DOCSLIB.ORG

Nicotinamide Mononucleotide Adenylyltransferase 2 (Nmnat2) Regulates Axon Integrity in the Mouse Embryo

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Nicotinamide Mononucleotide Adenylyltransferase 2 (Nmnat2) Regulates Axon Integrity in the Mouse Embryo Nicotinamide Mononucleotide Adenylyltransferase 2 (Nmnat2) Regulates Axon Integrity in the Mouse Embryo Amy N. Hicks1*, Diego Lorenzetti1, Jonathan Gilley2, Baisong Lu1, Karl-Erik Andersson1, Carol Miligan3,4, Paul A. Overbeek5, Ronald Oppenheim3,4, Colin E. Bishop1 1 Wake Forest Institute for Regenerative Medicine, Wake Forest University, Winston Salem, North Carolina, United States of America, 2 Signalling Programme, The Babraham Institute, Cambridge, United Kingdom, 3 Department of Neurobiology and Anatomy and the Neuroscience Program, Wake Forest University, Winston Salem, North Carolina, United States of America, 4 The Amyotrophic Lateral Sclerosis Center, Wake Forest University, Winston Salem, North Carolina, United States of America, 5 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas, United States of America Abstract Using transposon-mediated gene-trap mutagenesis, we have generated a novel mouse mutant termed Blad (Bloated Bladder). Homozygous mutant mice die perinatally showing a greatly distended bladder, underdeveloped diaphragm and a reduction in total skeletal muscle mass. Wild type and heterozygote mice appear normal. Using PCR, we identified a transposon insertion site in the first intron of Nmnat2 (Nicotinamide mononucleotide adenyltransferase 2). Nmnat2 is expressed predominantly in the brain and nervous system and has been linked to the survival of axons. Expression of this gene is undetectable in Nmnat2blad/blad mutants. Examination of the brains of E18.5 Nmnat2blad/blad mutant embryos did not reveal any obvious morphological changes. In contrast, E18.5 Nmnat2blad/blad homozygotes showed an approximate 60% reduction of spinal motoneurons in the lumbar region and a more than 80% reduction in the sensory neurons of the dorsal root ganglion (DRG). In addition, facial motoneuron numbers were severely reduced, and there was virtually a complete absence of axons in the hind limb. Our observations suggest that during embryogenesis, Nmnat2 plays an important role in axonal growth or maintenance. It appears that in the absence of Nmnat2, major target organs and tissues (e.g., muscle) are not functionally innervated resulting in perinatal lethality. In addition, neither Nmnat1 nor 3 can compensate for the loss of Nmnat2. Whilst there have been recent suggestions that Nmnat2 may be an endogenous modulator of axon integrity, this work represents the first in vivo study demonstrating that Nmnat2 is involved in axon development or survival in a mammal. Citation: Hicks AN, Lorenzetti D, Gilley J, Lu B, Andersson K-E, et al. (2012) Nicotinamide Mononucleotide Adenylyltransferase 2 (Nmnat2) Regulates Axon Integrity in the Mouse Embryo. PLoS ONE 7(10): e47869. doi:10.1371/journal.pone.0047869 Editor: Stefan Strack, University of Iowa, United States of America Received March 27, 2012; Accepted September 24, 2012; Published October 17, 2012 Copyright: ß 2012 Hicks et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: We would like to cite support by National Institutes of Health (NIH) grant type U01 HD43421 to CEB and NS069212 to RO. