sue Leurgans, PhD Jason Lazarou, MSc, MD V. Shane Pankratz, PhD Steven R. Messé, MD, FAAN Classification of Evidence Evaluations Pushpa Narayanaswami, MBBS, DM, Gary S. Gronseth, MD, FAAN FAAN Alex Rae-Grant, MD Equity, Diversity, and Inclusion (EDI) RoyH.Hamilton,MD,MS,FAAN Holly E. Hinson, MD, MCR, FAAN

Podcasts Stacey L. Clardy, MD, PhD Jeﬀrey B. Ratliﬀ, MD, Deputy Podcast Editor

Ombudsman David S. Knopman, MD, FAAN

Scientiﬁc Integrity Advisor Robert B. Daroﬀ, MD, FAAN

Copyright ª 2019 American Academy of Neurology. Unauthorized reproduction of this article is prohibited. ARTICLE OPEN ACCESS Next-generation sequencing approach to hyperCKemia A 2-year cohort study

Anna Rubegni, MD, Alessandro Malandrini, MD, Claudia Dosi, MD, Guja Astrea, MD, Jacopo Baldacci, BS, Correspondence Carla Battisti, MD, Giulia Bertocci, BSc, M. Alice Donati, MD, M. Teresa Dotti, MD, Antonio Federico, MD, Dr. Santorelli [email protected] Fabio Giannini, MD, Salvatore Grosso, MD, Renzo Guerrini, MD, Sara Lenzi, MD, Maria A. Maioli, MD, Federico Melani, MD, Eugenio Mercuri, MD, Michele Sacchini, MD, Simona Salvatore, MD, Gabriele Siciliano, MD, Deborah Tolomeo, MD, Paola Tonin, MD, Nila Volpi, MD, Filippo M. Santorelli, MD, and Denise Cassandrini, PhD

Neurol Genet 2019;5:e352. doi:10.1212/NXG.0000000000000352 Abstract Objective Next-generation sequencing (NGS) was applied in molecularly undiagnosed asymptomatic or paucisymptomatic hyperCKemia to investigate whether this technique might allow detection of the genetic basis of the condition.

Methods Sixty-six patients with undiagnosed asymptomatic or paucisymptomatic hyperCKemia, referred to tertiary neuromuscular centers over an approximately 2-year period, were analyzed using a customized, targeted sequencing panel able to investigate the coding exons and ﬂanking intronic regions of 78 genes associated with limb-girdle muscular dystrophies, rhabdomyolysis, and metabolic and distal myopathies.

Results A molecular diagnosis was reached in 33 cases, corresponding to a positive diagnostic yield of 50%. Variants of unknown signiﬁcance were found in 17 patients (26%), whereas 16 cases (24%) remained molecularly undeﬁned. The major features of the diagnosed cases were mild proximal muscle weakness (found in 27%) and myalgia (in 24%). Fourteen patients with a molecular diagnosis and mild myopathic features on muscle biopsy remained asymptomatic at a 24-month follow-up.

Conclusions This study of patients with undiagnosed hyperCKemia, highlighting the advantages of NGS used as a ﬁrst-tier diagnostic approach in genetically heterogeneous conditions, illustrates the ongoing evolution of molecular diagnosis in the ﬁeld of clinical neurology. Isolated hyper- CKemia can be the sole feature alerting to a progressive muscular disorder requiring careful surveillance.

From the IRCCS Fondazione Stella Maris (A.R., G.A., J.B., G.B., S.L., F.M.S., D.C.), Pisa, Italy; Department of Medicine (A.M., C.B., M.T.D., A.F., F.G., S.S., N.V.), Surgery and Neurosciences, University of Siena; Department of Clinical and Experimental Medicine (C.D., G.S., D.T.), University of Pisa; Metabolic Disease Unit (M.A.D., M.S.), AOU Meyer Children Hospital, Florence; Department of Molecular and Developmental Medicine (S.G.), University of Siena, Siena; Pediatric Neurology (R.G., F.M.), AOU Meyer Children Hospital, Florence; Neurophysiopathology Multiple Sclerosis Center Hospital Binaghi (M.A.M.), Cagliari; Pediatric Neurology and Nemo Clinical Centre (E.M.), Fondazione Policlinico Universitario “A. Gemelli IRCSS”, Universit`a Cattolica del Sacro Cuore, Rome; and Department of Neurosciences (P.T.), Biomedicine and Movement Sciences, University of Verona, Italy.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

The Article Processing Charge was funded by the authors. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary CK = creatine kinase; EFNS = European Federation of Neurologic Societies; HPO = Human Phenotype Ontology; LGMD = limb-girdle muscular dystrophy; NGS = next-generation sequencing; ULN = upper limit of normal; VUS = variants of unknown signiﬁcance.

Creatine kinase (CK) levels can be mildly and transiently the EFNS criteria) were consecutively referred to the neu- increased as a result of muscle injury or exercise, even in rology, pediatric, or neuropediatric units of 7 Italian tertiary healthy individuals. Persistent elevation of serum CK (termed neuromuscular centers for clinical and diagnostic purposes. hyperCKemia) is defined, according to European Federation All 66 met the inclusion criteria for our study: (1) persistent of Neurological Societies (EFNS) guidelines (ean.org/ serum CK elevation at rest and (2) values higher than twice Guideline-Reference-Center.2699.0.html), as the presence of the ULN on at least 2 occasions after refraining from muscular serum CK values beyond 1.5 times the upper limit of normal exercise for at least 72 hours before CK measurement. For (ULN) in least 2 measurements,1 and it is a common reason each patient, we collected clinical and laboratory data and the for referrals to specialized neuromuscular centers. results of familial segregation analyses and previous genetic tests. MRI scans of thigh and calf muscles were performed in Increased serum CK can be present in the absence of obvious 26 patients, EMG in 26, and muscle biopsy in 57, in all cases clinical signs.2 In individuals with a normal neurologic ex- using routine clinical methods.5 Before this study, we had amination, the condition is termed asymptomatic or isolated performed multiplex ligation-dependent probe amplifica- hyperCKemia, and it can signal the presence of several un- tion analysis in all the patients to exclude multiexon rear- suspected metabolic, cardiac, rheumatic, or endocrine con- rangements in the DMD gene and tested the levels of acid ditions. When no underlying cause is found, it is referred to as alpha-glucosidase from dried blood spots6 to detect possible idiopathic hyperCKemia. The clinical management of idio- undiagnosed late-onset Pompe disease. Patients with bor- pathic hyperCKemia is unclear; although clinically asymp- derline enzyme values or biallelic mutations in the GAA tomatic, affected patients are potentially susceptible to gene were not included in this study. DNA samples were malignant hyperthermia.3 analyzed at a single center.

In asymptomatic hyperCKemia, definition of the correct di- None of the 66 individuals had a medical history of anesthesia- agnosis may be time consuming, and success is not guaran- related complications or a family history of cardiovascular teed. Next-generation sequencing (NGS) has recently been events. Any family history of neuromuscular disorders or mild proposed as a cost-effective strategy for the molecular di- muscle complaints was carefully recorded. Occasional causes of agnosis of inherited neuromuscular disorders.4 The efforts to hyperCKemia, such as malignancies, drug and alcohol abuse, define the molecular etiology in hyperCKemia come from the rheumatic, thyroid, and parathyroid disorders, infections, and need to refine follow-up avoiding unnecessary examinations hematologic diseases, were all excluded. All patients underwent and to improve counseling in the family. We set out to explore routine serum chemistry, including serum myoglobin mea- whether NGS might allow detection of the molecular basis of surement. No participant was under statin treatment or taking hyperCKemia, addressing this question in a consecutive series other drugs potentially capable of inducing hyperCKemia. of adults and children recruited at 7 Italian tertiary neuromuscular centers over an approximately 2-year period. NGS workflow and sequencing analyses We used the SureSelect technology (Agilent, Santa Clara, CA) and SureDesign software (earray.chem.agilent.com/ Methods suredesign/) to design a multiexon amplicon panel containing Standard protocol approvals, registrations, a total of 78 genes known to be associated with limb-girdle and patient consents muscular dystrophies (LGMDs), rhabdomyolysis, and meta- 7 This study was approved by the Tuscany Regional Pediatric bolic and distal myopathies ; the panel spanned more than Ethics committee. All the procedures complied with the 259 Mbp, with gene coverage >99%. To analyze the data Helsinki Declaration of 1975. Genetic studies and muscle obtained from our study, we used a routine bioinformatic 8 biopsies were performed with written informed consent. All pipeline that adopts the Ingenuity Variant analysis suite participants (including parents or legal guardians in case of (Qiagen, apps.ingenuity.com). To assign pathogenicity, we minor patients) were provided pre- and post-test genetic set up a precise Alissa (Agilent) pipeline using the following counseling as routine in our neurogenetic clinics. criteria: a sequence quality score greater than 30, a read depth greater than 30, and rare occurrence in publicly available Patients and study design polymorphic data sets (with a minor allele frequency <0.01% Over an approximately 2-year period (May 2016–August for autosomal dominant and <0.1% for autosomal recessive 2018), 66 patients presenting with hyperCKemia (meeting genes) with less than 1 occurrence in homozygosity in

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG gnomADv2.1 (gnomad.broadinstitute.org/; macarthurlab. Most of the patients were Italian, adults (≥16 years), and ap- org/2018/10/17/gnomad-v2-1). As reported previously, we parently sporadic cases. Although none of them had obvious determined predictably or probably deleterious scores using neuromuscular disorders, 16 had a positive family history of an in silico pipeline using a set of 10 prediction software muscle weakness or fatigue compatible with autosomal domi- packages.8 Putatively deleterious variants were validated by nant inheritance in 13 and a recessive pattern of inheritance in PCR-based standard capillary Sanger sequencing, both in 3. Their mean age at onset (i.e., at the time of the first docu- patients and in relatives whose DNA was available for segre- mented evidence of hyperCKemia) was 26.7 ± 19.2 years, when gation studies, also to determine inheritance and phases of they had serum CK levels ranging from 300 to 103,000 UI/L multiple gene variants and to establish whether variants had (normal <190 UI/L). Their disease duration ranged from 3 occurred de novo. Segregation in affected and unaffected months to 30 years. Clinical examination revealed mild limb- relatives made it possible to better define pathogenic variants girdle muscle weakness (median Medical Research Council once we had identified those more likely to be disease scale score of 5 in upper girdle and 4+ in lower girdle muscle) in causative. 19 patients (figures 1–2). The distribution of the muscle weakness in these symptomatic patients is presented in figure 2 Routine morphology and immunofluorescence analysis of using the Human Phenotype Ontology (HPO) ID codes and muscle proteins were performed on vastus lateralis biopsy nomenclature.9 Thirteen participants reported occasional ex- samples according to standard protocols. ercise intolerance and myalgia, but showed no clear evidence of muscle weakness. Thirty-four patients remained completely Data availability asymptomatic over a 2-year observational period (figure 1). The data set used and analyzed during the current study is The patients’ serum CK levels at their latest neurologic ex- available from the corresponding author on reasonable request. amination ranged from 150 to 64,610 UI/L.

Cardiac examination, performed at some point during the Results course of the clinical follow-up, was unremarkable in all the patients except 4 whose ECG showed arrhythmias of un- We evaluated 66 patients with hyperCKemia (44 men and certain signiﬁcance. Pulmonary and functional respiratory 22 women, age range 5–73 years), referred over an ap- tests were within normal limits in all the patients and proximately 2-year period to tertiary neuromuscular centers. remained so throughout the study.

Figure 1 Flowchart of patients’ enrollment and results of genetic testing

VUS = variants of unknown significance.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 EMG, performed on average 1 year after hyperCKemia onset, internal databases, and annotation as disease-associated var- showed myopathic changes in 17 patients. Few patients un- iants with Alissa, a customizable pipeline tool.10 Presence of derwent repeated neurophysiologic follow-up, and none of the specific variant in the Human Genome Mutation Database these showed substantial modifications. Twenty-six patients (hgmd.cf.ac.uk) was not considered a mandatory criterion for underwent muscle MRI scans at least once during the study, attributing pathogenic significance. Bioinformatics data were and these scans were unremarkable in 17 and not informative combined and critically reevaluated taking into consideration in the other 9. Fifty-seven patients underwent a skeletal clinical presentation with the relative HPO definition, age at muscle biopsy. In 8 cases (14%), this showed clear dystrophic onset, and segregation studies in familial cases. Moreover, in changes, with fat and connective tissue replacement suggest- cases submitted to muscle biopsy, we integrated histologic ing a possible diagnosis of muscular dystrophy, whereas the and immunofluorescence features. vast majority (38/57, 67%) showed only mild, nonspecific myopathic changes, with normal muscle protein staining and On the basis of these procedural steps and criteria, already no abnormal metabolic features (figure 3 and supplementary used by us in previous research,7 we assigned a confirmatory figure e-1, links.lww.com/NXG/A175). Muscle biopsy was genetic diagnosis to 19 patients presenting pathogenic, normal in 11 patients. disease-associated (n = 13), or likely pathogenic (n = 6) variants. We also identified 14 patients harboring changes Through multigene targeted NGS analysis, we identified an predicted to affect function in genes corresponding to the average of 50 rare variants in each patient. To facilitate our clinical suspicions in these cases, thereby increasing group of “needle in a haystack” search, we used a stringent set of bio- individuals with a molecular diagnosis to 33 patients. We informatics filters, including effects on the protein, scores for confirmed the molecular diagnosis using segregation analysis predicting pathogenicity, allele frequencies in public and or immunofluorescence, or Western blotting on muscle

Figure 2 Clinical features of symptomatic patients presented using HPO ID codes and nomenclature

(A) Muscle weakness pattern frequencies expressed as percentage rates. Clinical phenotypes are indicated using the HPO ID codes. HP:0003325 = limb-girdle muscle weakness; HP:0008994 = proximal muscle weakness in lower limbs; HP:0003749 = pelvic girdle muscle weakness. (B) Fre- quencies of clinical phenotypes associated with hyperCKemia expressed as percentage rates. Clinical phenotypes are indicated using HPO codes and nomenclature. HPO = human phenotype ontology.

4 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG Figure 3 Myopathologic changes in patients with limb-girdle muscle weakness (top row, A–C), myalgia, and exercise intolerance (middle row, D–F) and in asymptomatic patients (bottom row, G–I)

(A and B) Hematoxylin and eosin (HE) staining demonstrating marked variation in fiber size, several central nuclei, and increased connective tissue staining in P4 and P16, respectively. (C) HE staining showing several degenerating fibers in P29. (D) HE staining revealing slight variation in fiber size and some central nuclei in P3. (E) Gomori trichrome staining showing some hypotrophic fibers and increased internal nuclei in P28. (F) NADH-TR staining showing moth- eaten fibers in P33. (G) HE staining demonstrating mild variation in fiber size and a few central nuclei in P7. (H and I) Gomori trichrome staining showing slight variation in fiber size and some internal nuclei in P19 and P22, respectively. Magnification 200×.

biopsies, or their combination. Detailed information on these there was only a partial correspondence with the clinical phe- patients, including clinical characteristics, CK levels, muscle notype or we discovered a single truncating variant (or a known biopsy, and gene mutations, is shown in tables 1 and 2, whereas disease-associated variant) in a recessive candidate gene. Most the genetic data are summarized in figure 4 and further detailed VUS occurred in 3 genes, namely CAPN3, CPT2,andANO5 in supplementary web data (tables e-1 to e-4, links.lww.com/ (figure 1 and supplementary table e-3, links.lww.com/NXG/ NXG/A176, links.lww.com/NXG/A177, links.lww.com/ A178). Although it is possible that the low number of genes in NXG/A178, and links.lww.com/NXG/A179). our panel limited its informativeness on the patients’ genotypes, it is also conceivable that in the VUS subgroup, the second allele Of the aforementioned 33 patients, 9 showed mild limb-girdle may carry a deep intronic change leading to a mRNA splicing muscle weakness, 10 showed myalgia and/or occasional ex- defect or large scale gene deletions/duplications, or a variation in ercise intolerance, and 1 case rhabdomyolysis, whereas 14 genomic regulatory regions not covered in our study. Our study were asymptomatic despite having muscle biopsies showing explored none of these possibilities. low immunofluorescence for specific proteins (Figure 1, figure e-1, links.lww.com/NXG/A175). Immunofluorescence Sixteen patients harbored molecular findings not compatible analysis was performed to corroborate loss-of-function var- with their phenotypes. Although we cannot exclude a possible iants in 7 cases. With regard to the genetic analyses, patho- role for some of the variants detected in this subgroup, other genic variants in RYR1 were found in 11 patients, in ANO5 in additional and undetected genetic changes could well be re- 4. Four patients harbored pathogenic variants in genes sponsible for their phenotypes. encoding sarcoglycans, whereas 3 in CAPN3 (figure 4). Serum CK levels in the group of molecularly defined patients ranged from 600 to 67,490 UI/L, whereas muscle biopsy (performed Discussion in 31/33 individuals) showed evidence of dystrophic pro- cesses in 6 (figure 3, figure e-1), mild nonspecific muscle Both the EFNS guidelines1 and the authors of a more recent changes in 21, and no noteworthy alterations in 4 patients. review article35 recommend conducting further investigations in individuals with apparently idiopathic hyperCKemia if the CK Variants of unknown significance (VUS) with a potential caus- level is repeatedly more than 3 times higher than the ULN, EMG ative role were found in 17 additional patients (supplementary reveals myopathic changes, and the patient is younger than 25 table e-3, links.lww.com/NXG/A178). In these cases, either years. However, it is anticipated that advancing knowledge in the

Table 1 Clinical and genetic features in 13 patients with pathogenic variants

Sex/ Serum CK Muscle Mutated ID age (y) (UI/L) Clinical findings HPO ID code biopsy gene Mutation cDNA level Mutation protein level Inheritance Reference

P9 F/54 y 1,310 Asymptomatic NA NA ANO5b c.1733T>C/c.2295C>G p.Phe578Ser/p.Tyr765* AR [11]

P10 F/61 y 2000 Limb-girdle muscle weakness HP:0003325 Mild CAPN3b c.633G>T/ p.Lys211Asn/ AR [12] myopathic c.1537insCCCCATCTCTCAG Met513Thrfs*68 signs

P13 M/32 y 1800 Myalgia and exercise intolerance HP:0003326; HP: Normal TCAPc c.33_35del/- p.Glu12del/- AD This work 0009020

P15 M/7 y 7,348 Asymptomatic NA NA CAPN3b c.549delA/c.2115+2T>A p.Thr184Argfs*35/splice AR [13,14] sitea

P16 M/14 y 2,800 Limb-girdle muscle weakness HP:0003325 Dystrophic SGCGc c.195+1G>A/c.195+1G>A Splice sitea/splice sitea AR This work signs

P22 F/48 y 2000 Asymptomatic NA Mild ANO5b c.1356C>G/c.1356C>G p.Tyr452*/p.Tyr452* AR This work myopathic signs

P25 M/11 y 19,000 Exercise intolerance and pelvic girdle HP:0009020; HP: Dystrophic DMDc c.151_153del p.Leu51del XL This work muscle weakness 0003749 signs

P27 F/67 y 900 Pelvic girdle muscle weakness HP:0003749 Mild PYGMc c.2262delA/c.406G>A p.Lys754Asnfs*49/ AR [14] myopathic p.Gly136Ser signs

P28 F/32 y 4500 Exercise intolerance and myalgia HP:0009020; HP: Mild SGCAc c.739G>A/c.850C>T p.Val247Met/p.Arg284Cys AR [15, 16] 0003326 myopathic signs

P29 F/6 y 16,340 Limb-girdle muscle weakness HP:0003325 Dystrophic SGCGc c.521delT/c.521delT p.Leu174Leufs*21/ AR This work signs p.Leu174Leufs*21

P30 M/66 y 1800 Asymptomatic NA Mild ANO5b c.629C>T/c.726dupT p.Ser210Leu/ AR [17] myopathic p.Ser243Phefs*2 signs

P32 M/53 y 780 Myalgia and exercise intolerance HP:0003326; HP: Mild PYGM/ PYGM: c.[148C>T]; CPT2: PYGM:p.[Arg50*]; CPT2: NA [18–20] 0009020 myopathic CPT2b c.[1348A>T] p.[Arg450*] signs

P33 M/18 2,937 Myalgia and exercise intolerance HP:0003326; HP: Mild myopathic MYH7b c.3790delG/- p.Glu1264Argfs*34/- AD This work 0009020 signs

Abbreviations: AD = autosomal dominant; AR = autosomal recessive; HPO = Human Phenotype Ontology; NA = not available; XL = X-linked. a Predicting splice site loss and exon skipping (fruitfly.org/seq_tools/splice.html). Functional validation was derived by bimmunofluorescence/protein studies combined with predictive early protein truncation or cimmuno- fluorescence studies only. Table 2 Clinical and genetic features in 20 patients with “likely” pathogenic variants

Sex/ Serum age CK (UI/ Clinical HPO ID Muscle Mutated Mutation Mutation ID (y) L) findings code biopsy gene cDNA level protein level Inheritance Reference

P1 M/ 3,000 Asymptomatic NA Mild RYR1 c.8888T>C/- p.Leu2963Pro/- AD [21] 19 y myopathic signs

P2 M/ 800 Asymptomatic NA Mild RYR1b c.7373G>A/- p.Arg2458His/- AD [22] 56 y myopathic signs

P3 M/ 816 Exercise HP: Mild RYR1 c.1163C>T/- p.Ser388Leu/- NA This work 68 y intolerance 0009020 myopathic signs

P4d M/ 1,044 Limb-girdle HP: Dystrophic GMPPBb c.95C>T/ p.Pro32Leu/ AR [8, 23] 48 y muscle 0003325 signs c.727C>T p.Arg243Trp weakness

P5 F/65 600 Myalgia HP: Mild MYH7 c.2009T>C/- p.Val670Ala/- NA This work y 0003326 myopathic signs

P6 M/ 865 Asymptomatic NA Mild RYR1b c.7291G>A/- p.Asp2431Asn/- NA [24] 17 y myopathic signs

P7 M/ 1,000 Asymptomatic NA Mild RYR1b c.5036G>A/- p.Arg1679His/- AD [25] 32 y myopathic signs

P8 M/ 1,000 Myalgia HP: Mild RYR1b c.7048G>A/- p.Ala2350Thr/- AD [26] 40 y 0003326 myopathic signs

P11d F/51 3,000 Limb-girdle HP: Dystrophic DYSFc c.862G>T/ p.Asp288Tyr/ AR [27] y muscle 0003325 signs c.2875C>T p.Arg959Trp weakness

P12 M/ 728 Myalgia and HP: Mild RYR1b c.6599C>T/- p.Ala2200Val/- AD [28] 11 y exercise 0003326; myopathic intolerance HP: signs 0009020

P14 F/65 3,300 Limb-girdle HP: Dystrophic ANO5 c.580C>T/ p.Arg194Trp/ AR This work y muscle 0003325 signs c.2219C>T p.Ser740Phe weakness

P17d M/5 67,490 Rhabdomyolysis HP: Mild CPT2b c.338C>T/ p.Ser113Leu/ AR [29] y 0003201 myopathic c.338C>T p.Ser113Leu signs

