University of Alberta
Taxonomy and Conservation of Apodemia mormo (Lepidoptera: Riodinidae) in North America
by
Benjamin Tyler Proshek
A thesis submitted to the Faculty of Graduate Studies and Research m partial fulfillment of the requirements for the degree of
Master of Science
in Systematics & Evolution
Department of Biological Sciences
©Benjamin Tyler Proshek Spring 2011 Edmonton, Alberta
Permission is hereby granted to the University of Alberta Libraries to ieproduce single copies of this thesis and to lend or sell such copies for private, scholarly or scientific research purposes only Where the thesis is converted to, or otherwise made available in digital form, the University of Alberta will advise potential users of the thesis of these terms
The author reserves all other publication and other rights in association with the copyi ight in the thesis and, except as herein before provided, neither the thesis nor any substantial portion thereof may be pi mted or otherwise reproduced in any material form whatsoever without the author's prior written permission Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington OttawaONK1A0N4 Ottawa ON K1A 0N4 Canada Canada
Your file Votre r6f6rence ISBN: 978-0-494-80974-7 Our file Notre r6f6rence ISBN: 978-0-494-80974-7
NOTICE: AVIS:
The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vend re des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.
1+1 Canada Examining Committee
Dr. Felix Sperling, Department of Biological Sciences Dr. Jocelyn Hall, Department of Biological Sciences Dr. Nadir Erbilgin, Department of Renewable Resources
Committee Chair Dr. Warren Gallin, Department of Biological Sciences Abstract
The Mormon Metalmark, Apodem/a mormo (Lepidoptera: Riodinidae), is a widespread and geographically variable North American butterfly. Three populations have received formal conservation ranking: two Canadian populations in British Columbia and Saskatchewan ("endangered" and
"threatened", respectively), and one subspecies, A. m. langei, in central
California ("endangered"). Using 1498 base pairs of mtDNA (COI) gene sequence data, a suite of six novel microsatellite loci and 11 dorsal wing characters, I tested the hypotheses implicit in those conservation rankings:
1) that the two Canadian populations are distinct and one is more at risk than the other, and 2) that A m. langei is a valid subspecies and qualifies as an evolutionarily significant unit. I conclude that the first hypothesis is corroborated but the second is tenuous, on the basis of the range-wide genetic diversity of the species. The findings have important ramifications for the conservation prioritization and management of these populations. Acknowledgements
I thank the Department of Biological Sciences, University of Alberta and an NSERC Discovery Grant to Felix Sperling for the funding to make this project possible; Felix Sperling, Jerry Powell and Anna Engberg for all their previous work upon which this research stands; Paul Gregoire of the Canadian Wildlife Service, Ann Potter and David Gadwa of the Washington Department of Fish and Wildlife (WDFW), and Penny Lalonde of the Saskatchewan Ministry of the Environment for assistance in obtaining collecting and transportation permits; Jeff Heinlein and Dale Swedberg of the WDFW and Jonathan Pelham for tips on where to find Apodemia mormo in Washington; Chuck Harp and especially Steve Kohler for invaluable assistance locating A mormo in Montana; Ron Royer and especially Jim Oberfoell for assistance in collecting A. mormo in North Dakota; Ron Royer and Gary Marrone for information on where to find A. mormo in South Dakota; Pat Fargey, Rob Sissons and the Grasslands National Park staff, especially Allison Henderson, Krista Fink, Meagan Fairbairn, and Courtney Dutchak, for accommodation and material assistance in collecting A mormo in Grasslands National Park, SK; sundry individual collectors, especially Ken Davenport, for collecting many unusual and interesting Apodemia from across North America that otherwise would have been unavailable; Corey Davis for his invaluable technical support; my examining committee, Jocelyn Hall and Nadir Erbilgin; and finally, the Sperling lab members, especially Thomas Simonsen, Lisa Lumley, and Jason Dombroskie, for practical advice, support, and camaraderie. Table of Contents
Chapter 1: General Introduction 1
Apodemia mormo: Life History 2
Apodemia mormo in Antioch Dunes National Wildlife Refuge 3
Apodemia mormo in British Columbia and
Saskatchewan 4
Thesis Overview 5
Literature Cited 8
Chapter 2: Apodemia mormo in Canada: population genetic data support prior conservation ranking 15
Introduction 15
Materials and Methods 17
Sampling 17
DNA Extraction 17
mtDNA Sequencing 18
Microsatellite Development 19
Microsatellite Amplification 20
Analyses 21
Results 24
COI Sequence and Haplotype Diversity 24
Phylogenetic Relationships Based on COI Haplotypes 24
Demographic Hypotheses Inferred from COI Sequences 2 5
Microsatellite Diversity and Hardy-Weinberg Equilibrium 26 DEST and Pairwise Population Divergence 26
Population Genetic Structure 27
Discussion 27
Relationship Between Southern Mountain and Prairie
Populations 27
Comparison of Genetic Diversity 28
Population Structure 29
Conclusion 30
Literature Cited 32
Chapter 3: Conservation and taxonomic status of the endangered butterfly Apodemia mormo langei (Lepidoptera: Riodinidae) 47
Introduction 47
Materials and Methods 49
Sampling 49
Photographs 50
Wing Characters 50
DNA Extraction 51
mtDNA Sequencing 51
Microsateliite Development, Amplification and Genotyping 52
Analyses 52
Results 54
Taxonomic Assessment Based on Wing Characters 54
mtDNA Phylogeography 55
Eastern Lineage 55 Western Lineage 56
Microsatellite Groupings 57
Discussion 58
Literature Cited 62
Chapter 4: Thesis Summary 77
Future Directions 81
Literature Cited 83
Appendix 1: Collection localities data 86
Appendix 2: Maximum-likelihood trees from COI sequences 88
Appendix 3: Assigned taxon names 89
Appendix 4: Autobiography 93 List of Tables
Table 2-1. Collection locality data 38
Table 2-2. PCR protocol for amplification of the COI gene 39
Table 2-3. Protocol for cycle-sequencing of COI gene fragments. 39
Table 2-4. Primer sequence and characteristics of six novel microsatellite
markers isolated from Apodemia mormo 40
Table 2-5. PCR protocols for amplification of six microsatellite loci 41
Table 2-6. Summary statistics for 1498 base pairs of the COI gene 42
Table 2-7. Summary statistics for all five microsatellite loci that amplified within all eastern or western populations, and for only the four loci that
were common to both eastern and western populations 43
Table 2-8. Pairwise DEST values for all eastern populations 44
Table 2-9. Pairwise DEST values for all western populations 44
Table 3-1. Summary of the six principal sampling sources 69
Table 3-2. Diagnostic wing characters 70
Table 3-3. Type descriptions and type localities of the 17 currently recognized subspecies within the Apodemia mormo species complex in North America (Pelham 2008) 71 Table 3-4. Diagnostic wing characters (see Table 3-2 and Fig. 3-1) scored for each of the 17 subspecies of the Apodemia mormo species complex 72 List of Figures
Figure 1-1. Species ranges and subspecies type localities of the Apodemia mormo complex, including A mormo (yellow, circles), A virgulti (black, squares) and A mejicanus (white, stars). Ranges are approximate and modified from Brown et al. (1992), Opler & Wright (1999), Brock & Kaufman (2003), Fisher (2009), and Opler et al. (2010). Black dots indicate locations where samples were collected for this study. Solid black dots indicate samples of the A mormo complex; empty dots indicate outgroups. 14
Figure 2-1. Map of sampling locations in Table 2-1, with inset of North America showing the study region. Numbers in parentheses indicate number of specimens from which genetic data was obtained. 45
Figure 2-2. Maximum likelihood phylogram of 78 unique haplotypes based on 1498 base pairs of the COI gene. Columns after terminal tips indicate number of specimens represented by each identical haplotype followed by geographical origin of those specimens. Haplotypes and labels representing British Columbia and Saskatchewan specimens are bolded. Numbers above branches indicate bootstrap support based on 200 replicates. Scale bar is proportional to changes per site. 46
Figure 3-1. Illustration of eleven wing characters and selected states listed in Table 3-2. 73 Figure 3-2. Maximum-likelihood tree of all unique COI haplotypes generated in Garli 1.0 (Zwickl 2006), rooted with Calephelis wrighti and Emesis emesia and trimmed in order to show the relationship of the outgroups to the Apodemia sequences. "A" corresponds to figure Appendix 2A, "B" to figure Appendix 2B. Terminal tips correspond to unique haplotypes (Appendix 1). Haplotypes are 648 bp, except for 4101,4102 and 4103, which are 1498 bp. Letters indicate state or province of collection: AZ: Arizona, BS: Baja Sur, CA: California, CO: Colorado, SI: Sinaloa. Numbers proximal to letters indicate location ID numbers (Appendix 1). Numbers above branches indicate bootstrap support based on 250 repetitions. Scale bar proportional to changers per site. 74
Figure 3-3. Trees generated from microsatellite frequency and mtDNA sequence data. Numbers after names indicate location ID numbers (Appendix 1); numbers in parentheses indicate number of specimens represented at each location. Unshaded branches indicate specimens of Apodemia mormo; darker-shaded branches indicate specimens of A m. langei or A m. nr. langei; lighter-shaded branches indicate specimens that are not A mormo. (A) Neighbor-joining tree constructed in P0PTREE2 (Takezaki et al. 2010) from genetic DA distances of microsatellite allele frequencies of the a priori populations at each terminal tip. Numbers above branches indicate bootstrap support based on 1000 bootstrap repetitions. (B) Maximum-likelihood tree generated in Garli 1.0 (Zwickl 2006) from 1498 bp of the COI gene from the same specimens represented in tree A. Terminal tips have been manually condensed to simplify groupings in order to show correspondence between trees. Numbers above branches indicate bootstrap support based on 250 bootstrap repetitions. Lettered clades correspond to clades in Appendix 2. 75 Figure 3-4. Collection locations and geographic distribution of the Apodemia mormo species complex. Range modified from Brown et al. (1992), Opler & Wright (1999), Brock & Kaufman (2003), and Opler et al. (2010). Solid dots indicate Apodemia mormo complex samples; empty dots indicate outgroups. Coloured histograms indicate proportional representation of samples from location in one of the six Q groups generated from microsatellite allele frequencies in STRUCTURE (Pritchard et al. 2000) figured on the right (numbers in the colour groups correspond to groupings in Appendix 2). Non-parenthetical numbers indicate location ID numbers (see Appendix 1); parenthetical numbers indicate number of samples for which microsatellite allele frequencies were recorded. 76 1
CHAPTER 1: GENERAL INTRODUCTION
Modern rates of global habitat and biodiversity loss are approaching record levels (Pimm & Raven 2000, Novacek 2007, Stork 2010). In the struggle to conserve the remaining biodiversity, insects are key. Not only do insects number more species than any other metazoans (Erwin 1991, Stork 1997) and account for more extinctions (Dunn 2005), they are excellent indicator species for and integral components of virtually every ecosystem on the earth (New 2009, Samways et al. 2010). Butterflies in particular are prime targets for conservation because of their ubiquity, conspicuity, aesthetic value, and the wealth of ecological information available for many of them (New 1997, Van Dyck et al. 2009, Bonebrake et al. 2010). In North America, butterflies are the most likely group of insects to attract conservation attention. In the United States, there are currently 60 insects on the United States Endangered Species List, 19 of which are butterflies (US Fish and Wildlife Service 2010). Six of the butterflies were among the first insects to be placed on the Endangered Species List in 1976, including Lange's Metalmark, Apodemia mormo langei Comstock, 1939 (Powell & Parker 1993). In Canada, of the 29 insects listed under Schedule 1 of the Species At Risk Act (SARA), which includes the categories of extirpated, endangered, threatened or of special concern, 18 are butterflies (Environment Canada 2010). Two of these are two separate populations of the Mormon Metalmark, Apodemia mormo (Felder & Felder, 1859): one in British Columbia and the other in Saskatchewan. Apodemia mormo is the only member of the family Riodinidae on any list of endangered species worldwide. This uniqueness is likely an artifact of the few species of riodinids found outside the Neotropical ecozone, since most invertebrate conservation efforts are biased towards species in temperate, well-developed areas (New 1997, Samways 2005). Worldwide, approximately 1400 of the 14,000 described species of true butterflies (Papilionoidea) are found in the Riodinidae (Heppner 1991, Robbins 1982, Robbins 1992, Robbins & Opler 1997, Lamas 2008). Riodinidae is unique, however, in the degree to which its biodiversity is concentrated in the Neotropical ecozone (Robbins et al. 1996, DeVries 1997). There 2 are only 20 species in North America, for example, and in Canada A mormo is the only representative (Scott 1986).
Apodemia mormo: Life History
Apodemia mormo is the most wide-ranging metalmark (riodinid) species in North America, occurring from central Mexico to Canada (Fig. 1-1) (Scott 1986). It belongs to a complex of closely related species along with A. virgulti (Behr, 1865), which is found in southern California and Mexico, and A mejicanus (Behr, 1865), which is found from southern California to Texas and north to Colorado (Fig. 1-1). There is wide geographical variation in wing patterns, resulting in 17 recognized subspecies (Pelham 2008). However, there is no consensus on the taxonomy of the species complex (e.g. Emmel & Emmel 1973, Pratt & Ballmer 1991, Emmel 1998, Davenport 2004). Apodemia mormo is found in a wide variety of ecological habitats, from sea level to tree line, but typically occurs in arid environments where its host plants, various wild buckwheats of the genus Eriogonum (Polygonaceae), flourish in exposed, nutrient-poor soil (Arnold & Powell 1983). Dozens of species of Eriogonum have been reported as hosts, but generally only one species is used by any one population of A mormo (Scott 1986). The life cycle of the butterfly is closely tied to its Eriogonum host. In the northern part of the range of A mormo there is one flight per year, in the late summer. In the southern part there may be several flights per year or even year- round reproduction (Scott 1986). Males perch and patrol for females during the middle part of the day, and courtship is brief. Pink spherical ova are laid singly or in small clusters near the base of the host plant and hatch within a few days (Scott 1986). The larvae are dark purple with four rows of yellow nodules from which protrude dark bristly hairs (Pyle 2002). They are solitary feeders for the most part, feeding on the leaves, flowers and stem of the host during the early morning and late evening hours when temperatures are cooler (Petersen et al. 2010). During the day they retire to silken shelters in dead, hollow stems and debris at the base of the 3 host plants (Scott 1986). Mature larvae are known to wander in search of forage and pupation sites (Petersen et al. 2010). In the northern part of the range, winter is passed by early-instar larvae in a silken shelter in debris near the base of an Eriogonum host before resuming feeding in the spring (Petersen et al. 2010). Adults are small, with a wingspan of 25-31 mm, with dark wings covered with white patches and some degree of orange or reddish scaling and fringed with black and white; the sexes are similar, although females are larger on average (Opler & Wright 1999). The adults live about 10 days and are quite local, with males and females dispersing an average of only 49 m and 64 m, respectively (Arnold & Powell 1983).
Apodemia mormo in Antioch Dunes National Wildlife Refuge
The only population of the subspecies Apodemia mormo langei was discovered in 1933 along the banks of the San Joaquin river upstream of San Francisco (Comstock 1939). Its namesake was Comstock's associate W. Harry Lange, professor of entomology at the University of California, Davis (Comstock 1939). Suitable habitat for this butterfly is confined to open dunes with blowing sand which allow for reproduction of the host plant, Eriogonum nudum auriculatum (Powell and Parker 1993). At the turn of the 20th century this habitat extended for several kilometers in a narrow band along the San Joaquin River, but sand mining for the development of San Francisco began to compromise and fragment the habitat. By 1979 suitable habitat for A m. langei reached its lowest extent, about 1.3 ha in total (Parker & Powell 1993). This led to A. m. langei being placed on the US Endangered Species List in 1976 (Federal Register 41:22044) and the Antioch Dunes National Wildlife Refuge (NWR) being established in 1980 to protect Lange's Metalmark as well as several rare plants that also rely on the unique habitat. This was the first instance of an NWR being established expressly for the purpose of protecting rare animals or plants (US Fish & Wildlife Service 2002). Since then the Antioch Dunes NWR and surrounding area have been the focus of extensive conservation action to prevent extirpation of the host E. n. auriculatum and to bolster the population of A m. langei (Howard & Arnold 1980, US Fish & Wildlife Service 2002). Although the 4 efforts of conservationists stabilized the population of A m. langei, it remains under threat today from wildfires and invasive plants. Measures currently being taken to preserve and expand the dune habitat and restore the butterfly population include hand-clearing and herbiciding of invasive plants, planting of £ n. auriculatum seedlings, and even experimental grazing on the NWR as well as a captive breeding program of A m. langei (Black & Vaughan 2005, Johnson et al. 2007, US Fish & Wildlife Service 2008).
Apodemia mormo in British Columbia and Saskatchewan
In British Columbia, the only population of A mormo consists of 11 small colonies scattered along several tens of kilometers along the Similkameen River valley near the town of Keremeos, mostly in areas disturbed by industrial activity. Its host plant, Eriogonum niveum, the Snowy Buckwheat, thrives in loose soil, chiefly on steep slopes where erosion reduces competition from other plants (COSEWIC 2002). It is usually found in close association with a commonly used nectar source, rabbitbrush (Ericameria nauseosus] (Guppy & Shepard 2001). In Saskatchewan, the only occurrence of A mormo consists of many small colonies scattered in the badlands of both the East and West blocks of Grasslands National Park (GNP) and nearby Prairie Farm Rehabilitation Act (PFRA) pastures, near the town of Val Marie. The most widely separated colonies are over 80 km apart. The butterfly is closely associated with its host plant, Eriogonum pauciflorum, the branched umbrella plant, which thrives on exposed clay soil where frequent erosion and/or arid conditions reduce competition with other plants (COSEWIC 2002). The butterfly's chief nectar sources are its host plant and rabbitbrush, E. nauseosus. Adults of A mormo are active from July through September, with the initial emergence associated with the flowering of E. pauciflorum (Henderson et al. 2008). Both Canadian populations, the former referred to as the Southern Mountain population and the latter as the Prairie population, were assessed as "endangered" and "threatened", respectively, by the Committee On the Status of Endangered 5
Wildlife In Canada (COSEWIC) (COSEWIC 2002) and designated as such under Canada's Species At Risk Act (SARA) in 2004 (Canada Gazette 2004). The justification for the listings was that not only are they are small, fragmented populations disjunct from and at the northern extreme of the main part of the species' range, but that the two populations represent a unique and significant contribution to Canadian biodiversity as the only representatives of the family Riodinidae in Canada (Layberry et al. 1998). The Southern Mountain population was designated as "endangered" while the Prairie population only as "threatened" since the former population was smaller, more fragmented, and found primarily on unprotected land, whereas the latter was larger, more connected, and found primarily within the bounds of a National Park (GNP) (COSEWIC 2002).