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] Introduction cytosolic pool of NAD+ quickly in response to a stimulus like cell stress. Genes required for axonal development and neuronal survival Nmnat2 has been associated with axonal survival in primary may provide targets for the treatment of neurodegenerative sensory and sympathetic nerve cell injury models in vitro [7,8]. disorders and for the re-innervation of tissues after injury. They Historically, aberrant or exogenous overexpression of the Wlds may also be used to promote innervation of tissues and organs protein (a fusion protein containing Nmnat1)orNmnat1 itself, has created using tissue engineering techniques. Recently, the Nmnat been used to protect axons from Wallerian degeneration after genes (Nmnat1, 2, and 3) have been studied as potential targets injury [1,11], but more recent studies suggest that the endogenous based on their ability to delay Wallerian degeneration after axonal Nmnat isoform required for the normal maintenance of healthy nerve damage [1]. All the Nmnat family members can catalyze the + axons is Nmnat2 [8,12]. This isoform can also delay Wallerian synthesis of NAD both in the de novo pathway and in the recycling degeneration when highly overexpressed [7,8,13]. Studies on the pathway [2]. Nmnat1 is ubiquitously expressed and localizes to the dNmnat ortholog in Drosophila indicate that it has a protective nucleus. Nmnat3 shows a more restricted expression pattern and function analogous to the mouse Nmnat2 gene [14,15,16]. Recent localizes to mitochondria [3]. Nmnat2 is expressed predominantly studies show that decreased endogenous Nmnat2 expression and in neurons [3,4,5,6,7]. Its protein product has been shown to function may play a role in mouse models of Alzheimer’s disease localize to the trans-Golgi complex [3,4] where it is packaged and and tauopathy neurodegenerative diseases [7,17]. transported down axons to the synapse [8]. In addition to Using a unique mouse mutant we present in vivo data indicating differences in tissue expression and intracellular localization, there that during embryogenesis Nmnat2 plays an essential role in axonal is an isoform-specific domain on each of the Nmnat genes [9]. In growth and/or survival. In its absence, major organs and muscles Nmnat2 this region is palmitoylated at two cysteine residues and, + are not functionally innervated resulting in perinatal lethality, when cleaved, the NAD synthesis activity of the enzyme increases which is likely due to failure of respiratory function at birth. significantly [4,10]. This provides a mechanism to increase the PLOS ONE | www.plosone.org 1 October 2012 | Volume 7 | Issue 10 | e47869 Nmnat2 Affects Peripheral Nerve Development Materials and Methods erates a 350bp X-specific band in males and females and a 300bp Y-specific band in males only. Mouse Mutant Generation and Insertion Localization Mouse mutants were generated at Baylor College of Medicine Gene Expression (Houston, TX) as previously described [18]. Female transgenic Three fetuses of each genotype were obtained from timed mice containing a Sleeping Beauty transposon-based coat color gene pregnant mice at E18.5. The genotype and sex were determined trap construct pT2. BART3 [19] (Figure 1C) were crossed to using DNA extracted from the tail. The bladder, liver, kidney, transgenic mice carrying the SB11 transposase under the control lung, heart, and brain were isolated and stored in RNALaterH at of a 1.4-kb testis-specific human PGK2 promoter [20] After 220uC (Ambion cat# AM7021). The tissues were homogenized mobilization of the gene trap in the double transgenic male using sonication, and RNA was extracted using a QIAcube gametes and crossing to wild type FVB females, new coat color automated extraction procedure employing an RNeasyH mini plus variants were isolated and those showing novel phenotypes were kit (Qiagen cat# 74134). cDNA was synthesized using the Applied maintained as independent families. Once F1 coat color variants Biosystems High Capacity cDNA Reverse Transcription Kit (ABI were identified, the transposase was bred out of the family to cat# 4374966). TaqManH gene expression assays for Nmnat1, 2, prevent further transposon jumping. and 