View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Virology 376 (2008) 13–23

Contents lists available at ScienceDirect

Virology

journal homepage: www.elsevier.com/locate/yviro

Genomic characterisation of Wongabel reveals novel genes within the

Aneta J. Gubala a,b,c,d,⁎, David F. Proll c, Ross T. Barnard b,d, Chris J. Cowled a,b,d, Sandra G. Crameri a, Alex D. Hyatt a, David B. Boyle a,d

a CSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong, Victoria, Australia b School of Molecular and Microbial Sciences, The University of Queensland, St. Lucia, Queensland, Australia c Human Protection and Performance Division, Defence Science and Technology Organisation, Melbourne, Australia d Australian Biosecurity Cooperative Research Centre for Emerging Infectious Disease, Brisbane, Queensland, Australia

article info abstract

Article history: belonging to the family Rhabdoviridae infect a variety of different hosts, including insects, vertebrates Received 21 August 2007 and plants. Currently, there are approximately 200 ICTV-recognised rhabdoviruses isolated around the world. Returned to author for revision However, the majority remain poorly characterised and only a fraction have been definitively assigned to 17 October 2007 genera. The genomic and transcriptional complexity displayed by several of the characterised rhabdoviruses Accepted 10 March 2008 indicates large diversity and complexity within this family. To enable an improved taxonomic understanding Available online 24 April 2008 of this family, it is necessary to gain further information about the poorly characterised members of this family. Here we present the complete genome sequence and predicted transcription strategy of Wongabel Keywords: virus (WONV), a previously uncharacterised rhabdovirus isolated from biting midges (Culicoides Wongabel virus Rhabdovirus austropalpalis) collected in northern Queensland, Australia. The 13,196 nucleotide genome of WONV Rhabdoviridae encodes five typical rhabdovirus genes N, P, M, G and L. In addition, the WONV genome contains three genes Full genome sequence located between the P and M genes (U1, U2, U3) and two open reading frames overlapping with the N and Novel genes G genes (U4, U5). These five additional genes and their putative protein products appear to be novel, and their Viroporin functions are unknown. Predictive analysis of the U5 gene product revealed characteristics typical of viroporins, and indicated structural similarities with the alpha-1 protein (putative viroporin) of viruses in the genus Ephemerovirus. Phylogenetic analyses of the N and G proteins of WONV indicated closest similarity with the avian-associated Flanders virus; however, the genomes of these two viruses are significantly diverged. WONV displays a novel and unique genome structure that has not previously been described for any animal rhabdovirus. Crown Copyright © 2008 Published by Elsevier Inc. All rights reserved.

Introduction more host-specific. Members of the genus are known to infect different species of fish, and members of the Cytorhabdovirus and The Rhabdoviridae, along with the virus families Paramyxoviridae, Nucleorhabdovirus genera are arthropod-borne plant viruses. Filoviridae,andBornaviridae, belong to the order .The Rhabdoviruses contain a negative-sense single stranded RNA Rhabdoviridae currently consists of six recognised genera, consisting of genome that typically encodes five structural proteins; the nucleopro- assigned and tentative species, and more than 120 yet unassigned tein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and isolates from around the world (International Committee on Taxonomy polymerase (L), in the order N–P–M–G–L. However, many members of of Viruses, 2005). Members of the genera Lyssavirus, Vesiculovirus and this family contain a more complex genome structure with a perplexing Ephemerovirus have been isolated from a variety of different hosts, pattern of gene expression. Two viruses belonging to the genus Ephe- including mammals, fish and invertebrates. Several viruses that belong merovirus, Bovine ephemeral fever virus (BEFV) and Adelaide River virus to these genera are known to cause significant disease in animals around (ARV), have a large stretch of sequence between the G and L genes. This the world, with potentially devastating impacts on livestock trade, region contains a second glycoprotein gene (GNS) and additional α, β and wildlife, and humans. Members of the three other genera appear to be γ (BEFV) coding regions which are believed to have resulted from gene duplication (McWilliam et al., 1997; Walker et al., 1992; Wang et al., 1994; Wang and Walker, 1993). Viruses belonging to the genus Novir- habdovirus contain a single coding region between the G and L genes that encodes a non-virion (NV) protein, which has been shown to play an ⁎ Corresponding author. CSIRO Livestock Industries, Australian Animal Health Laboratory, Private Bag 24, Geelong Victoria 3220, Australia. Fax: +61 3 5227 5555. essential role in the formation of the cytopathic effect (CPE) in cell E-mail address: [email protected] (A.J. Gubala). culture, and in pathogenicity for some species of fish (Basurco and

0042-6822/$ – see front matter. Crown Copyright © 2008 Published by Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2008.03.004 14 A.J. Gubala et al. / Virology 376 (2008) 13–23

Benmansour,1995; Kurath and Leong,1985; Thoulouze et al., 2004). The endoplasmic reticula (Fig. 1D), which is an uncommon observation of plant-infecting viruses belonging to the genera Nucleorhabdovirus and viruses within this family. Virions were observed to be approximately Cytorhabdovirus and the unclassified Drosophila Sigma virus (SIGMAV) 80–90×160–180 nm in dimensions. An intriguing observation was the all contain one to four additional genes between P and M, the function of common presence of elongated cell processes that contained virions which is unknown (Heaton et al., 1989; Landes-Devauchelle et al., 1995; lined up within, giving the appearance of a beaded string. Often, the Wetzel et al.,1994). The unassigned Tupaia rhabdovirus (TUPV) contains particles within these cell processes appeared to be touching and the a novel small hydrophobic gene between the M and G genes (Springfeld process appeared to be pinched in between, as highlighted by the et al., 2005) and the bird-infecting Flanders virus (FLAV) also appears to rectangles in Fig. 1A and B. The reason for this occurrence is unclear; contain a complex genome structure. Genomic diversity is particularly however, similar observations have been made for Tibrogargan virus prominent in members of the dipteran–mammalian “dimarhabdovirus (TIBV) (unpublished observations). supergroup”, which includes viruses classified in the genera Vesiculo- virus and Ephemerovirus and numerous unassigned viruses (Bourhy The complete genomic sequence of Wongabel virus et al., 2005; Kuzmin et al., 2006). Currently available sequence data for these viruses suggests the need to establish new genera within this The PCR-select cDNA subtraction method is a reliable and efficient family, however, more viruses must be characterised to enable this. method for obtaining new sequence data for uncharacterised viruses Although a large proportion of rhabdoviruses can cause diseases of (Bowden et al., 2001; Jack et al., 2005). This method has several significant importance, until recently only members of the genus Lys- considerable advantages over traditional cloning approaches for the savirus were recognised to cause deadly disease in humans. Recently, a sequencing of viruses. Firstly, no sequence information is required and large unexpected outbreak with a high fatality rate in India was no presumptions need to be made regarding the studied virus. attributed to Chandipura virus (CHPV), a member of the genus Vesicu- Secondly, extensive virus purification is not required as total RNA from lovirus (Rao et al., 2004). This highlights the importance of characterising the infected tissue culture supernatant (TCSN) is used as the starting pathogens about which little is known: pathogens with an unidentified material. Furthermore, this method is very efficient for viruses with pathogenic potential. single stranded genomes, making the assembly of sequences faster In Australasia over the last five decades 18 different viruses have and easier than for viruses with segmented genomes. With the aim of been isolated that have been tentatively assigned to the family Rhab- further improving the output of new sequence data generated by this doviridae based on serological cross-reactivity or virion morphology. method, we used alternate restriction enzymes, AluI and HaeIII, to These viruses have been isolated from a diverse range of hosts, digest cDNA, in addition to the enzyme RsaI provided in the kit. This including mammals, mosquitos, flies and lizards. Serological cross- generated three different restriction libraries of the WONV genome reactivity tests have indicated that some of these viruses share some with overlapping fragments that allowed fast and simple the assembly relationships with each other but most are unique (Calisher et al.,1989; of larger sequence contigs. This approach resulted in the generation of Karabatsos, 1985; Tesh et al., 1983). Little else is known about their a large amount of sequence data with extensive coverage of the WONV evolution or relationships at the genetic level. genome. In total, 168 clones containing PCR products generated from Wongabel virus (WONV) was isolated from biting midges (Culicoides the three individual cDNA subtractions were randomly selected. The austropalpalis) collected in 1979 at Wongabel on the Atherton Table- inserts were sequenced and screened for virus-specific sequences by lands, northern Queensland, Australia by the CSIRO Long Pocket performing BLASTX similarity searches of the NCBI databases. A high Laboratories, Brisbane, Australia (T. D. St George, personal communica- proportion of the clones (124 clones; 74%) contained inserts that were tion). Limited information is available describing the isolation of this rhabdoviral. The total amount of sequence data obtained from the virus. Culicoides austropalpalis has a feeding preference for birds (Muller three subtractions equated to 12,377 nt, representing ~95% coverage et al.,1981). Neutralizing antibodies to this virus were detected in 1.2% of of the entire genome of WONV. This was in the form of five distinct sea bird sera collected off the Great Barrier Reef (Humphrey-Smith et al., contigs that were separated by only small regions of unknown 1991). No neutralizing antibodies to WONV have been detected in sequence. Notably, sequence data was obtained to within as few as human sera collected from island residents within this region, and no 23 nt from 3′ genome terminus and 25 nt from 5′ genome terminus, link between WONV and disease has yet been established. WONV is highlighting the power of this improved technique. recognised as a member of the family Rhabdoviridae based on its bullet- The sequence data obtained by the subtraction method was used to shaped morphology, however, it is not yet classified as a member of the design 32 primer pairs which amplified overlapping products ranging Rhabdoviridae by the International Committee on Taxonomy of Viruses in length from 500 to 800 nt. These PCR primers were used to amplify (ICTV) (International Committee on Taxonomy of Viruses, 2005). This the entire WONV genome, excluding the terminal regions. Following report presents the characterisation of the entire WONV genome and its the sequencing of these PCR products, a single consensus sequence of predicted transcription strategy, revealing three novel genes between 13,148 nt, representing the majority of the WONV genome, was the P and M genes and the presence of two additional open reading created. Finally, the sequences of the genome termini were obtained frames that overlap the 3′ ends of the N and G genes. The sequence of the by a modified RACE method to complete the sequence of the entire full genome of this virus was obtained using a modified and improved 13,196-nt genome of WONV. The average quality scores of the PCR-select cDNA subtraction method. The function of the additional sequence data determined by the SeqMan program were very good. coding regions is unknown, however, their unexpected presence Every nucleotide of the WONV genome was sequenced with a highlights the large diversity between these viruses and the need to minimum four-fold coverage in each direction, including at least gain a deeper understanding of the genomic organization of other one-fold coverage in each direction directly from PCR products as uncharacterised rhabdoviruses. template. The majority of nucleotides had more than 10-fold coverage. Collectively, this provided high confidence in the final sequence. Results and discussion The organization of the 13,196-nt genome of WONV is depicted in Fig. 2. The genome contains the five typical rhabdovirus genes; N, P, M, WONV morphology G and L. The genome also contains three additional genes between the P and M genes, and the G and N genes contain long 3′ untranslated Electron micrographs of WONV-infected BHK-BSR cells (Fig. 1) regions (UTRs) that appear to contain additional ORFs that overlap revealed bullet-shaped virions characteristic of viruses within the with the 3′ end of the preceding ORF. The presence of these five family Rhabdoviridae. Arrows indicated virions budding from the cell additional genes and/or ORFs suggests that WONV has a novel and processes (Fig. 1A, B), at the plasma membrane (Fig. 1C) and from the unique genome organisation among animal rhabdoviruses. A.J. Gubala et al. / Virology 376 (2008) 13–23 15