Thesis Overview
Despite the long-recognized importance of incorporating genetic information into conservation assessments (O'Brien 1994), conservation rankings are usually assigned on the basis of more easily quantifiable metrics such as population reduction and habitat loss (IUCN 2001). Genetic data are most often taken into account in defining taxa or evolutionarily distinct populations within taxa that deserve to be assessed for conservation ranking (Moritz 1994a, Green 2005, Caterino & Chatzimanolis 2009, Taylor et al. 2010). Since preservation of biodiversity in all of its forms is the overarching goal of conservation (Brooks et al. 2006), several measures of evolutionary distinctiveness have been defined in an attempt to quantify levels of biodiversity below the taxon level. One of the most widely used is the Evolutionarily Significant Unit (ESU). Originally proposed by Ryder (1986), the first widely-accepted definition was that an ESU "should be reciprocally monophyletic for mtDNA alleles and show significant divergence of allele frequencies at nuclear loci" (Moritz 1994a). The term has evolved over the years to relax the strict need for mtDNA monophyly and to emphasize evidence of historical isolation at neutral genetic markers and morphological or ecological local adaptation (de Guia & Saitoh 2007, Palsb0ll et al. 6
2007). The ESU concept continues to be widely applied today (e.g. Paplinska et al. 2010). The genetic markers I chose to use were mitochondrial cytochrome oxidase I (COI) gene sequence and a suite of microsatellites loci. Because mtDNA genes assort much faster over evolutionary time than nuclear genes due to their smaller effective population size and more rapid mutation rate, and because of the logistic advantage of large copy number, mtDNA—and the COI gene in particular—has a long history of use in studies of species boundaries and within-species variation (Moritz 1994b, Sperling 2003, Zink & Barrowclough 2008). Despite concerns about the validity of the assumption of neutral variation that often underlies interpretation of mtDNA data in such studies (Galtier et al. 2009), mtDNA remains the marker of choice (Rubinoff & Holland 2005, Behura 2006, Eytan & Hellberg 2010). Microsatellites, or simple sequence repeats (SSRs), are hyper-variable nuclear markers widely used in many fields of biology (Selkoe and Toonen 2006). Despite the inherent technical difficulties in isolating and amplifying microsatellite loci in Lepidoptera (Meglecz et al. 2004, Zhang 2004, Torres-Leguizamon et al. 2009), the large numbers of alleles per locus, rapid mutation rate, and putatively neutral variation make microsatellites excellent markers for analysis of within- species genetic variation (Behura 2006, Koopman et al. 2007, Lukoschek et al. 2008, Saarinen et al. 2009). Although genetic data are often used to define taxa or ESUs for conservation, rarely are genetic data used post hoc to test assumptions of the distinctiveness of taxa or populations that were assigned conservation ranking without genetic data. The overarching goal of this thesis was to use mtDNA sequence data and a suite of microsatellite loci to test two hypotheses: 1) the British Columbia and Saskatchewan populations of A mormo are only distantly related to each other and have different levels of genetic diversity and genetic connectedness to neighbouring unlisted populations, and 2) A mormo langei is a valid taxon or at least justifiable as an ESU. I address the first hypothesis in Chapter 2 by asking three questions: 1) how divergent are the British Columbia and Saskatchewan populations from each 7 another, 2) can population structure can be detected within each of the Canadian populations, and 3) how genetically connected are the Canadian populations to other populations of A mormo in the USA? These questions also address some of the recovery objectives outlined in the Recovery Strategies drawn up for each Canadian population (Southern Interior Invertebrates Recovery Team [2008] for the Southern Mountain population, Pruss et al. [2008] for the Prairie population) by estimating the degree to which the colonies within the Canadian populations are linked by dispersal to each other and to populations in the USA. Colonies and populations which are linked by dispersal need less management, as any local extirpations would in theory be naturally replaced by new immigrants (Frankham et al. 2004). In Chapter 3,1 address whether A mormo langei is a valid taxon, or at least an ESU, by examining the genetic and phenotypic diversity of the population at Antioch Dunes NWR in the broader context of the genetic and phenotypic diversity of A mormo in California, across the continent, and within the species complex. I ask three specific questions: 1) how diagnosable is A m. langei with the phenotypic characters used to describe it, 2) what other populations is it most closely related to, and 3) how does its genetic diversity and inferred historical isolation compare with other populations and taxa of the A mormo species complex. These questions bear on how appropriate the prior conservation effort given to A m. langei has been, but also on the possibility that other populations within the A mormo species complex may be just as deserving of conservation. Finally, by cataloguing the diversity of wing characters and the range of genetic diversity in the species complex, this work contributes to a foundation for a more complete phylogeny and taxonomic understanding of these fascinating butterflies. Overall, this study addresses the taxonomy and conservation ranking of three populations of A mormo, a charismatic and unusual North American butterfly. The questions addressed here have ramifications not only for the immediate management of these populations but also more broadly for decision-making in conservation of threatened populations. 8
Literature Cited
Arnold, RA, Powell JA (1983) Apodemia mormo langei In: Ecological Studies of Six Endangered Butterflies (Lepidoptera, Lycaenidae): Island Biogeography, Patch Dynamics, and the Design of Habitat Preserves. University of California Publications in Entomology, vol 99, pp 99-128
Behura SK (2006) Molecular marker systems in insects: current trends and future avenues. Mol Ecol 25:3087-3113
Black SH, Vaughan DM (2005) Species Profile: Apodemia mormo langei. In: Shepherd, MD, Vaughan DM, Black SH (eds) Red List of Pollinator Insects of North America CD- ROM Version 1. The Xerces Society for Invertebrate Conservation, Portland, OR
Bonebrake TC, Ponisio LC, Boggs CL, Ehrlich PR (2010) More than just indicators: A review of tropical butterfly ecology and conservation. Biol Cons 143:1831-1841
Brock JP, Kaufman K (2003) Butterflies of North America. Houghton Mifflin, New York
Brooks TM, Mittermeier RA, da Fonseca GAB, Gerlach J, Hoffmann M, Lamoreux JF, Mittermeier CG, Pilgrim JD, Rodrigues ASL (2006) Global biodiversity conservation priorities. Science 313:58-61
Brown, JW, Real HG, Faulkner DK (1992) Butterflies of Baja California: faunal survey, natural history, conservation biology. The Lepidoptera Research Foundation, Beverly Hills, CA
Canada Gazette (2004) 138:408-479
Caterino MS, Chatzimanolis S (2009) Conservation genetics of three flightless beetle species in southern California. Conserv Genet 10:203-216
Comstock, JA (1939) A new Apodemia from California (Lepidopt). Bulletin of the Southern California Academy of Sciences 37:129-131
COSEWIC (2002) COSEWIC assessment and update status report on the Mormon Metalmarki4podeA7?/a mormo in Canada. Committee on the Status of Endangered Wildlife in Canada, Ottawa
Davenport K (2004) A concise update of the information provided in The Butterflies of Southern California (1973) by Thomas C Emmel and John F Emmel. The Taxonomic Report of the International Lepidoptera Survey 4:1-23 9 de Guia APO, Saitoh T (2007) The gap between the concept and definitions in the evolutionarily significant unit: the need to integrate neutral genetic variation and adaptive variation. Ecol Res 22:604-612
DeVries, PJ (1997) The Butterflies of Costa Rica and their Natural History, II: Riodinidae. Princeton University Press, New York
Dunn (2005) Modern insect extinctions, the neglected majority. Conserv Biol 19:1030-1036
Emmel TC, ed (1998) Systematics of Western North American Butterflies. Mariposa Press, Gainesville, FL
Emmel TC, Emmel, JF (1973) The Butterflies of Southern California. Natural History Museum of Los Angeles County, Los Angeles
Environment Canada (2010) Species at Risk Public Registry. http://wwwsararegistrygcca/species/schedules_ecfm?id=l Accessed 25 October 2010
Erwin TL (1991) How many species are there?: Revisited. Conserv Biol 5:330-333
Eytan R, Hellberg M (2010) Nuclear and mitochondrial sequence data reveal and conceal different demographic histories and population genetic processes in Caribbean reef fishes. Evolution doi:101111/jl558-5646201001071x
Felder C, Felder R (1859) Wiener Entomologische Monatschrift 3:271
Fisher MS (2009) The Butterflies of Colorado: Riodinidae and Lycaenidae - Part 4: The Metalmarks, Coppers, Hairstreaks and Blues. Contributions of the Gillette Museum of Arthropod Diversity: Lepidoptera of North America title 74. Hansen Brothers Printing, Littleton, CO.
Frankham R, Ballou JD, Briscoe DA (2004) A Primer of Conservation Genetics. University Press, Cambridge
Green DM (2005) Designatable units for status assessment of endangered species Conserv Biol 19:1813-1820
Guppy CS, Shepard JH (2001) Butterflies of British Columbia. UBC Press, Vancouver
Henderson A, Fargey P, Pruss SD, Sperling FAH (2008) Early sighting of a rare butterfly, Mormon Metalmark, in Grasslands National Park, SK. Blue Jay 66:105-106
Heppner, JB (1991) Faunal regions and the diversity of Lepidoptera. Trop Lepid 2 (Suppl. l):l-85 10
Howard AQ, Arnold RA (1980) The Antioch dunes—safe at last? Fremontia 8:3-12
IUCN (2001) IUCN Red List Categories and Criteria: Version 31. IUCN Species Survival Commission IUCN, Gland, Switzerland and Cambridge, UK
Johnson, JJ, Longcore T, Clause A, Pratt G, Dunn J, Osborne K (2007) Propagation handbook for Lange's metalmark butterfly, Apodemia mormo langei, 1st edn. The Urban Wildlands Group, Los Angeles
Koopman W, Li Y, Coart E, Van de Weg W, Vosman B, Roldan-Ruiz I, Smulders M (2007) Linked vs unlinked markers: multilocus microsatellite haplotype-sharing as a tool to estimate gene flow and introgression. Mol Ecol 16:243-256
Lamas, G (2008) Riodinidae of the World. http://wwwuclacuk/taxome/gbn/Lamas_Riodinidae_04ii08xls Accessed 12 Nov 2010
Layberry RA, Hall PW, Lafontaine JD (1998) The Butterflies of Canada. University of Toronto Press, Toronto
Lukoschek V, Waycott M, Keogh J (2008) Relative information content of polymorphic microsatellites and mitochondrial DNA for inferring dispersal and population genetic structure in the olive sea snake, Aipysurus laevis. Mol Ecol 17: 3062-3077
Meglecz E, Petenian F, Danchin E, D'Acier A, Rasplus J, Faure E (2004) High similarity between flanking regions of different microsatellites detected within each of two species of Lepidoptera: Parnassius apollo and Euphydryas aurinia. Mol Ecol 13:1693-1700
Moritz C (1994a) Defining 'Evolutionarily Significant Units' for conservation. Trends Ecol Evol 9:373-375
Moritz C (1994b) Applications of mitochondrial DNA analysis in conservation: a critical review. Mol Ecol 3:401-411
New, TR (1997) Butterfly Conservation, 2nd edition. Oxford Univ Press, Melbourne, Australia
New, TR (2009) Insect species conservation. Cambridge University Press, Cambridge, UK
Novacek, MT (2007) Our 100-Million-Year-Old Ecosystem — and the Threats that Now Put it at Risk. Farrar, Straus and Giroux, New York 11
O'Brien S (1994) A role for molecular genetics in biological conservation. P Natl Acad Sci USA 91:5748-5755
Opler PA, Lotts K, Naberhaus T, coordinators [2010) Butterflies and Moths of North America. Bozeman, MT: Big Sky Institute, http://www.butterfliesandmoths.org Accessed 12 Oct 2010
Opler, PA Wright AB [1999) A Field Guide to Western Butterflies. Houghton Mifflin Company, Boston
Palsb0ll PJ, Berube M, Allendorf FW (2007) Identification of management units using population genetic data. Trends Ecol Evol 22:11-16
Paplinska JZ, Taggart DA, Corrigan T (2010) Using DNA from museum specimens to preserve the integrity of evolutionarily significant unit boundaries in threatened species. Biol Conserv doi:101016/jbiocon201009005
Pelham JP (2008) A catalogue of the butterflies of the United States and Canada with a complete bibliography of the descriptive and systematic literature. J Res Lepid 40:1-652
Peterson K, Amosa E, Pruss SD, Erbilgin N (2010) First caterpillar observations of the Mormon Metalmark butterfly in Grasslands National Park, Saskatchewan. Blue Jay 68:37-40
Pimm SL, Raven P (2000) Extinction by numbers. Nature 403:843-845
Powell JA, Parker MW (1993) Lange's Metalmark, Apodemia mormo langei Comstock. In: New TR (ed) Conservation Biology of Lycaenidae. Occasional Paper of the IUCN Species Survival Commission, Gland, Switzerland, pp 116-119
Pratt G, Ballmer G (1991) Three biotypes of Apodemia mormo (Riodinidae) in the Mojave Desert. J Lep Soc 45:46-57
Pruss, SD, Henderson A, Fargey P, Tuckwell J (2008) Recovery Strategy for the Mormon Metalmark (Apodemia mormo) Prairie Population, in Canada Species at Risk Act. Recovery Strategy Series, Parks Canada Agency, Ottawa
Pyle, RM (2002) The butterflies of Cascadia: A field guide to all the species of Washington, Oregon, and surrounding territories. Seattle Audubon Society, Seattle
Robbins RK (1982) How many butterfly species? News Lep Soc 3:40-41
Robbins RK (1992) Comparison of butterfly diversity in the Neotropical and Oriental regions. J Lep Soc 46:298-300 12
Robbins RK, Lamas G, Mielke OHH, Harvey DJ, Casagrande MM [1996] Taxonomic composition and ecological structure of the species-rich butterfly community at Pakitza, Parque Nacional del Manu, Peru. In: Wilson DE, Sandoval A [eds] Manu: The Biodiversity of Southeastern Peru. Smithsonian Institution Press, Washington, pp 201-236
Robbins RK, Opler PA (1997) Butterfly diversity and a preliminary comparison with bird and mammal diversity. In: Reaka-Kudla ML, Wilson DE, Wilson EO (eds) Biodiversity II. Joseph Henry Press, Washington, DC, pp 69-82
Rubinoff D, Holland B (2005) Between two extremes: mitochondrial DNA is neither the panacea nor the nemesis of phylogenetic and taxonomic inference. Syst Biol 54:952-961
Ryder OA (1986) Species conservation and systematics: the dilemma of subspecies. Trends Ecol Evol 1:9-10
Saarinen E, Daniels J, Maruniak J (2009) Development and characterization of polymorphic microsatellite loci in the endangered Miami blue butterfly [Cyclargus thomasi bethunebakeri). Mol Ecol Res 9:242-244
Samways MJ (2005) Insect Diversity Conservation. Cambridge University Press, Cambridge
Samways MJ, McGeoch MA, New TR (2010) Insect conservation: handbook of approaches and methods. Oxford University Press, Oxford
Scott, JA (1986) The butterflies of North America: A natural history and field guide. Stanford University Press, Stanford
Selkoe K, Toonen R (2006) Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecol Letters 9:615-629
Southern Interior Invertebrates Recovery Team (2008) Recovery Strategy for the Mormon Metalmark (Apodemia mormd), Southern Mountain Population in British Columbia. Prepared for the BC Ministry of Environment, Victoria, BC
Sperling FAH (2003) Butterfly molecular systematics: from species definitions to higher level phylogenies. In: Boggs C, Ehrlich P, Watt W (eds) Ecology and Evolution Taking Flight: Butterflies as Model Study Systems. University of Chicago Press, Chicago, pp 431-458
Stork NE (2010) Re-assessing current extinction rates. Biodivers Conserv 19:357- 371 13
Stork, NE (1997) Measuring global biodiversity and its decline. In: In: Reaka-Kudla ML, Wilson DE, Wilson EO (eds) Biodiversity II. Joseph Henry Press, Washington, DC, pp 41-68
Taylor EB, Tamkee P, Keeley ER, Parkinson EA (2010) Conservation prioritization in widespread species: the use of genetic and morphological data to assess population distinctiveness in rainbow trout [Oncorhynchus mykiss) from British Columbia, Canada. Evol Appl doi:101111/jl752-4571201000136x
Torres-Leguizamon M, Solignac M, Vautrin D, Capdevielle-Dulac C, Dupas S, Silvain F (2009) Isolation and characterization of polymorphic microsatellites in the Potato Tuber Moth Tecia solanivora (Povolny, 1973) (Lepidoptera: Gelechiidae). Mol Ecol Res 9:1167-1169
US Fish and Wildlife Service (2002) Antioch Dunes National Wildlife Refuge Comprehensive Conservation Plan. US Fish and Wildlife Service, California/Nevada Planning Office, Sacramento CA
US Fish and Wildlife Service (2008) Sacramento Fish and Wildlife Office 2008 Species account: Lange's Metalmark butterfly, Apodemia mormo langei. http://wwwfwsgov/sacramento/es/animal_spp_acct/langes_metalmark_butterflyp df Accessed 25 October 2010)
US Fish and Wildlife Service (2010) Species Reports, Listed Animals. http://ecosfwsgov/tess_public/pub/listedAnimalsjsp Accessed 25 October 2010
Van Dyck H, Van Strien AJ, Maes D, van Swaay C (2009) Declines in common, widespread butterflies in a landscape under intense human use. Conserv Biol 23:957-965
Zhang DX (2004) Lepidopteran microsatellite DNA: redundant but promising. Trends Ecol Evol 19:507-509
Zink R, Barrowclough G (2008) Mitochondrial DNA under siege in avian phylogeography. Mol Ecol 17:2107-2121 14 r**- \A mormo
v-^ *pdrva. mormo pueBIo
tuolumnerisis *. langei \ cythera^*.* y^ autumrialis
deserti -*&•.»-.>. v ::-. '-•/., y4. mejicanus
\ \mefiG0MU$
Figure 1-1. Species ranges and subspecies type localities of the Apodemia mormo complex, including A. mormo (yellow, circles), A virgulti (black, squares) and A mejicanus (white, stars). Ranges are approximate and modified from Brown etal. (1992), Opler & Wright (1999), Brock & Kaufman (2003), Fisher (2009), and Opler et al. (2010). Black dots indicate locations where samples were collected for this study. Solid black dots indicate samples of the A mormo complex; empty dots indicate outgroups. 15
CHAPTER 2: APODEMIA MORMO IN CANADA: POPULATION GENETIC DATA SUPPORT PRIOR CONSERVATION RANKING
Introduction
Many endangered species exist as fragmented and isolated populations. Understanding genetic structure, relatedness and connectivity between populations is therefore paramount to their conservation (Frankel 1974, Hanski and Thomas 1994, Haig et al. 2001, DeSalle & Amato 2004, Palsb0ll et al. 2007). Mitochondrial DNA (mtDNA) sequence data and neutral, highly variable nuclear markers such as microsatellites have become increasingly important genetic tools for understanding these processes (Hedrick 2004, Behura 2006, Bos et al. 2008, Sigaard et al. 2008, Ortego et al. 2010). The Canadian populations of Apodemia mormo (Felder and Felder 1859), the Mormon Metalmark, provide a case study in the use of such markers in reassessing prior conservation listings. Apodemia mormo is a phenotypically and ecologically diverse butterfly species that occurs from Mexico to Canada throughout the western part of North America (Scott 1986). It is the most widespread member in North America of the mostly Neotropical family Riodinidae, and the only one that occurs in Canada (Layberry et al. 1998). It has a wide geographic range and broad habitat associations, ranging from below sea level to low-altitude summits, in dunes and in grasslands (Scott 1986). However, it tends to exist in scattered, isolated populations. The butterfly has a small size and low vagility as well as close association with its plant hosts, various species of wild buckwheats [Eriogonum, Polygonaceae) that occur disjunctly (Opler & Powell 1961). Additionally, it has substantial morphological variation across parts of its range, which has led to a number of geographically isolated populations receiving subspecific names (Pelham 2008). One subspecies, A. m. langei (Comstock 1939), was placed on the US Endangered Species List in 1976 and has subsequently received considerable conservation attention (US Fish & Wildlife Service 1984, US Fish & Wildlife Service 2007). 16
Two additional populations of A mormo listed as being of conservation concern are the only two known populations of A mormo in Canada (Layberry et al. 1998]. One is a cluster of colonies in the Similkameen River Valley of south-central British Columbia, and the other a cluster of colonies in Grasslands National Park (GNP) and adjacent Prairie Farm Rehabilitation Administration pastures, Saskatchewan. The two populations were termed the "Southern Mountain" and "Prairie" populations, respectively, and were classified as "endangered" and "threatened", respectively, under Canada's Species At Risk Act (SARA) (Canada Gazette 2004). For clarity, we refer to them herein as the British Columbia population and the Saskatchewan population. These designations by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC) were based on their low observed population numbers, high habitat specificity, and disjunction from the main range of the species to the south, which combine to make these populations vulnerable to stochastic events (COSEWIC 2002). The British Columbia population was classified as "endangered" while the Saskatchewan population was classified only as "threatened" because of disparate assessments of risk of extirpation. The former exists in a river valley system that contains no protected land and is already fragmented by development, whereas all of the known colonies of the latter were within the boundaries of a national park (GNP) or on lands proposed to be soon added to it. In addition, the total population size of the Saskatchewan population was estimated to be substantially larger than the British Columbia population (COSEWIC 2002). Recovery Strategies for both populations were drawn up in compliance with their designation under SARA (Pruss et al. 2008, Southern Interior Invertebrates Recovery Team 2008). Our study uses mitochondrial cytochrome oxidase I (COI) gene sequences and six novel nuclear microsatellite loci to address several conservation goals. Specifically, we ask: 1. What is the relationship between the British Columbia and Saskatchewan populations, and how do they compare in genetic diversity? 2. Can any population structure be detected within either population? 3. To what degree are the British Columbia and Saskatchewan populations genetically connected to other populations of A mormo across the USA/Canada border? Besides their 17 population genetic and phylogeographic interest, the answers to these questions will inform future management decisions for these two Canadian populations.
Materials and Methods
SAMPLING
Genetic data was collected from 317 individuals of Apodemia mormo mormo (Table 2-1). Two hundred and twelve were "eastern" specimens from seven locations in Montana, one location each in North Dakota, South Dakota, and Wyoming, and from several locations within GNP, Saskatchewan. The remaining 105 were "western" specimens from four locations in Washington, one each in Idaho and Oregon, and five locations near Keremeos, BC. Together the locations cover the entire northern portion of the range of A mormo (Fig. 2-1). Sample size per location ranged between 5 and 30 with a mode of 10, except for locations within GNP where sample size per unique location was constrained by our collecting permit (GRA- 2007-1247).