P18 M/ 600 Asymptomatic NA Normal RYR1b c.[4711A>G; p.[(Ile1571Val; NA [30–32] 29 y 10097G>A]/ Arg3366His)]/ c.11798A > G p.Tyr3933Cys

P19 M/ 2000 Asymptomatic NA Normal CAPN3 c.[1,395_ p.[(Leu465_ AR [12, 32, 33] 39 y 1397del; Glu466del; 2257G>A]/ Asp753Asn)]/ 1453A>G p.Met485Val

P20d M/ 12,000 Asymptomatic NA Mild SGCA c.242G>A/ p.Arg81His/ NA [15] 24 y myopathic c.739G>A p.Val247Met signs

P21 F/53 500 Limb-girdle HP: Mild RYR1 c.10923- Splice sitea/- NA This work y muscle 0003325 myopathic 8C>A/- weakness signs

P23 M/ 1,000 Asymptomatic NA Mild RYR1 c.14812A>G/- p.Ile4938Val/- NA This work 64 y myopathic signs

P24d M/ 1,103 Myalgia HP: Mild MYOT c.179C>T/- p.Ser60Phe/- AD [34] 67 y 0003326 myopathic signs

Continued

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 7 Table 2 Clinical and genetic features in 20 patients with “likely” pathogenic variants (continued)

Sex/ Serum age CK (UI/ Clinical HPO ID Muscle Mutated Mutation Mutation ID (y) L) findings code biopsy gene cDNA level protein level Inheritance Reference

P26d M/ 1929 Asymptomatic NA Normal POMT2c c.[1733G>A; p.[(Arg578His; AR This work 21 y 239C>T]/ Pro80Leu)]/ c.707T>G p.Leu236Arg

P31 M/ 40,000 Asymptomatic NA Mild RYR1c c.5288C>T/ p.Pro1763Leu/ NA This work 26 y myopathic c.7681C>T p.Leu2561Phe signs

Abbreviations: AD = autosomal dominant; AR = autosomal recessive; HPO = human phenotype ontology; NA = not available. aPredicting splice site loss and exon skipping (fruitfly.org/seq_tools/splice.html). bFunctional validation derived by immunofluorescence/protein studies combined with predictive early protein truncation/previous published work with evidences of pathogenicity. cFunctional validation derived through immunofluorescence studies only. d Patients with “likely” pathogenic variants confirmed by immunofluorescence analysis or previously published evidence of pathogenicity.

field of muscle disorders will lead to the identification of previously NGS, which has involved the development of different gene panels unrecognized causes of hyperCKemia, thereby reducing the pro- and seen the focus switch to peculiar muscle phenotypes, has portion of idiopathic cases. This would be an important de- transformed the approach to the study of neuromuscular disorders velopment, as it would allow more precise clinical monitoring and (the relevant data are for the most part reviewed in reference 4). follow-up and help to clarify the natural history of the different Some studies have also addressed, among other aspects, the ge- forms. notype of patients with isolated hyperCKemia, reporting a limited diagnostic yield (21%) in fewer than 40 patients.39,40 Studies conducted before NGS entered the clinical arena considered the diagnostic impact of muscle biopsy in the evaluation of Herein, we report the results obtained in a cohort of 66 – patients with asymptomatic hyperCKemia2,3,36 38 and the relative patients with hyperCKemia, half of whom were asymptomatic frequency of common genes such as DMD.38 In recent years, on evaluation. Our use of massive parallel sequencing with

Figure 4 Diagnostic rates and molecular results

(A) Pathogenic or likely pathogenic variants were found in 50% of the patients, whereas 25.7% showed variants that required further characterization, and 24.3% did not present pathogenic variants. (B) Type of causative mutations identified in diagnosed patients: missense (67%), small indels (18%), splice site variants (6%), and nonsense mutations (9%). (C) Bar chart showing number of patients with “pathogenic” (red), “likely pathogenic” variants (yellow), and variants of unknown significance (green) for each gene.

8 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG a multigene panel combined with the application of stringent substantiated by reduced α-sarcoglycan labeling in skeletal muscle bioinformatics filters, and integration of muscle phenotypes (both (figure e-1, links.lww.com/NXG/A175, A-B). Fourth, 26% of the clinical and morphological), produced a 50% diagnostic yield, patients were found to harbor VUS. Nonetheless, we frequently a rate higher than those previously reported.39,40 This difference is identified single deleterious variants in CAPN3 and CPT2,2 likely related to the combination of genotype with integrated autosomal recessive genes where manifesting heterozygosity re- – clinico-morphological phenotype data in the present study, to its portedly occurs.43 45 The existence, in hyperCKemia, of symp- more homogeneous population (mostly adults in our cohort as tomatic carriers, various degrees of clinical severity, and large opposed to the mixed populations studied by others), to technical intrafamilial heterogeneity of the phenotype (ranging from improvements implicit in more recent gene panel technologies, asymptomatic to fatal) could be explained by factors other than or to a combination of these factors. There were no straightfor- the genotype. In the case of CPT2-related myopathy, for exam- ward differences between the solved and unsolved participants, ple, one might consider different degrees of exposure to with clinical features and serum CK values being roughly the triggering/environmental factors (e.g., temperature, nutrition, same in the 2 subgroups. Our data confirm that main challenges fitness level) capable of increasing dependency on fat oxidation in NGS data analysis are the clinical interpretation of molecular and further impairing exercise performance.46 Taking these fac- findings and the distinction of causative mutations from the tors into consideration, as well as the possibility of synergistic plethora of not clinically significant DNA variations. The low heterozygosity34 (as in our case P32) and digenic inheritance, it is frequency of variants, or their absence in reference polymorphic imperative to combine thorough expert clinical and myopatho- databases, is recognized as a necessary but not sufficient criterion logic evaluation with NGS as a prelude to a higher diagnostic rate to assign pathogenicity. Moreover, in silico predictions present in patients with paucisymptomatic hyperCKemia. Finally, iso- often unanticipated discordance between different predicting lated hyperCKemia can be the sole feature alerting to a pro- algorithms.4 All this make more complex to reach a final mo- gressive muscular disorder requiring careful surveillance and may lecular diagnosis. Considering our results overall, there emerge open new prospective in future therapeutic opportunities. several points worth underlining. First, of the 33 patients who received a molecular diagnosis, 11 harbored mutations in RYR1, Acknowledgment and all of these presented normal muscle MRI scans and subtle The authors thank Catherine J. Wrenn, who provided expert muscle involvement on skeletal muscle biopsy. Only 1 presented editorial assistance. episodes of rhabdomyolysis, 2 presented myalgia, and 1 showed mild limb-girdle muscle weakness. Conversely, 7 patients were Study funding fully asymptomatic with a normal clinical evaluation associated Funding partially provided by Telethon Foundation grants with serum steady CK levels ranging from 500 to 1,000 UI/L. GUP13004 to GA) and Regione Toscana FAS SALUTE 2014 Although we did not seek to further corroborate our genomic (CUP 4042.16092014.066000060 to FMS). findings by evaluating their functional impact on intracellular calcium homeostasis through complex studies or by performing Disclosure immunoblotting with commercial antibodies, all the detected Disclosures available: Neurology.org/NG. RYR1 variants were rare ones, namely those inherited segregated in familial cases with clinical manifestations, and all are likely to Publication history perturb secondary ryanodine-1 receptor structure in protein Received by Neurology: Genetics March 21, 2019. Accepted in final form modeling (not shown). Overall, our data imply that mutations in June 21, 2019. RYR1 may be a common in hyperCKemia, even when CK levels are <1,000 UI/L. Of interest, we observed that the RYR1 participants presented pseudometabolic features more frequently Appendix Authors than patients harboring other genotypes but did not stand up as Name Location Role Contribution a clinically different subgroup. Second, we identified biallelic Anna IRCCS Author Designed and conceptualized mutations in ANO5 in 4 patients and mutations in SGCA in 2 Rubegni, MD Stella the study; analyzed the data; adults with long-lasting hyperCKemia without muscle weakness. Maris, Pisa and drafted the manuscript for intellectual content These data support previous impressions suggesting that analysis of known LGMD genes is justified even when isolated hyper- Alessandro University Author Major role in the acquisition of Malandrini, of Siena data and drafted the CKemia or minimal muscle weakness is the sole clinical MD manuscript for intellectual manifestation.41,42 Third, we frequently observed mild, non- content fi fi speci c muscle abnormalities consisting of variation in ber size, Claudia Dosi, University Author Acquisition, analysis, and nuclear internalization, or these 2 features combined; these MD of Pisa interpretation of data and critical revision of the alterations were always unrelated to serum CK levels, age at onset, manuscript clinical features, disease duration, and mutated gene. Neverthe- Guja Astrea, IRCCS Author Acquisition, analysis, and less, muscle biopsy remains an important part of the diagnostic MD Stella interpretation of data and process in hyperCKemia, as it can also fulfill a “functional” role Maris, Pisa critical revision of the assisting in the clarification of uncertain cases. This is illustrated manuscript by case P28 in our study where 2 changes in SGCA were Continued

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 9 Appendix (continued) Appendix (continued)

Name Location Role Contribution Name Location Role Contribution

Jacopo IRCCS Author Acquisition, analysis, and Gabriele University Author Acquisition, analysis, and Baldacci, BS Stella interpretation of data and Siciliano, MD of Pisa interpretation of data and Maris, Pisa critical revision of the critical revision of the manuscript manuscript

Carla University Author Acquisition, analysis, and Deborah University Author Acquisition, analysis, and Battisti, MD of Siena interpretation of data and Tolomeo, of Pisa interpretation of data and critical revision of the MD critical revision of the manuscript manuscript

Giulia IRCCS Author Acquisition, analysis, and Paola Tonin, University Author Acquisition, analysis, and Bertocci, BSc Stella interpretation of data and MD of Verona interpretation of data and Maris, Pisa critical revision of the critical revision of the manuscript manuscript

M. Alice AOU Author Acquisition, analysis, and Nila Volpi, University Author Acquisition, analysis, and Donati, MD Meyer, interpretation of data and MD of Siena interpretation of data and Florence critical revision of the critical revision of the manuscript manuscript

M. Teresa University Author Acquisition, analysis, and Filippo M. IRCCS Author Interpreted the data; revised Dotti, MD of Siena interpretation of data and Santorelli, Stella the manuscript for intellectual critical revision of the MD Maris, Pisa content; and provided funds for manuscript the study

Antonio University Author Acquisition, analysis, and Denise IRCCS Author Interpreted the data and Federico, MD of Siena interpretation of data and Cassandrini, Stella revised the manuscript for critical revision of the PhD Maris, Pisa intellectual content manuscript

Fabio University Author Acquisition, analysis, and Giannini, MD of Siena interpretation of data and critical revision of the References manuscript 1. Kyriakides T, Angelini C, Schaefer J, et al. European Federation of Neurological Societies. EFNS guidelines on the diagnostic approach to pauci- or asymptomatic Salvatore University Author Acquisition, analysis, and hyperCKemia. Eur J Neurol 2010;17:767–773. Grosso, MD of Siena interpretation of data and 2. Silvestri NJ, Wolfe GI. Asymptomatic/pauci-symptomatic creatine kinase elevations critical revision of the (hyperckemia). Muscle Nerve 2013;47:805–815. manuscript 3. Malandrini A, Orrico A, Gaudiano C, et al. Muscle biopsy and in vitro contracture test in subjects with idiopathic HyperCKemia. Anesthesiology 2008;109:625–628. Renzo University Author Acquisition, analysis, and 4. Nigro V, Savarese M. Next-generation sequencing approaches for the diagnosis of Guerrini, MD of Florence interpretation of data and skeletal muscle disorders. Curr Opin Neurol 2016;29:621–627. critical revision of the 5. Astrea G, Petrucci A, Cassandrini D, et al. Myoimaging in the NGS era: the discovery manuscript of a novel mutation in MYH7 in a family with distal myopathy and core-like features—a case report. BMC Med Genet 2016;17:25. Sara Lenzi, IRCCS Author Acquisition, analysis, and 6. Musumeci O, la Marca G, Spada M, et al. LOPED study: looking for an early diagnosis MD Stella interpretation of data and in a late-onset Pompe disease high-risk population. J Neurol Neurosurg Psychiatry Maris, Pisa critical revision of the 2016;87:5–11. manuscript 7. Savarese M, Di Fruscio G, Mutarelli M, et al. MotorPlex provides accurate variant detection across large muscle genes both in single myopathic patients and in pools of Maria A. Hospital Author Acquisition, analysis, and DNA samples. Acta Neuropathol Commun 2014;2:100. Maioli, MD Binaghi, interpretation of data and 8. Astrea G, Romano A, Angelini C, et al. Broad phenotypic spectrum and genotype- Cagliari critical revision of the phenotype correlations in GMPPB-related dystroglycanopathies: an Italian cross- manuscript sectional study. Orphanet J Rare Dis 2018;13:170. 9. Thompson R, Straub V. Limb-girdle muscular dystrophies—international collabo- Federico AOU Author Acquisition, analysis, and rations for translational research. Nat Rev Neurol 2016;12:294–309. Melani, MD Meyer, interpretation of data and 10. D’Amore A, Tessa A, Casali C, et al. Next generation revolution in molecular diagnosis Florence critical revision of the of hereditary spastic paraplegias: a large Italian cross-sectional study. Front Neurol manuscript 2018;9:981. 11. Hicks D, Sarkozy A, Muelas N, et al. A founder mutation in anoctamin 5 is a major Eugenio Catholic Author Acquisition, analysis, and cause of limb-girdle muscular dystrophy. Brain 2011;134:171–182. Mercuri, MD University, interpretation of data and 12. Piluso G, Politano L, Aurino S, et al. Extensive scanning of the calpain-3 gene Rome critical revision of the broadens the spectrum of LGMD2A phenotypes. J Med Genet 2005;42:686–693. manuscript 13. Richard I, Broux O, Allamand V, et al. Mutations in the proteolytic enzyme calpain 3 cause limb-girdle muscular dystrophy type 2A. Cell 1995;81:27–40. Michele AOU Author Acquisition, analysis, and 14. Kubisch C, Wicklein EM, Jentsch TJ. Molecular diagnosis of McArdle disease: revised Sacchini, MD Meyer, interpretation of data and genomic structure of the myophosphorylase gene and identification of a novel mu- Florence critical revision of the tation. Hum Mutat 1998;12:27–32. manuscript 15. Piccolo F, Roberds SL, Jeanpierre M, et al. Primary adhalinopathy: a common cause of autosomal recessive muscular dystrophy of variable severity. Nat Genet 1995;10:243–245. Simona University Author Acquisition, analysis, and 16. Duggan DJ, Gorospe JR, Fanin M, Hoffman EP, Angelini C. Mutations in the sar- Salvatore, of Siena interpretation of data and coglycan genes in patients with myopathy. N Engl J Med 1997;336:618–624. MD critical revision of the 17. Savarese M, Di Fruscio G, Tasca G, et al. Next generation sequencing on patients with manuscript LGMD and nonspecific myopathies: findings associated with ANO5 mutations. Neuromuscul Disord 2015;25:533–541.

10 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG 18. Tsujino S, Shanske S, DiMauro S. Molecular genetic heterogeneity of myophos- 32. Gillies RL, Bjorksten AR, Davis M, Du Sart D. Identification of genetic mutations in phorylase deficiency (McArdle’s disease). N Engl J Med 1993;329:241–245. Australian malignant hyperthermia families using sequencing of RYR1 hotspots. 19. Anichini A, Fanin M, Vianey-Saban C, et al. Genotype-phenotype correlations in a large Anaesth Intensive Care 2008;36:391–403. series of patients with muscle type CPT II deficiency. Neurol Res 2011;33:24–32. 33. Fanin M, Fulizio L, Nascimbeni AC, et al. Molecular diagnosis in LGMD2A: mutation 20. Vockley J, Rinaldo P, Bennett MJ, Matern D, Vladutiu GD. Synergistic heterozygosity: analysis or protein testing? Hum Mutat 2004;24:52–62. disease resulting from multiple partial defects in one or more metabolic pathways. Mol 34. Selcen D, Engel AG. Mutations in myotilin cause myofibrillar myopathy. Neurology Genet Metab 2000;71:10–18. 2004;62:1363–1371. 21. Böhm J, Vasli N, Malfatti E, et al. An integrated diagnosis strategy for congenital 35. Venance SL. Approach to the patient with HyperCKemia. Continuum (Minneap myopathies. PLoS One 2013;8:e67527. MN) 2016;22:1803–1814. 22. Manning BM, Quane KA, Lynch PJ, et al. Novel mutations at a CpG dinucleotide in 36. Filosto M, Tonin P, Vattemi G, et al. The role of muscle biopsy in investigating the ryanodine receptor in malignant hyperthermia. Hum Mutat 1998;11:45–50. isolated muscle pain. Neurology 2007;68:181–186. 23. Carss KJ, Stevens E, Foley AR, et al. Mutations in GDP-mannose pyrophosphorylase 37. Simmons Z, Peterlin BL, Boyer PJ, Towfighi J. Muscle biopsy in the evaluation of B cause congenital and limb-girdle muscular dystrophies associated with hypo- patients with modestly elevated creatine kinase levels. Muscle Nerve 2003;27: glycosylation of α-dystroglycan. Am J Hum Genet 2013;93:29–41. 242–244. 24. Sambuughin N, Sei Y, Gallagher KL, et al. North American malignant hyperthermia 38. Prelle A, Tancredi L, Sciacco M, et al. Retrospective study of a large population of population: screening of the ryanodine receptor gene and identification of novel patients with asymptomatic or minimally symptomatic raised serum creatine kinase mutations. Anesthesiology 2001;95:594–599. levels. J Neurol 2002;249:305–311. 25. Vukcevic M, Broman M, Islander G, et al. Functional properties of RYR1 mutations 39. Savarese M, Di Fruscio G, Torella A, et al. The genetic basis of undiagnosed muscular identified in Swedish patients with malignant hyperthermia and central core disease. dystrophies and myopathies: results from 504 patients. Neurology 2016;87:71–76. Anesth Analg 2010;111:185–190. 40. Wu L, Brady L, Shoffner J, Tarnopolsky MA. Next-generation sequencing to diagnose 26. Sambuughin N, Nelson TE, Jankovic J, et al. Identification and functional characterization of muscular dystrophy, rhabdomyolysis, and hyperCKemia. Can J Neurol Sci 2018;45: a novel ryanodine receptor mutation causing malignant hyperthermia in North American 262–268. and South American families. Neuromuscul Disord 2001;11:530–537. 41. Papadopoulos C, LaforEtˆ P, Nectoux J, et al. Hyperckemia and myalgia are common 27. Cagliani R, Fortunato F, Giorda R, et al. Molecular analysis of LGMD-2B and MM presentations of anoctamin-5-related myopathy in French patients. Muscle Nerve patients: identification of novel DYSF mutations and possible founder effect in the 2017; 56:1096–1100. Italian population. Neuromuscul Disord 2003;13:788–795. 42. Tarnopolsky M, Hoffman E, Giri M, Shoffner J, Brady L. Alpha-sarcoglycanopathy 28. Sambuughin N, Holley H, Muldoon S, et al. Screening of the entire ryanodine receptor type presenting as exercise intolerance and rhabdomyolysis in two adults. Neuromuscul 1 coding region for sequence variants associated with malignant hyperthermia susceptibility Disord 2015;25:952–954. in the north american population. Anesthesiology 2005;102:515–521. 43. Zatz M, Starling A. Calpains and disease. N Engl J Med 2005;352:2413–2423. 29. Taroni F, Verderio E, Dworzak F, Willems PJ, Cavadini P, DiDonato S. Identification 44. Vissing J, Barresi R, Witting N, et al. A heterozygous 21-bp deletion in CAPN3 causes of a common mutation in the carnitine palmitoyltransferase II gene in familial re- dominantly inherited limb girdle muscular dystrophy. Brain 2016;139:2154–2163. current myoglobinuria patients. Nat Genet 1993;4:314–320. 45. Fanin M, Anichini A, Cassandrini D, et al. Allelic and phenotypic heterogeneity in 49 30. Tammaro A, Di Martino A, Bracco A, et al. Novel missense mutations and unexpected Italian patients with the muscle form of CPT-II deficiency. Clin Genet 2012;82: multiple changes of RYR1 gene in 75 malignant hyperthermia families. Clin Genet 232–239. 2011;79:438–447. 46. Fontaine M, Kim I, Dessein AF, et al. Fluxomic assay-assisted diagnosis orientation in 31. Duarte ST, Oliveira J, Santos R, et al. Dominant and recessive RYR1 mutations in a cohort of 11 patients with myopathic form of CPT2 deficiency. Mol Genet Metab adults with core lesions and mild muscle symptoms. Muscle Nerve 2011;44:102–108. 2018;123:441–448.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 11 ARTICLE OPEN ACCESS Impaired kidney structure and function in spinal muscular atrophy

Fl´avia C. Nery, PhD,* Jennifer J. Siranosian, BS,* Ivy Rosales, BS, Marc-Olivier Deguise, BS, Amita Sharma, BS, Correspondence Abdurrahman W. Muhtaseb, BS, Pann Nwe, BS, Alec J. Johnstone, BS, Ren Zhang, BS, Maryam Fatouraei, BS, Dr. Swoboda [email protected] Natassja Huemer, BS, Christiano R.R. Alves, PhD, Rashmi Kothary, PhD, and Kathryn J. Swoboda, MD

Neurol Genet 2019;5:e353. doi:10.1212/NXG.0000000000000353 Abstract Objective To determine changes in serum proﬁles and kidney tissues from patients with spinal muscular atrophy (SMA) type 1 compared with age- and sex-matched controls.

Methods In this cohort study, we investigated renal structure and function in infants and children with SMA type 1 in comparison with age- and sex-matched controls.

Results Patients with SMA had alterations in serum creatinine, cystatin C, sodium, glucose, and calcium concentrations, granular casts and crystals in urine, and nephrocalcinosis and ﬁbrosis. Neph- rotoxicity and polycystic kidney disease PCR arrays revealed multiple diﬀerentially expressed genes, and immunoblot analysis showed decreased calcium-sensing receptors and calbindin and increased insulin-like growth factor–binding proteins in kidneys from patients with SMA.

Conclusions These ﬁndings demonstrate that patients with SMA type 1, in the absence of disease-modifying therapies, frequently manifest impaired renal function as a primary or secondary consequence of their disease. This study provides new insights into systemic contributions to SMA disease pathogenesis and the need to identify coadjuvant therapies.