Fig. 1. Transmission electron micrographs of BHK-BSR cells infected with WONV. Cells were prepared using the grid–cell–culture method and negatively stained (A, B), or using the thin section method (C, D). Viruses are budding (bv) from an elongated cell process (cp) (A). The viruses are bullet-shaped, possess an envelope (env), surface projections (peplomers) (p) and an internal helical ribonucleocapsid (RNP). Rectangles highlight the common observation of two viruses budding in a ‘facing’ orientation within individual cell processes (A, B). Arrows indicate viruses budding at the plasma membrane (C) and from the rough endoplasmic reticula within a degenerating cell (D).

Replication and transcription apparatus: N, P and L proteins N gene The N protein of rhabdoviruses is tightly associated with genomic All members of the order Mononegavirales encode proteins N, P RNA to form a ribonucleocapsid complex that acts as a template for and L, which together with the genomic RNA form the ribonucleo- transcription and replication and is highly resistant to degradation protein complex. (Soria et al., 1974). The N gene of WONV is predicted to encode a 440-

Fig. 2. Map of the 13,196-nt WONV genome in 3′ to 5′ orientation. Shaded arrows represent ORFs for the five typical rhabdovirus proteins N, P, M, G and L shown in the direction of mRNA transcription. Black arrows indicate ORFs encoding putative proteins of unknown function; U1, U2 and U3 are encoded by independent genes; U4 and U5 overlap the N and G genes respectively. Nucleotide positions of gene boundaries are indicated above the genes, and the nucleotide numbers of the ORF start and stop codons are indicated below the genes. Intergenic regions (listed in Table 2) are indicated by the black perpendicular lines. 16 A.J. Gubala et al. / Virology 376 (2008) 13–23 aa protein with a calculated molecular mass of 50.1 kDa (Table 1). The conserved motifs within these blocks all support that WONV has N gene also contains a 142-nt 3′ UTR of unknown function between the highest similarity to FLAV and the ephemeroviruses. stop codon and the polyadenylation signal. The putative N protein is predicted to contain numerous PKC, CK2 and TYR phosphorylation sites, The envelope-associated M and G proteins therefore it is probably phosphorylated like many other rhabdovirus N proteins. Pairwise analysis of the WONV N protein with other M gene rhabdovirus N proteins revealed highest amino acid sequence similarity The M proteins of negative-stranded RNA viruses play a diverse with FLAV (65%) which was isolated from mosquitos and birds in the and critical range of roles. These proteins organise the assembly of the USA, ARV and Obodhiang viruses (58%), and BEFV (57%). Within the virion by interacting with the ribonucleocapsid, lipid membranes and central region of this protein, the motif G(L/I)SXKSPYSS that is usually the cytoplasmic tails of the G protein, as well as mediating the highly conserved between the ephemeroviruses, vesiculoviruses and budding of virions from the infected cell (Jayakar et al., 2004, 2000; lyssaviruses (Crysler et al., 1990; Tordo et al., 1986; Walker et al., 1994)is Schmitt and Lamb, 2004). The M protein of VSIV, in particular, also also highly conserved in WONV (GLSLKSPYSA). blocks the expression of antiviral gene products by the host, enabling the virus to replicate unimpeded in the cell (Black et al.,1993; Petersen P gene et al., 2000). M protein alone is capable of causing CPE (Blondel The P protein of rhabdoviruses is an essential protein, which et al., 1990). Recently, the observation has been made that the VSIV together with the L protein forms the transcription and replication M protein is localized to the mitochondria, the significance of which complex. The WONV P gene encodes a putative protein of 245 aa with remains unknown (Lichty et al., 2006). The WONV putative M protein a calculated molecular mass of 27.9 kDa. Unlike a number of other is 198 aa in length with a calculated molecular mass of 22.9 kDa. This viruses such as BEFV and Vesicular stomatitis Indiana virus (VSIV), protein contains a single putative N-glycosylation site, an amidation the WONV P gene does not contain a second overlapping ORF that site, and numerous phosphorylation sites. Although M proteins gener- encodes an additional translation product (C protein). ClustalW ally share little similarity among rhabdoviruses, the WONV M protein alignments showed that the putative WONV P protein displays high shares as much as 50% similarity with FLAV and 48% similarity with divergence from other rhabdovirus P proteins, having the highest BEFV, and in comparison around 28% similarity with VSIV. The identity of only approximately 20% with FLAV, BEFV and VSIV. Based proline-rich motif PPXY within the M protein, which is necessary for on the predicted phosphorylation pattern, it appears that the WONV P virus budding in VSIV and RABV (Harty et al., 1999), is also conserved protein contains a 120-aa non-phosphorylated stretch in the centre. In in WONV (PPVY). Interestingly, the PPXY motif is not conserved in comparison, VSIV contains a 162-aa non-phosphorylated stretch in FLAV (containing the sequence PIDD instead), despite its overall close the centre of the protein, which contains a 72-aa hinge domain relationship with WONV at the aa level. believed to play a crucial role in the assembly of infectious particles (Das and Pattnaik, 2005). Although it is not known if WONV contains G gene this hinge domain, the similar phosphorylation pattern suggests The G glycoprotein of rhabdoviruses is a type I transmembrane similarities in overall structure and function of the two P proteins. protein that forms non-covalently bound trimers (peplomers) that project outside on the surface of the virion. It is responsible for L gene attachment to host cell receptors and membrane fusion, and is the The putative L polymerase of WONV is 2118 aa long and has a target of host neutralizing antibodies (Coll, 1995). The rhabdovirus calculated molecular mass of 245.7 kDa. Based on the complete G protein contains an N-terminal signal peptide that is cleaved protein sequence, pairwise alignments revealed that the L protein following transport to the endoplasmic reticulum, and a transmem- shares highest amino acid identity with FLAV (51%), followed by 41 to brane domain with a short cytoplasmic tail which is located near the 43% identity with the vesiculoviruses and BEFV, and 34 to 36% identity C terminus of the protein. The putative G protein of WONV is 623 aa in with the lyssaviruses. All viral RNA-dependent RNA polymerases length and has a calculated molecular mass of 71.2 kDa. The WONV contain six characteristic sequence blocks (designated I to VI) which G gene features a long 316-nt 3′ UTR between the stop codon and the are generally highly conserved. These blocks are proposed to specify polyadenylation signal, containing another ORF. Pairwise alignments the fundamental activities that are common to all L polymerases (Poch of the WONV G protein with other rhabdovirus G proteins indicated et al., 1990). Following ClustalW sequence alignment of the WONV closest similarity with FLAV (30%), followed by BEFV and ARV (21%). L protein with other rhabdovirus L proteins, it is evident that the The WONV G protein is predicted to contain a signal peptide at WONV L protein displays relatively high conservation of all six of the residues 1 to 19, an ectodomain region at residues 20 to 553, an 18-aa characteristic sequence blocks. Detailed comparisons of specific highly hydrophobic transmembrane region at residues 554 to 572, and a short cytoplasmic region at residues 573 to 623. These characteristics are comparable with other rhabdovirus G proteins. Typically rhabdo-