3 (ABI assay ID# Mm01257929_m1, Mm00615393_m1, and An asymmetric PCR amplification technique (APA) was to used Mm00513791_m1) were used to quantitate the levels of RNA in to identify mouse DNA flanking transposon integration sites as different tissues. The Primers PpidF1: previously described [19] using an APAgene kit (BioS&T Inc., TCGTCTTTGGACTCTTTGGAA and PpidR1: AGCGCT- Canada). Amplified bands were purified from agarose gels and CACCATAGATGCTC were designed across exon junctions of directly sequenced. Sequences were compared to that of the mouse the mouse peptidylprolyl isomerase B (Ppib) gene and were used as genome and PCR primers were designed to verify the presence of a loading/normalization control. We performed a statistical the Nmnat2 insertion site. The locations of these primers are analysis on the Pipb qPCR data to confirm that there was no pictured in Figure 1C and their sequences are as follows; (A) significant difference in expression across sample groups. The data Chr1F:CCATAAGAATAAATGCAGAATTAC , are presented as the mean difference in mRNA fold expression, 6 (B)Chr1R:TGTGCAGTTCAGTGGGTCTT , and standard deviation, relative to the wild-type brain sample. (C)SB25:CTGGAATTTTCCAAGCTGTTTAAAGGCACAGT- CAAC. Primers in the X-Y common Kdm5d (lysine (K)-specific Western Blot demethylase 5D) gene [21] were used to sex the embryos: SmcpF: Whole brains were isolated from E18.5 embryos, frozen in CCTGAAGCYTTTGGCTTTGAGCA and SmcpR: liquid nitrogen, and stored at 280uC. The tissue was homogenized AAMCCRCTGCCAAATTCTTTGGA. This primer pair gen- using a sonicator on ice with 10x volume to weight of a lysis buffer containing 50 mM Tris, 150 mM NaCl, 1% Tergitol-type NP-40, Figure 1. Identification of Nmnat2 mutants and transposon localization. Images of E18.5 embryos (A, B). In both images, the wild-type
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Palmitoylation Enables MAPK-Dependent Proteostasis of Axon Survival Factors
    Palmitoylation enables MAPK-dependent proteostasis of axon survival factors Daniel W. Summersa,b, Jeffrey Milbrandtb,c,1, and Aaron DiAntonioa,c,1 aDepartment of Developmental Biology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110; bDepartment of Genetics, Washington University in St. Louis School of Medicine, St. Louis, MO 63110; and cHope Center for Neurological Disorders, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 Edited by Yishi Jin, University of California, San Diego, La Jolla, CA, and accepted by Editorial Board Member Yuh Nung Jan July 31, 2018 (received for review April 22, 2018) Axon degeneration is a prominent event in many neurodegener- than NMNAT2 (15). Both NMNAT2 and SCG10 are short-lived ative disorders. Axon injury stimulates an intrinsic self-destruction proteins, and constant delivery to the axon is necessary for axon program that culminates in activation of the prodegeneration survival (15, 16). In addition, NMNAT2 and SCG10 are palmi- factor SARM1 and local dismantling of damaged axon segments. In toylated and associated with vesicles that are anterogradely healthy axons, SARM1 activity is restrained by constant delivery of transported through the axon (17–19). Surprisingly, membrane the axon survival factor NMNAT2. Elevating NMNAT2 is neuro- association promotes NMNAT2 degradation in HEK293t cells protective, while loss of NMNAT2 evokes SARM1-dependent axon (20), yet whether this occurs in axons is unknown. Inhibiting degeneration. As a gatekeeper of axon survival, NMNAT2 abundance pathways responsible for NMNAT2 degradation is neuro- is an important regulatory node in neuronal health, highlighting the protective, reinforcing the need to understand molecular mech- need to understand the mechanisms behind NMNAT2 protein ho- anisms of NMNAT2 protein homeostasis in the axon.