DNA EXTRACTION
For most samples, either two legs or the entire butterfly were placed into 95% ethanol in the field. The entire butterfly was placed into ethanol only in the case of many specimens from GNP. DNA was later extracted from two legs using the DNeasy Tissue Extraction Kit (Qiagen, Valencia, CA). Two final elutions of 200uL were performed for maximum extraction. For all the British Columbia specimens except site W6, DNA was extracted from wing clips as in Keyghobadi et al. (2009). 18
MTDNA SEQUENCING
We sequenced most of the mitochondrial gene COI for as many samples as possible: in total, 315 sequences of 1498 base pairs in length [Table 2-1). For most samples, the gene was amplified and sequenced in two fragments: LCO1490 (TTTCTACTAATCATAAAGATATTGG) to HC02198 [TAAACTTCTGGATGACCAAAAAATCA) [Folmer et al. 1994) and Jerry [Cl-J-2183) (CAACATTTATTTTGATTTTTTGG) (Simon et al. 1994) to Pat (ATCCATTACATATAATCTGCCATA) (Simon et al. 1994). If chromatogram signal was poor, the internal primers Jerry and Mila (MilaX, GATAGTCCTGTAAATAATGG, for samples from west of the Rocky Mountains and MilaXI, GATAATCCTGTAAATAATGG, for samples from east of the Rocky Mountains) and BrianXXVII (CACCTATATTATGAAGATTAGG) and Pat were used. The PCR protocol for amplification of the COI gene, including reaction components and cycling parameters, is given in Table 2-2. PCR buffer was from Promega (Madison, WI); dNTPs from Roche (Indianapolis, IN); primers from Integrated DNA Technologies (IDT: Coralville, IA); and Taq from the Fermentation Service Unit at the University of Alberta. Cycling was performed in either a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA) or a T-Personal (Biometra, Gottingen, Germany). Amplified fragments were cleaned of excess dNTPs and primers using the enzymes Exo and SAP from USB (Cleveland, OH): 2uL of a solution of Exo and SAP each at 0.1 U/u.L was added to 5.5 u.L of PCR product and incubated in a thermal cycler at 37°C for 25 minutes and 80°C for 12 minutes. Cycle sequencing was performed with the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA): the conditions are given in Table 2-3. Cycling was performed in either a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA) or a T-Personal (Biometra, Gottingen, Germany). Electrophoresis of fluorescent- labeled fragments was accomplished on an ABI 3700 automated sequencer (Applied Biosystems, Foster City, CA). Chromatograms were checked for signal quality in 19
Lasergene (DNASTAR, Madison, WI). Priming sites were removed manually and sequences were aligned manually in MESQUITE 2.72 (Maddison and Maddison 2009).
MlCROSATELLITE DEVELOPMENT
We isolated and characterized six microsatellite loci from two libraries. DNA for the first library was extracted from the thoraces of four A mormo from near Ladoga, CA (39.09°N, -122.24°W) using a CTAB (Cetyltrimethylammonium bromide) extraction technique. The tissue was digested with 200u.g Proteinase K at 50°C for 40 minutes in a buffer of 100 mM Tris-Cl (ph 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCl, 2% CTAB, 1% PVP-40 (Polyvinylpyrrolidone), and 0.2% 2-mercaptoethanol. DNA was extracted from the digested solution with chloroform and precipitated with isopropanol. The DNA was digested with the restriction enzymes Alu\ and Mi el. The fragments were ligated to linkers, enriched by hybridization to di- and tetranucleotide probes, inserted into pBSIl SK+ vector, and used to transform DH5a E. coli. competent cells based on the protocol of Hamilton et al. (1999). Transformed colonies were suspended in water and used directly as the template in a PCR reaction, using the T3 and T7 primers, to confirm the presence of an insert. Insert- bearing fragments of 92 positive clones were sequenced in both the T3 and T7 directions in an ABI 3700 automated sequencer using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). They were then assembled into contigs and manually inspected in Lasergene (DNASTAR, Madison, WI) for the presence of microsatellites. From 65 unique sequence contigs, 14 primer pairs were designed using Primer3 0.4.0 (Rozen & Skaletsky 2000) with all settings at default except that the maximum Tm difference was set to 1. These primers were tested for PCR amplification using the M13(-21) method of Schuelke (2000), using the dyes FAM, PET, VIC, and NED. Despite numerous attempts at optimization, however, no clear scoring of allele sizes could be generated. Therefore, for each of the 11 primer pairs that at least amplified a product in the expected size range, a forward primer labeled 20 with FAM, PET, VIC, or NED was obtained from ABI (Applied Biosystems, Foster City, CA). DNA for the second microsatellite library was extracted from legs of nine Apodemia mormo mormo collected from near Circle, MT, Spearfish, SD, and Graves Creek Rd, ID (Appendix] using the DNeasy Tissue Extraction Kit (Qiagen, Valencia, CA). All extractions were pooled. The construction of this library paralleled the first one, except that we used the double-enrichment procedure of Diniz et al. (2007). Insert-bearing fragments of 55 positives clones were sequenced in the T7 direction and manually inspected for microsatellite sequences, as above. From 26 unique sequence contigs, 16 primer pairs were designed using Primer3 0.4.0 (Rozen and Skaletsky 2000) with all settings set to default except that the maximum Tm difference was set to 1, minimum Tm set to 56, and the minimum primer length was set to 17. These primers were tested for PCR amplification using the M13(-21) method of Schuelke (2000), as above. For each of the 12 primer pairs that amplified a product in the expected size range, a dye-labeled forward primer was obtained from Applied Biosystems (Foster City, CA).
MICROSATELLITE AMPLIFICATION
Of the 23 microsatellite loci for which dye-labeled primers were used, only six were both variable and consistently amplifiable, despite numerous attempts at PCR optimization: loci D6, ML8, F3 and M2 from the first library, and E7 and W6 from the second library. Primer sequences, repeat motifs, TMS and size ranges are given in Table 2-4. The optimized amplification conditions for those loci are given in Table 2-5. The PCR buffer was composed of lOOmM Tris (tris[hydroxymethyl]aminomethane) (pH 8.8), 1% Triton X-100, 500mM KCL, and 1.6mg/mL bovine serum albumin. dNTPs were from Roche (Indianapolis, In). Forward primers were labeled with one of four fluorescent tags (FAM, VIC, NED, PET) from the DS-33 Dye Set (Applied Biosystems, Foster City, CA). Taq polymerase was from the Fermentation Service Unit at the University of Alberta. For locus M2 only, Phusion High-Fidelity PCR buffer and Taq (New England Biolabs, Beverly, MA) 21 were used. Fragments were analyzed in an ABI 3700 automated sequencer with 0.3 u.L LIZ 500 size standard (Applied Biosystems, Foster City, CA) per well. Loci D6 and E7 were loaded at a dilution of 1:15; loci M2, F3, and W6 at 1:30; and locus ML8 at 1:60. Genotyping was carried out with the software GeneMapper 4.0 (Applied Biosystems, Foster City, CA). We were able to obtain genotype scores for 296 samples (Table 2-1). Amplification was not consistent across sampling areas: locus E7 did not amplify for the western samples, and locus M2 did not amplify for the eastern samples. All samples, therefore, were genotyped at five loci at most. Forty- four were genotyped at only four loci and 45 only at three; any samples that amplified at fewer were discarded. We also tested for cross-amplification in three specimens of Calephelis wrighti (Holland 1930), the only other riodinid species whose DNA was available: after several attempts, we were able to get locus ML8 to amplify in all three individuals, D6 in two, and F3 in one.
ANALYSES
Summary statistics of genetic heterogeneity were calculated for each population. Samples from British Columbia and samples from northern Washington (Shanker's Bend, Toats Coulee, and Riverside) (Table 2-1) were grouped in order to increase sample size, since variability within those groups was low for both the microsatellite and the mtDNA sequence data. For the mtDNA sequence data, we calculated the nucleotide and haplotype diversities and estimated the statistics
Tajima's D (Tajima 1989) and Fu's Fs (Fu 1997) in ARLEQUIN 3.5 (Excoffier et al. 2005). Tajima's D and Fu's Fs test the null hypothesis of a stable population evolving neutrally. We also tested the hypotheses of range expansion and population expansion using two mismatch distribution statistics: sum of square deviator (SSD) (Slatkin and Hudson 1991, Schneider and Excoffier 1999) and the Raggedness Index (Harpending et al. 1993). The latter four statistics were tested for significance with 1000 bootstrap replicates. The SSD and the Raggedness Index are statistics 22 generated from the mismatch distribution, which is a distribution of the number of substitutions observed in pairwise comparisons of base pairs between random sequences within a population (Li 1977, Rogers and Harpending 1992). The shape of the distribution changes in a predictable way if a population undergoes demographic or range expansion. A negative and significant SSD or Raggedness rejects a model of population (or spatial) growth. On the other hand, a significant Tajima's D or Fu's Fs statistic supports a model of population growth. Tajima's D and Fu's Fs are tests of neutral evolution based on estimations of the frequency of mutation: if a population undergoes expansion, it creates an excess of singletons, or mutations that only occur in one sampled sequence (Ramos-Onsins & Rozas 2002). Descriptive statistics for the microsatellite frequency data were also generated in ARLEQUIN: observed and expected heterozygosities and Fis. The number of alleles per locus was estimated using the rarefaction approach in FSTAT 2.9.3.2 (Goudet 1995) in order to remove the bias toward greater number of alleles per locus in populations with a greater sample size. Statistics are reported both using all five loci that amplified for each set of populations as well as only the four loci that amplified across all populations, in order to assess the possibility that differences between eastern and western populations could be due to differences in the properties of the loci. To estimate microsatellite-based genetic divergences between populations, the DEST statistic was calculated in SMOGD 1.0 (Crawford 2010) from microsatellite frequency data pairwise between all populations in the eastern and western population sets. We reported DEST and not the more common statistics GST or FST because the latter two have been shown to significantly underestimate population divergence when gene diversity is high, a drawback which DEST eliminates (Jost 2008, Jost 2009, Heller & Siegismund 2009, Gerlach et al. 2010). Two individual-based Bayesian clustering programs were used in an attempt to find genetic structure within the western or eastern regions without defining populations a priori. The program STRUCTURE 2.3.2 (Pritchard et al. 2000) was run on all microsatellite genotypes four times. Each analysis was run for 200,000 MCMC generations after a burnin of 35,000 replicates, testing K (most likely number of 23 populations) at values from 2 to 25 with five runs at each K, under the admixed ancestry and correlated allele frequencies model. The four runs used either all six loci or only the four loci common across all populations, and either sampling locations defined as a prior or not. The eastern and western samples were also tested independently with the same running length as the combined analyses, testing K at values from 2 to 15 with five runs at each K, under both the admixed ancestry and correlated allele frequencies model and the admixed ancestry and independent allele frequencies model. The program TESS 2.3.1 (Francois et al. 2006, Chen et al. 2007], which explicitly incorporates geographic sampling location into the clustering algorithm, was run on the eastern samples. The western samples were not tested because of a lack of information in the genotypes indicated by the
STRUCTURE analyses. We tested maximum K values from 2 to 15, with 100 runs of 50,000 sweeps (burnin 10,000) at each maximum K tested, under the no admixture model. In order to illustrate relationships between populations based on mtDNA sequence data, a phylogenetic tree was generated from all sequences using the maximum likelihood method implemented in GARLI 1.0 (Zwickl 2006) according to the TVM+I model of evolution, which MODELTEST 3.7 (Posada & Crandall 1998) selected as the most likely to fit our data according to the AIC criterion. The rate parameters, base frequencies and proportion of invariable sites were estimated during analysis. Fifteen search replicates were performed to find the best tree. Three hundred bootstrap replicates were performed to estimate branch support. Maximum-likelihood trees were similarly generated separately from the eastern and western data sets to determine if topologies or branch lengths would be affected by the composition of the data set. 24
Results
COI SEQUENCE AND HAPLOTYPE DIVERSITY
Three hundred and fifteen COI sequences were generated in total, representing 78 unique haplotypes: 20 haplotypes from 105 western sequences and 58 haplotypes from 210 eastern sequences. No haplotypes were shared between the eastern and western samples. Of the 58 eastern haplotypes, 31 were unique to a single specimen, with the remaining 27 haplotypes each represented by an average of 6.7 sequences. The two most frequent haplotypes, hl37 and hl56, found in 31 and 21 specimens respectively, were almost exclusively restricted to specimens from GNP. Of the 20 western haplotypes, only nine were unique to a single specimen; the other 11 were represented by an average of 8.7 sequences per haplotype. Most of that high average is accounted for by the two most common haplotypes for the northern Washington and British Columbia specimens, h350 and h356, which were found in 24 and 43 specimens respectively. Overall, most of the haplotypes were unique to a particular location, with only 13 eastern and three western haplotypes shared between locations (counting the West Block and East Block of GNP, northern Washington, and British Columbia as unique locations]. Nucleotide and haplotype diversity was much lower among the western samples than the eastern ones (Table 2-6), with the British Columbia samples the most genetically homogeneous at the COI gene. All 44 sequences from British Columbia belonged to one of two haplotypes (h350 or h356). In contrast, the Saskatchewan samples were more heterogeneous at the COI gene, although samples from the East Block of GNP had lower nucleotide and haplotype diversity than any other eastern population (Table 2-6).
PHYLOGENETIC RELATIONSHIPS BASED ON COI HAPLOTYPES
Maximum likelihood analysis of 78 unique haplotypes resulted in a best tree of score -2837.30352028 (Figure 2-2). Trees generated from the eastern and 25 western data sets independently (not shown) did not differ in topology or branch lengths from the tree generated from all haplotypes. The tree is rooted at the midpoint between the western and eastern clades, with the two groups serving as outgroups for each other. The average sequence divergence between the two clades is 3.09%. In the western clade, a relatively weak geographic pattern emerges. All six of the northern Washington and British Columbia haplotypes assort into a single clade to the exclusion of the Oregon and Umtanum Ck. haplotypes, but the clade also includes the two more common Idaho haplotypes and lacks bootstrap support. All four of the Oregon haplotypes also assort into a single clade, but the clade also includes the two more common Umtanum Ck. haplotypes and only has a bootstrap support value of 58. The eastern clade shows only slightly more structure than the western one. Besides a clade of Wyoming and southern Montana haplotypes that is sister to (and 0.66% divergent from) the other eastern haplotypes, the only other clade with a relatively long branch and high bootstrap support is a clade composed entirely of haplotypes from the two south-central Montana sampling locations, Hollenbeck Draw and Laurel. All of the haplotypes from samples from GNP or Hinsdale, the sampling location closest to GNP, group together monophyletically, although this clade lacks bootstrap support.
DEMOGRAPHIC HYPOTHESES INFERRED FROM COI SEQUENCES
A negative and significant SSD or Raggedness rejects a model of population or spatial grown, while a significant Tajima's D or Fu's Fs statistic rejects a model of stable, neutral evolution without population or spatial growth. Our data provide no clear pattern of evidence to reject or accept either model for most of the sampled populations (Table 2-6). SSD and Raggedness statistics were not significant for most of the populations sampled and therefore we could not reject the models of population or range expansion. We did not find evidence to support those models in many of the same populations, however, since they did not also produce a 26 significant Tajima's D or Fu's Fs statistic. There were two instances of populations for which the statistics actually contradicted each other (i.e., both Tajima's D or Fu's Fs and the SSD or Raggedness Index were significant): northern Washington and the West Block of GNP (Table 2-6).
MlCROSATELLITE DIVERSITY AND HARDY-WEINBERG EQUILIBRIUM
Statistics generated for all five loci that amplified for a population were in most cases not substantially different from those generated using only the four loci that amplified in all populations (Table 2-7), so we will discuss the statistics based on all five loci. For the eastern populations, number of alleles per locus ranged from 3.2 to 4.4 with an average of 3.9. For the western populations, the range was 1.6 to 2.1 with an average of 1.8. The greater allelic diversity among the eastern populations is corroborated by the observed heterozygosity values, which ranged from 0.46 to 0.69 with a mean of 0.62 in the eastern populations but only 0.18 to 0.35 with a mean of 0.22 in the western populations. Of the eastern populations, only Spearfish, SD had an Fis value that indicated significant deviation from Hardy- Weinberg equilibrium. All of the western populations, however, were in significant Hardy-Weinberg disequilibrium.
DEST AND PAIRWISE POPULATION DIVERGENCES
DEST is a measure of population divergence analogous to FST in its interpretation (Crawford 2010). Values of < 0.05 are generally accepted to indicate little genetic differentiation; values between 0.05 and 0.15 moderate genetic differentiation; between 0.15 and 0.25 great genetic differentiation; and values >
0.25 very great genetic differentiation (Hartl & Clark 2007). The overall DEST between the eastern samples and the western samples at the four loci common to them all was 0.84. For the western populations, overall DEST was 0.059 for all five loci and 0.082 for the four loci in common with the eastern populations. For the eastern populations, overall DEST was 0.145 for all five loci and 0.133 for the four loci 27 in common with the western population, indicating greater overall divergence than among the western populations.
Pairwise estimates of DEST between populations within the eastern and western regions are given in Tables 2-8 and 2-9, respectively. For both the eastern and western samples, pairwise population divergence estimates were fairly evenly split between those pairs that displayed little differentiation, i.e. a DEST below 0.05, and pairs in which at least noticeable divergence was observed. While no clear correlation between geographic distance and level of differentiation was apparent, it is notable that the British Columbia and Northern Washington populations were very similar to each other according to the DEST statistic, as were the West and East Blocks of GNP. Slight differentiation was observed between Hinsdale, the Montana sampling location closest to the GNP locations, and both the West and East Blocks.
POPULATION GENETIC STRUCTURE
No genetic structure was discovered using the STRUCTURE or TESS analyses among our samples, besides the division between the western and eastern samples (not shown).
Discussion
RELATIONSHIP BETWEEN BRITISH COLUMBIA AND SASKATCHEWAN POPULATIONS
The clearest result from our research is that the British Columbia and Saskatchewan populations of Apodemia mormo are not closely related. The genetic distance between the A mormo populations on opposite sides of the Rocky
Mountains—over 3% sequence divergence at the COI gene and a pairwise DEST of 0.84—supports the importance of the Rocky Mountains as a barrier to gene flow in this weak-flying butterfly. Given that genetic differentiation is known to be inversely correlated with dispersal ability in many species (Bohonak 1999), this is not entirely surprising. Montane barriers play an important part in the phylogeography 28 of many butterfly species (e.g. Brower & Boyce 1991, Forister et al. 2004, Fordyce et al. 2008). We do not suggest that the A. mormo on opposite sides of the Rockies should be classified as separate, taxa, however, as no substantial morphological or behavioural differences have been observed between them. Large genetic divergences do not necessarily indicate different species (Rubinoff & Sperling 2004, Leo et al. 2010). Also, percent COI divergence can be an inconsistent estimator of true relatedness in butterfly species (e.g. Elias et al. 2007, Sperling & Roe 2009;
Linares et al. 2009), and our estimation of pairwise DEST was only based on four microsatellite loci. Such decisions should also incorporate the genetic diversity across the entire range of the species (Zhang et al. 2010). There are nonetheless some subtle differences in habitat and host plant use between the Saskatchewan and British Columbia populations. Apodemia mormo in the east (including Saskatchewan) is most often found in badlands and heavy clay soils in association with Ericameria nauseosa (Rabbitbrush) and the host plant Eriogonum pauciflorum (Henderson et al. 2008), whereas the western populations of A mormo (including British Columbia) tend to be found in dry valleys most often in association with Eriogonum niveum (Layberry et al. 1998, Pyle 2002). The importance of these differences are unclear, however, since A mormo is known to be adapted to many different habitat conditions and species of Eriogonum across its range (Opler & Powell 1961, Scott 1986), and neither species of Eriogonum is found on both sides of the Rockies. There is no evidence to suggest whether or not individuals of A mormo transplanted from one side of the Rockies to the other would thrive as well as in their native habitat.