Table 1 virus G proteins also contain two to six potential glycosylation sites Predicted genes and putative proteins of WONV (Coll, 1995). In comparison, the mature WONV G protein is predicted to contain seven putative N-glycosylation sites. Of significant ′ ′ Protein Gene ORF 5 UTR 3 UTR Protein Protein Isoelectric importance is the conservation of 12 cysteine residues in the majority length length (nt) (nt) length calculated point (pI) fi (nt) (nt) (aa) Mr (kDa) of animal rhabdoviruses, which form disul de bonds and play an essential role in protein folding and structure (Coll, 1995; Kongsuwan N 1475 1323 10 142 440 50.1 6.32 et al., 1998; Springfeld et al., 2005; Walker et al., 1992; Walker and U4 – 150 ––49 5.8 3.82 P 762 738 10 14 245 27.9 4.88 Kongsuwan, 1999). Following ClustalW alignment with all available U1 574 540 21 13 179 21.2 5.13 complete rhabdovirus G protein sequences, the WONV G protein U2 602 579 10 13 192 21.9 4.34 displayed conservation of all 12 cysteine residues in an identical U3 453 429 10 14 142 16.5 4.49 pattern to BEFV, ARV and FLAV, but with some variation compared to M 618 597 10 11 198 22.9 8.42 G 2209 1872 21 316 623 71.2 6.77 viruses from the other genera. The WONV G protein contains two U5 – 384 ––127 14.9 10.42 additional cysteine residues that are only conserved with FLAV. A L 6406 6357 10 39 2118 245.7 7.95 previous study has shown remarkable preservation of structural Gene positions and features are presented in the antigenome direction. 3′ UTRs include elements such as alpha helices, beta sheets and loop structures in 14 polyadenylation sequences. different rhabdovirus G proteins (Walker and Kongsuwan, 1999). It A.J. Gubala et al. / Virology 376 (2008) 13–23 17 appears that the majority of these secondary structural elements are At aa residues 45 to 62 a characteristically prominent 18-aa helix also highly conserved in WONV. Collectively, this indicates that the structure is located. No other characteristic features were identified WONV G protein has maintained a similar protein folding pattern and for this small hydrophilic protein. structure to the G proteins of other animal rhabdoviruses. Unusual ORFs at the 3′ ends of the N and G genes Novel genes between P and M genes Unknown 4 (U4) ORF The presence of up to four additional genes between P and M has Unlike the U1, U2 and U3 proteins which are each encoded by a been observed for several the plant-infecting members of the genera single gene, the U4 and U5 ORFs overlap other genes and are probably Cytorhabdovirus and Nucleorhabdovirus (Dietzgen et al., 2006; Huang translated from bicistronic mRNAs. The N gene contains a 142-nt 3′ et al., 2003; Reed et al., 2005; Revill et al., 2005; Scholthof et al., 1994; UTR between the N stop codon and the putative polyadenylation Tanno et al., 2000). The FLAV genome also appears to harbour a 19-kDa signal, which appears to harbour an ORF (U4) that overlaps the N ORF protein flanked by non-functional pseudo-genes in this region. The by one nt. The stop codon for this protein overlaps with the N putative region of 1632 nt between the P and M genes of WONV shows polyadenylation signal (3′-GUACUUUUUUU-5′). This ORF encodes a significant divergence from the genomes of other rhabdoviruses. This very small putative 49-aa protein with a calculated mass of 5.8 kDa, area of the WONV genome appears to contain three independent with a predicted transmembrane region at residues 13 to 30. The genes which encode putative proteins that have no significant equivalent region in FLAV does not harbour an ORF. This protein is similarity at the amino acid level to any other known proteins. The predicted to contain a single N-myristoylation site at residue 42. presence of three independent genes between P and M has never been BLAST searches indicated an unexpectedly high 49% overall similarity described for an animal rhabdovirus. with a fragment of GTP-binding proteins of several proteo- and entero-bacteria; however, the significance of this result at this stage is Unknown 1 (U1) hard to interpret. This putative hydrophilic protein encoded by the U1 gene is 179 aa in length and has a calculated molecular mass of 21.2 kDa. It is Unknown 5 (U5) ORF predicted to contain numerous phosphorylation sites, an N-glycosyla- Members of the genus Lyssavirus contain a large intergenic region tion site at residue 127, an amidation site at residue 122, and two located between the G and L genes, which is believed to be a remnant N-myristoylation sites (lipid anchor modification) at residues 70 and of a functional gene that possibly represents an intermediate step in 119, which may indicate that the protein may be targeted to membrane rhabdovirus evolution (Tordo et al., 1986). The fish-infecting members locations (Maurer-Stroh et al., 2002). of the genus Novirhabdovirus contain a single gene between the G and L genes that codes for a non-virion (NV) protein (Basurco and Unknown 2 (U2) Benmansour, 1995; Kurath and Leong, 1985) shown to play an The predicted transcription initiation sequence of the U2 gene is the essential role in the production of CPE and pathogenicity for some least conserved in comparison to that of the other WONV genes, as species of fish (Thoulouze et al., 2004). Members of the genus Ephe- depicted in Table 2. Low conservation of transcription initiation merovirus contain the largest stretch of sequence between the G and sequences might play a role in the efficiency of transcription, as L genes of all rhabdoviruses (3420 nt, BEFV). These viruses contain a previously observed for rhabdoviruses (Stillman and Whitt, 1997,1999). second glycoprotein gene (GNS) and additional α, β and γ (BEFV) This gene encodes a putative 192-aa protein with a calculated molecular coding regions, which are believed to have resulted through gene mass of 21.9 kDa. At aa residues 74 to 83 this protein contains a putative duplication (McWilliam et al., 1997; Walker et al., 1992; Wang et al., 10-aa highly hydrophobic region, followed by a mitochondrial energy 1994; Wang and Walker, 1993). transfer signature at aa residue 86. The presence of a short hydrophobic In comparison, this region in WONV also appears to be complex, yet region preceding a mitochondrial energy transfer signature is char- distinctly different. The G ORF is followed by a 315-nt 3′ untranslated acteristic of carrier and transport proteins. This protein also contains two region, followed by the GAAC[U]7 polyadenylation signal. In WONV this putative N-myristoylation sites at aa residues 68 and 76. untranslated region contains an ORF encoding the putative polypeptide U5 with three possible in-frame start codons resulting in the translation Unknown 3 (U3) of 127-aa (14.9 kDa), 106-aa (12.6 kDa) or 73-aa (8.6 kDa) proteins, The U3 gene encodes a 142-aa putative protein with a calculated referred to SC1,SC2 and SC3 respectively. The stop codon for the putative molecular mass of 16.5 kDa with five putative phosphorylation sites. U5 protein overlaps with the G polyadenylation sequence in the same