    [Show full text]
  • Nicotinamide Adenine Dinucleotide Is Transported Into Mammalian
    RESEARCH ARTICLE Nicotinamide adenine dinucleotide is transported into mammalian mitochondria Antonio Davila1,2†, Ling Liu3†, Karthikeyani Chellappa1, Philip Redpath4, Eiko Nakamaru-Ogiso5, Lauren M Paolella1, Zhigang Zhang6, Marie E Migaud4,7, Joshua D Rabinowitz3, Joseph A Baur1* 1Department of Physiology, Institute for Diabetes, Obesity, and Metabolism, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 2PARC, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 3Lewis-Sigler Institute for Integrative Genomics, Department of Chemistry, Princeton University, Princeton, United States; 4School of Pharmacy, Queen’s University Belfast, Belfast, United Kingdom; 5Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 6College of Veterinary Medicine, Northeast Agricultural University, Harbin, China; 7Mitchell Cancer Institute, University of South Alabama, Mobile, United States Abstract Mitochondrial NAD levels influence fuel selection, circadian rhythms, and cell survival under stress. It has alternately been argued that NAD in mammalian mitochondria arises from import of cytosolic nicotinamide (NAM), nicotinamide mononucleotide (NMN), or NAD itself. We provide evidence that murine and human mitochondria take up intact NAD. Isolated mitochondria preparations cannot make NAD from NAM, and while NAD is synthesized from NMN, it does not localize to the mitochondrial matrix or effectively support oxidative phosphorylation. Treating cells *For correspondence: with nicotinamide riboside that is isotopically labeled on the nicotinamide and ribose moieties [email protected] results in the appearance of doubly labeled NAD within mitochondria. Analogous experiments with †These authors contributed doubly labeled nicotinic acid riboside (labeling cytosolic NAD without labeling NMN) demonstrate equally to this work that NAD(H) is the imported species.
    [Show full text]
  • Sciencedirect.Com
    Available online at www.sciencedirect.com ScienceDirect Axon degeneration: context defines distinct pathways 1,2 1,2 Matthew J Geden and Mohanish Deshmukh Axon degeneration is an essential part of development, In the mammalian model, mechanistic details of axon plasticity, and injury response and has been primarily studied in degeneration has been predominantly studied in vitro in mammalian models in three contexts: 1) Axotomy-induced three contexts: 1) Axotomy (also known as Wallerian Wallerian degeneration, 2) Apoptosis-induced axon degeneration), where the severing of axons results in degeneration (axon apoptosis), and 3) Axon pruning. These the degeneration of axons distal to the cut site; 2) Apo- three contexts dictate engagement of distinct pathways for ptosis-induced Axon Degeneration, which we define here axon degeneration. Recent advances have identified the as ‘Axon Apoptosis’, where the entire neuron is exposed importance of SARM1, NMNATs, NAD+ depletion, and MAPK to apoptotic stimuli (e.g. global deprivation of trophic signaling in axotomy-induced Wallerian degeneration. factors) resulting in the degeneration of both axons and Interestingly, apoptosis-induced axon degeneration and axon soma; and 3) Pruning-induced Axon Degeneration, which pruning have many shared mechanisms both in signaling (e.g. we refer to here as ‘Axon Pruning’, where a subset of DLK, JNKs, GSK3a/b) and execution (e.g. Puma, Bax, axons are selectively exposed to a pruning stimuli (e.g. caspase-9, caspase-3). However, the specific mechanisms by axon-only or ‘local’ deprivation of trophic factors) which which caspases are activated during apoptosis versus pruning results in the selective degeneration of only the axons appear distinct, with apoptosis requiring Apaf-1 but not exposed to the stimulus.