COMPARISONS OF GENETIC DIVERSITY
In general, the eastern populations of A mormo are much more genetically diverse at the COI gene and microsatellite loci than the western populations. Much of that difference, however, can be ascribed to the northern Washington and especially the British Columbia populations, which have very low genetic diversity 29 relative to the eastern populations and to stable populations of many other lepidopterans (e.g. Keyghobadi et al. 2005, Chapuis et al. 2009, Franck & Timm 2010). There are a number of possible explanations for the lower genetic diversity in the western populations, especially the northern ones. One is recent re- colonization of those areas following Pleistocene glaciation. Although northern Washington and the Similkameen River valley where the British Columbia populations are found were not believed to have been covered by the Cordilleran ice sheet (Shafer et al. 2010), it is possible that the area only recently became colonized by A. mormo. Another possibility is a recent bottleneck resulting from loss of range and habitat fragmentation. Apodemia mormo has recently become extirpated in the Okanagan River valley adjacent to the Similkameen (Crawford et al. in review). The lack of genetic diversity in British Columbia and northern Washington samples at microsatellite loci can also be attributed to a high frequency of null alleles, resulting in an underestimation of the true genetic diversity of the populations. Support for this interpretation is based on the significant deviations from Hardy-Weinberg equilibrium (Table 2-7) observed for samples from this region. However, we postulate that the observation of low genetic diversity is not an artifact of amplification or allele scoring. Low genetic diversity is expected in populations at the periphery of the species' range (Hoffmann & Blows 1994, Arnaud-Haond et al. 2006). Moreover, the pattern of unusually high rates of homozygosity at the microsatellite loci is corroborated by unusually low haplotype diversity at the COI gene and by low levels of polymorphism observed in amplified fragment length polymorphism (AFLP) markers (Crawford et al. in review).
POPULATION STRUCTURE
We were unable to find evidence for genetic structure within the western populations as a whole, let alone within the British Columbia populations, with the exception of the weakly supported mtDNA clade containing all the northern Washington and British Columbia COI haplotypes. This may be partially attributable to the use of markers that may not reflect the genetic diversity of the butterflies 30 elsewhere in their genomes, however, as Crawford et al. (in review) found a small effect of isolation-by-distance between the British Columbia colony sites using AFLPs. Crawford et al. (in review) also had much larger sample sizes than were available to us, which could have allowed detection of more fine-scaled patterns. Several hypotheses can be proffered for our failure to find much geographic structure among the eastern populations despite higher levels of mitochondrial genetic diversity and a high overall DEST. The most obvious is ongoing gene flow between populations. This could explain some of the patterns of genetic similarity between nearby populations, but given the very low vagility observed in A. mormo (Arnold & Powell 1983), it is unlikely that this can explain the failure to find geographic structure across the entire region. Another hypothesis is rapid colonization of the eastern areas by populations of A mormo from further south in the Great Plains states. If this colonization occurred recently, genetic assortment may not have had enough time to occur. Some evidence for this hypothesis is given by the very small mtDNA sequence divergence between populations (Fig. 2-2) and the positive tests for demographic and/or spatial expansion for several of the eastern populations based on COI sequences (Table 2-6). Additionally, if colonization of the region is relatively recent, one would expect to find as yet uncolonized suitable habitat near the edge of the range of this butterfly. Surveys of ostensibly suitable habitat for A mormo in Alberta, in the Blakiston Fan in Waterton Lakes National Park and the Agriculture Canada Onefour Research Station near Manyberries, Alberta, failed to find any evidence of A mormo (Gary Anweiler, unpublished report for Parks Canada, 2008). Low sample sizes and too few loci could also have contributed to the failure to find geographical structure with our microsatellite data, as high sample size and/or many loci may be needed to find subtle geographic structure (Pritchard et al. 2000, Selkoe and Toonen 2006).
CONCLUSION
Apodemia mormo is not endangered or threatened on a continent-wide scale. Canada has chosen to conserve those two populations of this charismatic butterfly 31 on the grounds that they are a vulnerable and important part of Canadian biodiversity (COSEWIC 2002). They are the only representative of an entire family of butterflies (the Riodinidae) in Canada (Layberry et al. 1998). Our research is intended to guide continuing management and recovery efforts for these butterflies. We have demonstrated three principal patterns: 1. the British Columbia and Saskatchewan populations are only distantly related and further investigation into whether they deserve separate taxonomic status may be justified. 2. The differing classifications of "endangered" for the British Columbia population and "threatened" for the Saskatchewan population are justified, since the former is more genetically depauperate at the loci we examined than the latter. The samples from the East Block of the Saskatchewan population, however, were much less diverse than comparable samples from other eastern populations, which suggests that the East Block colonies may deserve special attention. 3. In British Columbia, the British Columbia population was not genetically similar to any other western samples except for the A mormo from northern Washington. The A mormo butterflies in the Saskatchewan population were genetically similar, however, to several other eastern populations, suggesting that immigration and dispersal may currently be taking place and that their habitat could possibly be recolonized naturally should local extirpation occur. 32
Literature Cited
Arnaud-Haond S, Teixeira S, Massa S, Billot C, Saenger P, Coupland G, Duarte C, Serrao EA (2006) Genetic structure at range edge: low diversity and high inbreeding in Southeast Asian mangrove (Avicennia marina) populations. Mol Ecol 15:3515- 3525
Arnold, RA, Powell JA (1983) Apodemia mormo langei In: Ecological Studies of Six Endangered Butterflies (Lepidoptera, Lycaenidae): Island Biogeography, Patch Dynamics, and the Design of Habitat Preserves. University of California Publications in Entomology, 99, pp 99-128
Behura SK (2006) Molecular marker systems in insects: current trends and future avenues. Mol Ecol 25:3087-3113
Bohonak (1999) Dispersal, gene flow, and population structure. Quarterly Review of Biology 74:21-45
Bos D, Gopurenko D, Williams R, DeWoody J (2008) Inferring population history and demography using microsatellites, mitochondrial DNA, and major histocompatibility complex (MHC) genes. Evolution 62:1458-1468
Brower AVZ, Boyce T (1991) Mitochondrial DNA variation in monarch butterflies. Evolution 45:1281-1286
Canada Gazette (2004) 138:408-479
Chapuis M, Loiseau A, Michalakis Y, Lecoq M, Franc A, Estoup A (2009) Outbreaks, gene flow and effective population size in the migratory locust, Locusta migratoha: a regional-scale comparative survey. Mol Ecol 18 (5) pp. 792-800
Comstock, JA (1939) A new Apodemia from California (Lepidopt). Bull South Calif Acad Sci 37:129-131
Chen CH, Durand E, Forbes F, Francois 0 (2007) Bayesian clustering algorithms ascertaining spatial population structure: a new computer program and a comparison study. Mol Ecol 7:747-756
COSEWIC (2002) COSEWIC assessment and update status report on the mormon metalmark <4podem/a mormo in Canada. Committee on the Status of Endangered Wildlife in Canada, Ottawa
Crawford NG (2010) SMOGD: software for the measurement of genetic diversity. Mol Ecol Res 10:556-557 33
Crawford L, Desjardins S, Keyghobadi N (In review) Fine-scale genetic structure of an endangered population of the Mormon metalmark butterfly [Apodemia mormo] revealed using AFLPs. Conserv Genet.
DeSalle R, Amato G (2004) The expansion of conservation genetics. Nat Rev Genet 5:702-712
Diniz F, Iyengar A, Lima P, Maclean N, Bentzen P (2007) Application of a double- enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping. Genet Mol Biol 30:380-384
Elias M, Hill R, Willmott K, Dasmahapatra K, Brower AVZ, Mallet J, Jiggins CD (2007) Limited performance of DNA barcoding in a diverse community of tropical butterflies. Proc R Soc B 274:2881-2889
Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform Online 1:47- 50
Felder C, Felder R (1859) Wiener Entomologische Monatschrift 3:271
Folmer 0, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol and Biotech 3:294-299
Fordyce JA, Forister ML, Nice CC, Burns J, Shapiro A (2008) Patterns of Genetic Variation Between the Checkered Skippers Pyrgus communis and Pyrgus albescens (Lepidoptera: Hesperiidae). Ann Entomol Soc Am 101:794-800
Forister ML, Fordyce JA, Shapira A (2004) Geological barriers and restricted gene flow in the holarctic skipper Hesperia comma (Hesperiidae). Molecular Ecology 11:3489-3499
Franck P, Timm A (2010) Population genetic structure of Cydia pomonella: a review and case study comparing spatiotemporal variation. J Appl Entomol 134:191-200
Francois 0, Ancelet S, Guillot G (2006) Bayesian clustering using hidden Markov random fields in spatial population genetics. Genetics 174:805-816
Frankel OH (1974) Genetic conservation: our evolutionary responsibility. Genetics 78:53-65
Fu Y (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147:915-925 34
Gerlach G, Jueterbock A, Kraemer P, Deppermann J, Harmand P (2010) Calculations of population differentiation based on Gst and D: forget Gst but not all of statistics! Mol Ecol 19:3845-3852
Goudet J (1995) FSTAT version 1.2: a computer program to calculate F statistics. Journal of Heredity 86:485-486
Guppy CS, Shepard JH (2001) Butterflies of British Columbia. UBC Press, Vancouver
Haig S, Wagner R, Forsman E, Mullins T (2001) Geographic variation and genetic structure in Spotted Owls. Conserv Genet 2:25-40
Hamilton M, Pincus E, Di Fiore A, Fleischer R (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27:500-507
Hanski I, Thomas C (1994) Metapopulation dynamics and conservation: a spatially explicit model applied to butterflies. Biol Cons 68:167-180
Hartl DL, Clark AG (2007) Principles of population genetics, 4th edn. Sinauer Associates, Sunderland, MA
Harpending H, Sherry S, Rogers A, Stoneking M (1993) The genetic structure of ancient human populations. Current Anthropology 34:483-496
Hedrick P. (2004) Recent developments in conservation genetics. Forest Ecol Manag 197:3-19
Heller R, Siegismund H (2009) Relationship between three measures of genetic differentiation Gst, Dest and G': how wrong have we been? Mol Ecol 18:2080-2083
Henderson A, Fargey P, Pruss SD, Sperling FAH (2008) Early Sighting of a Rare Butterfly, Mormon Metalmark, in Grasslands National Park, SK. Blue Jay 66:105-106
Hoffmann AA, Blows MW (1994) Species borders: ecological and evolutionary perspectives. Trends Ecol Evol 9:223 - 227
Holland W (1930). Ann. Carnegie Mus. 20(1): 5-6
Jost L (2008) Gst and its relatives do not measure differentiation. Mol Ecol 17:4015- 4026
Jost L (2009) D vs. Gst: Response to Heller and Siegismund (2009) and Ryman and Leimar (2009) Mol Ecol 18:2088-2091 35
Keyghobadi N, Roland J, Strobeck C (2005) Genetic differentiation and gene flow among populations of the alpine butterfly, Parnassius smintheus, vary with landscape connectivity. Mol Ecol 14:1897-1909
Keyghobadi N, Crawford L, Maxwell S (2009) Successful analysis of AFLPs from non- lethally sampled wing tissues in butterflies. Conserv Genet 10:2021-2024
Layberry RA, Hall PW, Lafontaine JD (1998) The Butterflies of Canada. University of Toronto Press, Toronto
Leo ST, Pybus M, Sperling FAH (2010) Deep mitochondrial DNA lineage divergences within alberta populations of Dermacentor albipictus (Acari: Ixodidae) do not indicate distinct species. J Med Entomol 47:565-574
Li WH (1977) Distribution of nucleotide differences between two randomly chosen cistrons in a finite population. Genetics 85:331-337
Linares MC, Soto-Calderon ID, Lees DC, Anthony NM (2009) High mitochondrial diversity in geographically widespread butterflies of Madagascar: A test of the DNA barcoding approach. Mol Phylogenet Evol 50:485-495
Maddison WP, Maddison DR (2009) Mesquite: a modular system for evolutionary analysis, http://mesquiteproject.org Accessed 18 Nov 2010
Opler P, Powell JA (1961) Taxonomic and distributional studies on the Western components of the Apodemia mormo complex (Riodinidae). J Lep Soc 15:145-171
Ortego J, Aguirre M, Cordero P (2010) Population genetics of Mioscirtus wagneri, a grasshopper showing a highly fragmented distribution. Mol Ecol 19:472-483
Palsb0ll PJ, Berube M, Allendorf FW (2007) Identification of management units using population genetic data. Trends Ecol Evol 22:11-16
Pelham JP (2008) A catalogue of the butterflies of the United States and Canada with a complete bibliography of the descriptive and systematic literature. J Res Lepid 40:1-652
Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. Bioinformatics 14:817-818
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959
Pruss, SD, Henderson A, Fargey P, Tuckwell J (2008) Recovery Strategy for the Mormon Metalmark {Apodemia mormo) Prairie Population, in Canada Species at Risk Act. Recovery Strategy Series, Parks Canada Agency, Ottawa 36
Pyle, RM (2002) The butterflies of Cascadia: A field guide to all the species of Washington, Oregon, and surrounding territories. Seattle Audubon Society, Seattle
Ramos-Onsins SE, Rozas J (2002) Statistical properties of new neutrality tests against population growth. Mol Biol Evol 19:2092-2100
Rogers A, Harpending H (1992) Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution 9:552-569
Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for General Users and for Biologist Programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totawa, NJ, pp 365-386
Rubinoff D, Sperling FAH (2004) Mitochondrial DNA sequence, morphology and ecology yield contrasting conservation implications for two threatened buckmoths (Hemileuca: Saturniidae). Biol Cons 118:341-351
Scott, JA (1986) The butterflies of North America: A natural history and field guide. Stanford University Press, Stanford
Schneider S, Excoffier L (1999) Estimation of past demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: application to human mitochondrial DNA. Genetics 152:1079-1089
Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol 18:233-234
Selkoe K, Toonen R (2006) Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol Letters 9:615-629
Shafer ABA, Cullingham CI, Cote SD, Coltman DW (2010) Of glaciers and refugia: a decade of study sheds new light on the phylogeography of northwestern North America. Mol Ecol 19:4589-4621
Sigaard P, Pertoldi C, Madsen AB, Sogaard B, Loeschke V (2008) Patterns of genetic variation in isolated Danish populations of the endangered butterfly Euphy dry as aurinia. Biol J Linn Soc 95:677-687
Simon C, Frati F, Beckenbach A, Crespi BJ, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87:651-701
Slatkin M, Hudson RR (1991) Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations. Genetics 129:555-562 37
Southern Interior Invertebrates Recovery Team (2008) Recovery Strategy for the Mormon Metalmark {Apodemia mormd), British Columbia Population in British Columbia. Prepared for the BC Ministry of Environment, Victoria, BC
Sperling FAH, Roe AD (2009) Molecular dimensions of insect taxonomy. In: Foottit R, Adler P (eds) Insect Biodiversity: Science and Society, 1st edn. Wiley-Blackwell, Chichister, UK, pp. 397-416
Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595
US Fish and Wildlife Service (1984) Revised Recovery Plan for Three Endangered Species Endemic to the Antioch Dunes, California (Lange's Metalmark Butterfly, Contra Costa Wallflower, and Antioch Dunes Evening Primrose). U.S. Fish and Wildlife Service, Portland, OR
US Fish and Wildlife Service (2007) Species account: Lange's Metalmark butterfly, Apodemia mormo langei. Sacramento Fish and Wildlife Office. http://www.fws.gov/sacramento/es/animal_spp_acct/langes_metalmark_butterfly. pdf Accessed 18 October 2010
Zhang A, He L, Crozier R, Muster C, Zhu C (2010) Estimating sample sizes for DNA barcoding. Mol Phylogenet Evol 54:1035-1039
Zwickl DJ (2006) Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. dissertation, The University of Texas at Austin Table 2-1 Collection locality data location, date, collector, latitude, longitude, number of SSRs generated, number of mtDNA sequences generated, and mtDNA haplotypes represented
Location Coll Date Collectors) Lat (deg) Long (deg) :SS R (n) mtDNA|'n ) mtDNA haplotypes "Eastern samples CAN SK West Block, Grasslands National Park Laounenan 15-Aug-2008 B Proshek, M Fairbairn 49 20603 -107 56911 6 5 hl56,hl57 CAN SK West Block, Grasslands National Park Timbergulch 15-Aug-2008 B Proshek, M Fairbairn 49 19856 •107 50081 4 4 hl39,hl56 CAN SK West Block Grasslands National Park Police Coulee 15 Aug-2008 B Proshek, M Fairbairn 49 17960 107 52509 4 4 hl56,hl66 CAN SK West Block, Grasslands National Park Police Coulee 17 Aug-2007 A Henderson 49 17960 -107 52509 3 3 hl39,hl56 CAN SK West Block, Grasslands National Park Timmons Coulee lS-Aug-2008 B Proshek, M Fairbairn 49 18259 -107 54510 4 4 hl35,hl56,hl71 CAN SK West Block, Grasslands National Park Timmons Coulee 16 Aug-2007 A Henderson 49 18259 107 54510 2 2 hl56 CAN SK West Block, Grasslands National Park Mid 70 Mile 15-Aug-2008 B Proshek, M Fairbairn 49 18724 -107 66578 4 4 hl37,hl56,hl57 CAN SK West Block, Grasslands National Park Broken Hills 16 Aug-2008 B Proshek 49 15049 -107 56326 8 8 hl37,hl39,hl78,hl80 CAN SK West Block, Grasslands National Park Broken Hills 20-Aug-2007 A Henderson 4915049 -107 56326 4 4 hl37,hl80 CAN SK West Block, Grasslands National Park 70 Mile 19-Aug-2008 K Fink, C Dutchak 49 20295 -107 65740 7 7 hl35,hl37,hl39,hl56,hl80 CAN SK West Block, Grasslands National Park Broken Hills 21-Aug-2007 A Henderson 49 20295 -107 65740 3 3 hl37,hl56,h400 CAN SK West Block, Grasslands National Park S 70 Mile 29-Aug-2008 A Henderson 49 15450 -107 68015 3 3 hl39,hl56 CAN SK West Block, Grasslands National Park S Gillespie 29-Aug-2008 A Henderson 49 01783 -107 27961 1 1 hl37 CAN SK West Block, Grasslands National Park S Gillespie 12-Aug-2008 A Henderson 49 01783 -107 27961 4 4 hl37,hl66 CAN SK West Block, Grasslands National Park S Gillespie 16-Aug 2007 A Henderson 49 01783 -107 27961 1 1 h405 CAN SK West Block, Grasslands National Park N Gillespie 15-Aug-2007 A Henderson 49 12839 -107 25547 1 1 hl37 CAN SK East Block, Grasslands National Park 1 ll-Aug-2008 A Henderson, C Dutchak, B Proshek 49 04011 -106 57832 6 6 hl35,136,hl37,hl39,hl40 CAN SK East Block, Grasslands National Park 1 12-Aug-2008 A Henderson, M Fairbairn 49 04011 -106 57832 1 1 hl37 CAN SK East Block, Grasslands National Park 1 13-Aug-2008 C Dutchak, K Fink 49 04011 -106 57832 2 2 hl35,hl37 CAN SK East Block, Grasslands National Park 2 12-Aug-2008 A Henderson, M Fairbairn 49 05735 -106 57436 4 4 hl35,hl37 CAN SK East Block, Grasslands National Park 3 12-Aug-2008 B Proshek 49 01677 -106 54233 6 6 hl37,hl39 CAN SK East Block, Grasslands National Park 4 12-Aug-2008 B Proshek 49 02457 -106 54509 2 2 hl37 USA MT Dry bluffs justs of Hinsdale 17-Aug-2008 B Proshek 48 37247 -107 09170 10 10 hl39,hl56,hl80 USA MT Missouri River bluffs E of Hwy 16, S of Culbertson 18-Aug-2008 B Proshek 4812879 -104 47260 16 16 hl96, hl97,198,199, h202, 206 h207, h208 USA MT E of Sidney, near junction ofSR 23 and Hwy 261 19-Aug-2008 B Proshek 47 66215 -10413214 7 7 h212, h213, h214, h216, h217, h218 USA MT Co Rd 467, S of Circle 20-Aug-2008 B Proshek 47 31305 -105 59655 5 5 h219,h220,h223 USA MT Badlands just E of Makoshika SP, near Glendive 21-Aug-2008 B Proshek 47 04881 -104 66299 30 29 hl97, h202, h225, h226, h228, h232, h237, h240 USA ND Burning Coal Vein Campground, NW of Amidon 23-Aug-2008 B Proshek 46 59727 103 44460 10 10 h225, h254, h255, h256, h258, h259, h260, h261 USA MT Dry bluffs 7 mi N of Laurel on Hwy S32 28-Aug-2008 B Proshek 45 80759 -108 83447 11 11 h287,h307,h309,h311 USA MT HollenbeckDraw,5miSofBelfrey 27-Aug-2008 B Proshek 45 07076 -109 03241 21 21 h286, h287, h295, h297, h298, h300 USA SD McNenny Fish Hatchery, near Spearfish 25-Aug-2008 B Proshek 44 56734 -104 01652 10 10 h207, h259, h265 USA WY Upper Powder River Rd, exit 88 off US 90W 26-Aug-2008 B Proshek 44 22189 -106 15839 12 12 h223, h226, h274, h275, h278, h281, h283, h285 totals 212 210
'Western samples CAN BC nearKeremeos siteNl 23-Aug-2008 L Crawford, S Desjardms 49 26469 -119 82383 5 10 h356 CAN BC nearKeremeos site CI 12-Aug-2008 L Crawford, S Desjardins 49 20787 -119 82460 5 10 h356 CAN BC nearKeremeos siteW8 17-Aug-2008 L Crawford, S Desjardins 49 20681 -119 85524 3 5 h356 CAN BC nearKeremeos siteW6 5-Sep-2008 B Proshek, S Desjardins 49 20430 119 86720 10 10 h350, h356 CAN BC near Keremeos site E2 18-Aug-2008 L Crawford, S Desjardins 4917759 -119 78030 8 9 h350, h356 USA WA Shanker's Bend, Similkameen River Cyn.W of Oroville 22-Aug-2008 L Crawford, S Desjardins 48 97314 -119 50821 5 8 hSHK02, 350 USA WA ToatsCouleeCk,WofSinlahekinCk,SofPalmerLake 6-Sep-2008 B Proshek 48 83255 -119 67781 10 10 h350,h371 USA WA Bluffs E of the Okanogan River at Riverside 4-Sep-2008 B Proshek 48 50761 -120 46909 10 11 h350,h352,h356,h358 USA WA Umtanum Ck off Hwy 281, S of Ellensburg 3-Sep-2008 B Proshek 46 85023 -120 48841 8 9 h341, h342, h343, h344, h345, h346 USA ID Bluffs E of Graves Creek Rd, 8 km S of Cottonwood 30-Aug-2008 B Proshek 45 97489 -116 36036 11 11 h318,h321,h323,h326 USA OR Just N of junction US 395 & OR 74 l-Sep-2008 B Proshek 45 46236 -118 98676 9 12 h329,h330,h332,h335 totals 84 105
CO 39
Table 2-2. PCR protocol for amplification of the COI gene.a
Rxn Initial Volume components concentration fuL) PCR buffer lOx 1.5 dNTPs 10 mM 0.3 Forward primer 5uM 0.6 Reverse primer 5mM 0.6 Taq polymerase -0.2 U/nL 0.2 water - 9.3 DNA template ~40 ng/ul 2.5 total 15 aCycling was performed for one cycle at 94 °C for 3 min; 30 cycles at 94 °C for 30 s, 45 °C for 30 s, and 72 °C for 60 s; and a final cycle at 72 °C for 7 min.