Table 2 WONV transcription/replication control sequences

Junction Gene end Intergenic Gene start

Leader–N na na UCAUCAAAAGUAC N–P AUU...131 nt...GUACUUUUUUU AG UCAUCAAUAGUAC P–U1 ACUAGUGUACUUUUUUU AG UCAUCUGUAGAUCAGAUGUUCUAC U1–U2 AUUAUGUACUUUUUUU AG CCGUCAGUAGUAC U2–U3 AUUUAGAACUUUUUUU AG UCAUCAGUAGUAC U3–M AUUUAUGUACUUUUUUU AG UCGUCAGUAGUAC M–G AUUGUACUUUUUUU GA UCAUCUGUAUAACUAAUGUUCUAC G–L AUC...305 nt...GAACUUUUUUU GA UCGUCAGUAUUAC

L–trailer AUU…28 nt…GUACUUUUUUU na na ⁎ ⁎⁎⁎⁎⁎⁎⁎⁎⁎ ⁎⁎⁎ ⁎ Consensus GWACUUUUUUU YCRUCWRWAK

The gene end (left column), intergenic (middle column) and gene start (right column) of the eight genes are indicated. Stop codons (left column) and start codons (right column) are in bold and underlined. Excessive internal sequences for N–P, G–L and L–trailer gene ends have been removed for clarity of presentation, as indicated. Asterisks indicate identical bases. A consensus sequence is shown in bold type below the gene end and gene start sequences (according to the nucleotide base code of the Nomenclature Committee of the International Union of Biochemistry). 18 A.J. Gubala et al. / Virology 376 (2008) 13–23

hydrophobic profile appears to be comparable to the small hydro- phobic α1 protein of BEFV and ARV (McWilliam et al., 1997). These proteins in BEFV and ARV have been proposed to act as viroporins. Viroporins are viral proteins that interact with and expand the host cell membrane lipid bilayer to increase the permeability of the cell membrane, thus facilitating the passage of ions or small molecules. They may be particularly important in late , and although they are not regarded as essential for viral replication, they may enhance virus growth (Gonzalez and Carrasco, 2003). The existence of viroporins in the Rhabdoviridae is yet to be confirmed experimentally. Analysis of the available sequence for FLAV reveals that this virus also appears to harbour an ORF encoding a protein of similar characteristics in the G gene 3′ UTR. Fig. 4 depicts a ClustalW alignment of the putative WONV U5 protein (SC2 translation product), the cognate FLAV protein and the BEFV α1 putative viroporin. The overall similarities (approximately 20%) at the aa level between these three proteins is low, however, this alignment highlights distinctive fi Fig. 3. Hydrophobicity pro le of the putative 127-aa U5 protein (viroporin), indicating highly hydrophobic regions in the central regions of all three proteins two other potential start codons SC2 and SC3, as indicated. Positive values indicate hydrophobic residues; negative values indicate hydrophilic residues. A prominent and highly basic domains at their carboxy termini. These distinct highly hydrophobic region is present from residues 63 to 85. regions have been previously described for the BEFV α1 protein (McWilliam et al., 1997). If U5 is produced during infection, this would be the first observation of another protein encoded by an ORF manner as the putative U4 protein (3′-GAACUUUUUUU-5′, genome overlapping with the G gene in a rhabdovirus. sense). None of the three potential start codons are preceded by the WONV consensus transcription initiation signal. This indicates that Immunodetection of WONV proteins translation would probably occur from a polycistronic mRNA transcript, which appears to occur in the ephemeroviruses (McWilliam et al., 1997; To confirm the expression of the predicted proteins, western Wang et al., 1994; Wang and Walker, 1993). It is yet unclear if or how blotting was performed with infected and mock-infected BHK-BSR these proteins are expressed by the ephemeroviruses or whether there cells. At 0 h, 17 h (early stages of CPE), 22 h, and 44 h (90% CPE) post are internal initiation regions within these polycistronic mRNAs, infection whole-cell protein preparations of infected and mock- however internal initiation has been observed for VSV (Herman, 1986, infected cells were separated by SDS-PAGE and transferred onto 1987). It has been proposed that the combination of low efficiency PVDF membrane. Polyclonal mouse ascitic fluid (MAF) generated to transcription promoters that result in the production of polycistronic WONV and sheep anti-mouse HRP-conjugated Ig were used to probe mRNAs, and internal initiation sites for protein expression, are a the membrane in order to visualise WONV proteins. mechanism used by the ephemeroviruses for the regulation of synthesis At 44 h post infection the infected cell extracts contained nine of low abundance proteins (McWilliam et al., 1997; Wang et al., 1994; proteins that were not present in mock-infected cells, as depicted in Wang and Walker, 1993). Fig. 5. At the earlier time points of 17 and 22 h post infection all proteins Kyte-Doolittle hydrophobicity plots and Phobius transmembrane except L were visualised on the immunoblots (results not shown). No topology/signal peptide prediction analyses performed on all three WONV-specific proteins were observed at timepoint 0 h. The largest putative polypeptides revealed that they each contain an extracellular visible protein unique to the WONV-infected cells is presumably the domain (varying in length: SC1, 63 aa; SC2, 42 aa; and SC3, 11 aa), L protein with a calculated mass of 245.7 kDa. The second largest visible followed by a 22-aa transmembrane domain and a 41-aa cytoplasmic protein is presumably the G protein. This protein has a calculated mass of tail. A hydrophobicity plot of these three translation products is 71.2kDa, however, it appears to run as a doublet of approximately 78 and depicted in Fig. 3. A possible cleavage site was identified by the SignalP 85 kDa possibly indicating glycosylated and non-glycosylated forms or program at the junction of the transmembrane domain and the different stages of maturity. This is consistent with previous observa- cytoplasmic tail, the function of which is unclear. tions of BEFV (Walker et al., 1991)andFLAV(Boyd and Whitaker- Although SC2 does not appear to have any significant similarity at Dowling, 1988). A band present at approximately 50 kDa is consistent in the amino acid level with any other known proteins, its size and size with the predicted mass of the N protein (50.1 kDa). The six

Fig. 4. ClustalW alignment of the putative WONV viroporin protein (SC2 translation product), the cognate FLAV protein and the BEFV α1 putative viroporin, indicating structural similarity between the proteins. Conserved aa residues (⁎) and functionally similar aa residues (.) are indicated below the aligned sequences. The hydrophobic domains and highly basic domains at the carboxy termini of the proteins are in bold. A.J. Gubala et al. / Virology 376 (2008) 13–23 19

These results indicate that four of the five putative proteins (bar the smallest U4 protein) appear to be expressed in WONV-infected cells. Additional confirmatory studies are currently underway to reveal the roles and functions of these novel proteins.

WONV transcription/replication control sequences

The ORFs of rhabdoviruses are separated by conserved sequences that are composed of a transcription termination/polyadenylation signal for the upstream ORF, a short intergenic spacer, and a transcription initiation sequence for the downstream ORF. At the termination/ polyadenylation signal, the presence of a tetranucleotide sequence (3′-

AUAC-5′ in VSIV) followed by seven uninterrupted uridine residues (U7), is responsible for viral polymerase “stuttering” that results in the reiterative copying of the U residues (Barr and Wertz, 2001; Schnell et al., 1996). This reiterative copying results in the generation of a poly(A) tail

at the 3′ terminus of each mRNA. This U7 tract must contain a minimum of seven residues for termination and polyadenylation to occur in VSIV (Barr et al.,1997). This signal also plays an important role in transcription of the downstream gene (Hinzman et al., 2002; Hwang et al., 1998). The putative control sequences of WONV are depicted in Table 2.The termination/polyadenylation sequences are generally conserved between genes, whereas the initiation sequences have minor variation. The putative transcription initiation signal 3′-UCAUC-5′ (genome sense) Fig. 5. Immunoblotting of WONV-infected and mock-infected BHK-BSR cells at 44 h post is conserved in the majority of WONV genes with the exception of the infection using mouse ascitic fluid made to WONV. Proteins unique to WONV-infected U2, M and L genes. It appears that the same sequence (3′-UCAUC-5′)is cells are highlighted by the arrows. The molecular mass bands of the marker Magic also conserved by FLAV. Mark XP (Invitrogen) are indicated.