    [Show full text]
  • Screening with an NMNAT2-MSD Platform Identifies Small Molecules
    www.nature.com/scientificreports OPEN Screening with an NMNAT2-MSD platform identifies small molecules that modulate NMNAT2 levels in Received: 30 September 2016 Accepted: 30 January 2017 cortical neurons Published: 07 March 2017 Yousuf O. Ali1,2,3,4, Gillian Bradley1,5 & Hui-Chen Lu1,2,3,4,5 Nicotinamide mononucleotide adenylyl transferase 2 (NMNAT2) is a key neuronal maintenance factor and provides potent neuroprotection in numerous preclinical models of neurological disorders. NMNAT2 is significantly reduced in Alzheimer’s, Huntington’s, Parkinson’s diseases. Here we developed a Meso Scale Discovery (MSD)-based screening platform to quantify endogenous NMNAT2 in cortical neurons. The high sensitivity and large dynamic range of this NMNAT2-MSD platform allowed us to screen the Sigma LOPAC library consisting of 1280 compounds. This library had a 2.89% hit rate, with 24 NMNAT2 positive and 13 negative modulators identified. Western analysis was conducted to validate and determine the dose-dependency of identified modulators. Caffeine, one identified NMNAT2 positive-modulator, when systemically administered restored NMNAT2 expression in rTg4510 tauopathy mice to normal levels. We confirmed in a cell culture model that four selected positive- modulators exerted NMNAT2-specific neuroprotection against vincristine-induced cell death while four selected NMNAT2 negative modulators reduced neuronal viability in an NMNAT2-dependent manner. Many of the identified NMNAT2 positive modulators are predicted to increase cAMP concentration, suggesting that neuronal NMNAT2 levels are tightly regulated by cAMP signaling. Taken together, our findings indicate that the NMNAT2-MSD platform provides a sensitive phenotypic screen to detect NMNAT2 in neurons. Optimal brain function requires that neurons respond appropriately to a range of environmental challenges.
    [Show full text]
  • Nmnats, Evolutionarily Conserved Neuronal Maintenance Factors
    Review NMNATs, evolutionarily conserved neuronal maintenance factors 1,2,3 2,4 2,3,4,5 Yousuf O. Ali , David Li-Kroeger , Hugo J. Bellen , 6 1,2,3,5 R. Grace Zhai , and Hui-Chen Lu 1 The Cain Foundation Laboratories, Texas Children’s Hospital, Houston, TX 77030, USA 2 Jan and Dan Duncan Neurological Research Institute at Texas Children’s Hospital, Houston, TX 77030, USA 3 Department of Pediatrics, Baylor College of Medicine, Houston, TX 77030, USA 4 Department of Molecular and Human Genetics, and Howard Hughes Medical Institute (HHMI), Baylor College of Medicine, Houston, TX 77030, USA 5 Program in Developmental Biology and Department of Neuroscience, Baylor College of Medicine, Houston, TX 77030, USA 6 Department of Molecular and Cellular Pharmacology, Miller School of Medicine, University of Miami, Miami, FL 33136, USA Proper brain function requires neuronal homeostasis A neuronal maintenance function has been attributed to over a range of environmental challenges. Neuronal NMNAT proteins, first characterized as essential enzymes activity, injury, and aging stress the nervous system, catalyzing NAD synthesis. Drosophila has a single and lead to neuronal dysfunction and degeneration. NMNAT gene, whereas mice and humans have three, Nevertheless, most organisms maintain healthy neu- NMNAT1–3, whose products differ in their kinetic proper- rons throughout life, implying the existence of active ties [2]. Drosophila NMNAT (dNMNAT) is widely distrib- maintenance mechanisms. Recent studies have revealed uted within cells [3], whereas mammalian NMNAT1–3 a key neuronal maintenance and protective function for proteins have distinct subcellular localizations [4]: nicotinamide mononucleotide adenylyl transferases NMNAT1 is localized to the nucleus, NMNAT2 is present (NMNATs).