Table 2-3. Protocol for cycle-sequencing of COI gene fragments.3 Rxn Initial Volume components concentration (|iL/) BigDye buffer 4x 3 primer 5uM 0.32 BigDye premix as supplied 0.92 water - 2.96 PCR product - 2.8 total 10 aCycling was performed for one cycle at 96 °C for 60 s, and 26 cycles at 96 °C for 15 s, 50 C for 10 s, and 60 °C for 4 min. Table 2-4. Primer sequence and characteristics of six microsatellite markers isolated from Apodemia mormo. Size is the length of the amplicon in the individual from which the locus was originally sequenced. Locus Direc- name tion Primer sequence Repeat motif Tm (°C) Size fbp") M2 F 5' GGTCCAGCCGTTCAAAAGT 3' (AC)AT(AC7)AT(AC8)ATGC(AXAC4) 60.1 118 R 5' TTTTCACGCCCTTTCTGAC 3' 60.2 F3 F 5' CCCATCACGCATACACTCAC 3' (CA5)A(CA5) 60.0 325 R 5' TGAAAGGCCGTAGATTTTGAA 3' 59.7 D6 F 5' GCAGAATCGATGTTAATTTGTTT 3' (TG3)AT(TG8) 57.4 124 R 5' CTTTTGCCCCGTCCTATTAT 3' 58.0 ML8 F 5' GCAGAATCTATTCGAAGTCCA 3' (CA)AA(CAIO) 57.0 150 R 5' CCAAAACAATGTAGCGAGGT 3' 57.7 W6 F 5' AGGCCGACTTGATTCAAACTT 3' (TACA3)(CA20)fTACA5) 60.1 211 R 5' CCAAATATATCCGCAATGACG 3' 60.1 E7 F 5' CTTCCCAATGGCGTGTCTAT 3' (TG3)GGGGAC(TG10) 60.0 247 R 5' CCCCTTGTCACACAATGTCA 3' 60.4
4». O Table 2-5. PCR protocols for amplification of six microsatellite loci.
Locus Loci F3 Loci D6 Locus W6a and E7a and M2C ML8b Rxn Initial volume volume volume volume components concentration (uL) fuL) fuL] (HL] PCR buffer lOx 1.5 1.5 1.5 2.4 MgC12 25 mM 1.32 1.02 1.5 - dNTPs 10 mM 0.3 0.3 0.3 0.24 Forward primer 2uM 1.2 1.2 1.2 0.96 Reverse primer 10 nM 0.24 0.24 0.24 0.19 Taq polymerase -0.2 U/nL 0.15 0.15 0.15 0.12 water - 7.79 8.09 7.61 5.59 DNA ~40 ng/iiL 2.5 2.5 2.5 2.5 total 15 15 15 12 aThermal cycling was performed for one cycle at 94 °C for 60 s; 30 cycles at 94 °C for 30 s, 60.5 °C for 20 s, and 72 °C for 5 s; and a final cycle at 72 °C for 15 min. bThermal cycling was performed for one cycle at 94 °C for 60 s; three cycles at 94 °C for 30 s, 55 °C for 20 s, and 72 °C for 5 s; 33 cycles at 94 °C for 15 s, 55 °C for 20 s, and 72 °C for 1 s; and a final cycle at 72 °C for 30 min. Thermal cycling was performed for one cycle at 98 °C for 45 s; 30 cycles at 98 °C for 8 s, 59 °C for 20 s, and 72 °C for 8 s; and a final cycle at 72 °C for 10 min. Table 2-6. Summary statistics for 1498 base pairs of the COI gene. N. Washington, British Columbia, East Block and West Block (Grasslands National Park, SK) represent pooling of samples from several locations. Averages do not include global values. Bold numbers indicate significant values (p < 0.05). Demographic Expansion Spatial Expansion N Nucleotide diversity Haplotype diversity SSD Raggedness SSD Raggedness Tajima's D Fu's Fs West Block, SK 60 0.001048 +/- 0.000704 0.8316+/-0.0319 0.0233 0.1025 0.0229 0.1025 -0.9640 -3.6600 East Block, SK 21 0.000430 +/- 0.000389 0.5524+/-0.1215 0.2527 0.2222 0.0084 0.2222 0.3406 0.2955 Hinsdale, MT 10 0.000270+/-0.000307 0.6667 +/- 0.1633 0.0058 0.1827 0.0058 0.1827 -1.4009 -1.1639 Culbertson, MT 16 0.001059 +/- 0.000746 0.8500 +/- 0.0772 0.0010 0.0397 0.0010 0.0397 -0.9068 -2.4941 Sidney, MT 7 0.003145+/- 0.002007 0.9524 +/- 0.0955 0.0527 0.1655 0.0520 0.1655 -0.6600 -1.2687 Circle, MT 5 0.002694+/-0.001889 0.7000 +/- 0.2184 0.1402 0.2300 0.1006 0.2300 -1.1927 1.8718 Glendive, MT 29 0.001830+/-0.001113 0.8547 +/- 0.0477 0.1720 0.4104 0.1397 0.4104 -0.3619 -0.3229 Amidon, ND 10 0.002131+/-0.001361 0.9556+/-0.0594 0.0060 0.0346 0.0060 0.0346 -0.8439 -3.3836 Laurel, MT 11 0.004084+/-0.002376 0.7636+/-0.1066 0.1565 0.3002 0.0929 0.3002 1.1920 4.0383 Hlbk. Draw, MT 21 0.000480 +/- 0.000419 0.5619+/-0.1263 0.0039 0.0957 0.0039 0.0957 -1.0189 -3.2602 Spearfish, SD 10 0.000719 +/- 0.000584 0.7778 +/- 0.0907 0.0149 0.1309 0.0149 0.1309 1.6415 0.6028 Pwd. Riv., WY 12 0.002632+/-0.001598 0.8788 +/- 0.0751 0.0388 0.0684 0.0418 0.0684 0.3045 -0.6542 global 212 0.002957+/-0.001622 0.9564+/-0.0065 0.0039 0.0141 0.0057 0.0141 -1.6476 -25.4061 average 17.7 0.001710+/-0.001124 0.7788+/-0.1011 0.0723 0.1652 0.0408 0.1652 -0.3225 -0.7833
British Columbia 44 0.000090+/-0.000152 0.1744 +/- 0.0760 0.0004 0.5608 0.0002 0.5608 -1.3040 -2.1488 N. Washington 29 0.000491 +/- 0.000419 0.4236+/-0.1113 0.2571 0.2134 0.0097 0.2134 -1.7605 -2.6855 Umtanum Ck., WA 9 0.001984+/-0.001299 0.9167+/-0.0725 0.0111 0.0563 0.0102 0.0563 -0.5101 -1.2062 Graves Ck., ID 11 0.000514+/-0.000459 0.6182 +/- 0.1643 0.0211 0.3332 0.0129 0.3332 -2.1175 0.0712 Oregon 12 0.001012+/-0.000737 0.8030 +/- 0.0627 0.0040 0.0654 0.0040 0.0654 0.4659 0.2597 global 105 0.001409+/-0.000879 0.7831+/-0.0326 0.3162 0.0289 0.0080 0.0289 -1.5512 -6.1922 average 21.0 0.000818+/-0.000613 0.5871+/-0.9736 0.0587 0.2458 0.0074 0.2458 -1.0452 -1.1419 43
Table 2-7. Summary statistics for all five microsatellite loci that amplified within either eastern or western populations, and for only the four loci that were common to both eastern and western populations. N. Washington, British Columbia, East Block and West Block (Grasslands National Park, SK) represent pooling of samples from several locations. Alleles per locus, observed heterozygosity (Ho), expected heterozygosity (HE), and Fis are reported. Bold Fis values indicate significance at p < 0.05.
Alleles/ Alleles/ H0 H0 HE HE Fis Fis N 5 loci 4 loci 5 loci 4 loci 5 loci 4 loci 5 loci 4 loci West Block, SK 59 3.9 3.8 0.5898 0.5551 0.6281 0.6048 0.0197 0.0292 East Block, - SK 21 3.7 3.7 0.6191 0.5714 0.6105 0.5920 0.0326 0.0133
Hinsdale, MT 10 4.0 4.2 0.6600 0.6500 0.6432 0.6645 0.0650 0.0202 Culbertson, - MT 12 4.1 4.2 0.6875 0.7031 0.7097 0.7354 0.0181 0.0169
Sidney, MT 7 3.7 4.3 0.5714 0.6786 0.5604 0.6648 0.0213 0.0224
Circle, MT 5 3.9 3.5 0.6400 0.6000 0.6756 0.6333 0.0378 0.0746 Glendive, MT 30 3.8 4.1 0.5867 0.6250 0.6064 0.6595 0.0092 0.0260
Amidon, ND 10 4.2 4.5 0.6600 0.7250 0.6590 0.7132 0.0017 0.0175 Laurel, MT 11 4.0 3.7 0.5818 0.5455 0.6355 0.5823 0.0883 0.0661 Hlbk. Draw, MT 21 4.4 3.9 0.6762 0.6071 0.7004 0.6463 0.0460 0.0621 Spearfish, SD 10 3.2 3.1 0.4600 0.4000 0.6074 0.5974 0.1919 0.2733 Pwd. Riv., - - WY 12 4.3 4.1 0.6833 0.6250 0.6978 0.6576 0.0189 0.0011 average 17.3 3.9 3.9 0.6180 0.6071 0.6445 0.6459 0.0133 0.0293
British Columbia 30 1.7 1.9 0.1936 0.1936 0.4375 0.4375 0.1521 0.1521 N. Washington 25 1.6 1.6 0.2080 0.2300 0.4496 0.4280 0.2163 0.1690 Umtanum Ck., WA 8 2.0 2.1 0.1750 0.2188 0.4983 0.5229 0.5782 0.4684 Graves Ck., ID 11 2.1 2.2 0.3455 0.4318 0.5957 0.6061 0.2516 0.1319 Oregon 9 1.7 1.8 0.1778 0.2222 0.5242 0.5245 0.4934 0.4199 average 16.6 1.8 1.9 0.2200 0.2593 0.5011 0.5038 0.3383 0.2683 Table 2-8. Pairwise DEST values for all eastern populations. Upper diagonal: values for all five loci that amplified within these populations Lower diagonal: values for the four loci common to the eastern and western populations, for the four loci that were common to both sets on the lower diagonals. The East Block and West Block of Grasslands National Park represent pooling of samples from several unique locations. Bold numbers indicate values that are < O.OS, indicating little differentiation.
West Block, Sidney, Circle, Glendive, Amidon, Laurel, Hlbk Draw, Spearfish, Pwd. Riv., SK East Block, SK Hinsdale, MT Culbertson, MT MT MT MT ND MT MT SD WY West Block, SK - 0.026 0.063 0.172 0.057 0.028 0.098 0.053 0.136 0.096 0.189 0.050 East Block, SK 0.039 - 0.060 0.197 0.117 0.008 0.080 0.042 0.189 0.152 0.155 0.046 Hinsdale, MT 0.082 0.094 - 0.034 0.000 0.089 0.031 0.009 0.098 0.082 0.105 0.109 Culbertson, MT 0.232 0.310 0.056 - -0.001 0 257 0.092 0.076 0.247 0.147 0.169 0.220 Sidney, MT 0.041 0.133 -0.001 -0.003 " 0.210 0.015 -0.015 0.185 0.062 0.117 0.044 Circle, MT 0.023 0.007 0 114 0.351 0 210 - 0114 0 100 0 127 0 133 0.092 0.042 Glendive, MT 0.089 0.093 0.046 0.139 0.021 0.118 - 0.000 0.148 0.143 0.159 0.037 Amidon, ND 0.051 0.054 0.018 0 129 -0.023 0.104 0.000 - 0.103 0.094 0.140 0.003 Laurel, MT 0.085 0.128 0.049 0.184 0.125 0.097 0.093 0.047 - 0.045 0 258 0.020 Hlbk. Draw, MT 0.059 0.098 0.064 0.081 0.015 0.085 0.085 0.054 0.019 - 0 259 0.059 Spearfish, SD 0.216 0.196 0.126 0.229 0124 0.173 0.192 0.171 0.190 0.194 - 0.174 Pwd. Riv., WY 0.031 0.023 0.089 0.201 0.010 0.049 0.009 -0.004 0.064 0.038 0.131 -
Table 2-9. Pairwise DEST values for all western populations. Upper diagonal: values for all five loci that amplified within these populations. Lower diagonal: values for the four loci common to the eastern and western populations. The British Columbia and Northern Washington populations represent pooling from several unique locations. Bold numbers indicate values that are < 0.05, indicating indicating little differentiation.
British N. Umtanum Ck., Graves Ck., Columbia Washington WA ID Oregon British Columbia - 0.005 0.057 0.070 0.052 N. Washington 0.004 - 0.109 0.066 0.036 Umtanum Ck., WA 0.067 0.172 - 0.048 0.089 Graves Ck., ID 0.091 0.102 0.091 - 0.038 Oregon 0.074 0.054 0.119 0.050 -
4* 4* Ju Kilometers
j s Lit,n(i (H
WBIock (59)
Umtanum Creek (9)
Glendive (30)
Laurel (11) Amidon (10
nbeck Draw (21)
Spearfish (1(
Powder Rivur
Figure 2-1. Map of sampling locations in Table 2-1, with inset of North America showing the study region. Numbers in parentheses indicate number of specimens from which genetic data was obtained. 46
2 Umtanum Ck, WA 1 Idaho 1 Umtanum Ck, WA 1 Umtanum Ck, WA 4 Oregon & Umtanum Ck, WA 4 Oregon 3 Oregon 1 Oregon 2 Umtanum Ck, WA CO 1 Umtanum Ck, WA c+ 24 N. Washington & British Columbia 1 Idaho 3 7 Idaho 1 N Washington 3 N Washington 2 Idaho 1 N Washington h352 1 N Washington h356 43 N Washington & British Columbia h3290regon 2 Oregon 65 I— h3H 3 Laurel, MT 74 r—A h223 2 Circle, MT&WY I h285 1 Wyoming I h278 1 Wyoming 1 Glendive, MT 13 Glendive, MT & WY 1 Wyoming 1 Sidney, MT 1 Culbertson, MT 10 Glendive, MT & ND 1 North Dakota 2 North Dakota 1 Sidney, MT 1 Sidney, MT h218 1 Sidney, MT 2 Glendive, MT 8 Culbertson & Glendive, MT 3 Circle, MT 1 Circle, MT 1 Glendive, MT 3 Culbertson, MT 1 North Dakota 1 Culbertson, MT 1 Culbertson, MT 1 Culbertson, MT m 1 Wyoming 2 Wyoming rt> 8 ND.WY 1 North Dakota 3 h265 4 South Dakota h298 1 H ollenbeck Draw, MT 70 h286 1 H ollenbeck Draw, MT - h297 2 Hollenbeck Draw, MT - h300 1 Hollenbeck Draw, MT j h307 6 Laurel, MT "1 h295 2 Hollenbeck Draw, MT h287 15 Hollenbeck Draw & Laurel, MT h309 1 Laurel, MT h202 3 Culbertson & Glendive, MT h207 5 Culbertson, MT & SD h214 2 Sidney, MT h212 1 Sidney, MT h258 1 North Dakota 57 hl71 1 WBIock.SK hl40 1 EBlock,SK 62 hl66 3 WBIock.SK hl36 1 EBIock.SK — hl78 2 WBIock.SK hl37 31 EBlock & WBlock, SK — h40S 1 WBlock, SK hlS7 2 WBlock, SK hl56 21 WBlock, SK& Hinsdale, MT 0 001 1— I— ih40 0 1 WBlock, SK hl39 16 EBlock & WBlock, SK, & Hinsdale, MT — hl80 4 WBlock, SK, & Hinsdale, MT — hl35 7 EBlock and WBlock, SK h256 1 North Dakota h228 1 Glendive, MT Figure 2-2. Maximum likelihood phylogram of 78 unique haplotypes based on 1498 base pairs of the COI gene Columns after terminal tips indicate number of specimens represented by each identical haplotype followed by geographical origin of those specimens. Haplotypes and labels representing British Columbia and Saskatchewan specimens are bolded Numbers above branches indicate bootstrap support based on 200 replicates. Scale bar is proportional to changes per site. 47
CHAPTER 3: CONSERVATION AND TAXONOMIC STATUS OF THE ENDANGERED BUTTERFLY APODEMIA MORMO LANGEI (LEPIDOPTERA: RIODINIDAE)
Introduction
Taxonomic rank assessments can have far-reaching consequences for many areas of biology, but are particularly important on an applied level for conservation (May 1990, DeSalle & Amato 2004, Ramey et al. 2005, King et al. 2006, Vila et al. 2010). The taxonomic status of a population greatly affects its conservation significance (Morrison et al. 2009], and careful application of taxonomic names allows more efficient use of limited conservation resources (Rubinoff and Sperling 2004). Although a taxonomic ranking is a hypothesis that the population in question possesses a unique evolutionary history (Wilson & Brown 1953), this is not always reflected in biological reality (O'Brien & Mayr 1991, Isaac et al. 2004, Zink 2004). Assessing whether or not a population possesses a unique evolutionary history—i.e., is an Evolutionary Significant Unit (ESU) (Ryder 1986)—has therefore long been a paramount factor in determining conservation priority (e.g. Moritz 1994a, Ramey et al. 2005, King et al. 2006, Morgan et al. 2008). Authors generally recognize an ESU when it has substantive historical genetic isolation from its closest relatives and some morphological or ecological evidence of local adaptation, whether due to genetic drift or natural selection (Ryder 1986, Moritz 1994a, Waples 1991, Palsb0ll et al. 2007). Although assessments of ESU status include ecological characteristics (Crandall et al. 2000), the use of genetic markers has become increasingly important (Laikre et al. 2009). Mitochondrial DNA (mtDNA) markers and the cytochrome oxidase I (COI) gene in particular have been demonstrated to be very useful markers for determining ESU status (Moritz 1994b). The small effective population size and fast mutation rate of mtDNA cause it to assort faster than nuclear genes, making it suitable for assessing recent historical genetic isolation. The evolution of mtDNA is also purportedly neutral and its inheritance both clonal and maternal, making interpretation straightforward (Sperling 2003). Despite concerns about the validity 48 of those properties across species (Galtier et al. 2009), mtDNA remains an important indicator (Rubinoff & Holland 2005). Nevertheless, since increasing the number of genetic markers can greatly multiply the accuracy and stability of assessments of evolutionary distinctiveness (Behura 2006, Gompert et al. 2006, Bos et al. 2008), mtDNA is often used in tandem with other markers. Microsatellites are also very popular genetic markers (Selkoe & Toonen 2006). These short-sequence repeats (SSRs) are widely used in conservation biology and molecular ecology, among other fields, due to their putatively neutral variation, large number of alleles at each locus, and rapid mutation rate that enables fine-scale resolution of population and phylogenetic processes (Friar et al. 2007, Lukoschek et al. 2008). Despite the technical difficulties they present in some taxa, especially Lepidoptera (Meglecz et al. 2004, Zhang 2004, Torres-Leguizamon et al. 2009), microsatellites are very useful markers for assessing evolutionary distinctiveness (Koopman et al. 2007, Saarinen et al. 2009). Lange's Metalmark, Apodemia mormo langei Comstock, 1939, is an endangered subspecies characterized by a constrained range and a unique phenotype. Described from the banks of the San Joaquin River upstream of San Francisco in Contra Costa County, that site remains the only recognized location for this taxon. Due to habitat loss from sand mining and other activities, the population was near extinction when it was placed on the US Endangered Species List in 1976 under the Endangered Species Act (ESA) (Federal Register 41:22044,1976). The Antioch Dunes National Wildlife Refuge (NWR) was established to protect it and two species of wildflower (the Antioch Dunes evening-primrose, Oenothera deltoides subsp. howellii [Munz] W. Klein and the Contra Costa wallflower, Erysimum capitatum var. angustatum [Greene] G. Rossb.) , the first use of a NWR expressly for conservation (Howard & Arnold 1980). Lange's Metalmark has undergone several boom-and-bust cycles, but is being maintained through extensive conservation efforts by several organizations, including a captive rearing program (US Fish and Wildlife Service 1984, 2002, 2008, Johnson etal. 2007). Apodemia mormo langei is a member of a unique and variable species group, the A. mormo species complex. Three species are currently recognized in this 49 complex: A. mormo (Felder & Felder, 1859), A. virgulti (Behr, 1865), and A. mejicanus (Behr, 1865) (Pelham 2008). Apodemia mormo occurs across western North America, from Mexico to Canada, and is by far the widest ranging metalmark in North America; A. virgulti is found from southern California into Mexico; and A mejicanus is found from southern California across to Texas, with an isolated subspecies in Colorado (Fig. 1-1) (Scott 1986, Opler & Powell 1961). The species complex shows considerable variation in wing markings, voltinism, flight periods, and host use, although all feed exclusively on Eriogonum (wild buckwheat, Polygonaceae). Due to this variability there is significant taxonomic interest in the group. Currently there are 17 accepted subspecies in the complex (Pelham 2008), but the number and status of these taxa is far from settled (e.g. Pratt & Ballmer 1991, Davenport 2004). Most of this taxonomic diversity is concentrated in the Southwest region of the USA. Here we employ mitochondrial COI gene sequence data, six novel microsatellite markers, and 11 wing characters to test the ESU and conservation status of Apodemia mormo langei. We ask three questions: (1) can A. m. langei be reliably and uniquely identified based on its phenotype, specifically its wing characters? (2) What other populations or taxa is it most closely related to? and (3) How does its genetic diversity compare to the rest of the species complex at the population, subspecific, and specific levels? These questions have important ramifications for this taxon's conservation and for conservation triage and prioritization broadly.