Leader and trailer sequences remaining bands unique to WONV-infected cells are smaller, ranging in mass from 20 to 32 kDa. The protein running at 31–32 kDa corresponds The WONV leader sequence is 45 nt in length and the trailer to the P protein (calculated mass 27.9 kDa), the band at 29 kDa cor- sequence is 38 nt in length. In comparison to other vertebrate responds to the M protein (calculated mass 22.9 kDa), a cluster of bands rhabdoviruses, which contain leader sequences approximately 50 to present at 25 and 24 kDa correspond to the U2 and U1 proteins 70 nt and trailer sequences approximately 55 to 80 nt in length, the (calculated masses 21.9 and 21.2 respectively), the band at 22 kDa corresponding WONV sequences are shorter. A common feature corresponds to the U3 protein (calculated mass 16.5), and the 20-kDa among rhabdoviruses is the complementarity of the 3′ and 5′ genome protein corresponds to the putative viroporin U5 (calculated mass 14.9). termini. WONV displays complementarity of 12 of 16 terminal A smear below the U2/U1 protein cluster might be a result of different nucleotides of the genome, as depicted in Fig. 6A. Commonly among glycosylation states of these proteins. A band corresponding to the small the vertebrate rhabdoviruses (excluding the ), there U4 protein (calculated mass 5.8 kDa) was not visualised on the western is perfect conservation of the three terminal nucleotides at the 3′ blots possibly due to its small size. genome termini. A comparison between the WONV leader sequence The P protein appears to produce the strongest signal in these with the leader sequences of representative members of the genera immunoblots, consistent with previous observations of FLAV (Boyd Ephemerovirus, Vesiculovirus and Lyssavirus is depicted in Fig. 6B. This and Whitaker-Dowling, 1988). The unknown proteins U1 and U2 also alignment shows perfect conservation of the three 3′ terminal produced strong signals. This could suggest that these proteins are nucleotides of WONV with the three other depicted viruses (3′ UGC, either highly immunoreactive or that they were expressed at high genome sense). There is also perfect conservation of nucleotides 7, 11 levels in the original infected suckling mouse brain that was used as and 14 among the four viruses analysed. the inoculum for the generation of MAF. In comparison, the intensity of the G protein is much lower. Likewise, the G protein of FLAV also Phylogenetic analysis had a low level of detection by immunoblotting. It has been suggested that this is due to low levels of synthesis of the protein (Boyd and Phylogenetic analyses were performed on the deduced full-length Whitaker-Dowling, 1988). N (highly conserved) and G (divergent) proteins of WONV with selected

Fig. 6. (A) Complementarity of the 3′ and 5′ termini of the WONV genome. (B) Alignment of the WONV 3′ leader sequence with the leader sequences of three other representative vertebrate rhabdoviruses. Conserved nucleotides are indicated (⁎) and perfectly conserved nucleotides at the 3′ genome termini of all depicted viruses are indicated in bold. The transcription initiation sequences for the N gene are indicated in bold at the 5′ ends of the sequences. 20 A.J. Gubala et al. / Virology 376 (2008) 13–23 full-length sequences in GenBank of other classified and unclassified (growth media, GM) or 2.5% (maintenance media, MM) fetal calf members of the Rhabdoviridae, with the exception of the plant-infecting serum, at 37 °C. At 4 days post infection (dpi), the infected cell culture rhabdoviruses. Bootstrap resampling performed on the data indicated a supernatant was centrifuged at 2000 ×g for 10 min to remove cellular high reliability of the generated trees. The phylogenetic analysis of these debris and the virus was subsequently pelleted by ultracentrifugation two full-length proteins, depicted in Fig. 7, supports the conclusion that at 206,000 ×g for 40 min in a Beckman type 55.2Ti rotor. Total RNA was WONV is closely related to FLAV (Bourhy et al., 2005). The trees con- extracted from the crude virus pellet using the RNeasy Mini Kit structed in our study support the presence of the diverse dimarhabdo- (QIAGEN, Germany) and quantified using the GeneQuant II RNA/DNA virus supergroup and highlight the need for further exploration to calculator. enable better classification of viruses, such as WONV, that do not fit into any existing genus. Electron microscopy of WONV In summary, the genomic characterisation of WONV has revealed the presence of five novel proteins. The roles and functions of these WONV-infected BHK-BSR cells were prepared for examination via proteins are unknown but they could play a role in the regulation of transmission electron microscopy. Specifically, samples were pro- replication and transcription, as has been proposed for the ephemer- cessed into resin blocks, sectioned and stained as previously described oviruses (Dhillon et al., 2000). WONV falls into the dimarhabdovirus (Hyatt et al., 2000), the only difference being that cacodylate and not supergroup that consists of mainly vertebrate and dipteran isolates, the described phosphate buffer was used. Infected cells were also and is most closely related to FLAV, a virus isolated from birds and examined using the grid cell culture (GCC) technique (Hyatt et al., mosquitos. These results support the speculation that WONV probably 1987). Briefly, cells were grown on parlodion-filmed, carbon-coated has an avian host. Assuming this, WONV displays a novel and unique gold grids and infected overnight with WONV at a multiplicity of genome structure that has not yet been described for any animal 0.15 TCID50/cell. Ultrathin sections and GCCs were examined at 100 kV rhabdovirus. Immunodetection of WONV-specific proteins has sug- with either a Philips CM120 or a Hitachi H7000 transmission electron gested that at least four of the five predicted novel proteins are microscope. expressed in infected cells, and further studies are underway into their roles and functions. The discovery of these novel proteins highlights A modified PCR-select cDNA subtraction method for isolation of viral that current knowledge of the diversity of the Rhabdoviridae is still sequences limited, and that studies of other poorly characterised rhabdoviruses are necessary to decipher this diverse and complex virus family. The isolation of viral genomic cDNA was performed using the Clontech PCR-select cDNA Subtraction Kit (Clonetech, Mountain View, Materials and methods CA) with some modifications to increase the efficiency of recovery. Briefly, cDNA was synthesized using 1.5 µg random hexamer primer Virus propagation and RNA extraction and 2 µg of total genomic RNA that was extracted from TCSN collected from cell culture infected with WONV (tester) and BEFV (driver). The WONV (strain CS264) was isolated from a pool of 45 female biting cDNA preparations were digested with RsaI to generate smaller cDNA midges (Culicoides austropalpalis (Lee and Reye, 1955)). BEFV (strain fragments. We modified the subtraction method by employing CS1927), was used as the “driver” in subtractive hybridization HaeIII and AluI as alternative blunt-end cutting enzymes to generate reactions. The propagation of both viruses for the work undertaken three different restriction libraries of the WONV genome, each con- in this study was performed in BHK-BSR cells that were grown in Basal taining different fragments of the genome with overlapping regions.

Medium Eagle supplemented with 10 mM HEPES, 6.7 mM NaHCO3, Kit adaptors 1 and 2R were ligated to each of the three digested 2mML-glutamine, 137 µM streptomycin, 80 U/ml penicillin and 5% tester cDNA libraries. After the addition of excess driver cDNA, two