    [Show full text]
  • Nicotinamide Mononucleotide Requires SIRT3 to Improve Cardiac Function and Bioenergetics in a Friedreich’S Ataxia Cardiomyopathy Model
    RESEARCH ARTICLE Nicotinamide mononucleotide requires SIRT3 to improve cardiac function and bioenergetics in a Friedreich’s ataxia cardiomyopathy model Angelical S. Martin,1,2 Dennis M. Abraham,3 Kathleen A. Hershberger,1,2 Dhaval P. Bhatt,1 Lan Mao,3 Huaxia Cui,1 Juan Liu,2 Xiaojing Liu,2 Michael J. Muehlbauer,1 Paul A. Grimsrud,1 Jason W. Locasale,1,2 R. Mark Payne,4 and Matthew D. Hirschey1,2,5 1Duke Molecular Physiology Institute and Sarah W. Stedman Nutrition and Metabolism Center, 2Department of Pharmacology and Cancer Biology, 3Department of Medicine, Division of Cardiology and Duke Cardiovascular Physiology Core, Duke University Medical Center, Durham, North Carolina, USA. 4Department of Medicine, Division of Pediatrics, Indiana University, Indianapolis, Indiana, USA. 5Department of Medicine, Division of Endocrinology, Metabolism, & Nutrition, Duke University Medical Center, Durham, North Carolina, USA. Increasing NAD+ levels by supplementing with the precursor nicotinamide mononucleotide (NMN) improves cardiac function in multiple mouse models of disease. While NMN influences several aspects of mitochondrial metabolism, the molecular mechanisms by which increased NAD+ enhances cardiac function are poorly understood. A putative mechanism of NAD+ therapeutic action exists via activation of the mitochondrial NAD+-dependent protein deacetylase sirtuin 3 (SIRT3). We assessed the therapeutic efficacy of NMN and the role of SIRT3 in the Friedreich’s ataxia cardiomyopathy mouse model (FXN-KO). At baseline, the FXN-KO heart has mitochondrial protein hyperacetylation, reduced Sirt3 mRNA expression, and evidence of increased NAD+ salvage. Remarkably, NMN administered to FXN-KO mice restores cardiac function to near-normal levels. To determine whether SIRT3 is required for NMN therapeutic efficacy, we generated SIRT3-KO and SIRT3-KO/FXN-KO (double KO [dKO]) models.
    [Show full text]
  • Mitochondrial Impairment Activates the Wallerian Pathway Through Depletion Of
    bioRxiv preprint doi: https://doi.org/10.1101/683342; this version posted June 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Mitochondrial impairment activates the Wallerian pathway through depletion of 2 NMNAT2 leading to SARM1-dependent axon degeneration 3 4 Andrea Loreto*,1, Ciaran S. Hill1,5, Victoria L. Hewitt2, Giuseppe Orsomando3, Carlo 5 Angeletti3, Jonathan Gilley1, Cristiano Lucci4, Alvaro Sanchez-Martinez2; Alexander J. 6 Whitworth2, Laura Conforti4, Federico Dajas-Bailador*,4, Michael P. Coleman*,1. 7 8 *Corresponding author - (Lead Contact): 9 Prof Michael Coleman Email: [email protected] 10 *Corresponding author: 11 Dr Andrea Loreto Email: [email protected] 12 *Corresponding author: 13 Dr Federico Dajas-Bailador Email: [email protected] 14 15 16 1 John van Geest Centre for Brain Repair, Department of Clinical Neurosciences, 17 University of Cambridge, Forvie Site, Robinson Way, CB2 0PY, Cambridge, UK 18 2 MRC Mitochondrial Biology Unit, University of Cambridge, Cambridge Biomedical 19 Campus, Hills Road, Cambridge, CB2 0XY, UK 20 3 Department of Clinical Sciences (DISCO), Section of Biochemistry, Polytechnic 21 University of Marche, Via Ranieri 67, Ancona 60131, Italy 22 4 School of Life Sciences, Medical School, University of Nottingham, NG7 2UH, 23 Nottingham, UK 24 5 Current address: Cancer Institute, University College London, WC1E 6AG, London, 25 UK 1 bioRxiv preprint doi: https://doi.org/10.1101/683342; this version posted June 27, 2019.