Materials and Methods
SAMPLING
A total of 548 specimens of Apodemia and outgroups were collected from six principal sources (Table 3-1). Specimens of A mormo langei from Antioch Dunes NWR were collected under US Fish & Wildlife Service collection permit PRT-832200. Collection, vouchering, and preservation of specimens differed among sources. 50
(Appendix 1). The mitochondrial COI gene was sequenced (1498 base pairs) and up to five microsatellite loci were scored from as many specimens as possible. The principal exceptions were the 82 specimens from Opler, Davenport et al. (Source #3, Table 3-1). The only genetic data available to us from those samples were the 648 base pairs of the "barcode region" of the COI gene, which were obtained via P. Opler from the Barcode of Life Database. In total, sampling of the A mormo species complex spanned 62 geographic locations in 12 states and two provinces in three countries (Appendix 1), comprising most of the known range.
PHOTOGRAPHS
All vouchered specimens were photographed, with the exception of 38 specimens vouchered at Grasslands National Park, SK, which were preserved in ethanol and were unable to be photographed. Dorsal-view photographs of most vouchered specimens were taken by B. Proshek with an 8.0 megapixel Nikon Coolpix 8400 mounted on an Olympus SZX16 dissecting microscope illuminated with a fiber-optic light source. Dorsal photographs of the specimens from Opler, Davenport et al. (Source #3, Table 3-1) were obtained via P. Opler from BOLD.
WING CHARACTERS
In order to relate the specimens in our study to the described taxa, seven binary and four multi-state wing characters were chosen to differentiate the 17 subspecies in the Apodemia mormo species complex (Pelham 2008) (Fig. 3-1, Table 3-2). Characters were chosen based on type descriptions (see Table 3-3 for list of subspecies and type descriptions), descriptions in Opler & Powell (1961), and examination of photographs in the Butterflies of America website (Warren et al. 2010). Images of type specimens were examined, when available; otherwise, images of several representative specimens were used. Characters were limited to the dorsal side only and chosen to be independent of specimen size or interpretation of shades of colour. This allows specimens to be scored with these characters based 51 only on a dorsal-view photograph with an unknown light source and camera settings and without a scale bar.
DNA EXTRACTION
Several methods of DNA extraction were used. DNA was extracted from the samples collected by Proshek et al., Powell, and Davenport (sources #1,4, and 5, Table 3-1) from two legs (or leg fragments and antennae, if the specimen was in poor condition) using the DNeasy Tissue Extraction Kit (Qiagen, Valencia, CA). Two final elutions of 200uL were performed for maximum extraction. DNA from the specimens collected by Sperling, Powell et al. (Table 3-1) was extracted from the thorax using a phenol-chloroform method as outlined in Sperling & Harrison (1994). Sequences from the samples collected by Opler, Davenport et al. (Table 3-1) were obtained from the Canadian Centre for DNA Barcoding (Guelph, ON) (Hajibabaei et al. 2005, www.dnabarcoding.ca), but we did not have access to these DNA extractions. DNA was extracted from the samples collected by Crawford and Desjardins (Table 3-1) from wing clips as in Keyghobadi et al. (2009).
MTDNA SEQUENCING
The mitochondrial gene C01 was sequenced in its entirety for as many specimens as possible. In total, 469 sequences of 1498 base pairs in length were obtained. For the samples collected by Sperling, Powell et al. (Table 1), 398 base pairs of the gene were initially sequenced using the two primers Jerry (CAACATTTATTTTGATTTTTTGG) (Cl-J-2183) (Simon etal. 1994) and K741 (Cl-N- 2578a) (Caterino and Sperling 1999), following Caterino and Sperling (1999). The rest of the gene was later amplified in two fragments using the primer pairs LCO1490 (TTTCTACTAATCATAAAGATATTGG) to HC02198 (TAAACTTCTGGATGACCAAAAAATCA) (Folmer et al. 1994) and BrianXXVII (CACCTATATTATGAAGATTAGG) to Pat (ATCCATTACATATAATCTGCCATA) (Simon 52 et al. 1994). For all other samples, the COI gene was sequenced in two fragments: LCO to HCO and Jerry to Pat, unless chromatogram signal was poor, in which case the internal primers Jerry and Mila (MilaX, GATAGTCCTGTAAATAATGG, for samples from west of the Rocky Mountains and MilaXI, GATAATCCTGTAAATAATGG, for samples from east of the Rocky Mountains) and BrianXXVIl and Pat were used. The polymerase chain reaction (PCR) and cycle sequencing protocols are given in detail in Chapter 2. Chromatograms were checked for signal quality in Lasergene (DNASTAR, Madison, WI). Priming sites were manually removed and sequences were manually aligned in MESQUITE 2.72 (Maddison & Maddison 2009).
MlCROSATELLITE DEVELOPMENT, AMPLIFICATION AND GENOTYPING
We isolated and characterized six novel microsatellite loci from two libraries. Details of library development and loci amplification are given in Chapter 2. Genotyping was carried out in GeneMapper (Applied Biosystems, Foster City, CA). We were able to obtain genotype scores for a total of 447 samples from all sampling sources except Source #3 (Table 3-1). Amplification success was not consistent across sampling areas. Locus E7 did not amplify in individuals from west of the Rockies, and locus M2 did not amplify for individuals from east of the Rockies (the two samples from Sonora, Mexico did not amplify at E7 but one did amplify at M2). All samples, therefore, were genotyped at a maximum of five loci; 60 were only genotyped at four loci and 52 only at three loci; any samples that amplified at less were disregarded.
ANALYSES
There were a total of 205 unique COI haplotypes: 157 haplotypes 1498 base pairs in length, and 48 "barcode" haplotypes 648 base pairs in length (Fig. 3-2, Appendix 2). Haplotypes were only considered unique if there was at least one base substitution relative to all other haplotypes. Missing base pairs were scored as "N" (missing). All 1498-base pair COI haplotypes from the specimens from Sperling, 53
Powell et al. (Table 1) had 18 missing base pairs from the middle of the haplotypes where the internal primers overlapped; all other 1498-base pair COI haplotypes had 11 missing base pairs at the same location. A maximum-likelihood phylogenetic analysis of the COI sequences was performed in GARLI 1.0 (Zwickl 2006) under the TPM2uf+I+G model, which was selected by JMODELTEST 0.1.1 (Posada 2008, Guindon & Gascuel 2003) as the most likely model for our data under the AIC, AICc, and BIC model selection criteria. For the best-tree analysis, rates were constrained so that r[AC] = r[AT], r[AG] = r[CT], and r[CG] = [GT]. The rate parameters, base frequencies, proportion of invariable sites, and gamma shape parameter were estimated during analysis. Twenty-five search replicates were performed to find the best tree. Two hundred fifty bootstrap replicates were also performed under the same model, except with parameters fixed at the following values: r[AC] = r[AT] = 4.6640; r[AG] = r [CT] = 36.8988; r[CG] = r [GT] = 1.000; eqA = 0.3248, eqC = 0.1293, eqG = 0.1129, eqT = 0.4330; proportion invariable sites = 0.4780; and gamma shape parameter = 0.3120. Five Calephelis wrighti and two Emesis emesia were selected as the outgroups, all of which are members of the subfamily Riodinidae; the former is in the Riodinini and the latter, like Apodemia, is incertae sedis (Brower 2008). In order to provide a direct comparison with the tree generated from microsatellite data, a second phylogenetic tree was generated from the 154 unique mtDNA haplotypes from samples for which we also had microsatellite genotypes.
We generated a maximum-likelihood tree in GARLI 1.0 (Zwickl 2006) under the
GTR+I+G model selected by JMODELTEST 0.1.1 (Posada 2008, Guindon & Gascuel 2003) as the most likely for our data under both the AIC and hLRT criteria. AH parameters were estimated during analysis. Twenty-five search replicates were performed to find the best tree. Two hundred fifty bootstrap replicates were also performed under the same conditions. All tree were unrooted. The terminal tips were manually condensed into simplified groupings that approximated the populations from which the haplotypes were sampled, in order to compare the topology of the tree to a tree generated by analysis of microsatellite genetic distances in a priori populations (below). 54
The program POPTREE2 (Takezaki et al. 2010) was used to generate a neighbour-joining tree based on the DA genetic distances (Nei et al. 1983) of population microsatellite allele frequencies within a priori populations. 1000 bootstrap replicates were performed.
The program STRUCTURE (Pritchard et al. 2000) uses a Bayesian algorithm to determine the fewest number of genetic clusters that maximizes Hardy-Weinberg equilibrium. Under the settings of no admixture between groupings and independent allele frequencies, with 40,000 burn-in generations and 240,000 post burn-in generations, we tested Rvalues (number of genetic clusters) between 2 and 20 with seven replications each. The ad hoc AK statistic of Evanno et al. (2005) indicated that the most likely true number of genetic clusters was six (Fig. 3-4).
Results
TAXONOMIC ASSIGNMENT BASED ON WING CHARACTERS
Using the diagnostic wing characters that distinguished the 17 subspecies of the Apodemia mormo complex (Table 3-4), as well as geographical information, most specimens could be assigned to one of A mormo mormo, A. mormo langei,A. mejicanus.A. mejicanus pueblo, A. cythera.A. cythera tuolumnensis, A. virgulti, or A virgulti nigrescens (Appendix 3). All specimens from the northern part of the range—BC, WA, OR, ID, MT, WY, SD, ND, and SK—were classified as A mormo mormo on the basis of geographic origin only, due to lack of morphological variation and because A mormo mormo is the only subspecies that occurs in those areas (Scott 1986). A few confusing specimens were classified as A nr. mormo, A. cf. mormo, or as A mormo nr. langei. Although A mormo langei was described based on its unique phenotype (Comstock 1939), a population has been discovered in the vicinity of Mendota, CA (Appendix 1) with very similar phenotypic characters to A mormo langei. Both populations share the unique character combination of orange 55 scaling over the forewing discal cell spot and hindwing basal spots and orange scaling medially on the hindwing (characters FE1, HI2, and HG1 [Table 2, Fig. 3-1]).
MTDNA PHYLOGEOGRAPHY
Maximum-likelihood search of 205 unique mtDNA haplotypes discovered a best tree of score -6087.971378 (Fig. 3-2). All the Apodemia of the A mormo species complex fell into the two clades denoted as the Western lineage and the Eastern lineage except for the three specimens of A mejicanus pueblo (Scott 1998). These specimens are very divergent from all others: the average percent sequence divergence between them and the other mejicanus from MX and CA is 4.0%, and between them and the other A mormo complex samples from Colorado is 3.35%. The latter divergence is much greater than that observed between any specimens of the A mormo species complex within any geographic region. The Eastern lineage comprised all Apodemia mormo complex haplotypes from individuals on or east of the Continental Divide, as well as from location #60 (Appendix 1), on the west slope of the Colorado Rockies. It also includes both Sonora, MX sites (Iocs. 64 & 65); the lone Nevada site (loc. 61); and one individual from a site in San Bernardino Co., CA (loc. 37). The Western lineage comprised all other haplotypes from west of the Continental Divide. The average percent sequence divergence between these two clades was 3.07%.
EASTERN LINEAGE
The Mexican haplotypes, the one sample from Nevada, and the outlier from San Bernardino, CA form a clade sister to all the other haplotypes in the Eastern lineage (Appendix 2). With the exception of one small clade of haplotypes from Wyoming and Montana with bootstrap support of 94%, the other haplotypes form very shallow clades with no bootstrap support and virtually no geographic pattern. The most interesting exception to the lack of geographic pattern is that all 13 Saskatchewan haplotypes and all three haplotypes from Hinsdale, MT (loc. 45 [Appendix 1], the closest site in Montana to the Saskatchewan locations) form a monophyletic clade. Most of the haplotypes from locations 51 and 52, in southern Montana and somewhat distant from other collection localities, also form a separate clade with a relatively long branch length.
WESTERN LINEAGE
The Western lineage clade is composed of four major clades, labeled A, B, C and D (Appendix 2, Fig. 3-3). Clade A is composed of specimens from the five most northern collection locations of Apodemia mormo in California (Iocs. 8-12, Appendix I), including the Antioch population of A. m. langei. Although branch lengths within this clade are short, the average divergence between this clade and the other three is 2.51%. The relative position of the other three major clades is unresolved. Branch lengths within each clade are relatively short, but divergences between them are substantial. Excluding one outlier from Santa Barbara Co., CA (haplotype 1189), Clade B is composed of specimens from four populations of A mormo in the central part of California (Iocs. 13-16), including the Mendota population of A m. cf. langei, all of which are south of the locations in Clade A and north of all the other California locations. Clade C is composed of specimens from all the central to southern California sampling locations, almost all of which we classify as either A virgulti ssp. or A mejicanus ssp. (Iocs. 17,18, 20-24, 27-30, 34-42 [Appendix 1]). Clade D is composed entirely of specimens from all collection locations in the Pacific Northwest (Iocs. 01-06 [Appendix 1]). The Pacific Northwest populations are quite divergent from the California populations, relative to divergences among California populations: on average, the samples in Clade D, from ID, OR, WA and BC, are 1.44% divergent from Clades B and C, the two closest clades based on sequence similarity, but 2.50% divergent from Clade A, the geographically closest samples in the West.
Clade C is the only one of the four major clades which has significant structure within it. Excluding the two outlier haplotypes (1180 and 1183), there are three clades within Clade C: clades CI, C2, and C3. Each is 0.94%, 1.10%, and 1.01% divergent, respectively, from all other haplotypes in Clade C. There is some 57 correspondence to taxonomic assignment between the C clades. Clade CI contains nine of the eleven A mejicanus samples in Clade C. Although Clade C2 contains a smattering of taxa, one clade within it is composed entirely of all the A cf. mormo from location 38. Clade C3 contains all eight of the A m. tuolumnensis samples and eight of the ten A mormo cythera samples. Geographically, while Clade CI is composed of samples widely distributed over central and southern California, Clade C2 only contains samples from southern California and all the samples in Clade C3 are from north of those in C2 (Fig. 3-3].
MlCROSATELLITE GROUPINGS
In a total analysis of all samples, using the program STRUCTURE (Pritchard et al. 2000) the most likely number of genetic clusters was determined to be six (AK highest at K=6 [Evanno et al. 2005]). The groupings found by the STRUCTURE analysis were robust across models and sampling. Even analyzing the populations from west and east of the continental divide separately, which enabled removal of the locus that did not amplify for each (locus E7 west of the Divide, locus M2 east of it) resulted in similar groupings (results not shown). The groupings are shown in Fig. 3-4. There are two clusters east of the Continental Divide without much geographical sorting, another cluster exclusive to the Pacific Northwest, and three clusters among the California populations. These broad groupings correspond well to the clades found with the mtDNA sequence analysis (Fig. 3-3): the two clusters east of the Divide correspond to the Eastern lineage, the Pacific Northwest cluster corresponds to Clade D of the Western lineage, and the remaining three California clusters are composed of the populations in clades A, B and C. The correspondence breaks down in California, however. Figure 3-3 shows the clades found by analysis of population distance based on microsatellite allele frequency in POPTREE2 (Takezaki et al. 2010), which correspond very closely to the clusters found in the STRUCTURE analysis. These microsatellite clades are compared to the clades in the best tree of score -4386.19156027 found by maximum likelihood 58 analysis of 154 mtDNA haplotypes from samples for which we also had microsatellite genotype data. The most notable instances of disagreement between microsatellite and mtDNA sequence are those with microsatellites: 1] the Cananea, MEX samples cluster with the western instead of the eastern samples; 2) the Jawbone and Limestone Camp samples of south-central California cluster with the northern California Hull Mt. and Ladoga samples; 3) the Antioch Apodemia mormo langei samples cluster with Tumey Hills, Arroyo Bayo and Del Puerto samples rather than with Mt. Diablo and Vallejo samples; and 4) the A. m. cf. langei samples from Mendota cluster with the southern California Camp Pendleton and Point Loma samples rather than with the much geographically closer Tumey Hills, Arroyo Bayo and Del Puerto samples. Overall, the concordance with between molecular groupings and the taxon names suggested by morphology is fairly high. As Fig. 3-3 shows, all the specimens in the mtDNA Eastern lineage and Clade D (the Pacific Northwest clade), which correspond with their respective complementary microsatellite grouping, are Apodemia mormo. Most of the specimens in Clade C and the corresponding microsatellite clades are some other taxon besides A. mormo. Within Clade C, however, there is little concordance between taxon names based on wing characters and groupings based on genetic analyses (Appendix 2). The correspondence between wing characters and genetic similarity most notably breaks down with respect to the A. mormo langei phenotype: according to both mtDNA and microsatellites, the population of A m. langei at Antioch and the A. m. nr. langei at Mendota are only distantly related.