Fig. 7. Phylogenetic analyses of full-length N proteins (A) and G proteins (B) of WONV (in bold) with selected cognate proteins of animal and dipteran Rhabdoviridae available on the GenBank database. Viruses falling within specific genera are indicated. Bootstrap values above 70 from 100 resampled data sets were overlaid on the trees. The bar represents the expected substitutions per site. A.J. Gubala et al. / Virology 376 (2008) 13–23 21 hybridization steps were performed to enrich for cDNA sequences sulting PCR products were purified using the QIAquick PCR Purification unique to each tester sample. The tester-specific sequences were then Kit (QIAGEN) and sequenced directly. For additional confirmation, the further enriched by primary and secondary nested PCR amplification. PCR products were also cloned into pCR-Blunt II-TOPO and sequence Products from the secondary PCR amplification step from each of the was confirmed by analysis of least ten independent clones with the three subtractions were subsequently analysed on 1% agarose gels and same insert. size-purified into four fractions using the QIAquick Gel Extraction Kit (QIAGEN). Each fraction was treated with DNA Polymerase I Large DNA sequencing and analysis Fragment (Klenow) (New England Biolabs, USA) at 25 °C for 20 min and purified using the QIAquick PCR Purification Kit (QIAGEN). Each of Sequencing of purified plasmid DNA or PCR products was performed the fractionated samples was cloned into pCR-Blunt II-TOPO and using the BigDye Terminator v. 1.1 kit and the ABI PRISM 3130xl Genetic electroporated into TOP10 Escherichia coli according to the kit manual Analyzer (both from Applied Biosystems, USA) according to the manu- (Invitrogen). E. coli colonies containing inserts were selected on LB facturer's protocols. agar containing 50 µg/ml Kanamycin (Gibco). This was followed by Primary assembly, consensus sequence generation, and routine further propagation in LB broth and plasmid isolation using the sequence management were performed using the programs SeqMan v. QIAprep Spin Miniprep Kit (QIAGEN). The inserts were subsequently 7.0.0 (Lasergene v. 6, DNASTAR) and Clone Manager v. 8 (Sci Ed Central). sequenced. Sequence similarity searches of GenBank/EMBL and SWISSPROT databases were performed using the BLAST service (http://www. PCR amplification of the WONV genome ncbi.nlm.nih.gov)(Altschul et al., 1997). Amino acid sequence identities of the deduced WONV proteins with equivalent proteins of cDNA synthesis was carried out using 1 µg of RNA and 1.5 µg random other members of the Rhabdoviridae were determined by ClustalW hexamer primer (RP-6) using the StrataScript First-Strand Synthesis [Accurate] pairwise alignment using MegAlign v. 6.00 (Lasergene v. 6, System (Stratagene, La Jolla, CA), according to the manufacturer's DNASTAR). Deduced protein sequences were analysed using Predict- instructions. PCR primer pairs were designed using the sequences of Protein (http://www.predictprotein.org), ProtScale and SignalP pro- cDNA fragments obtained from the subtractions, each amplifying grams available at the ExPASy Proteomics Server (http://au.expasy.org) overlapping regions of 500–800 nt that collectively covered the entire and Phobius (http://phobius.cgb.ki.se/). Phylogenetic analyses were WONV genome, excluding the termini. All primers were synthesized by performed using programs available through the BioManager at the GeneWorks, Australia. Each PCR amplification reaction contained 0.2 µM ANGIS web interface (http://www.angis.org.au). Deduced full-length each primer, 22 µl Platinum PCR SuperMix (Invitrogen), and 1 µl cDNA WONV proteins were aligned with cognate proteins from other mem- (equivalent to 1 to 10 ng cDNA) as template. PCR products were purified bers of the Rhabdoviridae using ClustalW [Accurate]. The alignments using the QIAquick PCR Purification Kit or the QIAquick Gel Extraction kit were truncated at both ends to avoid gaps and ensure maximum (QIAGEN) and sequenced directly to obtain a contiguous, consensus compatibility of the compared sequences. Evolutionary relationships sequence for the entire WONV genome, excluding the genome termini. were estimated using the distance matrix method (Protdist) and neighbour-joining phylogenetic trees were visualised using TreeView Characterisation of the genome terminal sequences by RACE v. 1.6.6 (Page, 1996). Bootstrap resampling (100 replicates) was performed on aligned sequences using Seqboot to confirm the statis- A modified protocol for the rapid amplification of cDNA ends tical reliability of the generated phylogenetic trees. (RACE) was used to obtain the sequences of the 5′ and 3′ termini of the WONV genome (Li et al., 2005; Tillett et al., 2000). For 5′ RACE, cDNA Polyacrylamide gel electrophoresis and immunoblotting was synthesized from total genomic RNA using the SuperScript III Reverse Transcriptase system (Invitrogen) and 250 ng of a virus- BHK-BSR monolayers were grown to 80% confluency in 20 cm2 specific primer (5′-AGAATCAGACTGCAAAGGCAATC-3′) designed 254 tissue culture plates (Nunc) and were infected with WONV at a nt from the 5′ genome terminus. The sample was then RNaseH treated multiplicity of 3–4 TCID50/cell or were mock infected. The inoculum at 37 °C for 20 min, purified using the QIAquick PCR Purification Kit was removed after 1 h and replaced with fresh MM. At 0,17, 21 and 44 h (QIAGEN), and then a 5′-phosphorylated 3′-end cordecypin-blocked post infection the cells were harvested into phosphate-buffered saline anchor adaptor (DT88) was ligated to the cDNA using T4 RNA ligase, as A (PBSA) containing 1×Complete Protease Inhibitor Cocktail (Roche), previously described (Li et al., 2005; Tillett et al., 2000). The adaptor- followed by a wash and resuspension in 100 µl of this solution. The cell ligated cDNA was diluted 1/10 and subjected to PCR amplification with preparations were then treated according to the Invitrogen instruc- the Platinum PCR SuperMix kit (Invitrogen), using a virus-specific tions for NuPAGE Novex SDS-PAGE gel analysis of proteins. Briefly, primer (5′-CTTAATAGGCAATACAATCCG-3′) located 228 nt from the 5′ 1×LDS sample loading buffer and 1×Reducing Agent (Invitrogen) were genome terminus, and the adaptor-specific primer DT29. This was added to 20 µl aliquots of the cell preparation. Samples were heated at followed by hemi-nested PCR amplification using a virus-specific 80 °C for 10 min and sonicated for 5–7 min. Proteins were separated primer (5′-AGAGGTTTAAATTGCAAGAC-3′) located 128 nt from the under reducing conditions on NuPAGE Novex 12% Bis–Tris SDS-PAGE terminus and DT89. For 3′ RACE, the DT88 adaptor was ligated directly gels with 1×MOPS Running Buffer, and were transferred onto Hybond-P to 1 µg of total RNA prior to cDNA synthesis as described previously PVDF membrane (Amersham) with 1×Transfer Buffer (Invitrogen) (Li et al., 2005) with the exception that the ligation reaction was according to the Invitrogen western blotting transfer protocol. performed at 4 °C with the addition of 40 U RNaseOut (Invitrogen). Membranes were blocked with PBS containing 0.05% Tween-20 and Synthesis of cDNA was performed directly on an aliquot of the ligation 5% skim milk powder (Diploma), treated with polyclonal MAF (1/300) reaction containing an equivalent of 200 ng RNA using 20 pmol raised to WONV prepared according to the method as previously adaptor-specific primer DT89. The sample was diluted 1/10 and sub- described (Sartorelli et al., 1966) followed by treatment with sheep jected to PCR amplification using a virus-specific primer (5′-CATT- anti-mouse HRP-conjugated Ig (1/1000) (Silenus, Australia). The CAGCCAGGTGATAAA-3′) located 130 nt from the 3′ genome terminus membranes were immersed in Western Lightning Chemiluminescence and primer DT89. The second PCR used a hemi-nested virus-specific Substrate Reagent Plus (PerkinElmer Life Sciences) for 1 min for primer (5′-CAATGAAATCCGTAAGGACATC-3′) located 96 nt from the development of chemiluminescence and were subsequently exposed terminus, and the same adaptor-specific primer. For both 5′ and 3′ to Hyperfilm ECL (Amersham) for visualisation. MAF was produced by RACE PCR amplification, all primers were used at a 0.2 µM final inoculation of mice with a heat-inactivated infected suckling mouse concentration and reactions were performed in triplicate. The re- brain (produced at CSIRO Long Pocket Laboratories, Brisbane; kindly 22 A.J. Gubala et al. / Virology 376 (2008) 13–23 supplied by R. Weir, Darwin). This MAF has been in the past used for Coll, J.M., 1995. The glycoprotein G of rhabdoviruses. Arch. Virol. 140 (5), 827–851. fi fl Crysler, J.G., Lee, P., Reinders, M., Prevec, L., 1990. The sequence of the nucleocapsid complement xation, immuno uorescence and virus neutralization protein (N) gene of Piry virus: possible domains in the N protein of vesiculoviruses. assays (personal communication, R. Wier) and does not cross-react J. Gen. Virol. 71 (9), 2191–2194. with any other Australian rhabdoviruses. Das, S.C., Pattnaik, A.K., 2005. Role of the hypervariable hinge region of phosphoprotein P of vesicular stomatitis virus in viral RNA synthesis and assembly of infectious virus particles. J. Virol. 