    [Show full text]
  • Sirtuin-3 (SIRT3), a Therapeutic Target with Oncogenic and Tumor-Suppressive Function in Cancer
    Citation: Cell Death and Disease (2014) 5, e1047; doi:10.1038/cddis.2014.14 OPEN & 2014 Macmillan Publishers Limited All rights reserved 2041-4889/14 www.nature.com/cddis Review Sirtuin-3 (SIRT3), a therapeutic target with oncogenic and tumor-suppressive function in cancer Y Chen1,6,LLFu2,6, X Wen1,2,6, XY Wang3, J Liu*,1, Y Cheng*,4 and J Huang*,5 Sirtuin-3 (SIRT3), a major mitochondria NAD þ -dependent deacetylase, may target mitochondrial proteins for lysine deacetylation and also regulate cellular functions. And, SIRT3 is an emerging instrumental regulator of the mitochondrial adaptive response to stress, such as metabolic reprogramming and antioxidant defense mechanisms. Accumulating evidence has recently demonstrated that SIRT3 may function as either oncogene or tumor suppressor on influencing cell death by targeting a series of key modulators and their relevant pathways in cancer. Thus, in this review, we present the structure, transcriptional regulation, and posttranslational modifications of SIRT3. Subsequently, we focus on highlighting the Janus role of SIRT3 with oncogenic or tumor-suppressive function in cancer, which may provide more new clues for exploring SIRT3 as a therapeutic target for drug discovery. Cell Death and Disease (2014) 5, e1047; doi:10.1038/cddis.2014.14; published online 6 February 2014 Subject Category: Cancer Facts range of intracellular processes including metabolism, long- evity, aging, cancer and response to stress.1,2 These proteins SIRT3, a major mitochondrial NAD þ -dependent deacety- are characterized by an evolutionarily conserved SIRT core lase, has a key role in cancer. domain that contains the catalytic and NAD þ binding The function of SIRT3 may be different depending on the domain.1 Among them, SIRT3 is an important mitochondrial cell-type and tumor-type; thereby, SIRT3 may act as an protein, which may function as a primary mitochondrial stress- oncogene or a tumor suppressor.
    [Show full text]
  • Dissecting the Genetic Etiology of Lupus at ETS1 Locus
    Dissecting the Genetic Etiology of Lupus at ETS1 Locus A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Immunobiology of the College of Medicine 2017 by Xiaoming Lu B.S. Sun Yat-sen University, P.R. China June 2011 Dissertation Committee: John B. Harley, MD, PhD Harinder Singh, PhD Leah C. Kottyan, PhD Matthew T. Weirauch, PhD Kasper Hoebe, PhD Lili Ding, PhD i Abstract Systemic lupus erythematosus (SLE) is a complex autoimmune disease with strong evidence for genetics factor involvement. Genome-wide association studies have identified 84 risk loci associated with SLE. However, the specific genotype-dependent (allelic) molecular mechanisms connecting these lupus-genetic risk loci to immunological dysregulation are mostly still unidentified. ~ 90% of these loci contain variants that are non-coding, and are thus likely to act by impacting subtle, comparatively hard to predict mechanisms controlling gene expression. Here, we developed a strategic approach to prioritize non-coding variants, and screen them for their function. This approach involves computational prioritization using functional genomic databases followed by experimental analysis of differential binding of transcription factors (TFs) to risk and non-risk alleles. For both electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genetic variants, a synthetic DNA oligonucleotide (oligo) is used to identify factors in the nuclear lysate of disease or phenotype-relevant cells. This strategic approach was then used for investigating SLE association at ETS1 locus. Genetic variants at chromosomal region 11q23.3, near the gene ETS1, have been associated with systemic lupus erythematosus (SLE), or lupus, in independent cohorts of Asian ancestry.