Discussion
The definition of an ESU (sensu Ryder 1986, Moritz 1994a, Waples 1991 and Palsb0ll et al. 2007), is a population with genetic evidence of substantive historical isolation as well as some degree of divergence in morphological and/or ecological characters indicative of local adaption, attributable to either genetic drift or natural selection. We examine this definition as it relates to A. m. langei in the context of the 59 highly phenotypically diverse A mormo species complex, for which we present the first molecular examination. Across its range, the A. mormo species complex is as diverse genetically as it is phenotypically. The genetic variation, however, is largely unrelated to the phenotypic variation. The nominate subspecies A. m. mormo, which is phenotypically virtually identical everywhere across its range, from California to British Columbia and from New Mexico to Saskatchewan (Fig. 1-1), contains several deep genetic divergences, especially between the East and West sides of the Continental Divide and between the Pacific Northwest and California. These divergences are much greater than any genetic divergences between currently recognized taxa based on phenotype, with the exception of A mejicanus pueblo. Described from Colorado by Scott (1986) as a subspecies of A mormo but now under A mejicanus (Pelham 2008), this taxon is over 4% divergent from the A mejicanus from California, Nevada and Sonora and over 3.3% divergent from the other Apodemia mormo in Colorado. Although these estimates are based merely on three specimens and less than half of the COI gene, this taxon merits further investigation into whether it deserves full species status. According to evidence from both mtDNA and microsatellites, the northern most populations, the central populations and the southern populations are all more closely related to each other regardless of the taxonomic divisions within them (although the exact populations present in each geographic grouping are slightly different according to mtDNA and microsatellites [Fig. 3-3]). In California, where phenotypic and taxonomic diversity is highest, genetic variation corresponds much better to geography than it does to taxonomy. Within southern California, the nexus of the taxonomic diversity in this group, there is less correspondence between genetic characters and either geographic patterns or taxonomic designations. Three mtDNA haplotypes of the "barcode" length, hll61, hll63, and hll76, are even shared between sites and subspecies (Appendix 2). Patterns like this can often be explained by introgressive hybridization between neighbouring populations (e.g. Schmidt and Sperling 2008), which is certainly plausible in this case given the small genetic distances between taxa and populations. If that were the best explanation, 60 we would expect adjacent sites to share more haplotypes than distant ones. Since sites that share identical haplotypes were as frequently tens of miles apart as they were adjacent (Appendix 1), however, patterns may also be explained by high levels of ancestral polymorphism. Apodemia mormo's low vagility (Arnold & Powell 1983) and high habitat specificity (Opler & Powell 1961) greatly restrict its dispersal abilities. An evolutionary history of recent expansion, founder effects, and genetic drift and/or local adaptation due to lack of gene flow with neighbouring populations could explain the pattern of diverse phenotypic and ecological characteristics across southern California. The case of A mormo langei illustrates this process well. An examination of the mtDNA and microsatellite data indicates that the A mormo langei at Antioch Dunes and the A. mormo nr. langei at Mendota are both unique and only distantly related. All of the A m. langei haplotypes are unique to the Antioch location, and the same is true for all but one of the Mendota haplotypes. Each is very closely related to its most geographically proximate neighbours (Fig. 3-3). The Antioch population is very closely related (less than half a percent mtDNA sequence divergence) to the Vallejo and Mt. Diablo populations, and also closely related to several other geographically proximate populations. Microsatellite evidence indicates that this second tier of relationship is comprised of the Arroyo Bayo and Del Puerto populations, although mtDNA indicates the Hull Mt. and Ladoga populations as the next most related (Fig. 3-4, Appendix 2). Discordance between maternally and biparentally inherited markers is not unexpected, due to their different evolutionary histories (Hammouti et al. 2009). In either case, however, the Antioch population of A m. langei is not related to the Mendota population of central California that shares many of the same phenotypic characteristics that define A m. langei. There is also no evidence of convergent evolution between the populations at Antioch and Mendota to explain their similar phenotypes, since the habitats there are not strikingly similar and have different Eriogonum hosts (Appendix 1). The most parsimonious explanation for the phenotypic similarity between these two unrelated populations is founder effects and genetic drift. Due to their low vagility and high habitat specificity, colonization of new habitats in this species complex is 61 likely to be accomplished by just a few individuals. If those founders have a high frequency of the genes that encode for the phenotypes found in Antioch and Mendota, those phenotypes could become established in just a few generations simply by genetic drift in the absence of gene flow. Gene flow does appear to be rare, considering that populations just a few kilometers apart can have entirely unique haplotypes at those locations (e.g. Antioch, Hull Mt, Ladoga, Mt. Diablo and Vallejo [Fig. 3-3]). In conclusion, Apodemia mormo langei is essentially a subspecies that is only scale deep. That is not to say that it is not worth conserving; decisions on what populations to conserve are never easy, and always depend upon multiple factors (Vane-Wright et al. 1991). On the contrary, our data show not so much that Lange's Metalmark is not worthy of conservation, but conversely that many other populations and regional segregates of this multifarious butterfly scattered across North America have had just as much historical isolation as Lange's Metalmark, even if they were not fortunate enough to have acquired a signature phenotype, and are arguably just as worthy of conservation efforts. Taxa are often identified as being of conservation concern by morphological characteristics (Rubinoff & Sperling 2004), as in this case. Our study highlights the importance of incorporating genetics into such determinations in order to separate real historical evolutionary history from superficial divergence in highly variable and plastic characters (Joyce et al. 2009). If nothing else, such scientific testing of the Endangered Species Act should be welcomed (Buck & Corn 2007). But in the end, is A. m. langei, Lange's Metalmark, an ESU and is it a valid subspecies? It does meet the ESU's definition of a population with a unique evolutionary history and local adaptation, if only a very recent history and local adaptation that is not unique. We certainly don't advocate the sinking of the langei subspecies. The loss of a name can have negative consequences for a population's conservation (Morrison et al. 2009), and preservation of diversity itself is an intrinsic good. But in the final consideration, Lange's Metalmark only has as much of a unique evolutionary history and local adaptation as many other unnamed and overlooked metalmarks. 62
Literature Cited
Arnold, RA, Powell JA (1983) Apodemia mormo langei In: Ecological Studies of Six Endangered Butterflies (Lepidoptera, Lycaenidae): Island Biogeography, Patch Dynamics, and the Design of Habitat Preserves. University of California Publications in Entomology, 99, pp 99-128
Austin (1998) New subspecies of Lycaenidae (Lepidoptera) from Nevada and Arizona. In: Emmel TC (ed) Systematics of Western North American Butterflies. Mariposa Press, Gainesville, FL, pp 539-572
Barnes W, McDunnough (1918) Contributions to the Natural History of the Lepidoptera of North America 4:75
Behr (1865) On California Lepidoptera. Proc Cal Acad Sci 3:178-179
Behura SK (2006) Molecular marker systems in insects: current trends and future avenues. Mol Ecol 25:3087-3113
Bos D, Gopurenko D, Williams R, DeWoody J (2008) Inferring population history and demography using microsatellites, mitochondrial DNA, and major histocompatibility complex (MHC) genes. Evolution 62:1458-1468
Brock JP, Kaufman K (2003) Butterflies of North America. Houghton Mifflin, New York
Brower, AVZ (2008) Riodinidae Grote 1895. Metalmarks. Version 01 January 2008 (under construction). The Tree of Life Web Project. http://tolweb.org/Riodinidae/12174/2008.01.01 Accessed 18 Nov 2010
Brown, JW, Real HG, Faulkner DK (1992) Butterflies of Baja California: faunal survey, natural history, conservation biology. The Lepidoptera Research Foundation, Beverly Hills, CA
Buck EH, Corn ML (2007) The Endangered Species Act and "Sound Science". Congressional Research Services Report RL32992, pp 1-29
Caterino MS, Sperling FAH (1999) Papilio phylogeny based on mitochondrial cytochrome oxidase I and II genes. Mol Phylogenet Evol 11:122-137
Comstock, JA (1939) A new Apodemia from California (Lepidopt). Bulletin of the Southern California Academy of Sciences 37:129-131 63
Crandall KA, Bininda-Emonds ORP, Mace G, Wayne RK (2000) Considering evolutionary processes in conservation biology. Trends Ecol Evol 15:290-295
Davenport K (2004) A concise update of the information provided in The Butterflies of Southern California (1973) by Thomas C Emmel and John F Emmel. The Taxonomic Report of the International Lepidoptera Survey 4:1-23
DeSalle R, Amato G (2004) The expansion of conservation genetics. Nat Rev Genet 5:702-712
Diniz F, Iyengar A, Lima P, Maclean N, Bentzen P (2007) Application of a double- enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping. Genet Mol Biol 30:380-384
Edwards WH (1873) Descriptions of diurnal Lepidoptera found within the United States. Trans Am Entomol Soc 4:343-348
Emmel J, Emmel T (1998) Two new geographically restricted subspecies of Apodemia mormo (Lepidoptera: Riodinidae) from the vicinity of San Bernardino, California. In: Emmel TC (ed) Systematics of Western North American Butterflies. Mariposa Press, Gainesville, FL, pp. 795-800
Emmel J, Emmel T, Pratt G (1998) Five new subspecies of Apodemia mormo (Lepidoptera: Riodinidae) from southern California. In: Emmel TC (ed) Systematics of Western North American Butterflies. Mariposa Press, Gainesville, FL, pp. 801-810
Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol 14:2611- 2620
Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform Online 1:47- 50
Felder C, Felder R (1859) Wiener Entomologische Monatschrift 3:271
Folmer 0, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol and Biotech 3:294-299
Friar E, Cruse-Sanders J, McGlaughlin M (2007) Gene flow in Dubautia arborea and D. ciliolata: the roles of ecology and isolation by distance in maintaining species boundaries despite ongoing hybridization. Mol Ecol 16:4028-4038 64
Galtier N, Nabholz B, Glemin S, Hurst G (2009) Mitochondrial DNA as a marker of molecular diversity: a reappraisal. Mol Ecol 18:4541-4550
Gompert Z, Nice CC, Fordyce JA, Forister ML, Shapiro A (2006) Identifying units for conservation using molecular systematics: the cautionary tale of the Karner blue butterfly. Mol Ecol 15:1759-1768
Guindon S, Gascuel 0 (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52:696-704
Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooh RT, Kirk SL, Mackie PM, Hebert PDN (2005) Critical factors for assembling a high volume of DNA barcodes. Philos Trans R Soc Biol B Biol Sci 360:1959-1967
Hammouti N, Schmitt T, Seitz A, Kosuch J, Veith M (2009) Combining mitochondrial and nuclear evidences: a refined evolutionary history of Erebia medusa (Lepidoptera: Nymphalidae: Satyrinae) in Central Europe based on the COI gene. J Zool Sys Evol Res 48:115-125
Howard AQ, Arnold RA (1980) The Antioch dunes—safe at last? Fremontia 8:3-12
Isaac N, Mallet J, Mace G (2004) Taxonomic inflation: its influence on macroecology and conservation. Trends Ecol Evol 19:464-469
Johnson, JJ, Longcore T, Clause A, Pratt G, Dunn J, Osborne K (2007) Propagation handbook for Lange's metalmark butterfly, Apodemia mormo langei, 1st edn. The Urban Wildlands Group, Los Angeles
Joyce D, Dennis RLH, Bryant S, Shreeve T, Ready J, Pullin A (2009) Do taxonomic divisions reflect genetic differentiation? A comparison of morphological and genetic data in Coenonympha tullia (Miiller), Satyrinae. Biol J Linn Soc 97:314-327
Keyghobadi N, Crawford L, Maxwell S (2009) Successful analysis of AFLPs from non- lethally sampled wing tissues in butterflies. Conserv Genet 10:2021-2024
King TL, Switzer JF, Morrison CL, Eackles MS, Young CC, Lubinski BA, Cryan P (2006) Comprehensive genetic analyses reveal evolutionary distinction of a mouse {Zapus hudsonius preblei] proposed for delisting from the US Endangered Species Act. Mol Ecol 15:4331-4359
Koopman W, Li Y, Coart E, Van de Weg W, Vosman B, Roldan-Ruiz I, Smulders M (2007) Linked vs. unlinked markers: multilocus microsatellite haplotype-sharing as a tool to estimate gene flow and introgression. Mol Ecol 16:243-256 65
Laikre L, Nilsson T, Primmer C, Ryman N, Allendorf FW (2009) Importance of Genetics in the Interpretation of Favourable Conservation Status. Conserv Biol 23:1378-1381
Lukoschek V, Waycott M, Keogh J (2008) Relative information content of polymorphic microsatellites and mitochondrial DNA for inferring dispersal and population genetic structure in the olive sea snake, Aipysurus laevis. Mol Ecol 17: 3062-3077
Maddison WP, Maddison DR (2009) Mesquite: a modular system for evolutionary analysis, http://mesquiteproject.org Accessed 18 Nov 2010
May RM (1990) Taxonomy as destiny. Nature 347:129-130
Meglecz E, Petenian F, Danchin E, D'Acier A, Rasplus J, Faure E (2004) High similarity between flanking regions of different microsatellites detected within each of two species of Lepidoptera: Parnassius apollo and Euphydryas aurinict. Mol Ecol 13:1693-1700
Morgan M, Hunter D, Pietsch R, Osborne W, Keogh J (2008) Assessment of genetic diversity in the critically endangered Australian corroboree frogs, Pseudophryne corroboree and Pseudophryne pengilleyi, identifies four evolutionarily significant units for conservation. Mol Ecol 17:3448-3463
Moritz C (1994a) Defining 'Evolutionarily Significant Units' for Conservation. Trends Ecol Evol 9:373-375
Moritz C (1994b) Applications of mitochondrial DNA analysis in conservation: a critical review. Mol Ecol 3:401-411
Morrison W, Lohr J, Duchen P, Wilches R, Trujillo D, Mair M, Renner S (2009) The impact of taxonomic change on conservation: does it kill, can it save, or is it just irrelevant? Biol Cons 142:3201-3206
Nei M, Tajima F, Tateno Y (1983) Accuracy of estimated phylogenetic trees from molecular data. J Mol Evol 19:153-170
O'Brien S, Mayr E (1991) Bureaucratic mischief: recognizing endangered species and subspecies. Science 251:1187-1188
Opler PA, Lotts K, Naberhaus T, coordinators (2010) Butterflies and Moths of North America. Bozeman, MT: Big Sky Institute, http://www.butterfliesandmoths.org Accessed 12 Oct 2010
Opler P, Powell JA (1961) Taxonomic and distributional studies on the Western components of the Apodemia mormo complex (Riodinidae). J Lep Soc 15:145-171 66
Opler, PA Wright AB (1999) A Field Guide to Western Butterflies. Houghton Mifflin Company, Boston
Palsb0ll PJ, Berube M, Allendorf FW (2007) Identification of management units using population genetic data. Trends Ecol Evol 22:11-16
Park SDE (2001) Trypanotolerance in West African Cattle and the Population Genetic Effects of Selection. Ph.D. thesis, University of Dublin
Pelham JP (2008) A catalogue of the butterflies of the United States and Canada with a complete bibliography of the descriptive and systematic literature. J Res Lepid 40:1-652
Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25:1253- 1256
Pratt G, Ballmer G (1991) Three biotypes of Apodemia mormo (Riodinidae) in the Mojave Desert. J Lep Soc 45:46-57
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959
Ramey RR, Liu H, Epps CW, Carpenter LM, Wehausen JD (2005) Genetic relatedness of the Preble's meadow jumping mouse (Zapus hudsonius preblei) to nearby subspecies of Z. hudsonius as inferred from variation in cranial morphology, mitochondrial DNA and microsatellite DNA: implications for taxonomy and conservation. Anim Cons 8:329-346
Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered 86:248-249
Rubinoff D, Holland B (2005) Between two extremes: mitochondrial DNA is neither the panacea nor the nemesis of phylogenetic and taxonomic inference. Syst Biol 54:952-961
Rubinoff D, Sperling FAH (2004) Mitochondrial DNA sequence, morphology and ecology yield contrasting conservation implications for two threatened buckmoths (Hemileuca: Saturniidae). Biol Cons 118:341-351
Ryder OA (1986) Species conservation and cystematics: the dilemma of subspecies. Trends Ecol Evol 1:9-10
Saarinen E, Daniels J, Maruniak J (2009) Development and characterization of polymorphic microsatellite loci in the endangered Miami blue butterfly [Cydargus thomasi bethunebakeri). Mol Ecol Res 9:242-244 67
Schmidt BC, Sperling FAH (2008) Widespread decoupling of mtDNA variation and species integrity in Grammia tiger moths (Lepidoptera: Noctuidae). Syst Ent 33:613- 634
Scott, JA (1986) The butterflies of North America: A natural history and field guide. Stanford University Press, Stanford
Scott, JA (1998) New western North American butterflies. Papilio (New Series) 11
Selkoe K, Toonen R (2006) Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol Letters 9:615-629
Simon C, Frati F, Beckenbach A, Crespi BJ, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87:651-701
Sperling FAH (2003) Butterfly molecular systematics: from species definitions to higher level phylogenies. In: Boggs C, Ehrlich P, Watt W (eds) Ecology and Evolution Taking Flight: Butterflies as Model Study Systems. University of Chicago Press, Chicago, pp 431-458
Sperling FAH, Harrison RG (1994) Mitochondrial DNA variation within and between species of the Papilio mctchaon group of swallowtail butterflies. Evolution 48:408- 422
Takezaki N, Nei M, Tamura K (2010) POPTREE2: Software for constructing population trees from allele frequency data and computing other population statistics with Windows interface. Mol Biol Evol 27:747-752
Torres-Leguizamon M, Solignac M, Vautrin D, Capdevielle-Dulac C, Dupas S, Silvain F (2009) Isolation and characterization of polymorphic microsatellites in the Potato Tuber Moth Tecia solanivora (Povolny, 1973) (Lepidoptera: Gelechiidae). Mol Ecol Res 9:1167-1169
US Fish and Wildlife Service (1984) Revised Recovery Plan for Three Endangered Species Endemic to the Antioch Dunes, California (Lange's Metalmark Butterfly, Contra Costa Wallflower, and Antioch Dunes Evening Primrose). U.S. Fish and Wildlife Service, Portland, OR
US Fish and Wildlife Service (2002) Antioch Dunes National Wildlife Refuge Comprehensive Conservation Plan. US Fish and Wildlife Service, California/Nevada Planning Office, Sacramento CA 68
US Fish and Wildlife Service (2008) Sacramento Fish and Wildlife Office 2008 Species account: Lange's Metalmark butterfly, Apodemia mormo langei. http://wwwfwsgov/sacramento/es/animal_spp_acct/langes_metalmark_butterflyp df Accessed 25 October 2010)
Vane-Wright RI, Humphries CJ, Williams PH (1991) What to Protect?-Systematics and the Agony of Choice. Biol Cons 55:235-254
Vila R, Lukhtanov VA, Talavera G, Gil-T F, Pierce NE (2010) How common are dot like distributions? Taxonomical oversplitting in western European Agrodiaetus (Lepidoptera: Lycaenidae) revealed by chromosomal and molecular markers. Biol J Linn Soc 101:130-154
Waples R (1991) Pacific salmon, Oncorhyncus spp., and the definition of'species' under the Endangered Species Act. Mar Fish Rev 53:11-21
Warren AD, Davis KJ, Grishin NV, Pelham JP, Stangeland EM (2010) Interactive Listing of American Butterflies, http://www.butterfliesofamerica.com Accessed 18 Nov 2010
Weir BS, Cockerham CC (1984) Estimating F-statistics for the analysis of population structure. Evolution 38:1358-1370
Wilson EO, Brown Jr. WL (1953) The subspecies concept and its taxonomic application. Syst Zool 2:97-111
Zhang DX (2004) Lepidopteran microsatellite DNA: redundant but promising. Trends Ecol Evol 19:507-509
Zink R (2004) The role of subspecies in obscuring avian biological diversity and misleading conservation policy. Proc R Soc B 271:561-564
Zwickl DJ (2006) Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. dissertation. The University of Texas at Austin Table 3-1. Summary of the six sampling sources of specimens used in this study, including members of the Apodemia mormo species complex and outgroups. Initial Collectors N Region Dates preservation Extraction3 Locations Vouchers1 B. Prosheketal. 273 BC, SK, MT, ND, SD, Aug 2007 - Sep 2008 two legs in 99% DNeasy 01,03-07,43-54 UASM,GNP WY, ID, OR, WA ethanol F. Sperling, J. Powell et al. 121 California Sep 1995 - Jun 1998 Live frozen Phenol- 08-16.38,41-42 UASM, EME chloroform P. Opler, K. Davenport et al. 82 CA, AZ, NM, CO, Jul 1992 - Sep 2008 Dried CCDB 18, 20, 22-24, 27, 29-36, CSU Mexico 39-40, 55-62, 64-69 J. Powell 12 California Apr 2000 Dried DNeasy 26, 28, 37, 63 UASM
K. Davenport 17 California Aug 1989 - Nov 2002 Dried DNeasy 17,19,21,25 UASM
L. Crawford, S. Desjardins 42 BC,WA Aug 2008 wing clips in DNeasy 01 N/A 99% ethanol aDNeasy: DNeasy Tissue Extraction Kit (Qiagen, Valencia, CA). CCDB: extractions processed according to the methods of the Canadian Centre for DNA Barcoding (Guelph, ON) (Hajibabaei et al. 2005, www.dnabarcoding.ca). bLocation numbers refer to Figure 3-2 and Appendix 1. CUASM: University of Alberta, Strickland Museum of Entomology. EME: University of California, Berkeley, Essig Museum of Entomology. CSU: Colorado State University, C.P. Gillette Museum. GNP: Grasslands National Park.