79 (13), 8101–8112. Database accession numbers Dhillon, J., Cowley, J.A., Wang, Y., Walker, P.J., 2000. RNA polymerase (L) gene and genome terminal sequences of ephemeroviruses bovine ephemeral fever virus The genome sequence of WONV has been deposited in the GenBank and Adelaide River virus indicate a close relationship to vesiculoviruses. Virus. Res. 70 (1–2), 87–95. database and has the accession number EF612701. The database Dietzgen, R.G., Callaghan, B., Wetzel, T., Dale, J.L., 2006. Completion of the genome accession numbers of other sequences used for comparisons and sequence of Lettuce necrotic yellows virus, type species of the genus Cytorhabdo- – – phylogenetic analyses in this study are listed as follows. ABLV, Austra- virus. Virus. Res. 118 (1 2), 16 22. Gonzalez, M.E., Carrasco, L., 2003. Viroporins. FEBS Lett. 552 (1), 28–34. lian bat lyssavirus (NC_003243); ARV, Adelaide River virus (U10363, Harty, R.N., Paragas, J., Sudol, M., Palese, P., 1999. A proline-rich motif within the matrix L09207, U05987); BEFV, Bovine ephemeral fever virus (NC_002526); protein of vesicular stomatitis virus and rabies virus interacts with WW domains of CHPV, Chandipura virus (AY614724, AY614717); COCV, Cocal virus cellular proteins: implications for viral budding. J. Virol. 73 (4), 2921–2929. Heaton, L.A., Hillman, B.I., Hunter, B.G., Zuidema, D., Jackson, A.O., 1989. Physical map of (AF045556); FLAV, Flanders virus (AF523196); HIRRV, Hirame rhabdo- the genome of sonchus yellow net virus, a plant rhabdovirus with six genes and virus (NC_005093); IHNV, Infectious hematopoietic necrosis virus conserved gene junction sequences. Proc. Natl. Acad. Sci. U. S. A. 86 (22), 8665–8668. (NC_001652); ISFV, Isfahan virus (AJ810084); LBV, Lagos bat virus Herman, R.C., 1986. Internal initiation of translation on the vesicular stomatitis virus phosphoprotein mRNA yields a second protein. J. Virol. 58 (3), 797–804. (DQ499944, AF298148); MOKV, Mokola virus (NC_006429); OITAV, Herman, R.C., 1987. Characterization of the internal initiation of translation on the Oita virus (AB116386); PIRYV, Piry virus (D26175); RABV, Rabies virus vesicular stomatitis virus phosphoprotein mRNA. Biochemistry 15 (26), 8346–8350. (NC_001542); STRV, Sea trout rhabdovirus (AF434992); SIGMAV, Hinzman, E.E., Barr, J.N., Wertz, G.W., 2002. Identification of an upstream sequence element required for vesicular stomatitis virus mRNA transcription. J. Virol. 76 (15), (X91062); SiCRV, Siniperca chuatsi rhabdovirus (NC_008514); SHRV, 7632–7641. rhabdovirus (NC_000903); SVCV, Spring viremia of carp virus Huang, Y., Zhao, H., Luo, Z., Chen, X., Fang, R.X., 2003. Novel structure of the genome of (NC_002803); TUPV, (NC_007020); VSIV, Vesicular stomatitis Indiana Rice yellow stunt virus: identification of the gene 6-encoded virion protein. J. Gen. – virus (NC_001560); VSNJV, Vesicular stomatitis New Jersey virus (K02379, Virol. 84 (8), 2259 2264. Humphrey-Smith, I., Cybinski, D.H., Byrnes, K.A., St George, T.D., 1991. Seroepidemiology V01214); VHSV, Viral hemorrhagic septicaemia virus (NC_000855); of arboviruses among seabirds and island residents of the Great Barrier Reef and WCBV, West Caucasian bat virus (AY333113). The viruses SiCRV, STRV Coral Sea. Epidemiol. Infect 107, 435–440. and WONV are not yet recognised by the ICTV as members of the family Hwang, L.N., Englund, N., Pattnaik, A.K., 1998. Polyadenylation of vesicular stomatitis virus mRNA dictates efficient transcription termination at the intercistronic gene Rhabdoviridae and therefore their abbreviations are tentative and junctions. J. Virol. 72 (3), 1805–1813. subject to approval. Hyatt, A.D., Eaton, B.T., Lunt, R., 1987. The grid–cell–culture technique: the direct examination of virus-infected cells and progeny viruses. J. Microsc. 145 (1), 97–106. Acknowledgments Hyatt, A.D., Gould, A.R., Zupanovic, Z., Cunningham, A.A., Hengstberger, S., Whittington, R.J., Kattenbelt, J., Coupar, B.E., 2000. Comparative studies of piscine and amphibian We would like to acknowledge and thank Toby St George and Steve iridoviruses. Arch. Virol. 145 (2), 301–331. International Committee on the Taxonomy of Viruses, 2005. Rhabdoviridae. In: Fauquet, Davis for the isolation of WONV, and Dean Gibson for the collection C. (Ed.), Virus Taxonomy: Classification and Nomenclature of Viruses. Eighth Report and identification of Culicoides spp. We gratefully thank Peter Walker of the International Committee on the Taxonomy of Viruses. Elsevier Academic and Linfa Wang for their valuable advice and reviewing of this Press, San Diego, Calif., pp. 623–644. Jack, P.J., Boyle, D.B., Eaton, B.T., Wang, L.F., 2005. The complete genome sequence of manuscript, Tony Pye for providing the sequencing service, Richard J virus reveals a unique genome structure in the family Paramyxoviridae. J. Virol. Weir and others at the Berrimah Veterinary Laboratories for general 79 (16), 10690–10700. advice, and Frank Filippi for his assistance with the graphics. We Jayakar, H.R., Murti, K.G., Whitt, M.A., 2000. Mutations in the PPPY motif of vesicular gratefully acknowledge the funding contributed by the Australian stomatitis virus matrix protein reduce virus budding by inhibiting a late step in virion release. J. Virol. 74 (21), 9818–9827. Biosecurity CRC and DSTO in support of this work. Jayakar, H.R., Jeetendra, E., Whitt, M.A., 2004. Rhabdovirus assembly and budding. Virus. Res. 106 (2), 117–132. Karabatsos, N. (Ed.), 1985. The American Committee on Arthropod-borne Viruses: References International Catalog of Arboviruses Including Certain Other Viruses of Vertebrates, Third ed. American Society for Tropical Medicine and Hygiene, San Antonio, TX. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., Kongsuwan, K., Cybinski, D.H., Cooper, J., Walker, P.J., 1998. Location of neutralizing 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search epitopes on the G protein of bovine ephemeral fever rhabdovirus. J. Gen. Virol. 79 programs. Nucleic. Acids. Res. 25 (17), 3389–3402. (11), 2573–2581. Barr, J.N., Wertz, G.W., 2001. Polymerase slippage at vesicular stomatitis virus gene junctions Kurath, G., Leong, J.C., 1985. Characterization of infectious hematopoietic necrosis virus to generate poly(A) is regulated by the upstream 3′-AUAC-5′ tetranucleotide: im- mRNA species reveals a nonvirion rhabdovirus protein. J. Virol. 53 (2), 462–468. plications for the mechanism of transcription termination. J. Virol. 75 (15), 6901–6913. Kuzmin, I.V., Hughes, G.J., Rupprecht, C.E., 2006. Phylogenetic relationships of seven Barr, J.N., Whelan, S.P., Wertz, G.W., 1997. cis-Acting signals involved in termination of previously unclassified viruses within the family Rhabdoviridae using partial vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the U7 nucleoprotein gene sequences. J. Gen. Virol. 87 (8), 2323–2331. signal for polyadenylation. J. Virol. 71 (11), 8718–8725. Landes-Devauchelle, C., Bras, F., Dezelee, S., Teninges, D., 1995. Gene 2 of the sigma Basurco, B., Benmansour, A., 1995. Distant strains of the fish rhabdovirus VHSV maintain rhabdovirus genome encodes the P protein, and gene 3 encodes a protein related to a sixth functional cistron which codes for a nonstructural protein of unknown the reverse transcriptase of retroelements. Virology 213 (2), 300–312. function. Virology 212 (2), 741–745. Lee, D.J., Reye, E.J., 1955. Australasian Ceratopogonidae (Diptera, Nematocera). Part. VII. Black, B.L., Rhodes, R.B., McKenzie, M., Lyles, D.S., 1993. The role of vesicular stomatitis Notes on the genera Alluaudomyia, Ceratopogon, Culicoides and Lasiohelea. Proc. virus matrix protein in inhibition of host-directed gene expression is genetically Linn. Soc. N.S.W. 79, 233–246. separable from its function in virus assembly. J. Virol. 67 (8), 4814–4821. Li, Z., Yu, M., Zhang, H., Wang, H.Y., Wang, L.F., 2005. Improved rapid amplification of Blondel, D., Harmison, G.G., Schubert, M., 1990. Role of matrix protein in cytopathogen- cDNA ends (RACE) for mapping both the 5′ and 3′ terminal sequences of esis of vesicular stomatitis virus. J. Virol. 64 (4), 1716–1725. paramyxovirus genomes. J. Virol. Methods 130 (1–2), 154–156. Bourhy, H., Cowley, J.A., Larrous, F., Holmes, E.C., Walker, P.J., 2005. Phylogenetic Lichty, B.D., McBride, H., Hanson, S., Bell, J.C., 2006. Matrix protein of Vesicular relationships among rhabdoviruses inferred using the L polymerase gene. J. Gen. stomatitis virus harbours a cryptic mitochondrial-targeting motif. J. Gen. Virol. 87 Virol. 86 (10), 2849–2858. (11), 3379–3384. Bowden, T.R., Westenberg, M., Wang, L.F., Eaton, B.T., Boyle, D.B., 2001. Molecular Maurer-Stroh, S., Eisenhaber, B., Eisenhaber, F., 2002. N-terminal N-myristoylation of characterization of Menangle virus, a novel paramyxovirus which infects pigs, fruit proteins: refinement of the sequence motif and its taxon-specific differences. J. Mol. bats, and humans. Virology 283 (2), 358–373. Biol. 317 (4), 523–540. Boyd, K.R., Whitaker-Dowling, P., 1988. Flanders virus replication and protein synthesis. McWilliam, S.M., Kongsuwan, K., Cowley, J.A., Byrne, K.A., Walker, P.J., 1997. Genome Virology 163 (2), 349–358. organization and transcription strategy in the complex GNS-L intergenic region of Calisher, C.H., Karabatsos, N., Zeller, H., Digoutte, J.P., Tesh, R.B., Shope, R.E., Travassos da bovine ephemeral fever rhabdovirus. J. Gen. Virol. 78 (6), 1309–1317. Rosa, A.P., St George, T.D., 1989. Antigenic relationships among rhabdoviruses from Muller, M.J., Murray, M.D., Edwards, J.A., 1981. Blood-sucking midges and mosquitoes vertebrates and hematophagous arthropods. Intervirology 30 (5), 241–257. feeding on mammals at Beatrice Hill, N.T. Austral. J. Zool. 29, 573–588. A.J. Gubala et al. / Virology 376 (2008) 13–23 23