    [Show full text]
  • Potential Therapeutic Benefit of NAD+ Supplementation for Glaucoma And
    nutrients Review Potential Therapeutic Benefit of NAD+ Supplementation for Glaucoma and Age-Related Macular Degeneration 1,2 2,3 2,4 1, , Gloria Cimaglia , Marcela Votruba , James E. Morgan , Helder André * y and 1, , Pete A. Williams * y 1 Department of Clinical Neuroscience, Division of Eye and Vision, St. Erik Eye Hospital, Karolinska Institutet, 112 82 Stockholm, Sweden; CimagliaG@cardiff.ac.uk 2 School of Optometry and Vision Sciences, Cardiff University, Cardiff CF24 4HQ, Wales, UK; VotrubaM@cardiff.ac.uk (M.V.); morganje3@cardiff.ac.uk (J.E.M.) 3 Cardiff Eye Unit, University Hospital Wales, Cardiff CF14 4XW, Wales, UK 4 School of Medicine, Cardiff University, Cardiff CF14 4YS, Wales, UK * Correspondence: [email protected] (H.A.); [email protected] (P.A.W.) These authors contributed equally to this work. y Received: 25 August 2020; Accepted: 17 September 2020; Published: 19 September 2020 Abstract: Glaucoma and age-related macular degeneration are leading causes of irreversible blindness worldwide with significant health and societal burdens. To date, no clinical cures are available and treatments target only the manageable symptoms and risk factors (but do not remediate the underlying pathology of the disease). Both diseases are neurodegenerative in their pathology of the retina and as such many of the events that trigger cell dysfunction, degeneration, and eventual loss are due to mitochondrial dysfunction, inflammation, and oxidative stress. Here, we critically review how a decreased bioavailability of nicotinamide adenine dinucleotide (NAD; a crucial metabolite in healthy and disease states) may underpin many of these aberrant mechanisms. We propose how exogenous sources of NAD may become a therapeutic standard for the treatment of these conditions.
    [Show full text]
  • Downregulated SIRT6 and Upregulated NMNAT2 Are Associated with the Presence, Depth and Stage of Colorectal Cancer
    ONCOLOGY LETTERS 16: 5829-5837, 2018 Downregulated SIRT6 and upregulated NMNAT2 are associated with the presence, depth and stage of colorectal cancer JIA QI1, CHUNHUI CUI1, QUANWEN DENG2, LIFENG WANG3, RIHONG CHEN1, DUANYANG ZHAI1, LANG XIE1 and JINLONG YU1 1Department of General Surgery, Zhujiang Hospital of Southern Medical University, Guangzhou, Guangdong 510280; 2Department of Pharmacy, Nanfang Hospital of Southern Medical University, Guangzhou, Guangdong 510515; 3Department of Gastroenterology, Zhujiang Hospital of Southern Medical University, Guangzhou, Guangdong 510280, P.R. China Received July 22, 2016; Accepted January 8, 2018 DOI: 10.3892/ol.2018.9400 Abstract. Colorectal cancer (CRC) is an important cause of preliminary study demonstrated that the increased expres- morbidity and mortality worldwide, and is difficult to detect sion of NMNAT2 and reduced expression of SIRT6 may be in its early stages. Diagnostic and prognostic biomarkers associated with the progression of CRC. The downregulation are required, which may also be the basis for improving the of SIRT6 may promote the expression of NMNAT2. Further targeted therapy for CRC. Sirtuin 6 (SIRT6) is a member of the studies are indicated on the role of NMNAT2 and SIRT6 as sirtuin family of gene regulators, which have specific functions potential diagnostic and prognostic biomarkers and as targets in genomic stability, gene transcription and energy metabolism for therapy in CRC and other malignant tumors. in tumorigenesis. Nicotinamide mononucleotide adenylyl- transferase 2 (NMNAT2) is a metabolic enzyme which can Introduction be deacetylated by sirtuins. In this study, tissue samples from 29 patients with histologically confirmed CRC of varying grade Colorectal cancer (CRC) is one of the most common types of and stage were studied for SIRT6 and NMNAT2 expression by solid tumor, with ~1.2 million new confirmed diagnoses of western blotting and reverse transcription-quantitative poly- CRC annually worldwide and with 55% of cases occurring merase chain reaction.
    [Show full text]