*Both authors contributed equally to this work. From the Department of Neurology (F.C.N., J.J.S., A.W.M., P.N., A.J.J., R.Z., M.F., N.H., C.R.R.A., K.J.S.), Center for Genomic Medicine, Massachusetts General Hospital, Boston, MA; Department of Pathology (I.R.), Massachusetts General Hospital, Boston, MA; Regenerative Medicine Program (M.-O.D., R.K.), Ottawa Hospital Research, Institute Ottawa, Ontario, Canada; Department of Cellular and Molecular Medicine (M.-O.D., R.K.), University of Ottawa, Canada; Centre for Neuromuscular Disease (M.-O.D., R.K.), University of Ottawa, Ottawa, Ontario, Canada; Division of Pediatric Nephrology (A.S.), Massachusetts General Hospital, Boston, MA; Department of Biology (N.H.), Federal University of São Carlos, Sorocaba, Sao Paulo, SP, Brazil; and Department of Medicine (R.K.), University of Ottawa, Ottawa, Ontario, Canada.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary ASO = antisense oligonucleotide; CaSR = calcium-sensing receptor; CALB1 = calbindin 1; IGF = insulin-like growth factor; IGFBP = insulin-like growth factor–binding proteins; SMA = spinal muscular atrophy; SMN = survival motor neuron.

– Spinal muscular atrophy (SMA), a devastating neuromuscular pathogenesis.14 17 Systemic administration of an ASO (ASO- disease characterized by motor neuron degeneration and pro- 10-27) that restores SMN expression systemically extended gressive muscle atrophy, is a leading genetic cause of infantile the lifespan of a severe SMA mouse model by 25-fold, whereas death worldwide. SMA is caused by mutations in the Survival direct intracerebroventricular administration induced a much Motor Neuron 1 (SMN1) gene that result in reduced func- more modest increase in survival.17 However, the only clini- tional SMN protein expression. However, a paralog gene, cally available ASO therapy for patients with SMA is delivered SMN2, undergoes alternative splicing, including the removal of intrathecally and largely limited to the CNS. The drug reaches exon 7, and producing only ;10% functional SMN protein.1,2 the systemic circulation via CSF flow dynamics, redistributing The severe infantile variant (SMA type 1) is the most frequent to the kidney and other organs to a variable degree before it is SMA subtype, accounting for more than 50% of incident cases. excreted in urine.4,5 Studies exploring the contribution of Patients with SMA type 1 develop early infantile-onset pro- peripheral systemic pathology to SMA disease phenotype are gressive skeletal, bulbar, and respiratory muscle weakness. By limited, and renal studies in SMA have not been performed. the time such patients present with symptoms, severe de- nervation has already occurred, and the majority of patients Thus, we investigated serum profiles and kidney tissues from with SMA type 1 die in infancy or childhood.1,3 patients with SMA type 1 who died before the availability of proven disease-altering therapies and compared them with Recent cutting-edge molecular and gene therapies have shown age- and sex-matched controls. Participants with SMA type 1 striking clinical benefit when such treatments were started in showed low serum creatinine, cystatin C (CysC), and sodium the presymptomatic or early symptomatic period in infants concentrations, high circulating glucose and calcium levels, with SMA type 1. The US Food and Drug Administration and granular casts and amorphous crystals in the urine, fea- approved the use of nusinersen (Spinraza; Biogen, Cambridge, tures that indicate renal tubular dysfunction before death. MA), a synthetic antisense oligonucleotide (ASO) that mod- Participants with SMA displayed (1) medullary nephrocalci- ulates premessenger RNA splicing of the SMN2 gene.4,5 nosis and fibrosis, (2) multiple differentially expressed genes Clinical trials with nusinersen have demonstrated improve- and molecular pathways associated with nephrotoxicity and ments in morbidity and ventilator-free survival in patients with polycystic kidney disease, (3) downregulated calcium-sensing early infantile-onset SMA.6,7 However, increased risk of renal receptor (CaSR) and calbindin 1 (CALB1) proteins, and (4) toxicity is listed on the FDA-approved product insert,8 and upregulated insulin-like growth factor–binding proteins 1 similar therapies have been associated with acute tubular (IGFBP1) and 3 (IGFBP3) compared with age- and sex- injury.9,10 Longitudinal studies for patients treated with nusi- matched controls. Therefore, we conclude that patients with nersen are still ongoing and will provide additional insights to SMA type 1 have an increased risk of impaired kidney func- confirm its long-term efficacy and safety.4 In the meantime, tion, more specifically renal tubular dysfunction. This factor other potential therapies for SMA type 1 are under clinical needs to be considered from the initial point of diagnosis. investigation and show promising preliminary results, including the SMN1 gene replacement AVXS-101 (Zolgensma; AveXis, Novartis, Chicago, IL)11,12 and the modulator of SMN2 splic- Methods ing RO7034067 (Risdiplam; Roche, Basel, Switzerland; trial 13 Standard protocol approvals, registrations, #NCT02913482). These emerging therapies, in conjunction and patient consents with standardized respiratory, orthopedic, and nutritional Mouse experiments were approved by the Animal Care and support, will continue to improve morbidity and survival in Veterinary Services of the University of Ottawa, ON, Canada even the weakest patients with SMA type 1. Thus, un- (protocols #OHRI-1927 and #OHRI-1948). This study com- fi derstanding the full spectrum of the impact of SMN de ciency plies with the guidelines of the International Committee of both within and outside of the CNS is critical to the health and Medical Journal Editors. The procedures comply with the in- well-being of patients with SMA. stitutional and national guide for the care and use of laboratory animals. Human studies were approved by the Institutional fi Motor neurons are selectively vulnerable to SMN de ciency Ethics Review Board at the University of Utah (protocol #8751). and subsequently account for the earliest manifestation in SMA clinical disease. However, patients with SMA have de- Mice creased levels of SMN protein throughout the whole body, This study was approved by the Animal Care and Veterinary and increasing evidence indicates that SMN deficiency in Services of the University of Ottawa, ON, Canada (protocols − tissues other than motor neurons may contribute to disease #OHRI-1927 and #OHRI-1948). Smn2B/ mice were obtained

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG as previously described18 and housed at the Animal Facility of TTTcAGACAAAATCAAAAGA-PHO. The SMN1 and SMN2 University of Ottawa in accordance with the Canadian Council probes are located at the C/T base difference in SMN exon 7. on Animal Care. Samples were collected from symptomatic Each reaction was multiplexed with a primer/probe set to − Smn2B/ mice at postnatal day 19. Mouse blood was collected detect exon 14 of CFTR as a 2-copy gene control using FP-CFTR following decapitation using either Microvette CB300 K2 59 AGAGAGAAGGCTGTCCTTAGT, RP-CFTR EDTA (Sarstedt, cat# 16.444.100) coated with EDTA for 59 GAGTGTGTCATCAGGTTCAGG, and HEX- plasma extraction or Microvette CB300 Z (Sarstedt, cat# TTCTGAGCAGGGAGAGGCGATACT probe. Copy num- 16.440.100). Blood was spun for 5 minutes at 10,000g to obtain bers were determined by dividing the number of SMN1 or SMN2 serum and 2,000g to obtain plasma at room temperature. copies by the number of CFTR copies for each sample. Plasma was analyzed for creatinine, blood urea nitrogen (BUN), albumin, calcium, and phosphorus at a veterinary Biochemical analysis reference laboratory using commercially available biochemical CysC concentrations were determined using Luminex xMAP® assays (Beckman-Coulter, Inc, Brea, CA) on an automated technology (Myriad RBM, Austin, TX) on existing frozen se- clinical chemistry analyzer platform (Beckman-Coulter rum samples. Circulating creatinine, BUN, calcium, phospho- AU680; Beckman-Coulter, Inc). Sodium, chloride, and potas- rous, sodium, chloride, potassium, glucose, and C-reactive sium were determined using ion-selective electrodes protein, granular casts and amorphous crystals in the urine, and (Beckman-Coulter) on the same platform. Kidney tissues were generalized aminoaciduria analyses were available from pre- collected for Western blot analysis. mortem clinical laboratory data in the Project Cure SMA Longitudinal Population Data Repository (Massachusetts Human experiments General Hospital IRB protocol #2016P000469). This cohort study includes a total of 13 pediatric participants with SMA type 1 who died during the course of their disease Histology and 13 age- and sex-matched pediatric controls from the NIH Paraffin-embedded kidney tissues were cut at a thickness of 5- NeuroBioBank. Written informed parental consent was μm and stained with hematoxylin and eosin, periodic acid– obtained for all participants with SMA under the Institutional Schiff, Masson trichrome, Alizarin red, von Kossa, and Prussian Ethics Review Board at the University of Utah (protocol blue according to standard histologic protocols. Sections were #8751) and Massachusetts General Hospital (protocol examined by an experienced renal pathologist (I.R.) blinded for #2016P000469). No participants with SMA received either sample IDs. For immunohistochemistry, paraffin-embedded disease-modifying therapies nusinersen or AVXS-101 gene tissues were cut at a thickness of 5 μm on glass slides and therapy. Tissues from controls were obtained from the NIH incubated at 60°C for 30 minutes, followed by deparaffinization NeuroBioBank’s Brain and Tissue repository at the University in xylene and rehydration in graded alcohol into water. Antigen of Maryland, Baltimore. Comprehensive clinical data were retrieval was performed by boiling the slides in 10 mM sodium available for all participants with SMA, and premortem clinical citrate buffer (pH = 6.0) for 30 minutes. Endogenous peroxi- laboratory data from medical records were available for 12 dase activity was quenched with Dual Endogenous Enzyme participants with SMA. Kidney samples were obtained during Block (DAKO, Agilent, CA) for 5 minutes. Tissue sections were a rapid autopsy protocol in 12 participants with SMA and 13 incubated with 1:500 dilution of CaSR mouse monoclonal an- controls. Sufficient tissue was available in 4 age- and sex- tibody (Novus 5C10, ADD) or 1:5,000 dilution of CALB1 matched SMA and controls for RNA (SMA #177, 272, 251, rabbit polyclonal antibody (Sigma-Aldrich HPA023099) or 1: and 195; controls: #5883, 5282, 5564, and 5180) and protein 100 dilution of AQP3 (Atlas Antibodies HPA014924) in 1% (SMA #272, #251, #195, and #101, and controls: #5387, TBS/BSA at 4°C inside a humidified chamber overnight. After #5564, #5282, and #5883) extraction and analysis. washing, slides were incubated with Envision Dual Link System Polymer HRP (DAKO) for 30 minutes at room temperature. SMN1 and SMN2 copy numbers After washing, the DAB+ reagent (DAKO) was added with SMN1 and SMN2 copy numbers were determined by droplet monitoring for 5–10 minutes. After washing, counterstain was digital PCR using the Bio-Rad QX-200 system (Bio-Rad, Her- performed using Harris-type hematoxylin. Slides were briefly cules, CA). Each sample was amplified separately to measure dehydrated and then mounted with Histomount solution (Life SMN1 or SMN2 copies relative to the number of CFTR copies. A Technology, Grand Island, NY). Immunohistochemical analy- competitive oligo with a 39 phosphate was used to increase probe ses were performed according to standard protocols on 4-m specificity.19 SMN1 was detected with SMN-Ex7-FP 59 sections using the Vector ABC Reagent kit and developed with AATGCTTTTTAACATCCATATAAAGCT, SMN-Ex7-RP DAB substrate (Vector Laboratories, Burlingame, CA). Kidney 59CCTTAATTTA AGGAATGTGAGCACC, SMN1-LNA slides were also double stained for CD3 (1:400 Dako A0452)/ probe FAM-A+G+GGTT+T+c+AGAC and competitive CD68 (1:800 Dako M0814) markers in the autostainer. SMN1 oligo ATTTTCCTTACAGGGTTTtAGACAAAATCAAAAGA- PCR array PHO. SMN2 was detected with the same primers as SMN1 Total RNA was extracted from frozen kidney samples using and using SMN2-LNA probe FAM-A+G+GGTT+T+T+AGAC TRIzol reagent (Thermo Fisher Scientific, Waltham, MA). All and competitive SMN2 oligo ATTTTCCTTACAGGG the samples had a 280/260 ratio ≥1.9. Complementary DNA

Table 1 Serum biochemical profiles in spinal muscular atrophy type 1 participants

Patient Age at C-reactive Granular casts and/or Generalized ID no. death Creatinine Cystatin C BUN Calcium Phosphorus Sodium Chloride Potassium Glucose protein amorphous crystals aminoaciduria

0.23–0.61 0.51–1.10 5–17 8.7–9.8 3.7–7.4 137–146 98–109 3.4–4.7 60–108 <0.8 Normal ranges: mg/dL mg/L mg/dL mg/dL mg/dL mmol/L mmol/L mmol/L mg/dL mg/dL Urine results

101 10.2 <0.05–0.4 0.35 3.0–17 7.5–10.2 4.3–5.5 133–142 102–115 3.9 82–142 <0.7–3.2 Present Present

187 5.1 0.05–0.28 0.54–0.65 2.0–13 6.7–10.8 2.0–6.4 123–158 79–124 1.7–7.0 65–332 6.2 Absent Present

7† 4 0.2 N.t. 2.0–10 8.1–10.3 1.7–6.0 134–143 97–114 3.3–7.0 66–358 <0.8 Present N.t.

196 3.8 0.08–0.24 0.57–0.66 4.0–23 8.1–10.6 2.5–5.7 133–159 91–114 1.7–6.9 71–168 <0.5–8.1 Present Present

195 2.96 0.10–0.30 0.38–0.43 3.0–13 8.9–10.5 5.8–6.1 128–140 97–112 3.7–7.2 71–135 0.5–1.2 Present Normal

217 2.75 0.12–0.32 0.61 5.0–25 8.3–11.6 2.4–5.6 133–163 95–125 3.2–6.0 70–143 0.3–1.3 Present N.t.

206 2.34 0.15–0.34 0.47–0.75 7.0–17 8.9–11.6 N.t. 131–139 102–108 3.5–5.6 73–105 <0.5 N.t. N.t.

403 2.3 0.06 N.t. 5.0 8.3 N.t. N.t. N.t. N.t. 449 N.t. N.t. N.t.

353 1.65 N.t. N.t. 5.0–8.0 8.9–10.6 N.t. N.t. N.t. 3.2–5.4 116 N.t. N.t. N.t.

177 1.38 0.11–0.7 0.54–0.69 3.0–15 8.4–10.4 3.9–7.7 132–146 97–114 3.0–5.4 70–209 0.2–0.5 Present Present

251 1.2 0.14–0.66 0.35–0.83 5.0–19 8.4–10.1 N.t. 135–139 95–108 3.8–4.3 70–97 N.t. Present N.t.

351 0.56 0.21–0.34 0.96 2.0–16 8.9–10.6 3.9–5.1 137–143 103–112 2.6–5.5 73–218 N.t. Present N.t.

Lowest value 11/11 (100%) 4/9 (44%) 8/12 (67%) 7/12 (58%) 5/8 (63%) 9/10 (90%) 7/10 (70%) 7/11 (64%) 0/12 (0%) 0/8 (0%) 8/9 (89%) 4/5 (80%)

Highest value 2/11 (18%) 0/9 (0%) 3/12 (25%) 11/12 (92%) 1/8 (13%) 3/10 (30%) 8/10 (80%) 9/11 (82%) 10/12 (83%) 5/8 (63%)

Abbreviations: BUN = blood urea nitrogen; N.t. = not tested. was generated from 500 ng of purified RNA using the RT2 First Catalog PA5-59252, Dilution 1:1,000, rabbit polyclonal), CaSR Strand Kit (Qiagen, Venlo, the Netherlands) protocol or 300 ng (Novus, Denver, CO, Catalog NB120-19347SS, Dilution 1: for SuperScript IV VILO (11766050; ThermoFisher Scientific). 500, monoclonal), CALB1 (Sigma, Saint Louis, MO, Catalog The Nephrotoxicity and Polycystic Kidney Disease RT2 Profiler HPA023099, Dilution 1:750, rabbit polyclonal), and α-tubulin PCR Arrays (PAHS-094Z and PAHS-168Z; Qiagen) were (Cell Signaling Technology, Catalog 3873S, Clone DM1A, performed, and each messenger RNA (mRNA) gene expres- Dilution 1:2,000, monoclonal). Secondary antibodies were sion was calculated relative to the average of 5 housekeeping IRDye 680RD Donkey anti-Mouse IgG (Li-COR, Catalog 925- genes in the arrays accordingly to the manufacture instructions. 68,072, Dilution 1:5,000), IRDye 680RD Donkey anti-Goat IgG (Li-COR, Lincoln, NE, Catalog 925-68,074, Dilution 1: Western blot 5,000), IRDye 800CW Donkey anti-Mouse IgG (Li-COR, Protein was extracted from frozen kidney samples using RIPA Catalog 925-32,212, Dilution 1:10,000), IRDye 800CW Don- lysis buffer (Cell Signaling Technology, Danvers, MA). Sam- key anti-Rabbit IgG (Li-COR, Catalog 925-32,213, Dilution 1: ples were sonicated and centrifuged at 10,000 rpm for 10 10,000), and IRDye 800CW Donkey anti-Goat IgG (Li-COR, minutes at 4°C. Protein concentrations were determined using Catalog 925-32,214, Dilution 1:2,000). Membranes were im- the Bradford assay (Bio-Rad). Protein samples (30 μg) were aged using the Odyssey CLx (Li-COR). Blots were quantified run on a NuPAGE 12% Bis-Tris Protein Gel (NP0342Box, using ImageJ and normalized by α-tubulin. Invitrogen by Thermo Fisher Scientific) electrophoresis and transferred to a nitrocellulose membrane. Membranes were Statistical analysis incubated with Odyssey blocking buffer (Li-Cor 927–40,000) Data are presented as mean ± standard error of the mean with diluted 1:1 in Tris-buffered saline buffer. REVERT Total Pro- dots as individual values. Sample size is indicated in the figure tein Stain (Li-Cor 926–11,010) was used for loading control. legends. Statistical analyses were performed using GraphPad Primary antibodies were incubated overnight at 4°C to probe Prism 7 software (GraphPad Software, Inc). Unpaired 2-tailed for SMN (BD Transduction, San Jose, CA, Catalog 610647, Student t tests were used to compare groups. Statistical sig- Dilution 1:2,000, monoclonal), IGFBP1 (Santa Cruz, Dallas, nificance was defined as p < 0.05. TX, Catalog c-55474, Dilution 1:1,000, monoclonal), IGFBP3 (Abcam, Cambridge, UK, Catalog ab77635, Dilution 1:1,000, Data availability goat polyclonal), IGF-1 (Abcam, Catalog ab9572, Dilution 1: All data relevant to this study are contained within the 500, rabbit polyclonal), IGFALS (Thermo Fisher Scientific, article.

Figure 1 Kidney histopathology in patients with SMA type 1

Sections from the kidneys of SMA cases show medullary calcifications (yellow arrows, H&E and PAS) along collecting ducts. Medullary interstitial fibrosis is also present (trichrome). Representative images were taken at 100× (indicated as 10× objective) and 400× magnifications. H&E = hematoxylin and eosin; PAS= periodic acid–Schiff; SMA = spinal muscular atrophy.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 5 Results were obtained in the clinical care setting, including circulating creatinine, BUN, calcium, phosphorus, sodium, chloride, po- To determine whether renal function is affected in a model of tassium, glucose, and C-reactive protein. In addition, we eval- SMA, we first evaluated serum creatinine, BUN, albumin, uated circulating CysC, a cysteine protease inhibitor produced calcium, phosphorus, sodium, chloride, and potassium in by all nucleated cells and freely filtered by the glomerulus. By 2B/− 2B/− Smn mice. Smn mice have reduced SMN protein comparing the blood test results with reference values, most of content through the whole body, including in the kidney the patients in our study consistently had values out of the (figure S1, links.lww.com/NXG/A174), exhibiting a classic − expected range in all these analytes (table 1 and table S4). SMA phenotype and a short lifespan (<30 days).18,20 Smn2B/ mice had reduced circulating creatinine, BUN, albumin, cal- We investigated kidneys from 12 participants with SMA who cium, and chloride at symptomatic age postnatal day 19 (table underwent comprehensive rapid research autopsy with S1). These initial observations suggest that renal abnormali- a postmortem interval time ranging from 1 to 20 hours in all ties are present in an intermediate mouse model of the but 1 subject (table S2, links.lww.com/NXG/A174). The disease. absolute mass of kidneys from SMA type 1 and controls was similar (figure S2). We found several histopathologic changes We further investigated available renal tissues and laboratory in kidney tissues from participants with SMA type 1 without data from a cohort of 13 participants with SMA type 1 who corresponding abnormalities in controls (figures 1 and 2, were followed longitudinally and died in infancy or childhood figure S3, table 2, and table S5). Participants with SMA type 1 due to complications of SMA and compared them with age- showed varying degrees of tubular injury characterized by loss and sex-matched controls (tables S2 and S3, links.lww.com/ of brush borders, flattened epithelium with detachment, and NXG/A174). All participants with SMA were confirmed to occasional protein casts. Interstitial fibrosis and tubular atro- have homozygous deletion of SMN1 and 2 SMN2 copies phy were absent to minimal. Occasional intratubular calcifi- (table S2), whereas all controls had at least 1 SMN1 copy cation was present in 2 of 12 participants with SMA (figure 1A (table S3). During longitudinal follow-up, laboratory studies and table 2, IDs #206 and 217). The glomeruli showed rare,

Figure 2 Medullary calcifications in patients with SMA type 1

The medullary calcifications (black arrows) are positive for von Kossa and Alizarin red stains. Immunohistochemical studies show CD3+ (brown) and CD68+ (blue) cells along calcifications black (arrows). Representative images were taken at 100× (indicated as 10× objective) and 400× magnifications. SMA = spinal muscular atrophy.