Page, R.D., 1996. TreeView: an application to display phylogenetic trees on personal sequences required for efficient termination and initiation of VSV transcripts. computers. Comput. Appl. Biosci. 12 (4), 357–358. J. Virol. 71 (3), 2127–2137. Petersen, J.M., Her, L.S., Varvel, V., Lund, E., Dahlberg, J.E., 2000. The matrix protein of Stillman, E.A., Whitt, M.A., 1999. Transcript initiation and 5′-end modifications are vesicular stomatitis virus inhibits nucleocytoplasmic transport when it is in the separable events during vesicular stomatitis virus transcription. J. Virol. 73 (9), nucleus and associated with nuclear pore complexes. Mol. Cell Biol. 20 (22), 7199–7209. 8590–8601. Tanno, F., Nakatsu, A., Toriyama, S., Kojima, M., 2000. Complete nucleotide sequence of Poch, O., Blumberg, B.M., Bougueleret, L., Tordo, N., 1990. Sequence comparison of five Northern cereal mosaic virus and its genome organization. Arch. Virol. 145 (7), polymerases (L proteins) of unsegmented negative-strand RNA viruses: theoretical 1373–1384. assignment of functional domains. J. Gen. Virol. 71 (5), 1153–1162. Tesh, R.B., Travassos Da Rosa, A.P., Travassos Da Rosa, J.S., 1983. Antigenic relationship Rao, B.L., Basu, A., Wairagkar, N.S., Gore, M.M., Arankalle, V.A., Thakare, J.P., Jadi, R.S., Rao, among rhabdoviruses infecting terrestrial vertebrates. J. Gen. Virol. 64 (1), 169–176. K.A., Mishra, A.C., 2004. A large outbreak of acute encephalitis with high fatality rate Thoulouze, M.I., Bouguyon, E., Carpentier, C., Bremont, M., 2004. Essential role of the NV in children in Andhra Pradesh, India, in 2003, associated with Chandipura virus. protein of Novirhabdovirus for pathogenicity in rainbow trout. J. Virol. 78 (8), Lancet 364 (9437), 869–874. 4098–4107. Reed, S.E., Tsai, C.W., Willie, K.J., Redinbaugh, M.G., Hogenhout, S.A., 2005. Shotgun Tillett, D., Burns, B.P., Neilan, B.A., 2000. Optimized rapid amplification of cDNA ends sequencing of the negative-sense RNA genome of the rhabdovirus Maize mosaic (RACE) for mapping bacterial mRNA transcripts. Biotechniques. 28 (3), 448, 450, virus. J. Virol. Methods 129 (1), 91–96. 452–3, 456. Revill, P., Trinh, X., Dale, J., Harding, R., 2005. Taro vein chlorosis virus: characterization Tordo, N., Poch, O., Ermine, A., Keith, G., Rougeon, F., 1986. Walking along the rabies and variability of a new nucleorhabdovirus. J. Gen. Virol. 86 (2), 491–499. genome: is the large G–L intergenic region a remnant gene? Proc. Natl. Acad. Sci. Sartorelli, A.C., Fischer, D.S., Downs, W.G., 1966. Use of sarcoma 180/TG to prepare U. S. A. 83 (11), 3914–3918. hyperimmune ascitic fluid in the mouse. J. Immunol. 96 (4), 676–682. Walker, P.J., Kongsuwan, K., 1999. Deduced structural model for animal rhabdovirus Schmitt, A.P., Lamb, R.A., 2004. Escaping from the cell: assembly and budding of glycoproteins. J. Gen. Virol. 80 (5), 1211–1220. negative-strand RNA viruses. Curr. Top. Microbiol. Immunol. 283, 145–196. Walker, P.J., Byrne, K.A., Cybinski, D.H., Doolan, D.L., Wang, Y.H., 1991. Proteins of bovine Schnell, M.J., Buonocore, L., Whitt, M.A., Rose, J.K., 1996. The minimal conserved ephemeral fever virus. J. Gen. Virol. 72 (1), 67–74. transcription stop-start signal promotes stable expression of a foreign gene in Walker, P.J., Byrne, K.A., Riding, G.A., Cowley, J.A., Wang, Y., McWilliam, S., 1992. The vesicular stomatitis virus. J. Virol. 70 (4), 2318–2323. genome of bovine ephemeral fever rhabdovirus contains two related glycoprotein Scholthof, K.B., Hillman, B.I., Modrell, B., Heaton, L.A., Jackson, A.O., 1994. Characteriza- genes. Virology 191 (1), 49–61. tion and detection of sc4: a sixth gene encoded by sonchus yellow net virus. Walker, P.J., Wang, Y., Cowley, J.A., McWilliam, S.M., Prehaud, C.J., 1994. Structural and Virology 204 (1), 279–288. antigenic analysis of the nucleoprotein of bovine ephemeral fever rhabdovirus. Soria, M., Little, S.P., Huang, A.S., 1974. Characterization of vesicular stomatitis J. Gen. Virol. 75 (8), 1889–1899. virus nucleocapsids. I. Complementary 40 S RNA molecules in nucleocapsids. Wang, Y., Walker, P.J., 1993. Adelaide river rhabdovirus expresses consecutive Virology. 61 (1), 270–280. glycoprotein genes as polycistronic mRNAs: new evidence of gene duplication as Springfeld, C., Darai, G., Cattaneo, R., 2005. Characterization of the Tupaia rhabdovirus an evolutionary process. Virology 195 (2), 719–731. genome reveals a long open reading frame overlapping with P and a novel gene Wang, Y., McWilliam, S.M., Cowley, J.A., Walker, P.J.,1994. Complex genome organization in encoding a small hydrophobic protein. J. Virol. 79 (11), 6781–6790. the GNS-L intergenic region of Adelaide River rhabdovirus. Virology 203 (1), 63–72. Stillman, E.A., Whitt, M.A., 1997. Mutational analyses of the intergenic dinucleotide and Wetzel, T., Dietzgen, R.G., Dale, J.L., 1994. Genomic organization of lettuce necrotic the transcriptional start sequence of vesicular stomatitis virus (VSV) define yellows rhabdovirus. Virology 200 (2), 401–412.