Table 2 Pathologic findings in spinal muscular atrophy type 1 kidneys

Cortex Medulla

Interstitium Interstitium

ID Alizarin von CD3/ no. Pathologic findings in kidneys at autopsy Glomerular changes Tubular changes Calcification Inflammation Fibrosis Calcification Fibrosis red Kossa CD68

101 Tubules showed normal size, pyknotic nuclei, acute Rare mesangial Mild to moderate <5% None <5% <5% Focal Pos Pos Pos tubular necrosis, and calcifications in the cortex and hypercellularity; rare <5% medulla adhesions

187 Patchy foci of necrosis bilaterally; mild ectasia of the None Mild None None None None None N.t. N.t. N.t. renal collecting system

196 Small focal nephrocalcinosis in the right kidney Focal mesangial Mild to moderate; None None None <5% Focal Pos Pos Neg hypercellularity/rare occasional protein <5% adhesions casts

195 No reported abnormalities None Mild None None None None None Neg Neg N.t.

217 Scattered calcifications in the kidney Rare mesangial Mild Focal, Mild <5% 50% 50% Pos Pos Pos hypercellularity; rare intratubular adhesions and <5% global sclerosis

206 Multifocal calcifications in the renal medulla with Rare mesangial Mild Focal, <1% <10% 60% 60% Pos Pos Pos surrounding inflammation and fibrosis. Focal hyaline hypercellularity; rare intratubular casts, dilated tubules in the medulla are associated adhesions and <1% global with areas of dystrophic calcification and sclerosis accumulation of macrophages and multinucleated cells. Pale renal medullary pyramids bilaterally

403 Acute tubular congestion of kidneys Diffuse mesangial None None None 20% None None N.t. Neg N.t. hypercellularity; rare adhesions and <1% global sclerosis

353 Acute passive congestion; microcalcifications Focal mesangial None None <5% None 20% 20% Pos Pos Pos hypercellularity; rare adhesions and <5% global sclerosis

177 Scattered nephrocalcinosis None None None None None None None N.t. Neg N.t.

251 No reported abnormalities None None None None None None None N.t. N.t. N.t.

351 No reported abnormalities None None None <5% None <5% Focal N.t. Pos N.t. <5%

272 No reported abnormalities None Mild None None None <1% None N.t. Neg N.t.

Abbreviations: Pos = positive; Neg = negative; N.t. = not tested. 7 focal mesangial hypercellularity and adhesions in 6 partic- terminal events, the tubulointerstitial lesions, including ipants with SMA (figures 1 and 2 and figure S3, IDs #101, 196, nephrocalcinosis and interstitial fibrosis, are indicative of 217, 206, 403, and 353). Approximately 50% of SMA kidneys chronic renal dysfunction. Future studies will be important to showed tubular injury, medullary calcinosis, and fibrosis determine whether impaired kidney function is a primary (table 2). Medullary calcification surrounding collecting ducts consequence of reduced SMN protein, a secondary conse- associated with interstitial fibrosis was prominent in 2 par- quence of muscle atrophy and bone disease, or more likely ticipants (figure 1, A and B, IDs #206 and 217). Alizarin red a combination of both. and von Kossa stains confirmed medullary calcium phosphate deposits. Positive staining for T-cell and macrophage markers Furthermore, we were interested in determining the mo- (CD3 and CD68) around calcification foci indicates an in- lecular mechanisms associated with renal dysfunction. flammatory response (figure 1B). Overall, pathologic abnor- Nephrotoxicity and polycystic kidney disease PCR arrays malities in the kidney were present in two-thirds of revealed multiple differentially expressed genes in kidneys participants with SMA type 1 in our cohort. Although findings from participants with SMA type 1 compared with controls suggesting acute tubular injury could be confounded by (figure 2, A and B). Each PCR array targeted 84 genes

Figure 3 Changes in genes involved in calcium reabsorption in the kidney from SMA participants

Volcano plots derived from (A) Nephrotoxicity RT2 Profiler PCR Array and (B) Polycystic Kidney Disease RT2 Profiler PCR Array in kidney samples from SMA and controls. Upregulated and downregulated genes are indicated in red and blue, respectively (n = 3–4). Unpaired 2-tailed Student t tests were used to compare groups. SMA = spinal muscular atrophy.

8 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG previously characterized as biomarkers associated with ei- Discussion ther kidney toxicity or cystic renal disease. We found 25 differentially expressed genes in the nephrotoxicity array Most of the patients in our study consistently had values (figure S4A, links.lww.com/NXG/A174, and table S6) and out of the expected range in several blood analytes. We 8 in the polycystic kidney disease array (figure S4B and believe that many of these abnormalities are an expected table S7, figures 3 and 4). These genes are involved in consequence of severe generalized muscle atrophy and bone disease. For example, low creatinine concentrations calcium signaling, apoptosis, cell proliferation, metal ion in these participants were expected because creatinine is binding, glucose metabolism, oxidative stress, and kidney a product of creatine metabolism, and creatine is mainly transporters signaling. Moreover, immunohistochemistry 22 fi fi present in muscle. Importantly, analysis of urine sedi- ( gure 2, C and D) and immunoblot ( gure 2, E and F) ment revealed granular castsand/oramorphouscrystals analysis demonstrated that participants with SMA type 1 and generalized aminoaciduria in the majority of partic- had decreased CaSR and CALB1 protein expression. ipants with SMA type 1 (table 1). These elements being foundinurineareassociatedwithacuteandchronickidney It has been previously demonstrated that insulin-like growth injury with potential calcium oxalate deposition within the ff factor 1 (IGF-1) is dysregulated in severely a ected SMA renal tubules. This process may lead to obstruction of the 17 mice. Given that IGF-1 signaling plays a role in the mainte- urine flow in the tubules while the intratubular crystals 21 nance of normal renal function, we further evaluated IGF-1 develop an inflammatory reaction with the renal inter- signaling in renal tissues from SMA type 1 and controls. Par- stitium and promote acute kidney dysfunction.23,24 ticipants with SMA type 1 had normal IGF-1 protein content, Overall, the clinical laboratory data in these participants but increased levels of IGFBP1 and IGFBP3 (figure 2, E and F). strongly suggest that the majority had impaired kidney

Figure 4 Increased IGFBPs in kidney from SMA participants

(A) Representative immunohistochemistry (magnification 100×) and (B) quantification of staining intensity for CaSR and CALB1 in kidney samples from SMA and controls (n = 9–10). (C) Representative immunoblot and (D) quantification of protein content in kidney samples from SMA (n = 4) and controls (n = 4). Data are presented as mean SEM with dots as individual values. Unpaired 2-tailed Student t tests were used to compare groups. *p < 0.05; **p < 0.01; ****p < 0.0001. CALB1 = calbindin 1; CaSR = calcium-sensing receptor; IGF = insulin-like growth factor; IGFBP = insulin-like growth factor binding proteins; SMA = spinal muscular atrophy.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 9 function before death, with features indicative of renal SMA/Families of SMA Canada; Muscular Dystrophy tubular dysfunction. Association (USA) (#575466); and Canadian Institutes of Health Research (CIHR) (#PJT-156379). M.-O.D. was Participants with SMA type 1 had decreased CaSR and supported by a Frederick Banting and Charles Best CIHR CALB1 protein expression. CaSR and CALB1 play critical Doctoral Research Award. N.H. was supported by CAPES, anticalcification roles. CaSR acts as a sensitive detector of Brazil. The authors thank Vicky L. McGovern and Arthur extracellular calcium and regulates parathyroid hormone ac- H.M. Burghes for technical support and scientific discussion tivity, protecting against calcium phosphate precipitation.25,26 and Patricia Della Pelle for technical support in histology. CALB1 regulates calcium reabsorption, and models of kidney Control tissues were obtained from the NIH NeuroBioBank’s dysfunction show downregulated CALB1.27 Altogether, these Brain and Tissue repository at the University of Maryland, changes in the expression of key molecules and proteins are Baltimore. They are very grateful to all the SMA families who consistent with renal function abnormalities as indicated by participated in this study. premortem clinical laboratory testing. Study funding Participants with SMA type 1 had increased levels of IGFBP1 No targeted funding reported. and IGFBP3. IGF signaling is complex, and IGFBPs have an important role in this signaling by enhancing or inhibiting Disclosure IGF-1. IGFBP1 also affects cell growth and apoptosis.21,28 Disclosures available: Neurology.org/NG. Transgenic mice with increased Igfbp1 expression demonstrate reduced number of nephrons and glomerulosclerosis,29 Publication history whereas those with Igfbp3 overexpression show hypoplastic Received by Neurology: Genetics April 10, 2019. Accepted in final form kidneys.30 Kidneys in early-stage diabetic rats show increased June 25, 2019. IGFBP1 expression,31 and increased IGFBP3 protease activity correlates with the degree of albuminuria in patients with diabetic nephropathy.32 Thus, increased local expression of IGFBPs supports the concept of impaired kidney function in Appendix Authors participants with SMA. Name Location Role Contribution

The precise mechanism by which kidney function is impaired Flavia´ C. Nery Massachusetts Author Directed the research General project and designed in patients with SMA type I is not fully understood. We be- Hospital, experiments; performed lieve that changes in kidney structure, gene, and protein ex- Boston, MA experiments; collected pression are in large part a consequence of severe generalized clinical data; analyzed the data; wrote the muscle atrophy, immobility, and dysregulation of bone me- manuscript; participated tabolism resulting in secondary medullary calciﬁcation and in the data interpretation, and reviewed and renal tubular dysfunction. However, given the numerous approved the final functions of the SMN protein, SMN deﬁciency could also manuscript. contribute to changes in gene expression through direct Jennifer J. Massachusetts Author Performed experiments; mechanisms. SMN protein plays an integral role in the spli- Siranosian General collected clinical data; Hospital, analyzed the data; wrote ceosomal assembly and processing of pre-mRNA species in all Boston, MA the manuscript; cells.33 For example, SMN depletion has been demonstrated participated in the data interpretation; and to cause intron retention, triggering a global DNA damage reviewed and approved 34 and stress response. In future studies, additional the final manuscript.

approaches, including in vitro studies, are necessary for de- Ivy Rosales Massachusetts Author Performed experiments; termining whether SMN has a primary contribution to the General analyzed the data; ﬁ Hospital, participated in the data gene expression pro le in developing nephrons. Boston, MA interpretation; and reviewed and approved The present study has important clinical implications. the final manuscript. Patients with SMA type 1 are living longer due to recent Marc-Olivier University of Author Performed mouse advances in SMA therapeutics, and impaired kidney function Deguise Ottawa, experiments; Canada participated in the data is likely to be a signiﬁcant comorbidity. To help improve long- interpretation; and term survival and well-being of patients with SMA, it is im- reviewed and approved the final manuscript. portant to think ahead to provide therapeutic avenues that can positively modulate renal function. Amita Sharma Massachusetts Author Performed experiments; General collected clinical data; Hospital, participated in the data Acknowledgment Boston, MA interpretation; and reviewed and approved Financial support was provided to K.J.S. from NIH NINDS the final manuscript. R21-NS108015 and Cure SMA. R.K. was supported by Cure

10 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG 3. Thomas NH, Dubowitz V. The natural history of type I (severe) spinal muscular – Appendix (continued) atrophy. Neuromuscul Disord 1994;4:497 502. 4. Corey DR. Nusinersen, an antisense oligonucleotide drug for spinal muscular atrophy. Nat Neurosci 2017;20:497–499. Name Location Role Contribution 5. Wood MJA, Talbot K, Bowerman M. Spinal muscular atrophy: antisense oligonucleotide therapy opens the door to an integrated therapeutic landscape. Hum Mol Abdurrahman Massachusetts Author Performed experiments; Genet 2017;26:R151–R159. W. Muhtaseb General participated in the data 6. Finkel RS, Mercuri E, Darras BT, et al. Nusinersen versus sham control in infantile- Hospital, interpretation; and onset spinal muscular atrophy. N Engl J Med 2017;377:1723–1732. Boston, MA reviewed and approved 7. Finkel RS, Chiriboga CA, Vajsar J, et al. Treatment of infantile-onset spinal muscular the final manuscript. atrophy with nusinersen: a phase 2, open-label, dose-escalation study. Lancet 2016; 388:3017–3026. Pann Nwe Massachusetts Author Performed experiments; 8. Spinraza (Nusinersen) Injection [package insert]. Cambridge, MA: Biogen Inc.; 2016. General collected clinical data; 9. Khvorova A, Watts JK. The chemical evolution of oligonucleotide therapies of clinical Hospital, participated in the data utility. Nat Biotechnol 2017;35:238–248. Boston, MA interpretation; and 10. Van Poelgeest EP, Swart RM, Betjes MGH, et al. Acute kidney injury during therapy reviewed and approved with an antisense oligonucleotide directed against PCSK9. Am J Kidney Dis2013;62: the final manuscript. 796–800. 11. Mendell J, Al-Zaidy S, Shell R, et al. AVXS-101 phase 1 gene therapy clinical trial in Alec J. Massachusetts Author Performed experiments; SMA type 1: end-of-study event free survival and achievement of developmental Johnstone General collected clinical data; milestones. Neuromuscul Disord 2017;27(Suppl 2):S208. Hospital, participated in the data 12. Mendell JR, Al-Zaidy S, Shell R, et al. Single-dose gene-replacement therapy for spinal Boston, MA interpretation; and muscular atrophy. N Engl J Med 2017;377:1713–1722. reviewed and approved 13. Ratni H, Ebeling M, Baird J, et al. Discovery of risdiplam, a selective survival of motor the final manuscript. neuron-2 (SMN2) gene splicing modifier for the treatment of spinal muscular atrophy (SMA). J Med Chem 2018;61:6501–6517. Ren Zhang Massachusetts Author Performed experiments; 14. Rudnik-Schöneborn S, Heller R, Berg C, et al. Congenital heart disease is a feature of General collected clinical data; severe infantile spinal muscular atrophy. J Med Genet 2008;45:635–638. Hospital, participated in the data 15. Simone C, Ramirez A, Bucchia M, et al. Is spinal muscular atrophy a disease of the Boston, MA interpretation; and motor neurons only: pathogenesis and therapeutic implications? Cell Mol Life Sci reviewed and approved 2016;73:1003–1020. the final manuscript. 16. Deguise MO, Kothary R. New insights into SMA pathogenesis: immune dysfunction and neuroinflammation. Ann Clin Transl Neurol 2017;4:522–530. Maryam Massachusetts Author Performed experiments; 17. Hua Y, Sahashi K, Rigo F, et al. Peripheral SMN restoration is essential for long-term Fatouraei General participated in the data rescue of a severe spinal muscular atrophy mouse model. Nature 2011;478:123–126. Hospital, interpretation; and 18. Deguise MO, De Repentigny Y, McFall E, Auclair N, Sad S, Kothary R. Immune Boston, MA reviewed and approved dysregulation may contribute to disease pathogenesis in spinal muscular atrophy mice. the final manuscript. Hum Mol Genet 2017;26:801–819. 19. Anhuf D, Eggermann T, Rudnik-Schöneborn S, Zerres K. Determination of SMN1 Natassja Massachusetts Author Performed experiments; and SMN2 copy number using TaqManTM technology. Hum Mutat 2003;22:74–78. Huemer General participated in the data 20. Eshraghi M, McFall E, Gibeault S, Kothary R. Effect of genetic background on the Hospital, interpretation; and phenotype of the Smn 2B/- mouse model of spinal muscular atrophy. Hum Mol Genet Boston, MA reviewed and approved 2016;25:4494–4506. the final manuscript. 21. Oh Y. The insulin-like growth factor system in chronic kidney disease: pathophysi- ology and therapeutic opportunities. Kidney Res Clin Pract 2012;31:26–37. Christiano R.R. Massachusetts Author Analyzed the data; wrote 22. Hijikata Y, Hashizume A, Yamada S, et al. Biomarker-based analysis of preclinical Alves General the manuscript; progression in spinal and bulbar muscular atrophy. Neurology 2018;90:e1501–e1509. Hospital, participated in the data 23. Mulay SR, Shi C, Ma X, Anders HJ. Novel insights into crystal-induced kidney injury. Boston, MA interpretation; and – reviewed and approved Kidney Dis (Basel) 2018;4:49 57. the final manuscript. 24. Luciano RL, Perazella MA. Crystalline-induced kidney disease: a case for urine mi- croscopy. Clin Kidney J 2015;8:131–136. Rashmi University of Author Performed mouse 25. Vezzoli G, Terranegra A, Rainone F, et al. Calcium-sensing receptor and calcium Kothary Ottawa, experiments; kidney stones. J Transl Med 2011;9:201. Canada participated in the data 26. Ba J, Brown D, Friedman PA. Calcium-sensing receptor regulation of PTH-inhibitable – interpretation; and proximal tubule phosphate transport. Am J Physiol Physiol 2003;285:F1233 F1243. reviewed and approved 27. Iida T, Fujinaka H, Xu B, et al. Decreased urinary calbindin 1 levels in proteinuric rats the final manuscript. and humans with distal nephron segment injuries. Clin Exp Nephrol 2014;18: 432–443. Kathryn J. Massachusetts Author Directed the research 28. Jones J, Gockerman A, Busby W, et al. Insulin-like growth factor binding protein 1 Swoboda General project and designed stimulates cell migration and binds to the alpha5beta1 integrin by means of its Arg- – Hospital, experiments; collected Gly-Asp sequence. EMBO J 1993;90:10553 10557. Boston, MA clinical data; wrote the 29. Doublier S, Seurin D, Fouqueray B, et al. Glomerulosclerosis in mice transgenic for – manuscript; participated human insulin-like growth factor-binding protein-1. Kidney Int 2000;57:2299 2307. in the data interpretation; 30. Modric T, Silha JV, Shi Z, et al. Phenotypic manifestations of insulin-like growth and reviewed and factor-binding protein-3 overexpression in transgenic mice. Endocrinology 2001;142: – approved the final 1958 1967. manuscript. 31. Flyvbjerg A, Kessler U, Dorka B, Funk B, Ørskov H, Kiess W. Transient increase in renal insulin-like growth factor binding proteins during initial kidney hypertrophy in experimental diabetes in rats. Diabetologia 1992;35:589–593. 32. Shinada M, Akdeniz A, Panagiotopoulos S, Jerums G, Bach LA. Proteolysis of insulin- like growth factor-binding protein-3 is increased in urine from patients with diabetic nephropathy. J Clin Endocrinol Metab 2000;85:1163–1169. References 33. Swoboda KJ. Romancing the spliceosome to fight spinal muscular atrophy. N Engl J 1. Groen EJN, Talbot K, Gillingwater TH. Advances in therapy for spinal muscular Med 2014;371:1752–1754. atrophy: promises and challenges. Nat Rev Neurol 2018;14:214–224. 34. Jangi M, Fleet C, Cullen P, et al. SMN deficiency in severe models of spinal muscular 2. Faravelli I, Nizzardo M, Comi GP, Corti S. Spinal muscular atrophy-recent thera- atrophy causes widespread intron retention and DNA damage. Proc Natl Acad Sci peutic advances for an old challenge. Nat Rev Neurol 2015;11:351–359. 2017;114:E2354–E2356.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 11 ARTICLE OPEN ACCESS A family with spinocerebellar ataxia and retinitis pigmentosa attributed to an ELOVL4 mutation

Changrui Xiao, MD, Elaine M. Binkley, MD, Jessica Rexach, MD, PhD, Amy Knight-Johnson, GSC, Correspondence Pravin Khemani, MD, Brent L. Fogel, MD, PhD, Soma Das, PhD, Edwin M. Stone, MD, PhD, and Dr. Gomez cgomez@ Christopher M. Gomez, MD, PhD neurology.bsd.uchicago.edu Neurol Genet 2019;5:e357. doi:10.1212/NXG.0000000000000357 Abstract Objective To identify the genetic cause of autosomal dominant spinocerebellar ataxia and retinitis pigmentosa in a large extended pedigree.

Methods Clinical studies were done at 4 referral centers. Ten individuals in the same extended family participated in at least a portion of the study. Records were obtained from an 11th, deceased, individual. Neurologic and dermatological examinations were performed. Ophthalmologic evaluation including funduscopic examination and in some cases ocular coherence tomography were used to identify the presence of retinal disease. Whole exome sequencing (WES), in conjunction with Sanger sequencing and segregation analysis, was used to identify potential genetic mutation.

Results Affected individuals reported slowly progressive cerebellar ataxia with age at onset between 38 and 57. Imaging demonstrated cerebellar atrophy (3/3). WES identified a novel heterozygous mutation in the elongation of very long chain fatty acids 4 (ELOVL4) gene (c.512T>C, p.Ile171Thr) that segregated with ataxia in 7 members tested. Four of 8 members who underwent ophthalmologic evaluation were found to have retinitis pigmentosa. No skin findings were identified or reported. Ocular movement abnormalities and pyramidal tract signs were also present with incomplete penetrance.

Conclusions We report a family with both spinocerebellar ataxia and retinal dystrophy associated with an ELOVL4 mutation. In addition, to supporting prior reports that ELOVL4 mutations can cause spinocerebellar ataxia, our ﬁndings further broaden the spectrum of clinical presentations associated with spinocerebellar ataxia 34.

From the National Human Genome Research Institute (C.X.), Bethesda, MD; Department of Neurology (C.M.G.), University of Chicago Hospitals, IL; Department of Ophthalmology and Visual Sciences (E.M.B., E.M.S.), University of Iowa; Department Neurology (J.R., B.L.F.), David Geffen School of Medicine, University of California Los Angeles; Department of Genetics (A.K.-J., S.D.), University of Chicago, IL; and Department of Neurology (P.K.), UTSW Medical Center, Dallas, TX.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary EKV = erythrokeratodermia variabilis; ELOVL4 = elongation of very long chain fatty acids 4; PUFA = poly-unsaturated; SCA = spinocerebellar ataxias; SFA = saturated; WES = whole exome sequencing.

The spinocerebellar ataxias (SCAs) are a group of auto- Methods somal dominant disorders characterized by progressive cerebellar ataxia. Some subtypes of SCA are associ- Ten individuals with ataxia from the same extended family ated with other neurologic dysfunction including ocular located in 8 different cities participated in the elements of the movement abnormalities, peripheral neuropathy, pyrami- study based on logistical availability. The pedigree can be found dal or extrapyramidal signs, and in some cases non- in figure 1. DNA was collected from 7 affected and 2 unaffected neurological signs. To date, over 40 causative genes have individuals. Clinical studies were done at 4 referral centers. been described.1 Participants were referred for neurologic, dermatologic, and ophthalmic evaluations. Participants who were unable to reach Mutations in the elongation of very long chain fatty acids a referral center were interviewed remotely, and clinical records 4(ELOVL4) gene have been associated with spinocer- were obtained when possible. Six individuals participated in ebellar ataxia SCA34 (OMIM 133190) in 3 families and neurologic and dermatologic examination. On neurologic 2 other individuals. One French Canadian family and 2 evaluation, both Scale for the Assessment and Rating of Ataxia individuals were reported to have spinocerebellar ataxia and Inventory of Non-Ataxia Signs scales were recorded. Seven with erythrokeratodermia variabilis (EKV) while 2 Japa- individuals participated in ophthalmic examination. Clinical – nese families have a pure SCA with no skin findings.2 5 records of one deceased individual (IV-1) were also obtained. Although ELOVL4 mutations are also known to cause autosomal dominant Stargardt-like macular dystrophy, Genetic analysis was done independently at 3 Clinical none of the previous reports identified ophthalmologic Laboratory Improvement Amendments-certified centers. abnormalities. Two individuals (V-1 and V-I12) were evaluated for ataxia via targeted analysis of WES. Details of sequencing and bio- We report an American family with a late onset SCA in informatics used are previously published. See supplemental which many affected individuals also have retinitis pig- materials NGS Pipeline and Bioinformatics (links.lww.com/ mentosa on ophthalmologic evaluation. Whole exome se- NXG/A182) for details. In conjunction, Sanger sequencing quencing (WES) with confirmative Sanger sequencing and segregation analysis were used to confirm and support the identifiedanovelmutationintheELOVL4 gene genetic mutation. Another individual (IV-1), now deceased, (c512.T>C, pIle171Thr) that segregated with the disease in underwent allele-specific prescreen followed by targeted anal- this family. ysis of WES at a third center for familial retinitis pigmentosa.

Figure 1 Pedigree of an American Family with a Novel Mutation in ELOVL4

Pedigree of a large extended family including all members of our study. Individuals who participated in genetic testing for p.I171T variant denoted in + for presence and − for absence.

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG Standard protocol approvals, registrations, Results and patient consents fi Elements of this study involving human subjects were A summary of clinical ndings can be found in the table. The approved by the institutional review board of participating age at ataxia onset was in early 40s for most individuals, ff institutions (University of Iowa ID# 200202022 and though this ranged from 38 to 57. All 10 a ected individuals University of Chicago 14707A-CR004). Other studies reported slowly progressive gait instability, 6 of 10 com- were standard of care. All participants provided informed plained of dysarthria, and 8 of 10 noted handwriting written consents prior to initiating research and data changes. Three individuals have progressed to using collection. a wheelchair (average 18.3 years after onset). One of 10 complained of diplopia, 7 of 10 wear corrective lenses. Two of 10 complained of nighttime vision loss corresponding to Data availability onset of ataxia. All persons denied bowel/bladder issues as The authors confirm that the deidentified data well as history of dermatologic disease. Disease progression supporting the findings of this study are available within was extremely slow. Of the 10 persons interviewed, one the article and supplementary materials (links.lww.com/ required a cane and 2 required wheelchairs at the time of NXG/A181). interview.

Table Comparison of clinical characteristics among patients with spinocerebellar ataxia 34

French Canadian American family Japanese family (Ozaki family (Giroux et al.; Case report Case report (present study) et al.) Cardieux-Deion et al.) (Bourassa et al.) (Bourque et al.)

Mutation ELOVL4 (c.512T>C, ELOVL4 (c.736T>G, ELOVL4 (c.504G>C, ELOVL4 (c.539A>C, ELOVL4 (c.698C>T, p.I171T); heterozygous p.W246G); heterozygous p.L168F); heterozygous p.Q180P); p.T233M); heterozygous heterozygous

Approximate 42.6 33.9 51 20s 15 mean age at symptom onset

Progression Slow Slow Slow Unclear Slow

Ataxia Gait ataxia (10 of 10), Gait ataxia, limb ataxia, Gait ataxia (12 of 19), Gait ataxia, limb Gait limb ataxia (8 of 10), and dysarthria (9 of 9) limb ataxia and ataxia, dysarthria dysarthria (6 of 10) dysarthria observed

Oculomotor Horizontal nystagmus (5 Horizontal gaze evoked Nystagmus (7 of 19), Nystagmus, Saccadic pursuit, signs of 6), vertical nystagmus nystagmus (7 of 9), slow saccade and slow ophthalmoplegia square wave jerks, (4 of 6), vertical gaze supranuclear gaze palsy pursuit observed and periodic palsy (1 of 6), slow (3 of 9), impaired smooth alternating skew saccades (5 of 6), pursuit (5 of 9) deviation impaired smooth pursuits (5 of 6)

Pyramidal tract Increased DTRs (6 of 6) Increased DTRs or Decreased DTRs None Decreased DTRs signs positive Babinski (8 of 9)

Autonomic None Bladder disturbance (4 of None Not reported Not reported disturbance 9), constipation (2 of 9)

Ophthalmologic Retinitis pigmentosa (4 None None Not reported Not reported findings of 8)

Skin findings None None Erythrokeratodermia Erythrokeratodermia Erythrokeratodermia variabilis (14 of 19) variabilis variabilis

Radiographic Pontine and cerebellar Pontine and cerebellar Pontine, cerebellar, Pontine and Mild cerebellar and findings atrophy (2 of 3), mild atrophy (8 of 8), hot ross cerebral atrophy (4 of 9), cerebellar atrophy pontine basal atrophy cerebellar atrophy (1 of bun sign (4 of 6), pontine pontine and cerebellar 3) midline linear atrophy (1 of 9), mild hyperintensity (2 of 6), cerebellar atrophy (1 of hyperintensity of middle 9), normal MRI (3 of 9) cerebellar peduncles on FLAIR (1 of 6)

Other findings Decreased vibration (2 of None Mild peripheral axonal None None 6), decreased olfaction (3 neuropathy (4 of 8) of 6)

Abbreviation: DTR = deep tendon reflexes; ELOVL4 = elongation of very long chain fatty acids 4; FLAIR = fluid-attenuated inversion recovery sequence on MRI.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 Genetic testing Dermatological workup Data from WES on 2 individuals with ataxia (V1 and VI12) None of the 10 affected individuals had a history of skin were analyzed independently by different labs and resulted in findings that could be attributed to a form of EKV. A com- identification of a variant in ELOVL4 (c.512T>C, pIle171Thr). plete skin examination done by a dermatologist found no The variant was deemed likely pathogenic based on American evidence of EKV or unusual skin lesions in 4 of 4 College of Medical Genetics Standards and Guidelines. DNA participants. from 5 more affected and 2 unaffected members of this family was analyzed for the presence of this mutation by Sanger se- Ophthalmologic evaluation quencing. All affected family members carried the mutation, Clinical images can be found in figure 5. Three of 7 affected while the 2 unaffected members lacked the mutation. A third lab individuals had peripheral bone-spicule-like pigmentary independently identifiedthesamemutationinELOVL4 in changes on funduscopic examination consistent with a now deceased individual (IV1) during evaluation for retinal retinitis pigmentosa. Records obtained from an eighth, pigmentary changes; this individual was reported to have ataxia. now deceased, individual (IV1) also showed peripheral A representation of the novel variant can be found in figure 2; its bone-spicule-like pigmentary changes consistent with relation to previously described variants is detailed in figure 3. retinitis pigmentosa. Electroretinogram results on this individual showed rod-cone photoceptor degeneration Neurologic evaluation (figure 6). On neurologic examination, affected individuals had gait ataxia (6/6), limb ataxia (5 of 6), dysarthria (3 of 6) along with ocular movement abnormalities (5 of 6), and pyramidal tract Discussion signs (6 of 6). We identified a novel missense variant in ELOVL4 in a large MRI of the brain was done in 3 affected individuals, all showing American family with SCA. This variant is in a highly cerebellar and pontine atrophy that correlated with their dis- conserved amino acid residue, is predicted to be likely ease duration. Representative images can be found in figure 4. pathogenic by American College of Medical Genetics

Figure 2 Novel Mutation in ELOVL4

(A) Whole-exome sequencing identified a novel heterozygous mutation in the elongation of very long chain fatty acids 4 (ELOVL4) gene (c.512T>C, p.Ile171Thr) that segregated with symptoms in 9 individuals tested. (B) The nucleic acid change is highly conserved across species and is predicted to be likely pathogenic.

4 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG Figure 3 Location of Novel ELOVL4 Mutation on Topographic Prediction of Protein

Illustration of topographic prediction of the ELOVL4 protein based on the Uniprot database and location of our mutation relative to previously reported disease-causing mutations.

criteria and is nearby a previously reported mutation Japanese families, we did not see the loss of transverse (P168F) in a large French Canadian family with SCA34. In pontine fibers on neuroimaging for members of our cohort. addition, affected persons have relatively high incidence of Several members of our family reported subjectively an- pyramidal tract signs and oculomotor signs more consistent osmia around the onset of gait ataxia. The clinical signifi- with those reported in the 2 Japanese families. Unlike the cance of this is unclear.

Figure 4 Brain MRIs of an American Family with Novel ELOVL4 Mutation

MRI demonstrates cerebellar and pontine atrophy in 2 of 3 participants who were imaged. The third younger individual had mild changes.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 5 Figure 5 Fundus Photographs of an American Family with Novel ELOVL4 Mutation

Color fundus photographs demonstrating ophthalmic examination findings. Four patients were found to have ophthalmic findings consistent with retinitis pigmentosa. Color fundus photographs of patient IV1 (A, B) demonstrate bone spicule-like pigmentary changes. Mon- tage color photographs of patient V4 demonstrate mild optic disc pallor, arteriolar attenuation, and peripheral retinal pigment epithelial changes (C = right eye, D = left).

The relevant new finding in our family is the presence of polyunsaturated (PUFA) vs saturated (SFA) very long retinitis pigmentosa. Although RP is not a typical pre- chain fatty acid biosynthesis, important in retina and brain/ sentation for Stargardt type 3, previous work on the more skin respectively.9 This model predicts patients carrying the common autosomal recessive form of Stargardt disease, Thr171Ile mutation would have decreased PUFA and SFA caused by mutations in the ABCA4 gene, has shown synthesis while persons carrying previous mutations in SCA RP and macular dystrophy to be part of the same pheno- families would only have decreased SFA synthesis. Since our typic spectrum due to buildup of a toxic product in the mutation is in close proximity to prior reported mutations in retinal pigmented epithelium layer.6 The presence of the 4th transmembrane domain of the ELOVL4 protein, inclusions in the retina of an ELOVL4 transgenic mouse which were not associated with retinal phenotypes, it is un- model could also point to a toxic gain of function clear why it would produce a different functional effect. Re- mechanism.7 cent work found ELOVL4 synthesis of VLCFAs play an important role in tight junction stability in the blood-retinal While ELOVL4 mutations have been associated with auto- barrier in mice.10 This could suggest blood-brain and blood- somal dominant Stargardt-like macular dystrophy (OMIM retinal barrier instability as a potential mechanism of disease in 600110) in the past, ophthalmologic pathology in the pre- late-onset SCA. Speculation on potential mechanisms of cere- viously reported SCA34 families has not been identified. bellar and retinal pathogenesis is limited by the lack of a robust The mechanism by which ELOVL4 mutations lead to both biomarker for the synthesis of either VLC-PUFA or VLC-SFA in Stargardt disease or SCA34 is currently unknown. ELOVL4 human subjects as well as limited understanding of the biological encodes a protein that contributes to elongation of fatty function of ELOVL4 and its very long chain FA products on acids longer than 26 carbons and is expressed in the retina, health and disease. brain, testis, skin, and thymus.8 We did not measure very long chain fatty acids (VLCFA) due to technical constraints ELOVL4 mutations have previously been associated with as standard assays cannot resolve the necessary carbon inherited retinopathy and SCA independently of each other. length. Further study is necessary to determine whether the We report an American family with concurrent spinocer- pathogenesis of ELOVL4 related disorders can be directly ebellar ataxia and retinal dystrophy due to an ELOVL4 mu- linked to VLCFA production. Based on the lack of over- tation. In addition, to supporting prior reports that ELOVL4 lapping ophthalmologic and neurologic phenotypes in af- mutations can cause an autosomal dominant spinocerebellar fected patients with ELOVL4 mutations, the mechanism for ataxia, our findings further broaden the spectrum of clinical the 2 phenotypes is thought to be preferential disruption of presentations associated with SCA34.

6 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG Figure 6 Electroretinogram Data for Individual IV1

(A) Scotopic electroretinogram: After 30 minutes of dark adaptation, a bright flash stimulus resulted in b-waves of 37.8 μV OD (implicit time 45.5 msec) and 50 μV OS (implicit time 49.5 msec). Normal for age is greater than 229.2 μV with an implicit time of less than 53.4 msec. (B) Photopic lectroretinogram: Under light-adapted conditions, a bright flash stimulus resulted in b-waves of 19.8 μV OD (implicit time 35.5 msec) and 21 μV OS (implicit time 34.5 msec). Normal for age is greater than 27.2 μV with an implicit time of less than 32.4 msec. The rod-selective responses were nonrecordable. The scotopic bright flash responses were markedly reduced in amplitude (A). The photopic responses were reduced in amplitude and delayed (B).

Study funding No targeted funding reported. Appendix (continued)

Name Location Role Contribution Disclosure Disclosures available: Neurology.org/NG. Jessica University of Author Acquisition of the data, Rexach, MD, California Los drafted the figures, and PhD Angeles, Los revised the manuscript for Publication history Angeles intellectual content Received by Neurology: Genetics December 14, 2018. Accepted in ﬁnal Amy Knight- University of Author Major role in the form July 8, 2019. Johnson, Chicago, Chicago acquisition of data GSC

Appendix Authors Pravin Swedish Medical Author Major role in the Khemani, Group, Seattle acquisition of data Name Location Role Contribution MD

Changrui NIH, Bethesda Author Acquisition and analysis of Brent L. University of Author Acquisition and Xiao, MD the data and drafted the Fogel, MD, California Los interpretation of data; manuscript for intellectual PhD Angeles, Los revised the manuscript for content Angeles intellectual content

Elaine M. University of Author Acquisition and Soma Das, University of Author Acquisition and Binkley, MD Iowa, Iowa City interpretation of the data, PhD Chicago, Chicago interpretation of drafted the figures, and molecular data and revised the manuscript for revised the manuscript for intellectual content intellectual content

Continued Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 7 Erythrokeratodermia. JAMA Neurol 2014;71:470–475. doi: 10.1001/jama- Appendix (continued) neurol.2013.6337. 3. Ozaki K, Doi H, Mitsui J, et al. A novel mutation in ELOVL4 leading to spinocerebellar ataxia (SCA) with the hot cross bun sign but lacking erythrokeratodermia: Name Location Role Contribution a broadened spectrum of SCA34. JAMA Neurol 2015;72:797–805. doi: 10.1001/ jamaneurol.2015.0610. Edwin M. University of Author Acquisition and 4. Bourassa CV, Raskin S, Serafini S, et al. A new ELOVL4 mutation in a case of Stone, MD, Iowa, Iowa City interpretation of spinocerebellar ataxia with erythrokeratodermia. JAMA Neurol 2015;72:942–943. PhD molecular data and doi: 10.1001/jamaneurol.2015.0888. revised the manuscript for 5. Bourque PR, Warman-Chardon J, Lelli DA, et al. Novel ELOVL4 mutation associated intellectual content with erythrokeratodermia and spinocerebellar ataxia (SCA 34). Neurol Genet 2018;4: e263. doi: 10.1212/NXG.0000000000000263. Christopher University of Author Designed and 6. Sheffield VC, Stone EM. Genomics and the eye. N Engl J Med 2011;364:1932–1942. M. Gomez, Chicago, Chicago conceptualized study and doi: 10.1056/NEJMra1012354. MD, PhD revised the manuscript for 7. Karan G, Lillo C, Yang Z, et al. Lipofuscin accumulation, abnormal electrophysiology, intellectual content and photoreceptor degeneration in mutant ELOVL4 transgenic mice: a model for macular degeneration. Proc Natl Acad Sci U S A 2005;102:4164–4169. doi: 10.1073/ pnas.0407698102. 8. ELOVL4—elongation of very long chain fatty acids protein 4—Homo sapiens (human)—ELOVL4 gene & protein. Available at: uniprot.org/uniprot/ References Q9GZR5#sequences. Accessed March 5, 2018. 1. Autosomal dominant hereditary ataxia—NORD (National Organization for Rare 9. Agbaga MP. Different mutations in ELOVL4 affect very long chain fatty acid bio- Disorders). NORD (National Organization for Rare Disorders) (blog). Available at: synthesis to cause variable neurological disorders in humans. Adv Exp Med Biol 2016; rarediseases.org/rare-diseases/autosomal-dominant-hereditary-ataxia/. Accessed 854:129–135. doi: 10.1007/978-3-319-17121-0_18. June 26, 2018. 10. Kady NM, Liu X, Lydic TA, et al. ELOVL4-Mediated production of very 2. Cadieux-Dion M, Turcotte-Gauthier M, Noreau A, et al. Expanding the clinical long chain ceramides stabilizes tight junctions and prevents diabetes-induced phenotype associated with ELOVL4 mutation: study of a large French- retinal vascular permeability. Diabetes 2018;67:769–781. doi: 10.2337/ Canadian family with autosomal dominant spinocerebellar ataxia and db17-1034.

8 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG ARTICLE OPEN ACCESS Epidemiology of DYT1 dystonia Estimating prevalence via genetic ascertainment

Joseph Park, AB, Scott M. Damrauer, MD, Aris Baras, MD, MBA, Jeffrey G. Reid, PhD, John D. Overton, PhD, and Correspondence Pedro Gonzalez-Alegre, MD, PhD Dr. Gonzalez-Alegre pedro.gonzalez-alegre@ Neurol Genet 2019;5:e358. doi:10.1212/NXG.0000000000000358 uphs.upenn.edu Abstract Objective To estimate the prevalence of TOR1A sequence variants associated with DYT1 dystonia.

Methods We determined the frequency of the common trinucleotide deletion that causes DYT1 in the Genome Aggregation Database and the Penn Medicine Biobank, totaling exomes from over 135,000 individuals. We also evaluated the prevalence of other possible pathogenic variants in this gene and asked whether the D216H polymorphism is linked to a higher diagnostic rate for dystonia independent of the DYT1-causing mutation.

Results The estimated range of prevalence of the most common pathogenic variant that causes DYT1 is ;17.6–26.1 carriers per 100,000 individuals. Based on the diﬀerent data sets used, we predict that there are between 54,366 and 80,891 mutation carriers in the United States, which, due to the reduced penetrance of this variant, would translate into 16,475–24,513 DYT1 patients.

Conclusions Our data provide a prevalence estimate of the most common DYT1 mutation in the general population. This information is speciﬁcally important for those with interest in the development of precision therapeutics for dystonia.

From the Department of Medicine (J.P.), University of Pennsylvania, Philadelphia; Department of Surgery (S.M.D.), Perelman School of Medicine, University of Pennsylvania, Philadelphia; Regeneron Genetics Center (A.B., J.G.R., J.D.O.), Tarrytown, NY; and Department of Neurology (P.G.-A.), Perelman School of Medicine, University of Pennsylvania, Philadelphia.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

The Article Processing charge was funded by the University of Pennsylvania. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary EHR = electronic health record; gnomAD = Genome Aggregation Database; ICD = International Classiﬁcation of Diseases; PMBB = Penn Medicine Biobank; REVEL = Rare Exonic Variant Ensemble Learner; SNP = single nucleotide polymorphism.

DYT1, an autosomal dominant form of dystonia, almost c.907_909del:p.303_303del).1 Next,wequeriedthePMBB universally caused by an in-frame GAG deletion in the data set for other reported private pathogenic variants4,5 TOR1A gene1 with reduced clinical penetrance, reported at and to identify other novel predicted deleterious missense about 33%.2,3 In addition to the GAG deletion, a few private variants in TOR1A, evaluating their frequency in gnomAD. sequence variants in TOR1A have been linked to the ap- For prediction of deleterious missense variants, we used pearance of dystonia,4,5 and biallelic mutations in this gene theRareExonicVariantEnsembleLearner(REVEL)11 were recently identified in patients with a severe congenital selecting the top 20% REVEL scores to be considered syndrome.6 Recent studies have estimated the prevalence of deleterious. For all participants from the PMBB harboring dystonia in different populations.7,8 However, most focus on known pathogenic or predicted deleterious variants, their adult-onset isolated dystonia. With the advent of precision EHR was reviewed for the presence of a diagnosis of dys- medicine, it is important to ascertain the prevalence of ge- tonia, description of a phenotype suspected to be dystonia, netically defined forms. This epidemiologic information is or a family history of dystonia or similar neurologic important not only to extrapolate the burden of the disease syndrome. but also to inform those with potential interest on therapeutic development about the target population. Finally, we evaluated the PMBB data set for the frequency of the exon4:c.G646C:p.D216H single nucleotide poly- Here, we designed a genetic ascertainment study that quan- morphism (SNP), known to influence the penetrance of the tifies the prevalence of the GAG deletion and other rare common DYT1 mutation3 but also proposed to be a risk pathogenic variants in TOR1A in the general population and factor for isolated dystonia independent of the GAG de- interrogated the electronic health records of TOR1A variant letion.12 We identified carriers of the minor allele in hetero- carriers to estimate the prevalence of DYT1 dystonia. zygous and homozygous state. As manual evaluation of the 11,451 medical charts is not feasible, we queried the diagnostic codes from the EMR of all PMBB participants with Methods exome data for ICD-9 codes 333.6, 333.7, and 333.8 to cor- relate the p.D216H polymorphism with dystonia. We analyzed exome sequencing data from the Genome Ag- gregation Database (gnomAD) and Penn Medicine Biobank Data availability (PMBB). gnomAD is a coalition of investigators that have Anonymized data not published within the article will be generated harmonized exome sequencing data freely available shared by request from any qualified investigator. to the scientific community (from 125,748 unrelated individuals of various population genetic studies).9 The PMBB, approved by the University of Pennsylvania Institutional Results Review Board, consists of over 60,000 patients from clinical practice sites of the University of Pennsylvania Health System We used the minor allele frequencies reported for the GAG deletion in gnomAD, all in a heterozygous state, to calculate who have given appropriate consent regarding access to all fi available electronic health records (EHRs). Participants are the carrier frequency (table 1). To con rm this prevalence in recruited independent of diagnosis and at multiple locations, an independent US-based data set, we evaluated carrier fre- from clinical visits to those undergoing blood draws or ra- quency in the PMBB. Overall, the data were consistent diologic studies for any reason, among others. This study included a subset of 11,451 individuals who have undergone whole-exome sequencing, for which we obtained whole- Table 1 Prevalence of GAG deletion in the 2 data sets and exome sequences as generated via DNA extracted from stored in aggregate ff bu y coats by the Regeneron Genetics Center (Tarrytown, Database Exomes (n) DGAG carrier frequencya NY) and mapped these sequences to GRCh37 as previously described.10 Furthermore, International Classification of Dis- gnomAD 125,748 0.000199 eases (ICD) Ninth Revision and Tenth Revision (ICD-10) dis- PMBB 11,451 0.00026 ease diagnosis codes and procedural billing codes were All 137,199 0.0002 extracted from the patients’ EHR. Abbreviations: gnomAD = Genome Aggregation Database; PMBB = Penn fi Medicine Biobank. We rst evaluated the frequency of the sequence variant a Estimated from allele frequencies assuming all carriers are heterozygous. responsible for almost all cases of DYT1 dystonia (exon5:

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG between both data sets, with a frequency in the entire data set Finally, we evaluated for the frequency of the D216H poly- of 20 carriers per 100,000. Although there is no clinical in- morphism among the PMBB exome data set. In addition to formation available for gnomAD participants, we reviewed the influencing DYT1 penetrance, it has been proposed as a risk EHR for the 3 participants carrying the GAG deletion in the factor for isolated dystonia.12 The frequency of the SNP PMBB (54- and 85-year-old men and 88-year-old woman). encoding for aspartic acid (88.3%) and histidine (11.7%) was None had any evidence of a neurologic disorder affecting as previously described,3 with the number of participants per motor function, with no mention of neurologic disease or genotype and frequency of diagnostic codes for dystonia in disability in their family history (which was recorded). their EHR shown in table 4. However, they had not been evaluated by a movement disorders neurologist. Discussion Next, we aimed to estimate the prevalence of this variant in the United States based on these data (table 2). However, this In this work, we estimate the frequency of the most common cannot be simply extrapolated from the full gnomAD data set. DYT1-causing mutation in the general population using The GAG deletion is overrepresented in Ashkenazi Jewish exome data sets representing over 135,000 individuals, mak- (AJ),2 a subgroup that represents 4% of gnomAD participants ing it a robust genetic ascertainment study. The only previous but only 2% of the US population.13 This subgroup had attempt to quantify the prevalence of the GAG deletion in the a carrier frequency of 0.003. For that reason, we also estimated general population was genotyping of the GAG deletion in the expected prevalence of the GAG deletion based on both samples from a neonatal screen in South-Eastern France, the PMBB data set (US based) and in gnomAD including an identifying 1 mutation among 12,000 births.15 Our study AJ subgroup adjusted to represent only 2% of the sample. As includes 2 additional independent data sets. All yielded con- shown in table 2, this yields a range of prevalence of the GAG sistent findings. These data have very important implications deletion in the United States of 17.6–26.2 carriers/100,000. for therapeutic development in DYT1, allowing to quantita- Table 2 also shows the number of predicted carriers and tively estimate the target population. In addition, we evaluated symptomatic DYT1 patients, assuming a 33.3% penetrance. the frequency of other rare potentially pathogenic and pre- We did not collect information to identify an AJ subgroup in dicted deleterious variants in TOR1A, linking it to clinical the PMBB data set, but 75% of that sample is of European information in PMBB participants. This additional piece of descent. information was not used for our prevalence estimates, as the pathogenicity of some of these variants is still debated. We also queried the PMBB data set for other previously However, it will help clarify their role in dystonia as their reported likely pathogenic variants in TOR1A4,5,14 and iden- frequency and clinical correlates are evaluated in additional tified 3 participants, with 5 additional participants with pre- data sets. dicted deleterious variants (table 3). EHR review disclosed that none of them had dystonia or any other motor or neu- Dystonia is clinically and etiologically very heterogeneous,16 rologic disorder. Similarly, there was no mention of family and DYT1 represents a very small fraction of patients with history of dystonia or other neurologic disorder in their dystonia. A well-designed study recently estimated the prev- records. None of the patients had been evaluated by a neu- alence of adult-onset isolated idiopathic or hereditary dysto- rologist in our institution. nia in Finland at 405 per million,7 whereas a meta-analysis estimated the prevalence of isolated dystonia at 164 per 1,000,0008. However, genetic forms such as DYT1 represent a minority of those cases. The prevalence of the GAG deletion Table 2 Estimated prevalence of carrier status and clinically manifest DYT1 dystonia in the United in TOR1A among patients of all ages presenting with idio- States pathic dystonia has been addressed following a forward genetics approach, with reported rates of 5% (France),17 3.4% Carriers/ Carriers in the Predicted 18 19 20 Database 100,00 United Statesa symptomaticb (Japan), 2.3% (Germany), 1.5% (Taiwan), or 7% (Poland).21 If, based on these reports, we consider these gnomAD 19.9 61,440 18,618 dystonia prevalence data (405 per million) and the approxi- (all) mate frequency of the GAG deletion among those patients gnomAD 17.6 54,366 16,475 (5%), there would be approximately 6,252 patients with (2% AJ)c DYT1 in the United States. Another approach to evaluate PMBB 26.2 80,891 24,513 DYT1 prevalence is to use epidemiologic data including only early-onset idiopathic dystonia, the most common pheno- Abbreviations: gnomAD = Genome Aggregation Database; PMBB = Penn Medicine Biobank. typical presentation of DYT1. The prevalence of early-onset a US Census 2010 (308,745,538). b idiopathic dystonia in the United States has been reported at 1 Assumes 33% penetrance. 22 c Estimated using carrier frequency in AJ in the gnomAD sample but as- in 30,000, with about 70% of those predicted to carry the suming that the AJ subgroup represents 2% of participants (percentage of AJ 23 in the US population), rather than the 4% in the full gnomAD data set. DYT1 mutation. Using these rates, the estimate would amount to 7,204 DYT1 patients in the United States. Both

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 Table 3 Prevalence of previously reported pathogenic variants and new predicted deleterious variants in TOR1A in PMBB, with carrier frequencies in gnomAD

Variant Participants Age, y (sex) gnomAD PMBB

− − Pathogenic exon3:c.T613A:p.F205I 2 70 (M); 28 (M) 8.9 × 10 5 1.7 × 10 4

− − exon5:c.C862T:p.R288X 1 50 (M) 5.7 × 10 5 8.7 × 10 5

− − Predicted deleterious exon2:c.A440G:p.Y147C 1 79 (M) 8.1 × 10 6 8.7 × 10 5

− exon2:c.C205A:p.L69I 1 73 (W) 8.7 × 10 5

− − exon3:c.G580T:p.D194Y 2 69 (M); 67 (W) 3.3 × 10 5 1.7 × 10 4

− − exon5:c.C962T:p.T321M 1 84 (M) 1.6 × 10 5 8.7 × 10 5

Abbreviations: gnomAD = Genome Aggregation Database; PMBB = Penn Medicine Biobank.

clinical ascertainment-based estimates are significantly lower In this work, we report the frequency of the most common than the range of 16,475 to 24,513 DYT1 patients yielded by DYT1 mutation in the general population using large genetic this genetic ascertainment approach. data sets, with additional data on rare pathogenic and a clinically significant polymorphism. Together with clinically ascer- There are different potential reasons for this discrepancy. tained information, we provide a solid prevalence estimate for First, penetrance could be lower than the estimated 30%. DYT1. This information establishes the size of the target The families used for penetrance studies were recruited population for genetically driven precision therapies for DYT1. through clinical ascertainment of affected family members followed by genetic screening of unaffected relatives. How- Acknowledgment ever, it is possible that many families carry the GAG deletion The authors thank the Exome Aggregation Consortium, the with no expression of dystonia. A second reason for the Genome Aggregation Database, and the groups that provided discrepancy between clinical and genetic ascertainment exome variant data to these resources. A full list of contributing approaches is underdiagnosis (or misdiagnosis) of DYT1 of groups can be found at gnomad.broadinstitute.org/about. The dystonia. data collection in this work was partially supported by the Regeneron Genetics Center. PGA is supported by the Finally, our data do not support an association of the D216H Neurogenetics Translational Center of Excellence, Department polymorphism with isolated dystonia. However, these data of Neurology, the University of Pennsylvania. SMD is should be taken with caution because of the pitfalls of using supported by the US Department of Veterans Affairs (IK2- diagnostic codes from EHR for genotype-phenotype corre- CX001780). This publication does not represent the views of lations, especially in a challenging and heterogeneous syn- the Department of Veterans Affairs or the US government. drome such as dystonia. Study funding P. Gonzalez-Alegre is supported by the Neurogenetics Translational Center of Excellence, Department of Neurol- ogy, the University of Pennsylvania. S. Damrauer is supported Table 4 Distribution of the clinically significant SNP by the US Department of Veterans Affairs (IK2-CX001780). (encoding for either an aspartic acid or histidine in amino acid 216) in the PMBB data set, correlated with the presence of diagnostic codes Disclosure for dystonia in the EMR Disclosures available: Neurology.org/NG.

216 Publication history DD DH HH Total Received by Neurology: Genetics June 4, 2019. Accepted in ﬁnal form Dystoniaa 14 3 0 17 August 2, 2019.

No dystonia 8,931 2,325 178 11,434

Total 8,945 2,328 178 11,451 Appendix Authors Dystonia/100,000 156.5 128.9 0.0 148.5 Name Location Role Contribution Abbreviations: D = aspartic acid; H = histidine; ICD-9 = International Classifi- cation of Diseases Ninth Revision; PMBB = Penn Medicine Biobank; SNP = Joseph University of Author Interpreted the data and single nucleotide polymorphism. Park, AB Pennsylvania, revised the manuscript for a ICD-9 codes 333.6, 333.7, and 333.8. Philadelphia, PA intellectual content

4 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG 5. Vulinovic F, Lohmann K, Rakovic A, et al. Unraveling cellular phenotypes of novel – Appendix (continued) TorsinA/TOR1A mutations. Hum Mutat 2014;35:1114 1122. 6. Reichert SC, Gonzalez-Alegre P, Scharer GH. Biallelic TOR1A variants in an infant with severe arthrogryposis. Neurol Genet 2017;3:e154. Name Location Role Contribution 7. Ortiz R, Scheperjans F, Mertsalmi T, Pekkonen E. The prevalence of adult-onset isolated dystonia in Finland 2007-2016. PLoS One 2018;13:e0207729. Scott M. University of Author Interpreted the data and 8. Steeves TD, Day L, Dykeman J, Jette N, Pringsheim T. The prevalence of primary Damrauer, Pennsylvania, revised the manuscript for dystonia: a systematic review and meta-analysis. Mov Disord 2012;27:1789–1796. MD Philadelphia, PA intellectual content 9. Lek M, Karczewski KJ, Minikel EV, et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature 2016;536:285–291. Aris Baras, Regeneron Author Major role in the acquisition 10. Dewey FE, Murray MF, Overton JD, et al. Distribution and clinical impact of func- MD, MBA Genetics of data tional variants in 50,726 whole-exome sequences from the DiscovEHR study. Science Center, 2016;354:aaf6814. Tarrytown, NY 11. Ioannidis NM, Rothstein JH, Pejaver V, et al. REVEL: an Ensemble method for predicting the pathogenicity of rare missense variants. Am J Hum Genet 2016;99:877–885. Jeffrey G. Regeneron Author Major role in the acquisition 12. Kamm C, Fischer H, Garavaglia B, et al Susceptibility to DYT1 dystonia in European Reid, PhD Genetics of data patients is modified by the D216H polymorphism. Neurology 2008;70:2261–2262. Center, 13. Ostrer H, Skorecki K. The population genetics of the Jewish people. Hum Genet Tarrytown, NY 2013;132:119–127. 14. Bhagat SL, Qiu S, Caffall ZF, et al. Mouse model of rare TOR1A variant found in John D. Regeneron Author Major role in the acquisition sporadic focal dystonia impairs domains affected in DYT1 dystonia patients and Overton, Genetics of data animal models. Neurobiol Dis 2016;93:137–145. PhD Center, 15. Frederic M, Lucarz E, Monino C, et al. First determination of the incidence of the Tarrytown, NY unique TOR1A gene mutation, c.907delGAG, in a Mediterranean population. Mov Disord 2007;22:884–888. Pedro University of Author Designed and 16. Albanese A, Bhatia K, Bressman SB, et al. Phenomenology and classification of dys- Gonzalez- Pennsylvania, conceptualized the study; tonia: a consensus update. Mov Disord 2013;28:863–873. Alegre, MD, Philadelphia, PA analyzed the data; and 17. Brassat D, Camuzat A, Vidailhet M, et al. Frequency of the DYT1 mutation in primary PhD drafted the manuscript for torsion dystonia without family history. Arch Neurol 2000;57:333–335. intellectual content 18. Matsumoto S, Nishimura M, Kaji R, et al. DYT1 mutation in Japanese patients with primary torsion dystonia. Neuroreport 2001;12:793–795. 19. Grundmann K, Laubis-Herrmann U, Bauer I, et al. Frequency and phenotypic variability of the GAG deletion of the DYT1 gene in an unselected group of patients with References dystonia. Arch Neurol 2003;60:1266–1270. 1. Ozelius LJ, Hewett JW, Page CE, et al. The early-onset torsion dystonia gene (DYT1) 20. Lin YW, Chang HC, Chou YH, et al. DYT1 mutation in a cohort of Taiwanese encodes an ATP-binding protein. Nat Genet 1997;17:40–48. primary dystonias. Parkinsonism Relat Disord 2006;12:15–19. 2. Bressman SB, Sabatti C, Raymond D, et al. The DYT1 phenotype and guidelines for 21. Szczaluba K, Jurek M, Milewski M, et al. Clinical characteristics of carriers of a GAG diagnostic testing. Neurology 2000;54:1746–1752. deletion in the DYT1 gene amongst Polish patients with primary dystonia. Eur J 3. Risch NJ, Bressman SB, Senthil G, Ozelius LJ. Intragenic Cis and Trans modification Neurol 2007;14:659–662. of genetic susceptibility in DYT1 torsion dystonia. Am J Hum Genet 2007;80: 22. Kamm C. Early onset torsion dystonia (Oppenheim’s dystonia). Orphanet J Rare Dis 1188–1193. 2006;1:48. 4. Hettich J, Ryan SD, de Souza ON, et al. Biochemical and cellular analysis of human 23. Klein C, Friedman J, Bressman S, et al. Genetic testing for early-onset torsion dystonia variants of the DYT1 dystonia protein. TorsinA/TOR1A. Hum Mutat 2014;35: (DYT1): introduction of a simple screening method, experiences from testing of 1101–1113. a large patient cohort, and ethical aspects. Genet Test 1999;3:323–328.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 5 ARTICLE OPEN ACCESS Homozygous pathogenic variant in BRAT1 associated with nonprogressive cerebellar ataxia

Areej Mahjoub, MD,* Zuzana Cihlarova, MS,* Martine T´etreault, PhD, Lauren MacNeil, PhD, Correspondence Neal Sondheimer, MD, PhD, Keith W. Caldecott, PhD, Hana Hanzlikova, PhD, and Grace Yoon, MD, Dr. Yoon [email protected] on behalf of the Care4Rare Canada Consortium or Dr. Hanzlikova [email protected] Neurol Genet 2019;5:e359. doi:10.1212/NXG.0000000000000359

Abstract MORE ONLINE Videos Objective To investigate the pathogenicity of a novel homozygous BRAT1 variant in 2 siblings with nonprogressive cerebellar ataxia (NPCA) through functional studies on primary and immor- talized patient cell lines.

Methods BRAT1 protein levels and ataxia-telangiectasia mutated (ATM) kinase activity in patient- derived and control cell lines were assessed by Western blotting. The impact of the novel BRAT1 variants on mitochondrial function was also assessed, by comparing patient and control cell lines for rates of oxygen consumption and for phosphorylation (S293) of the E1⍺ subunit of pyruvate dehydrogenase (PDH).

Results Two male siblings with NPCA, mild intellectual disability, and isolated cerebellar atrophy were found to be homozygous for a c.185T>A (p.Val62Glu) variant in BRAT1 by whole exome sequencing. Western blotting revealed markedly decreased BRAT1 protein levels in lymphocytes and/or fibroblast cells from both affected siblings compared to control cell lines. There were no differences between the patient and control cells in ATM kinase activation, following ionizing radiation. Mitochondrial studies were initially suggestive of a defect in regulation of PDH activity, but there was no evidence of increased phosphorylation of the E1⍺ subunit of the PDH complex. Measurement of oxygen consumption rates similarly failed to identify differences between patient and control cells.

Conclusions Biallelic pathogenic variants in BRAT1 can be associated with NPCA, a phenotype considerably milder than previously reported. Surprisingly, despite the molecular role currently proposed for BRAT1 in ATM regulation, this disorder is unlikely to result from defective ATM kinase or mitochondrial dysfunction.

*These authors contributed equally to this work.

From the Division of Neurology (A.M., G.Y.), Department of Paediatrics, University of Toronto, The Hospital for Sick Children, Canada; Department of Genome Dynamics (Z.C., K.W.C., H.H.), Institute of Molecular Genetics of the Czech Academy of Sciences, Prague, Czech Republic; Faculty of Science (Z.C.), Charles University in Prague, Czech Republic; Department of Neuroscience (M.T.), Université de Montréal, CHUM, Montréal, Québec, Canada; Department of Paediatric Laboratory Medicine (L.M.), Hospital for Sick Children; Department of Lab Medicine and Pathobiology (L.M.), University of Toronto, Ontario, Canada; Program in Genetics and Genome Biology (N.S.), SickKids Research Institute, Toronto, Ontario, Canada; Division of Clinical and Metabolic Genetics (N.S., G.Y.), Department of Paediatrics, University of Toronto, The Hospital for Sick Children, Toronto, Canada; and Genome Damage and Stability Centre (K.W.C., H.H.), School of Life Sciences, University of Sussex, Falmer, Brighton, UK.

Go to Neurology.org/NG for full disclosures. Funding information are provided at the end of the article.

Care4Rare Canada Consortium coinvestigators are listed in the appendix 2 at the end of the article.

The Article Processing charge was funded by the authors. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary AFP = alpha-fetoprotein; ATM = ataxia telangiectasia mutated; DCA = dichloroacetate; NPCA = non-progressive cerebellar ataxia; PDH = pyruvate dehydrogenase.

BRAT1 (BRCA1-associated ataxia telangiectasia mutated Sibling 1, currently 24 years of age, was born spontaneously at [ATM] activator 1) mutations were initially identified to term. Pregnancy and delivery were uneventful except for cause rigidity and multifocal seizure syndrome, lethal neonatal clubfoot noted at birth. He rolled at 3 months, sat without (RMFSL, OMIM #614498).1 Nonlethal phenotypes were support at 7–8 months, pulled to stand at 12 months, and subsequently described in several patients with biallelic crawled at 18 months. At the age of 15 months, parents noted BRAT1 mutations, with clinical features ranging from severe gait instability with frequent falls. Limb ataxia was formally developmental delays, ataxia, and seizures to “atypical” RMFS documented at 3 years of age. He spoke his first words at 4 – with no lethality.2 8 The underlying mechanism for this years, was able to ambulate independently, and continued to phenotypic variability is unknown. We report 2 brothers with make steady developmental gains. By 8 years, he was able to a novel homozygous BRAT1 variant who present with a much feed himself, drink from a cup, write single letters and num- milder phenotype than reported in the literature to date, with bers, and perform simple mathematical calculations. He mild intellectual disability, nonprogressive cerebellar ataxia completed education at the college level and is fully in- (NPCA), and stable cerebellar atrophy on serial brain imag- dependent for all activities of daily living, although he uses ing. Functional studies confirmed markedly decreased levels a walker for longer distances. Neurologic examination of BRAT1 protein in both affected patients’ cells compared to revealed normal head circumference and mild dysarthria with controls. monophasic scanning speech. He had mild ocular motor apraxia, saccadic smooth pursuit, and gaze-evoked nystagmus (video 1), and fundoscopy was normal. Dysmetria and dys- Clinical report diadochokinesia were evident, and he had truncal titubation. Gait was ataxic and he was unable to complete tandem gait We describe 2 brothers with NPCA and ocular motor apraxia (video 2). Extensive metabolic and other laboratory inves- born to a healthy, nonconsanguineous couple of Pakistani tigations, including microarray and serum alpha-fetoprotein descent. The family history was negative for ataxia, de- (AFP) were normal, as were EMG and nerve conduction velopmental delays, seizures, or other neurologic disorders. studies. Serial brain imaging at 9 and 16 years of age revealed

Figure 1 Pedigree and brain imaging

(A) Family pedigree. (B) Neuroimaging findings in the affected siblings. (B.a–B.d) Serial brain imaging for sibling 1. (B.a) Sagittal T1 image at 9 years showing normal cerebrum and brainstem, with diffuse cerebellar atrophy and moderately dilated fourth ventricle with prominent CSF spaces surrounding the cerebellum. (B.b) Coronal T2 image at 9 years showing cerebellar atrophy of both hemispheres and vermis. (B.c) Sagittal T1 and (B.d) coronal T2 images for sibling 1 at the age of 16 years, shows similar findings of stable severe cerebellar atrophy. (Be–B.h) Serial brain imaging for sibling 2. (B.e) Sagittal T1 image at 3 years showing cerebellar volume loss with prominent CSF spaces and fourth ventricle; brain and brainstem are normal. (B.f) Coronal T1 at 3 years showing small vermis and cerebellar hemispheres. (B.g) Sagittal T2 and (B.h) coronal T2 images for sibling 2 at the age of 5 years showing stable cerebellar atrophy.

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG stable isolated cerebellar atrophy (figure 1, A–D). Molecular symptoms, and is able to walk without assistance, but with testing of FXN, APTX, SETX, and spinocerebellar ataxia types a clearly ataxic gait. Neurologic examination revealed normal 1, 2, 3, 6, 7, 8 was normal. Muscle biopsy showed no overt head circumference, and funduscopy was normal. He had histopathologic abnormalities, and CoQ10 levels in muscle dysarthria, ocular motor apraxia, saccadic smooth pursuit, were normal. Mitochondrial studies of patient-derived fibro- gaze-evoked nystagmus, dysmetria, dysdiadochokinesia, and blasts revealed a decreased native pyruvate dehydrogenase mild wide-based ataxic gait with unsteadiness while turning. (PDH) level of 0.38 nmoles/min/mg protein compared with He was unable to perform tandem gait. Metabolic inves- that of control (0.73) but the activated PDH (with dichlor- tigations including serum AFP, microarray, EMG, and NCS oacetate, [DCA]) was restored to the normal levels of 1.12, were normal. Brain imaging at the ages of 3 and 5 years compared with control (1.22). The cellular lactate/pyruvate revealed stable isolated cerebellar atrophy, similar to his ratio of 6.1 was low in patients compared with control brother (figure 1, E–H). (12.09). Sibling 2, currently 7 years of age, was born spontaneously at Methods term following a normal pregnancy. He first sat at 8 months, stood with support at 12 months, but did not walk until 21 Standard protocol approvals, registrations, months. He spoke his first words at 12 months but did not and patient consents speak in full sentences until 4.5 years of age. His hearing is This study was approved by the Research Ethics Board of The normal but he wears glasses for myopia. He attends a regu- Hospital for Sick Children (#1000009004). Tissue samples lar grade 2 program, with an individualized educational were obtained with appropriate informed consent according plan, speech therapy, occupational therapy, and physical to the declaration of Helsinki principles of medical research therapy support. He has no swallowing difficulties or bulbar involving human subjects. The parents provided written

Figure 2 BRAT1 expression in patient cells

(A) Quantification of BRAT1 protein in control (1BR), parent (Father), and BRAT1 patient (Sib1) hTERT fibroblasts normalized to tubulin levels using Image studio lite. (B) BRAT1 protein levels measured in BRAT1 patients’ (Sib1 and Sib2) and parents’ (Mother and Father) LCLs before and after incubation with the proteasome inhibitor MG132 by Western blotting. p53 was used as a positive control. (C) BRAT1 mRNA levels in parents’ (Mother and Father) and patients’ (Sib1 and Sib2) LCLs as measured by qPCR. (D) BRAT1 protein levels measured in BRAT1 patient (Sib1) and parent (Father) LCLs before and after incubation with the protein synthesis inhibitor CHX by Western blotting. Note that default exposure levels were adjusted. p53 was used as a positive control. CHX = cycloheximide; LCL= lymphoblastoid cell line.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 informed consent to participate in this study, including pub- the mutant protein, and/or reduced binding to one or more lication of videos. as yet unidentiﬁed protein partners.

Whole exome sequencing and ATM kinase activation studies BRAT1 expression BRAT1 has been reported to be important for ATM phos- Whole exome sequencing of genomic DNA extracted from phorylation at Ser1981 and for activation of this protein ki- blood lymphocytes from both siblings identified a homozy- nase by DNA damage.9 We therefore compared ATM gous missense c.185T>A (p.Val62Glu) variant in BRAT1. autophosphorylation and transphosphorylation of its down- There are no homozygotes for this BRAT1 variant in large stream targets (e.g., Chk2, p53, and H2AX) in patient and databases of genetic variation including the Genome Ag- parental control cells lines, following ionizing radiation. Sur- gregation Database (gnomad.broadinstitute.org/; accessed prisingly, however, we failed to detect a defect in the BRAT1 July 2019). The parents were each heterozygous carriers of patient cells in ATM kinase activity (figure 3). the variant. This mutation, which is located in the middle of the second exon encoding a putative CIDE-N domain, Mitochondrial studies markedly reduced the level of BRAT1 protein in patient- Despite initial indications of a possible PDH dysfunction, derived cell lines from both affected siblings (figure 2, A and analysis of the E1⍺ subunit of this protein for phosphorylation B). This reduction was not due to decreased levels of BRAT1 at S293 by Western blotting failed to identify a difference be- mRNA, which were similar in the patients’ and parental cells tween patient and parent control cells, even with the addition of (figure 2C), suggesting instead that it might reflect instability DCA (figure 4A). Moreover, measurement of oxygen con- of the mutant BRAT1 protein. Indeed, although we could sumption rates in fibroblasts did not reveal any differences not restore normal levels of BRAT1 protein in the patient between the patient and the parental control cells (figure 4B). cells by incubation with the proteasome inhibitor MG132 (figure 2B), incubation with cycloheximide to prevent na- Data availability scent protein synthesis revealed that the half-life of the Detailed methods are available as supplemental data (e- mutant protein was much shorter than the parental BRAT1 Methods, links.lww.com/NXG/A185). All data presented in (figure 2D). This instability could reflect incorrect folding of this study are available on reasonable request.

Figure 3 ATM activation in BRAT1 patient cells

Western blot analysis of the phosphorylation of ATM kinase and its downstream substrates in indicated BRAT1 patients (Sib1 and Sib2), parents (Mother and Father), and control (1BR) (A) LCLs, (B) primary fibroblasts and/or (C) hTERT fibroblasts before and after ionizing irradiation (IR, 5 Gy) as indicated. ATM = ataxia telangiectasia mutated.

4 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG extent a defect in ATM function contributes to this disease are Figure 4 Analysis of PDH E1α phospho293 (S293) expres- unknown. We therefore evaluated a potential effect of the novel sion and oxygen consumption rates in parent and BRAT1 variant on ATM protein kinase activity following DNA BRAT1 patient primary fibroblasts damage. Surprisingly, however, BRAT1 patient cells did not exhibit a defect in ATM protein kinase activity following DNA damage induced by exposure to ionizing radiation. This may reflect differences in the cell lines and experimental systems employed in the studies.9 Nevertheless, our data strongly suggest that defective ATM activity does not contribute to the BRAT1 disease phenotype.

One patient with biallelic mutations in BRAT1 exhibited severely reduced cytochrome c oxidase enzyme histochemical staining on muscle biopsy, suggestive of mitochondrial dysfunction.7 In another study, loss of BRAT1 expression caused decreased cell proliferation and increased glucose uptake and reactive oxygen species production, also suggestive of mitochondrial impairment.10 In the current study, analysis of fibroblasts from sibling 1 revealed decreased native PDH, again consistent with a mitochondrial defect. However, a muscle biopsy from sibling 1 was essentially normal, and DCA activation restored PDH to normal levels, suggesting that mitochondrial function was intrinsically normal. Indeed, we were unable to demonstrate a deleterious impact of the BRAT1 (A) Representative Western blot analysis showing no observed differences in variant on either PDH regulation or oxygen consumption rate PDH E1α S293 expression in parent (Father) and BRAT1 patient (Sib1). Pro- in the patient cells. tein lysates were extracted from untreated cells or fibroblasts treated with 5 mM DCA (B) OCRs of the same fibroblast cells using the Seahorse XFe96 Extracellular Flux Analyzer (Seahorse Bioscience). OCR was normalized to A major consequence of the Val62Glu homozygous variant in protein to eliminate differences in growth rate between cell lines (n = 8 wells/ cell line). DCA = dichloroacetate; PDH = pyruvate dehydrogenase; OCR = BRAT1 appears to be reduced BRAT1 protein levels and it is oxygen consumption rates. possible that this mutation also affects one or more as yet unidentified activities of this protein. We note that the Val62Glu mutation resides within a putative CIDE-N domain, Discussion a domain identified previously in apoptotic nucleases. We describe 2 brothers, both homozygous for a pathogenic variant in BRAT1, with NPCA, ocular motor apraxia, and isolated cere- Finally, we highlight here that biallelic pathogenic variants in bellar atrophy, which was nonprogressive on serial brain imaging. BRAT1 can be associated with NPCA, a phenotype consid- Seizures have not been observed in either of the affected siblings. erably milder than previously reported, but which should be considered in the differential diagnosis of NPCA. While both siblings have mild intellectual disability, the elder brother completed education at college level and is independent Acknowledgment for ambulation at the age of 24. Variable but consistently severe The authors thank the family for participating in this study. phenotypes have been associated with biallelic BRAT1 mutations This work was selected for study by the Care4Rare Canada ranging from RMFSL to severe neurodevelopmental disorder with (Enhanced Care for Rare Genetic Diseases in Canada) cerebellar atrophy with or without seizures (NEDCAS, OMIM Consortium Gene Discovery Steering Committee: Kym #618056). The reason for this variable phenotype is not well Boycott (lead; University of Ottawa), Alex MacKenzie (co- understood, but the possibility of hypomorphic BRAT1 variants, lead; University of Ottawa), Jacek Majewski (McGill which have less disruptive effects on protein function resulting in University), Michael Brudno (University of Toronto), Dennis 3,4 a milder phenotype has been considered. The nonprogressive Bulman (University of Ottawa), and David Dyment nature and considerably milder clinical course of the patients we (University of Ottawa). HH is funded by an ERC Advanced describe are consistent with NPCA, which has never been pre- Investigator Award (SIDSCA; 694996) to KWC. The study viously associated with biallelic mutations in BRAT1. was supported by the Charles University, project GA UK fellowship (project No. 1212219) to ZC. BRAT1 has been reported to interact with the tumor-suppressor BRCA1 (breast cancer type 1) and ATM, and is believed to play Study funding a role in the activity of these proteins during cellular responses to This study was supported by Genome Canada, the Canadian DNA damage.9 However, the exact mechanism(s) by which Institutes of Health Research, the Ontario Genomics In- mutations in BRAT1 trigger neurodegeneration and to what stitute, Ontario Research Fund, Genome Quebec, Children’s

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 5 Hospital of Eastern Ontario Foundation, and The Hospital for Sick Children. The study was funded by an ERC Advanced Appendix 1 (continued)

Investigator Award to KWC (SIDSCA; 694996). The study Name Location Role Contribution was supported by the Charles University, project GA UK fellowship (project No. 1212219) to ZC. Grace Yoon, University of Author Overall study MD Toronto, Toronto, concept and design, ON, Canada acquisition of data, Disclosure analysis and interpretation, Disclosures available: Neurology.org/NG. critical revision of the manuscript for important Publication history intellectual content, Received by Neurology: Genetics February 25, 2019. Accepted in ﬁnal and overall study form July 29, 2019. supervision

Appendix 2 Co-investigators Appendix 1 Authors Name Location Role Contribution Name Location Role Contribution Kym University of Co- Care4Rare Canada Areej University of Author Contributed clinical Boycott Ottawa investigator Consortium Steering Mahjoub, MD Toronto, Toronto, data and wrote the Canada Committee ON, Canada first draft of the manuscript Alex University of Co- Care4Rare Canada MacKenzie Ottawa investigator Consortium Steering Zuzana Institute of Molecular Author Acquisition of Canada Committee Cihlarova, Genetics of the Czech BRAT1/ATM data, MS Academy of Sciences, analysis and Jacek McGill Co- Care4Rare Canada Prague, CZ interpretation, Majewski University, investigator Consortium Steering critical revision of the Canada Committee manuscript for important Michael University of Co- Care4Rare Canada intellectual content Brudno Toronto, investigator Consortium Steering Canada Committee Martine Universitéde Author Performed analysis Tétreault, Montréal, Montréal, of whole exome Dennis University of Co- Care4Rare Canada PhD QC, Canada sequencing data, Bulman Ottawa, investigator Consortium Steering critically reviewed Canada Committee the manuscript for important David University of Co- Care4Rare Canada intellectual content Dyment Ottawa, investigator Consortium Steering Canada Committee Lauren University of Author Clinical MacNeil, PhD Toronto, Toronto, mitochondrial ON, Canada analyses and interpretation, critical revision of the References manuscript for 1. Puffenberger EG, Jinks RN, Sougnez C, et al. Genetic mapping and exome se- important quencing identify variants associated with five novel diseases. PLoS One 2012;7: intellectual content e28936. 2. Hanes I, Kozenko M, Callen DJ. Lethal neonatal rigidity and multifocal seizure Neal University of Author Mitochondrial study syndrome—A misnamed disorder? Pediatr Neurol 2015;53:535–540. Sondheimer, Toronto, Toronto, concept and design, 3. Mundy SA, Krock BL, Mao R, Shen JJ. BRAT1-related disease—identification of MD, PhD ON, Canada acquisition of data, a patient without early lethality. Am J Med Genet A 2016;170:699–702. analysis and 4. Srivastava S, Olson HE, Cohen JS, et al. BRAT1 mutations present with a spectrum of interpretation, – critical revision of the clinical severity. Am J Med Genet A 2016;170:2265 2273. ´ manuscript for 5. Fernández-Jaén A, Alvarez S, So EY, et al. Mutations in BRAT1 cause autosomal important recessive progressive encephalopathy: report of a Spanish patient. Eur J Paediatr intellectual content Neurol 2016;20:421–425. 6. Valence S, Cochet E, Rougeot C, et al. Exome sequencing in congenital ataxia Keith W. University of Sussex, Author Critical revision of identifies two new candidate genes and highlights a pathophysiological link between Caldecott, Falmer, Brighton, UK the manuscript for some congenital ataxias and early infantile epileptic encephalopathies. Genet Med PhD important 2019;21:553–563. intellectual content 7. Horn D, Weschke B, Knierim E, et al. BRAT1 mutations are associated with infantile epileptic encephalopathy, mitochondrial dysfunction, and survival into childhood. Am Hana Institute of Molecular Author BRAT1/ATM study J Med Genet A 2016;170:2274–2281. Hanzlikova, Genetics of the Czech concept and design, 8. Smith NJ, Lipsett J, Dibbens LM, Heron SE. BRAT1-associated neurodegeneration: PhD Academy of Sciences, acquisition of data, intra-familial phenotypic differences in siblings. Am J Med Genet A 2016;170: Prague, CZ analysis and – interpretation, 3033 3038. critical revision of the 9. Aglipay JA, Martin SA, Tawara H, Lee SW, Ouchi T. ATM activation by ioniz- manuscript for ing radiation requires BRCA1-associated BAAT1. J Biol Chem 2006;281: important 9710–9718. intellectual content 10. So EY, Ouchi T. BRAT1 deficiency causes increased glucose metabolism and mitochondrial malfunction. BMC Cancer 2014;14:548.

6 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG CLINICAL/SCIENTIFIC NOTES OPEN ACCESS Fatal TTR amyloidosis with neuropathy from domino liver p.Val71Ala transplant

Ross C. Puffer, MD, Robert J. Spinner, MD, Hongyan Bi, MD, Rishi Sharma, Yucai Wang, MD, Jason D. Theis, Correspondence Ellen D. McPhail, MD, John J. Poterucha, MD, Zhiyv Niu, PhD, and Christopher J. Klein, MD Dr. Klein [email protected] Neurol Genet 2019;5:e351. doi:10.1212/NXG.0000000000000351

Familial transthyretin (TTR) amyloidosis (FTA) is a serious autosomal dominant neuropathy caused by TTR germline mutations that lead to death on average 10 years from symptom onset. The mutant tetramer protein is produced predominantly in the liver, and liver transplantation is commonly performed to reduce the production of the mutant protein.1 The otherwise well- working explanted TTR liver can be transplanted into recipients who require liver transplantation but are unable to receive a liver in a timely fashion, the so-called domino liver transplant (DLTX). Recently, oligonucleotide drugs that reduce circulating TTR have been approved by the Food and Drug Administration (FDA), and these drugs use either antisense (inotersen) or RNA interference (patisiran), whereas earlier tetramer-stabilizing drugs (tafa- midis and diﬂunisal) were less eﬃcacious.2 Herein, we describe a domino liver recipient who died of respiratory failure from transplanted p.Val71Ala amyloidosis.

Case report A 70-year-old man with nonalcoholic steatohepatitis cirrhosis underwent DLTX from a 40- year-old man with TTR p.Val71Ala amyloidosis and neuropathy. The recipient was otherwise healthy and had no personal or family history of neuropathy (10 brothers and sisters). He initially did well, but 3 years after transplant developed pain in the feet with symmetric sensory loss and ankle weakness. He was treated with IV immunoglobulin and pulse steroids, but progressed with weight loss (40 Ibs), orthostasis, and postprandial diarrhea. His liver continued to function well on tacrolimus and oral prednisone.

He was referred 2 years from neuropathy onset unsafe to walk, having proximal and distal extremity weakness (Medical Research Council strength: 1/5 bilaterally below knees and elbows; 2/5 bilaterally at the thighs and shoulders). He was hyporeflexic and had dense sensory loss for heat pain and proprioception extending to the shins. Nerve conductions were abnormal, compound muscle action potential (peroneal 0.2, normal > 2.0 mV; tibial 0.3, normal > 4.0 mV; ulnar 3.2 mV, normal > 6.0 mV) and sensory nerve action potential (sural 0.0, normal > 0.0 uV; median 0.0, normal > 15 uV; ulnar 2.0, normal uV > 10.0 uv) without demyelination. Needle EMG showed neurogenic potentials with fibrillations extending to the arms and thighs, all consistent with a severe axonal sensorimotor polyneuropathy. Autonomic testing showed patchy postganglionic sudomotor abnormality by quantitative sudomotor autonomic reflex testing and moderate adrenergic and severe cardiovagal impairment by tilt table evaluation with Valsalva maneuver. Echocardiogram was normal 13 months before death, but 99mTc-hydroxyethylene diphosphonate single-photon emission computed tomography and needle EMG or nerve conductions of the diaphragm were not performed. Urine analysis revealed proteinuria 454 mg (normal <167 mg/24 hours), with creatinine clearance

From the Department of Neurosurgery (R.C.P., R.J.S.); Department of Neurology (H.B., R.S., C.J.K.), Mayo Clinic, Rochester, MN; Department of Neurology (H.B.), China Friendship Hospital, Beijing; Hematology and Oncology (Y.W.); Laboratory Medicine and Pathology (J.D.T., E.D.M.); Gastroenterology and Hepatology (J.P.P.); Laboratory Genetics and Genomics (Z.N., C.J.K.), Mayo Clinic, Rochester, MN.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

The Article Processing Charge was funded by the Mayo Clinic.

Ethical statement: We confirm that we have read the Journal’s position on issues involved in ethical publication and affirm that this report is consistent with those guidelines. Approval for this study was obtained by the Institutional Review Board at the Mayo Clinic, and the patient provided written consent to participate. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 68 mL/min (normal 77–130 mL/min/body surface area). Transplant Registry identifies 11 TTR p.Val71Ala persons having Multiple tests were unremarkable: serum immunofixation, CSF undergone liver transplant.1 One p.Val71Ala DLTX recipient PCR (cytomegalovirus, Epstein-Barr virus, and burgdorferi), aged 59 years developed neuropathy and cardiomyopathy 5 years serum thryoid stimulating hormone, B12, folate, copper, after transplant but was still alive 9 years later.4 Our patient was C-reactive protein, MRI of the spine, CT of the chest-abdomen- considerably older (70 years) at the time of transplant, and older pelvis, and bone marrow flow cytometry for lymphoma. age has been identified as an important accelerator of domino recipient amyloid neuropathy.5 The limited inflammation in our Sural nerve and bone marrow biopsies showed infiltration by case seems coincidental occurring in up to one-third or amyloid fl 6 amyloidwithoccasionalinammatory cells seen in the nerve sural nerve biopsies. The problems experienced by domino fi ( gure). TTR DNA sequencing from his blood was negative for recipients related to mutant TTR are increasingly recognized. – mutation. Liquid chromatography tandem mass spectrometry Prospective investigations of neuropathy within domino recipi- fi (LC-MS/MS) performed on the amyloid in ltration from the ents have identified common (one-fourth affected) pathologic fi bone marrow and nerve specimens con rmed TTR p.Val71Ala nerve amyloid infiltration with symptomatic neuropathy.7 Al- fi amyloidosis in both specimens ( gure). Repeat liver transplant though patients were reported to have symptoms mimic FTA, was considered, but he was not a candidate based on the severity our patient seems to have worse severity. of neuropathy and his age. He was unable to tolerate diflunisal due to gastrointestinal upset. He died 5 years and 1 month from Neurologic improvements in FTA can occur not only in the time of transplantation with respiratory failure. those receiving early-onset liver transplantation1 but also those treated early with the new FDA-approved drugs.2 A theoretical advantage of the new oligonucleotide therapies is Discussion that they reduce both wild-type and mutant TTR, both Amyloid transthyretin p.Val71Ala amyloidosis has been as- linked to disease progression. However, before consider- sociated with young onset of disease (in the 30s and 40s), as ation of these drugs in DLTX-affected patients, mutant TTR occurred in the living donor of our patient.3 Recent 20-year will likely need to be confirmed by LC MS/MS, as diagnosis review of the familial amyloid polyneuropathy World of mutant TTR by blood DNA will not be possible.

Figure Nerve biopsy and proteomic analysis of ATTR p.Val71Ala domino liver amyloidosis

(A) Congo red–stained characteristic microvessel in nerve (B) confirmed to be amyloid under fluorescent birefringence. (C) Epineurial microvessel with small inflammatory cell collections of unclear significance. (D) Semithin epoxy sections with acellular lardaceous accumulations characteristic of amyloid deposition and marked nerve fiber reductions. (E) ATTR p.Val71Ala was identified proteomically in both nerve and bone marrow (bone marrow data shown). Congo red–positive amyloid was microdissected and analyzed using liquid chromatography–tandem mass spectrometry (LC-MS/MS) (chymotrypsin modification). The protein identification report shows the type-specific markers (ATTR and ATTR with Val71Ala mutation, highlighted with blue/gold stars) and the universal amyloid markers (highlighted with blue stars). The total number of MS/MS spectra matched to the listed protein is represented by the numbers displayedin green boxes. Two independent microdissections with subsequent LC MS/MS analysis are shown. The arrows indicate acellular homogenous collections typical of amyloid. ATTR = amyloid transthyretin.

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG Study funding This work was supported by the Mayo Clinic Foundation and Appendix (continued) the Department of Laboratory Medicine and Pathology, Name Location Role Contribution Rochester, MN. Ellen D. Mayo Author Interpreted the data and McPhail, MD Clinic, revised the manuscript for Disclosure Rochester, intellectual content Disclosures available: Neurology.org/NG. MN John J. Mayo Author Interpreted the data and Publication history Poterucha, Clinic, revised the manuscript for ﬁ MD Rochester, intellectual content Received by Neurology: Genetics April 26, 2019. Accepted in nal form MN July 1, 2019. Zhiyv Neal, Mayo Author Interpreted the data and PhD Clinic, revised the manuscript for Rochester, intellectual content MN Appendix Authors Christopher Mayo Author Designed and conceptualized Name Location Role Contribution J. Klein, MD Clinic, the study; analyzed the data; Rochester, and revised the manuscript Ross Puffer, Mayo Author Designed and conceptualized MN for intellectual content MD Clinic, the study; analyzed the data; Rochester, and drafted the manuscript for MN intellectual content

Robert J. Mayo Author Interpreted the data and References Spinner, MD Clinic, revised the manuscript for 1. Ericzon BG, Wilczek HE, Larsson M, et al. Liver transplantation for hereditary transthyretin Rochester, intellectual content amyloidosis: after 20 Years still the best therapeutic alternative? Transplantation 2015;99: MN 1847–1854. 2. Buxbaum JN. Oligonucleotide drugs for transthyretin amyloidosis. N Engl J Med Sharma Mayo Author Interpreted the data and 2018;379:82–85. Rishi Clinic, revised the manuscript for 3. Benson MD II, Turpin JC, Lucotte G, Zeldenrust S, LeChevalier B, Benson MD. A Rochester, intellectual content transthyretin variant (alanine 71) associated with familial amyloidotic polyneuropathy MN in a French family. J Med Genet 1993;30:120–122. 4. van den Berg MP, Slart RH, Blokzijl H, Hazenberg BP. Transthyretin-derived Yucai Wang, Mayo Author Interpreted the data and (ATTR) amyloidotic cardiomyopathy after receiving a domino liver allograft. Cir- MD Clinic, revised the manuscript for culation 2015;132:e216–e217. Rochester, intellectual content 5. Misumi Y, Narita Y, Oshima T, et al. Recipient aging accelerates acquired transthyretin MN amyloidosis after domino liver transplantation. Liver Transpl 2016;22:656–664. 6. Rajani B, Rajani V, Prayson RA. Peripheral nerve amyloidosis in sural nerve Jason D. Mayo Author Interpreted the data; revised biopsies: a clinicopathologic analysis of 13 cases. Arch Pathol Lab Med 2000; Theis Clinic, the manuscript for intellectual 124:114–118. Rochester, content 7. Adams D, Lacroix C, Antonini T, et al. Symptomatic and proven de novo amyloid MN polyneuropathy in familial amyloid polyneuropathy domino liver recipients. Amyloid 2011;18:174–177.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 CLINICAL/SCIENTIFIC NOTES OPEN ACCESS AnovelPUS7 mutation causes intellectual disability with autistic and aggressive behaviors

Hossein Darvish, PhD, Luis J. Azcona, BA, Elham Alehabib, MSc, Faezeh Jamali, MSc, Abbas Tafakhori, MD, Correspondence ´ Sakineh Ranji-Burachaloo, MD, Joanna C. Jen, MD, PhD, and Coro Pais´an-Ruiz, PhD Dr. Paisan-Ruiz [email protected] Neurol Genet 2019;5:e356. doi:10.1212/NXG.0000000000000356

Recently, homozygous PUS7 mutations causing premature stop and truncation of the gene product were identified in 3 independent consanguineous families presenting with intellectual disability (ID), speech delay, short stature, microcephaly, and aggressive behavior.1 PUS7 encodes for a pseudouridine synthase 7 that catalyzes the isomerization of RNA uridine to RNA pseudouridine (Psi), which is the most abundant modified nucleotide found in all cellular RNAs and which may function as an RNA chaperone. The encoded protein contains a pseudouridine synthase domain of the TruD family that modifies uracil-13 in tRNA. Two homozygous mutations c.89_90del (p.Thr30Lysfs20*) and c.1348C>T (p.Arg450*) resulted in nonsense- mediated mRNA decay, meaning that mRNA transcripts containing the premature stop codons were eliminated through surveillance mechanisms, while the third mutation, consisting of a homozygous deletion encompassing the penultimate exon 15, escaped the nonsense- mediated mRNA decay to encode a mutant protein missing the C terminus including the TruD catalytic domain. All identified PUS7 variants resulted in aberrant pseudouridylation of at least 10 cytosolic tRNAs at position 13.1

Clinical and scientific findings We report a novel PUS7 homozygous mutation resulting in p.Gly128Arg amino-acid translation in a consanguineous Afghani family presenting with similar but milder clinical features without microcephaly and short stature (table e-1, links.lww.com/NXG/A180), further confirming the pathogenic role of PUS7 in ID syndromes with autistic features, speech delays, and aggressive behaviors.

The entire nuclear family of 2 healthy parents and 2 affected siblings (figure) was subjected to homozygosity mapping (HM) using high-throughput single nucleotide polymorphism genotyping (HumanOmniExpress Exome arrays v1.3; Illumina Inc., San Diego, CA) as previously described.2,3 The generated single nucleotide polymorphism data were used to determine regions of homozygosity present exclusively in the affected siblings but not their healthy parents. A total of 10 different homozygous tracks were identified (table e-2, links.lww.com/NXG/A180). We then proceeded to perform whole genome sequencing (WGS) analyses in both affected siblings. WGS was carried out at the New York Genome Center and the data were analyzed as previously described.2,4 Based on parental consanguinity and recessive inheritance (figure), novel and rare genomic variations, including nonsynonymous, frame-shift, splice site, small insertions and deletions, as well as gain/loss of stop codons, present in homozygosity or compound heterozygosity were considered as potential candidates. All genetic variations present in the regions of homozygosity were prioritized. Ten out of 303 genomic variations found to be present in

From the Cancer Research Center (H.D.), Semnan University of Medical Sciences; Department of Medical Genetics (H.D., E.A., F.J.), School of Medicine, Semnan University of Medical Sciences, Iran; Department of Neurosciences (L.J.A.) and Department of Neurology (L.J.A., J.C.J., C.P.-R.), Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York; Iranian Center of Neurological Research (A.T.), Neuroscience Institute, Tehran University of Medical Sciences, Iran; Department of Otolaryngology (J.C.J.), Department of Neurosurgery (J.C.J.), Department of Psychiatry (C.P.-R.), Department of Genetics and Genomic Sciences (C.P.-R.), Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place; Mindich Child Health and Development Institute (C.P.-R.), Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place; and Friedman Brain Institute (C.P.-R.), Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

The Article Processing Charge was funded by NINDS.

Ethical approval: The local ethics committee at the Semnan University of Medical Sciences approved this study, and informed consent according to the Declaration of Helsinki was obtained from all participants. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Figure Identification of a PUS7 homozygous mutation in a family with intellectual disability (ID), autistic features, and aggressive behaviors

(A) Genomic variants identified in the genomes of 2 siblings with ID, autistic features, and aggressive behaviors. Disease-causing mutation is highlighted in bold. CADD = combined annotation dependent depletion (cadd.gs.washington.edu/); GNOMAD = genome aggregation database (gnomad.broadinstitute. org/); and NA = not applicable. Recessive mutations in COL1A2 cause Ehlers-Danlos syndrome. (B) Pedigree structure of the examined ID family. Wt/m indicates heterozygous carrier for the PUS7 p.Gly128Arg mutation while m/m indicates homozygous carrier. Affected siblings are represented with a black square (male) and a black circle (female). *Indicates participants that underwent whole genome sequencing analyses. (C) Sanger chromatogram sequences of the PUS7 exon 1 containing the c.382G>A mutation are shown on the left, while G128 amino-acid conservation among other species is shown on the right. (D) PUS7 protein structure. R3H domain that is predicted to bind single-stranded DNA; PseudoU_synth_ScPUS7 is a pseudouridine synthase domain of the TruD family (PMID:12756329). The PUS7 mutation identified in this study is represented at the top while previously reported PUS7 mutations are represented at the bottom.

both affected siblings were homozygous; however, only 3 were pathogenic PUS7 mutations1 strengthened the likelihood of located within the previously determined homozygous tracks c.382G>A (p.Gly128Arg) as the disease-causing mutation. (figure, table e-2). These 3 novel genetic variations were lo- The pathogenicity of this novel PUS7 mutation is further cated within the COL1A2, COL26A1, and PUS7 genes, and supported by its segregation with disease status (figure A–C), none of them were present in public databases, including the its location within a region of homozygosity identified Iranome browser (iranome.com/), the Greater Middle-East through the performed HM analyses (table e-2, links.lww. variome (igm.ucsd.edu/gme/), and the Genome Aggregation com/NXG/A180), and the alteration of an evolutionarily database (gnomAD; gnomad.broadinstitute.org/), and dis- conserved glycine down to yeast (figure, C). The PUS7 ease databases such as ClinVar (ncbi.nlm.nih.gov/clinvar/) p.Gly128Arg mutation lies within the Pseudouridine synthase and the Human Gene Mutation Database (hgmd.org). TruD domain (figure, D) such that this amino acid alteration may disrupt pseudouridylation, similar to the recently de- Mutations in COL1A2 encoding collagen of skin, tendon, and scribed truncation mutations. bone are associated with diseases of the connective tissues distinct from the manifestations of our family and not ob- We present genetic and clinical evidence of another family served in the patients.5 No human disease has been associated identified with ID, speech delay, motor impairments, and with mutations in COL26A1, which encodes a protein with aggressive behavior due to pathogenic PUS7 mutations. The collagen-like characteristics expressed in mouse mesenchyme absence of highly extreme phenotypes such as short stature of the head, skeletal muscles, and kidney (Mendelian In- or microcephaly in this family might reflect genotype– heritance in Man [MIM] #608927). Given the association of phenotype correlation, since this family presented with PUS1 (MIM #600462) and PUS3 (MIM #616283) genes with a PUS7 missense mutation that may be hypomorphic, while ID syndromes with speech and motor impairments,6,7 we previously reported families carried nonsense or frameshift favored the nucleotide variant in the PUS7 gene as a causative. mutations that may cause loss of function. This is the first The recent identification of 3 different ID families with report of a PUS7 missense mutation that confirms PUS7 as

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG a pathogenic gene for ID syndromes with speech impair- References ments and aggressive behaviors. 1. de Brouwer APM, Abou Jamra R, Kortel N, et al. Variants in PUS7 cause intellectual disability with speech delay, microcephaly, short stature, and aggressive behavior. Am J Hum Genet 2018;103:1045–1052. Acknowledgment 2. Khodadadi H, Azcona LJ, Aghamollaii V, et al. PTRHD1 (C2orf79) mutations lead to The authors thank the patients and their relatives for their autosomal-recessive intellectual disability and parkinsonism. Mov Disord 2017;32: 287–291. cooperation in this study. 3. Krebs CE, Karkheiran S, Powell JC, et al. The Sac1 domain of SYNJ1 identified mutated in a family with early-onset progressive Parkinsonism with generalized Study funding seizures. Hum Mutat 2013;34:1200–1207. This work was supported by the Semnan University of 4. Taghavi S, Chaouni R, Tafakhori A, et al. A clinical and molecular genetic study of 50 families with autosomal recessive parkinsonism revealed known and novel gene Medical Sciences and the NINDS of the NIH mutations. Mol Neurobiol 2018;55:3477–3489. (R01NS079388; C. Paisán-Ruiz). 5. Schwarze U, Hata R, McKusick VA, et al. Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway. Am J Hum Genet 2004;74: Disclosure 917–930. Disclosures available: Neurology.org/NG. 6. Bykhovskaya Y, Casas K, Mengesha E, Inbal A, Fischel-Ghodsian N. Missense mutation in pseudouridine synthase 1 (PUS1) causes mitochondrial myopathy and Publication history sideroblastic anemia (MLASA). Am J Hum Genet 2004;74:1303–1308. 7. Shaheen R, Han L, Faqeih E, et al. A homozygous truncating mutation in PUS3 Received by Neurology: Genetics March 3, 2019. Accepted in final form expands the role of tRNA modification in normal cognition. Hum Genet 2016;135: June 24, 2019. 707–713.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 CLINICAL/SCIENTIFIC NOTES OPEN ACCESS Enhancement of cranial nerves, conus medullaris, and nerve roots in POLG mitochondrial disease

Michael Bayat, MD, Yousef Yavarian, MD, Allan Bayat, MD, and Jakob Christensen, MD, PhD Correspondence Dr. Bayat Neurol Genet 2019;5:e360. doi:10.1212/NXG.0000000000000360 [email protected]

A 20-year-old female patient was admitted to our department due to ptosis, double vision, and diﬃculty walking. The symptoms had evolved during the course of 2 months. She had never been very athletic and was described as always having been a “slow runner,” but otherwise her previous history was unremarkable. There was no family history of neurologic disease. There were no preceding triggering factors such as infections, fever, or physical stress, and the patient did not take valproate. On examination, she had bilateral external ophthalmoplegia and ptosis, grade 4 proximal and distal paresis in the lower extremities, grade 4 distal paresis in the upper extremities, distal sensory loss (for all sensory modalities), and sensory ataxia. After several months, she started experiencing a very slow improvement, which is—at the present moment—still incomplete.

MRI showed enhancement of the oculomotor nerves, the conus medullaris, the adjacent leptomeninges, and the cauda equina nerves. In the course of 1½ years, 5 MRI scans of the brain and medulla were performed, and the ﬁndings were stationary and independent of the acute decline. The radiologic ﬁndings were present before a lumbar puncture was performed.

Electroneuronography showed signs of an axonal neuropathy mainly aﬀecting the lower extremities. CSF examination revealed a mild pleocytosis (7 cells) [reference <5 cells/ mm3], elevated protein (22 mg/dL) [reference 20–50 mg/dL), and elevated lactate (3.3 mmol/L) [reference 1.2–2.1 mmol/L). Several repeat CSF examinations were performed and showed the same abnormalities. CSF was negative for viruses and bacteria including Borrelia burgdorferi, syphilis, and tuberculosis. CSF cytology and ﬂow cytometry were performed on 3 consecutive samples and revealed no tumor cells. Blood samples showed normal thyroid and liver functions tests and were negative for HIV serology, hepatitis B and C serology, tuberculosis (QuantiFERON test), syphilis, monoclonal protein, antinuclear antibody, antineutrophil cytoplasmic antibodies, antiphospholipid antibodies, angiotensin-converting enzyme, paraneoplastic antibodies, aquaporin-4 antibodies, contactin-1 and neurofascin-155 antibodies, ganglioside antibodies (incl.GQ1B), and acetylcholine receptor antibodies. Serum lactate was not measured. PET CT showed no abnormalities.

The clinical phenotype was compatible with sensory ataxic neuropathy, dysarthria, and oph- thalmoparesis. Genetic testing revealed that she was compound heterozygous for 2 pathogenic polymerase gamma 1 (POLG) variants (c.2243G>C and c.2391G>T) located on chromosome 15. Parental DNA testing showed that the POLG variants were in trans position and therefore responsible for the clinical phenotype. The POLG gene is essential for the function of the only DNA polymerase that is active in mitochondria and can replicate in mitochondrial DNA (ﬁgures 1 and 2).

From the Department of Neurology (M.B., J.C.), Aarhus University Hospital; Centre for Rare Diseases (M.B.), Department of Pediatrics, Aarhus University Hospital; Department of Radiology (Y.Y.), Aalborg University Hospital; and Danish Epilepsy Centre (A.B.), Dianalund, Denmark.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

The Article Processing Charge was funded by Novo Nordisk Foundation NNF16OC0019126. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Figure 1 Contrast-enhanced T1-weighted axial and coronal fat-saturated images showing bilateral smooth enhancement of the oculomotor nerves (arrows)

There has been only 1 previous report of abnormal nerve POLG-related epilepsy showed that stroke-like lesions were enhancement in mitochondrial disease. That report in- the most prevalent abnormalities (43%), followed by thalamic volved an infant patient with POLG variants whose MRI (37%), cerebellar (17%), basal ganglia (14%), and cerebral showed oculomotor nerve and cervical root enhancement.1 white matter (7%) lesions. Generalized atrophy was also The pattern of enhancement in our patient (involving the prevalent (28%). No such lesions were found in our patient.2 cranial nerves, conus medullaris, and cauda equine nerve roots) is rare and usually not associated with mitochondrial The diﬀerential diagnoses for nerve root and conus disease. We believe that the patient has been thoroughly medullaris enhancement are very broad and include in- investigated and has been followed clinically for more than fectious, autoimmune, and neoplastic disorders.3 Mito- 1 year without emergence of symptoms compatible with chondrial disease is a very rare cause of nerve enhancement. a systemic condition such as an autoimmune or neoplastic The reason for the enhancement is not known, and it is disorder. Therefore, it is considered likely that the MRI unclear whether it is a distinguishing property of POLG ﬁndings are caused by the mitochondrial disorder, although variants or whether the enhancement is to be found in other a peripheral nerve or nerve root biopsy was not performed. mitochondrial variants as well. Routine use of contrast in the radiologic evaluation of patients with neurologic POLG-related disorder can be associated with MRI changes manifestations of mitochondrial disease could help eluci- of the brain parenchyma. A review of 136 patients with date this.

Figure 2 Contrast-enhanced sagittal T1-weighted and axial fat-saturated images showing enhancement of the conus medullaris (A) and cauda equina nerve roots (B) (arrows)

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG With this case, we wish to highlight that POLG-associated mitochondrial disorder should be included as a diﬀerential Appendix Authors diagnosis in patients with enhancement of the cranial nerves, Name Location Role Contribution nerve roots, and the conus medullaris. Michael Aarhus Author Designed and Bayat, MD University conceptualized the study Study funding Hospital and drafted the manuscript

J. Christensen and M. Bayat were supported by the Danish Yousef Aalborg Author Data collection and analysis Epilepsy Association, Central Denmark Region, and Novo Yavarian, University (radiology) Nordisk Foundation (grant NNF16OC0019126). MD Hospital Allan Bayat, Danish Author Drafting and revision of the MD Epilepsy manuscript Disclosure Centre, J. Christensen reported receiving honoraria from serving Dianalund on the scientific advisory boards of and giving lectures Jakob Aarhus Author Drafting and revision for for UCB Nordic and Eisai AB and receiving travel Christensen, University intellectual content MD Hospital funding from UCB Nordic. The other authors have no conflicts of interest. Go to Neurology.org/NG for full References disclosures. 1. Horst DM, Ruess L, Rusin JA, Bartholomew DW. Cranial nerve and cervical root enhancement in an infant with polymerase gamma mutation mitochondrial disease. Pediatr Neurol 2014;51:734–736. Publication history 2. Anagnostou ME, Ng YS, Taylor RW, McFarland R. Epilepsy due to mutations in the Received by Neurology: Genetics April 12, 2019. Accepted in final form mitochondrial polymerase gamma (POLG) gene:a clinical and molecular genetic review. Epilepsia 2016;57:1531–1545. July 10, 2019. 3. Georgy BA, Snow RD, Hesselink JR. MR imaging of spinal nerve roots: techniques, enhancement patterns, and imaging findings. AJR Am J Roentgenol 1996;166:173–179.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 CLINICAL/SCIENTIFIC NOTES OPEN ACCESS Digital necrosis in an infant with severe spinal muscular atrophy

Diana Carrasco, MD, Pilar Magoulas, MS, CGC, Jennifer C. Scull, PhD, Jill A. Jarrell, MD, MPH, Correspondence Seema R. Lalani, MD, and Michael F. Wangler, MD Dr. Wangler [email protected] Neurol Genet 2019;5:e361. doi:10.1212/NXG.0000000000000361

Spinal muscular atrophy (SMA) is the leading genetic cause of death for infants.1,2 Digital necrosis is an ultra-rare manifestation of this disease, and its etiology has yet to be elucidated.4,5 We present a child who was referred to genetics for extensive digital necrosis after cardiac surgery. The infant was ultimately diagnosed with SMA by single gene testing that revealed a homozygous deletion of exons 7 and 8 on the SMN1 gene. SMA is a motor neuron disorder typically presenting with neurologic symptoms but should be considered in any infant with digital necrosis.

Case report The child was born uneventfully to a family with an unremarkable medical history. At age 1 month, he presented with failure to thrive. Workup revealed a large atrial septal defect and multiple ventricular septal defects. Pulmonary artery banding was performed at age 2 months. Postoperatively, he required intubation for 3 weeks. He also developed severe necrosis of all 10 toes (ﬁgure, A). A hypercoagulation panel was normal. A Doppler ultrasound revealed a left femoral clot, which was successfully treated with anticoagulation, aspirin, and nitroglycerin. However, the necroses progressed, and no cause was initially identiﬁed. Allowing autoamputation of the toes was recommended. He was discharged home at age 4 months on gastrostomy tube feeds. By then, developmental delay was noted, although he was able to roll from his stomach to his back and bring his hands to his mouth. At home, he started having respiratory problems, with oxygen saturations in the mid 80s. He intermittently developed diaphoresis and tachypnea.

He was readmitted 1.5 weeks later. His mother had additionally noticed a violaceous dis- coloration of his fingernails (figure, B). Despite heparin, aspirin, methylprednisolone (in case of vasculitis), and a supraclavicular nerve block with the intent of reversing any vasoconstriction, this progressed to severe necrosis. CT angiography and an echocardiogram did not reveal an embolic source. At that time, the child was also found to have clinically recognizable hypotonia, decreased right palmar grasp strength, and a tremulous tongue. On the day of readmission, he went into respiratory failure requiring intubation. A workup for rheumatologic conditions returned negative including an antiphospholipid panel, antinuclear antibodies, cryoglobulin levels, anti-neutrophil cytoplasmic antibodies for myeloperoxidase, anti-neutrophil cytoplasmic antibodies for proteinase 3, adenosine deaminase 2 deficiency, and a cytokine panel. A brain MRI returned normal. Trio whole- exome sequencing was sent, and results were nondiagnostic. An electromyogram demonstrated evidence of possible anterior horn cell dysfunction as can be seen in SMA. SMN1 genetic testing was sent, and PCR amplification showed a homozygous deletion of exons 7 and 8, diagnostic of SMA. In addition, the SMN2 copy number was tested revealing that the patient had only 1 copy of SMN2. The pediatric palliative care team helped elucidate the family’s goals for the patient, facilitated a comfort care plan, which included a compas- sionate extubation, and continued to provide bereavement support for the family.

From the Department of Molecular and Human Genetics (D.C., P.M., J.C.S., S.R.L., M.F.W.), Baylor College of Medicine, Houston, TX; Texas Children’s Hospital (P.M., S.R.L., M.F.W.), Houston, TX; Baylor Genetics (J.C.S.), Houston, TX; Section of Palliative Medicine (J.A.J.), Department of Pediatrics, Baylor College of Medicine, Houston TX; and Jan and Dan Duncan Neurological Research Institute (M.F.W.), Texas Children’s Hospital, Houston, TX.

Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

(A) Left foot. (B) Right hand.

Discussion Study funding No targeted funding reported. SMA is a result of biallelic intragenic deletions or pathogenic variants in the SMN1 gene located on chromosome 5q13, Disclosure which cause loss of function of the survival of motor neuron Disclosures available: Neurology.org/NG. protein (SMN). SMN is ubiquitously expressed, and although SMA is characterized by loss of motor neurons in the ventral Publication history horn of the spinal cord, multiple organs, including cardiac, Received by Neurology: Genetics April 30, 2019. Accepted in ﬁnal form 2,3 skeletal, and gastrointestinal, are negatively aﬀected as well. August 12, 2019. The severity and age at onset span a continuum. Digital necrosis is rare in SMA and has been reported in only 4 other cases, all infants with a severe form of the disease.4,5 Of interest, mouse models for severe SMA given life-prolonging Appendix Authors treatments have developed tail and ear necrosis.6 The SMN2 gene is nearly identical to the SMN1 gene except for a single Name Location Role Contribution

nucleotide change, which causes skipping of its exon 7, Diana Department of Molecular and Author Drafting and resulting in only 10% of its protein product being functional. Carrasco, Human Genetics, Baylor revision MD College of Medicine, Houston, The copy number of SMN2 varies in the population and TX inversely correlates with disease severity. In our case, the Pilar Department of Molecular and Author Drafting and patient was found to have only 1 copy of SMN2. The antisense Magoulas, Human Genetics, Baylor revision oligonucleotide nusinersen was approved for treatment of MS, CGC College of Medicine; Texas Children’s Hospital, Houston, certain cases of SMA. Nusinersen increases the percentage of TX SMN2’s functional protein product by including transcription of its exon 7.7 This along with other interventions is expected Jennifer C. Department of Molecular and Author Revision and Scull Human Genetics, Baylor molecular to improve life expectancy. Our patient presented before the College of Medicine, Houston, diagnostics approval of this medication, and it is not known whether TX a manifestation such as a digital necrosis would respond to Jill Ann Texas Children’s Hospital, Author Drafting and this new therapy. Further delineation of the phenotype of Jarrell, Houston, TX revision MD, MPH SMA will aid in uncovering etiologies of the disease’s manifestations and directed therapies. This report describes the Seema Department of Molecular and Author Drafting and ﬁ Lalani, MD Human Genetics, Baylor revision fth case of an infant with severe SMA who developed distal College of Medicine, Houston, digital necrosis. An examination of SMN2 copy number in TX

more of these cases with this unusual and dramatic compli- Michael F. Department of Molecular and Author Drafting and cation would be useful. Our case highlights the need to con- Wangler, Human Genetics, Baylor revision ﬀ MD College of Medicine, Houston, sider SMA in the di erential diagnosis for infantile digital TX necrosis.

2 Neurology: Genetics | Volume 5, Number 5 | October 2019 Neurology.org/NG References 4. Araujo AQ, Araujo M, Swoboda KJ. Vascular perfusion abnormalities in infants with spinal muscular atrophy. J Pediatr 2009;155:292–294. 1. Sugarman EA, Nagan N, Zhu H, et al. Pan-ethnic carrier screening and prenatal 5. Rudnik-Schoneborn S, Vogelgesang S, Armbrust S, Graul-Neumann L, Fusch C, diagnosis for spinal muscular atrophy: clinical laboratory analysis of >72,400 speci- Zerres K. Digital necroses and vascular thrombosis in severe spinal muscular atrophy. mens. Eur J Hum Genet 2012:27–32. Muscle Nerve 2010;42:144–147. 2. Shababi M, Lorson CL, Rudnik-Schoneborn SS. Spinal muscular atrophy: a motor 6. Narver HL, Kong L, Burnett BG, et al. Sustained improvement of spinal muscular neuron disorder or a multi-organ disease? J Anat 2014;224:15–28. atrophy mice treated with trichostatin A plus nutrition. Ann Neurol 2008;64: 3. Sintusek P, Catapano F, Angkathunkayul N, et al. Histopathological defects in in- 465–470. testine in severe spinal muscular atrophy mice are improved by systemic antisense 7. Wurster CD, Ludolph AC. Nusinersen for spinal muscular atrophy. Ther Adv Neurol oligonucleotide treatment. PLoS One 2016;11:e0155032. Disord 2018;11:1756285618754459.

Neurology.org/NG Neurology: Genetics | Volume 5, Number 5 | October 2019 3 CORRECTION Genomic deletions upstream of lamin B1 lead to atypical autosomal dominant leukodystrophy Neurol Genet 2019;5:e362. doi:10.1212/NXG.0000000000000362

In the article “Genomic deletions upstream of lamin B1 lead to atypical autosomal dominant leukodystrophy” by Nmezi et al.,1 ﬁrst published January 24, 2019, the funding statement for Bruce Nmezi and Quasar S. Padiath should have included NIH (R01NS095884). The authors regret the error.

Reference 1. Nmezi B, Giorgio E, Raininko R, et al. Genomic deletions upstream of lamin B1 lead to atypical autosomal dominant leukodystrophy. Neurol Genet 2019;5:e305. doi: 10.1212/NXG.0000000000000305.