ON Table 3-2. Wing characters. In character names, "F" refers to a forewing character, "H" to a hindwing character, and "B" to a character on both pairs of wings. In the descriptions, "DF" refers to "dorsal forewing" and "DH" to "dorsal hindwing". Character states with asterisks refer to states illustrated in Figure 3-1. Character State Description FA 0 DF: Reduced orange scaling medially, obviously not reaching postmedian spot band 1 DF: Prominent orange scaling extending to or close to basal margin of postmedian spot band, or distal to no more than one spot 2 * DF: Prominent orange scaling extending beyond more than one spot of postmedian spot band FB 0 DF: Orange scaling very lightly present if at all anterior to discal cell 1 * DF: Orange scaling extensively present anterior to discal cell FC 0 DF: Orange scaling distant from anal margin: not proximal to 1st and 2nd spots from anal margin 1 DF: Orange scaling close to anal margin: proximal to 2nd but not 1st spot from anal margin 2 * DF: Orange scaling very close to anal margin: proximal to 1st spot from anal margin FD 0 * DF: Basal spots reduced, substantially smaller than white postbasal spots 1 DF: Basal spots prominent, subequal to white postbasal spots FE 0 * DF: Anterior postbasal spot (in discal cell) white 1 DF: Anterior postbasal spot (in discal cell) invaded by orange scaling FF 0 * DF: Postmedian spots reduced, esp. spots 4 and 5 from the costal margin absent or nearly so 1 DF: Postmedian spots prominent HG 0 * DH: Orange scaling not present medially 1 DH: Orange scaling present medially HH 0 DH: Orange scaling absent distal to postmedian spot band 1 DH: Orange scaling slightly present distal to postmedian spot band 2 * DH: Orange scaling broadly present distal to postmedian spot band HI 0 * DH: White basal and postbasal spots reduced, esp. posterior basal spot greatly reduced if not absent (basal spots possibly obscured with orange scaling) 1 DH: All four white basal and postbasal spots prominent (basal spots possibly obscured with orange scaling) 2 DH: Postbasal spots obscured with orange scaling HJ 0 * DH: Postmedian spots reduced, several spots absent or nearly so 1 DH: Postmedian spots prominent BK 0 * DF: Marginal spots small, substantially smaller than postmedian spot band (if present) 1 DF: Marginal spots prominent, equal or subequal to postmedian spot band, esp. apical two
o Table 3-3. Type descriptions and type localities of the 17 currently recognized subspecies within the Apodemia mormo species complex (Pelham 2008). Name Citation Type locality Latitude Longitude A. mormo mormo Felder&Felderl859 Washoe Co., NV 39.30 -119.83 A. mormo cythera Edwards 1873 Independence, Inyo Co., CA 36.599 -118.059 A. mormo langei Comstock 1939 Antioch, Contra Costa Co., CA 38.0143 -121.7933 A. mormo tuolumnensis Opler& Powell 1961 Yosemite National Park, Tuolumne Co., CA 37.739 -119.569 A. mormo autumnalis Austin 1998 Spring Mountains, Clark Co., NV 35.83 -115.43 A. mormo parva Austin 1998 Diamond Mountains, Eureka Co., NV 39.539 -115.960 A. virgulti virgulti Behr1865 La Tuna Canyon, Los Angeles Co., CA 34.23 -118.30 A. virgulti arenaria Emmel et al. 1998 El Segundo sand dunes, Los Angeles Co., CA 33.919 -118.419 A. virgulti davenporti Emmeletal. 1998 Walker Pass, Kern Co., CA 35.659 -118.029 A. virgulti dialeucoides Emmel etal. 1998 Sugarloaf Mountain, San Bernardino Co., CA 34.20 -116.81 A. virgulti mojavelimbus Emmel et al. 1998 Ord Mountains, San Bernardino Co., CA 34.66 -116.75 A. virgulti peninsularis Emmeletal. 1998 Laguna Mountains, San Diego Co., CA 32.88 -116.44 A. virgulti nigrescens Emmel & Emmel 1998 Colton, San Bernardino Co., CA 34.069 -117.310 A. virgulti pratti Emmel & Emmel 1998 Holcomb Valley, San Bernardino Co., CA 34.309 -116.930 A. mejicanus mejicanus Behr1865 Mazatlan, Sinaloa, Mexico 23.22 -106.40 A. mejicanus deserti Barnes & McDunnough 1918 La Puerta Valley, San Diego Co., CA 32.47 -116.98 A. mejicanus pueblo Scott 1998 Security, El Paso Co., CO 38.764 -104.735 aType localities condensed from original description bCoordinates estimated from description of type locality
^J 72
Table 3-4. Diagnostic wing characters (see Table 3-2 and Fig. 3-1) scored for each of the 17 subspecies of the Apodemia mormo species complex. Characters that could not be scored for a taxon are marked with a "?". Name FA FB FC FD FE FF HG HH HI H) BK A. mormo mormo 100001000 0 A. mormo cythera 2120010211 1 A. mormo langei 11201110210 A. mormo tuolumensis 2120000200? A. mormo autumnalis 111/2 00 100101 A. mormo parva 11100100110 A. virguiti virguiti 20000102100 A. virguiti arenaria 20100002010 A. virguiti davenporti 211001021?? A. virguiti dialeucoides 0001010011? A. virguiti mojavelimbus 11100101111 A. virguiti peninsularis 20100002000 A. virguiti nigrescens 70000001000 A. virguiti pratti 21010102111 A. mejicanus mejicanus 2 0/1 1/2 10 112 1 0/1 0 A mejicanus deserti 21110100111 A. mejicanus pueblo 20 0/110112100 FA 2
BKO
HH2 Figure 3-1. Illustration of eleven wing characters and selected ^4 states listed in Table 3-2. CO 74
i- 1168 SI: 69 Emesis emesia 100
1297 SI: 69 Emesis emesia
57 Western Lineage B Eastern « 89 Lineage -"•
99 0366 CO: 55 A. mej. pueblo
hl472 CO: 59 A. mej. pueblo 53 hl293 CO: 56,57 A. nais 99
1295 CO: 56 A. nais
1292 SI: 68 A. hepburni 87 1479 SO: 66 A. hepburni 68 —1488 AZ: 62 A. palmeri 78
1455 BS: 67 A. cf. hepburni
1299 BS: 67 Calephelis wrightii
4102 CA:63 Calephelis wrightii 100
-4103 CA:63 Calephelis wrightii
1298 BS:67 Calephelis wrightii 0.02
L4101 CA: 63 Calephelis wrightii
Figure 3-2. Maximum-likelihood tree of all unique COI haplotypes generated in Garli 1.0 (Zwickl 2006), rooted with Calephelis wrighti and Emesis emesia and trimmed in order to show the relationship of the outgroups to the Apodemia sequences. "A" corresponds to figure Appendix 2A, "B" to figure Appendix 2B. Terminal tips correspond to unique haplotypes (Appendix 1). Haplotypes are 648 bp, except for 4101,4102 and 4103, which are 1498 bp. Letters indicate state or province of collection: AZ: Arizona, BS: Baja Sur, CA: California, CO: Colorado, SI: Sinaloa. Numbers proximal to letters indicate location ID numbers (Appendix 1). Numbers above branches indicate bootstrap support based on 250 repetitions. Scale bar proportional to changers per site. HullMt08(10)| Hull Mt 08 (10) i Ladoga 09 (10) | Ladoga 09 (10) Jawbone Cyn 26 (1) " Last Chance Cyn 28 (4) MtDiablo 12 (10) • Graves Creek, ID 06 (11) Vallejo 10 (10) "-Jl Oregon 07 (9) Western . Riverside, WA 04 (10) Lineage BC 01 (44), Shanker's 02 (8), Toats 03 (10) Keremeos, BC01 (31) 100 Riverside 04 (10), Umtanum Ck 05 (9) 94 D Toats C , WA 03 (10) Graves Ck 065 (11), Oregon 07 (12) Umtanum Ck,WA05(8) Corral Ck, Walker Pass 21, 25(3) Shanker's, WA 02 (5) MtDiabiol2(10) I Camp Pendleton 41 (9), Point Loma 42(10) CI Jawbone Cyn 26 (2), Last Chance 28 (2) Valle|Ol0(10) I \
>, Camp Pendleton 41 (2) —i 89
Tumey Hills 16 (10) , 435B Rock Corral 37(1) Arroyo Bayo 14 (10) Onyx Summit 38 (10) Del Puerto 13 (10) '?-.«.- Limestone Camp 17 (1) "afcwl :, ..--'' Corral Ck. 21 (13) ;:>.-.; • "* Point Loma 42 (10) *' I Del Puer 13 (10), Arroyo Bay 14 (5) CampPendleton41(ll) ••' ./•' I Tumey Hills 16 (10) Rock Corral 37 (2) -•"" ** / ...^ I Arroyo Bay 14 (5) Onyx Summit 38 (10) "] B Limestone Camp 17 (1) I/, Mendota08(?) —; v Corral Ck. 21 15) l ' Onyx Summit 38(1) Walker Pass 25 (1) | Cananea 67 (2) Cananea 67 (2) 3 66 N Dakota 50 (10) Glendive 49 (13), Wyoming 54 (2) . Glendive49(30) 65 Culbertson 16 (6), Glendive 49 (1), N Dakota 50 (1) Culbertson46(16) 68 Sidney 47 (7) Glendive 49 (9), N Dakota 50 (4) 70 _ Hinsdale 45 (10) Sidney 47 (3) Eastern Lineage - East Block, SK 44 (21) Culbertson 46 (8), Sidney 47 (1), Circle 48 (4), Glendive 49 (3) West Block, SK 43 (59) Culbertson 16 (2), Sidney 47 (3), Glendive 49 (3) _ Wyoming 54 (12) N Dakota 50 (5), Spearfish 53 (10), Wyoming 54 (7) — Hollenbeck52(21) A \ Laurel 51 (11) West Block 43 (59), East Block 44 (21), Hinsdale 45 (10) . Circle 48 (5) Laurel 51 (8), Hollenbeck Draw 52 (21) B S Dakota 53 (10) Circle 48 (1), Laurel 51 (1), Wyoming 54 (3)
0.10 °'010 Figure 3-3. Trees generated from microsatellite frequency and mtDNA sequence data. Numbers after names indicate location ID numbers (Appendix 1); numbers m parentheses indicate number of specimens represented at each location. Unshaded branches indicate specimens of Apodemia mormo; darker-shaded branches indicate specimens of A m. langei or A m. nr. langei; lighter-shaded branches indicate specimens that are not A. mormo. (A) Neighbor-joining tree constructed in POPTREE2 (Takezaki et al. 2010) from genetic DA distances of microsatellite allele frequencies of the a priori populations at each terminal tip. Numbers above branches indicate bootstrap support based on 1000 bootstrap repetitions. (B) Maximum-likelihood tree generated in Garli 1.0 (Zwickl 2006) from 1498 bp of the COI gene from the same specimens represented in tree A. Terminal tips have been manually condensed to simplify groupings in order to show correspondence between trees. Numbers above branches indicate bootstrap support based on 250 bootstrap repetitions. Lettered clades correspond to clades in Appendix 2. 76
Figure 3-4. Collection locations and geographic distribution of the Apodemia mormo species complex. Range modified from Brown et al. (1992), Opler & Wright (1999), Brock & Kaufman (2003), and Opler et al. (2010). Solid dots indicate Apodemia mormo complex samples; empty dots indicate outgroups. Coloured histograms indicate proportional representation of samples from location in one of the six Q groups generated from microsatellite allele frequencies in STRUCTURE (Pritchard et al. 2000) figured on the right (numbers in the colour groups correspond to groupings in Appendix 2). Non-parenthetical numbers indicate location ID numbers (see Appendix 1); parenthetical numbers indicate number of samples for which microsatellite allele frequencies were recorded. 77
CHAPTER 4: THESIS SUMMARY
The aim of this thesis was to use genetic data, specifically mitochondrial COI gene sequence data and a suite of microsatellite loci, to test several prior hypotheses about three North American populations of the butterfly Apodemia mormo that have been given conservation rankings. It is only the second example of the use of genetic data on any populations of conservation importance of any species in the family Riodinidae (Crawford et al. in review). Although genetic research has been done before on A. mormo (e.g. Penz & DeVries 2006, Briscoe 2008), none of the examples involve any of the three populations given conservation ranking discussed here. In Canada in particular, genetic data are rarely used to test prior hypotheses on species that have been recommended for conservation by COSEWIC (Committee On the Status of Endangered Wildlife In Canada). Genetic data are by no means absent from conservation decisions in Canada; for example, they are often used to assess populations and subpopulations that may be deserving of conservation ranking by COSEWIC (Green 2005, Piercey-Normore et al. 2006, Bernard et al. 2009, Taylor et al. 2010). Rankings are nevertheless often assigned and revised without genetic data (COSEWIC 2010a, Mooers et al. 2007, Lukey & Crawford 2009). In Canada, species, subspecies, or Designatable Units (DUs) (discrete and evolutionarily significant populations within species [Green 2005, COSEWIC 2010b]), can be designated by COSEWIC for inclusion under the Species At Risk Act (SARA) as "Endangered" or "Threatened", as well as several other categories. The categories are respectively defined as "facing imminent extirpation or extinction" or "likely to become endangered if nothing is done to reverse the factors leading to its extirpation or extinction" (COSEWIC 2010a). The criteria for each category are based on demography and range: a small or declining number of mature individuals; a small distribution range and a decline or fluctuation in distribution range; a very small or restricted total population, or a quantitative analysis of likelihood of extirpation or extinction (COSEWIC 2010a). The status assessments can be modified based on "rescue effect": i.e. whether other populations of the species in question ("extra-regional populations") have the capability of mitigating 78 the threat of extinction or extirpation through immigration (COSEWIC 2010a). This is assessed based on likelihood of immigration; existence of local adaptation that could not be replaced by immigration; availability of suitable habitat to be colonized by immigrants; and the status of extra-regional populations (whether they can be relied on to consistently produce immigrants) (COSEWIC 2010a). In the case of A. mormo in British Columbia and in Saskatchewan, the former population classified as "endangered" and the latter as "threatened" (Canada Gazette 2004), the aim of this thesis was threefold: to 1) determine how closely the two populations are related; 2) determine the level of genetic connectedness to other unlisted populations of A. mormo in the same region, on the other side of the US/Canada border; and 3) assess the level of genetic diversity within each of the two populations and whether any signatures of geographic structure could be detected within them. The first goal tests the hypothesis that the two Canadian populations are indeed separate populations, distinguishable by more than geographic distance, and should be managed separately as they have been. The second goal tests the hypothesis that any "rescue effect" from the unranked populations of A. mormo across the US/Canada border is minimal, and the third goal tests the hypothesis explicit in the different rankings that the British Columbia population is in greater danger of extirpation than the Saskatchewan population. In the United States, the criteria for listing a species as "threatened" or "endangered" under the Endangered Species Act (ESA) are less explicit. 16 U.S.C. § 1533(a) simply states that
The Secretary [of the Interior] shall by regulation promulgated in accordance with subsection (b) of this section determine whether any species is an endangered species or a threatened species because of any of the following factors: (A) the present or threatened destruction, modification, or curtailment of its habitat or range; (B) overutilization for commercial, recreational, scientific, or educational purposes; 79
(C) disease or predation; (D) the inadequacy of existing regulatory mechanisms; or (E) other natural or manmade factors affecting its continued existence.
A "species" under the act includes any subspecies of wildlife (16 U.S.C. § 1532 [6]) or any population of a species determined to be eligible for listing under the ESA according to "standard taxonomic distinctions and the biological expertise of...the scientific community" (50 C.F.R. § 424.11[a]). In the case of the federally endangered subspecies Apodemia mormo langei in the Antioch Dunes National Wildlife Refuge near San Francisco, California, the principal aim was to test the hypothesis that A. m. langei is a subspecies or at least an Evolutionary Significant Unit (ESU). The ESU, defined as a population with historical isolation and local adaptation as indicated by genetics and unique ecological or morphological traits (Moritz 1994, Crandall et al. 2000), meets the qualification of a population of a species eligible for listing under the ESA according to the scientific community (Crandall et al. 2000, de Guia & Saitoh 2007, Paplinska et al. 2010). We accomplished this goal by examining genetic diversity in the A mormo species complex across many of the named subspecies and across most of its wide range comprising much of western North America, as well as categorizing the diversity of wing patterns found in the species complex. We were then able to compare the genetic and wing character patterns found at Antioch Dunes to the patterns found in other populations to assess genetic and morphological indications of historical isolation and thus subspecific and ESU status. These aims were largely met. For our genetic tools we were able to successfully amplify nearly 1500 base pairs of the mitochondrial COI gene, enough to provide ample estimates of evolution in the mitochondrial genome (Roe & Sperling 2007). For microsatellite loci, we were able to develop a suite of six novel loci, the first ever developed for the family Riodinidae. Although only six loci were developed due to the inherent difficulties in isolating and amplifying microsatellite loci in Lepidoptera (Zhang 2004, Van't Hof et al. 2007), and only five of them 80 amplified well in any given population due to regional differences, those loci proved variable and informative. For the two Canadian populations of A mormo, we were able to determine that they were only very distantly related. At the COI gene, the genetic distance between the two was greater than was observed between almost any other regional pair of populations in the A mormo species complex across North America (Appendix 2). At the microsatellite loci, the genetic distance between the two (DEST 0.84) was over eight times greater than the average observed distance between populations (Tables 2-8,2-9). Despite this level of genetic divergence we hesitate to propose different taxonomic names for each, since no morphological differences were observed and genetic divergence, especially at mitochondrial genes, is often a poor indicator of species delimitation (Funk & Omland 2003, Leo et al. 2010). We were also able to confirm that the British Columbia population was indeed at a higher risk level and deserving of a higher level conservation action than the Saskatchewan population, since the former was much more genetically depauperate and less genetically connected to other populations of A mormo in the geographic region across the US/Canada border. Reduction in genetic heterozygosities is strongly linked to elevated risk of extirpation (Spielman et al. 2004). Essentially, our findings confirm the different rankings of "endangered" and "threatened" for the British Columbia and Saskatchewan populations. Regarding A mormo langei, we were able to determine that, according to the COI gene sequence at least, it has undergone historical isolation, if only very recently on an evolutionary time scale. Although it is indistinguishable from several neighboring populations at microsatellite loci, it does display a set of unique COI haplotypes with only 0.47% sequence divergence from the nearest population. We were unable to confirm any unique wing pattern characters as indication of local adaptation, however, since another population of A mormo that shared many of the wing characters upon which A mormo langei was originally described was shown to be only distantly related to it by both mitochondrial DNA and microsatellites. In short, A m. langei does meet the definition of an ESU, since it shows a degree of historical genetic isolation and is morphologically distinct from its neighbours. Since 81 it is not unique with respect to its phenotype or degree of historical genetic isolation, however, it is no more worthy of conservation than many other unnamed and unrecognized populations of A mormo in California likely are.
Future Directions
As with any study, this research opens as many questions as it answers. I will highlight some of the more obvious avenues of research that would complement the work already done. First, additional nuclear genetic markers would enable resolution of finer-scale genetic patterns than the small library of microsatellite markers here developed for this research. Additional marker candidates include another a microsatellite library, perhaps this time from expressed sequence tag (EST) libraries, since they have been shown to produce more microsatellite loci than from traditional enriched genomic libraries in Lepidoptera (Arunkumar et al. 2009); single-nucleotide polymorphisms (SNPs); and amplified fragment-length polymorphisms (AFLPs) (Behura 2006, Haasl & Payseur 2010), the latter of which have already been demonstrated to be informative at a fine scale in the British Columbia population of Apodemia mormo (Crawford et al. in review). With such tools, it might be possible to detect signs of genetic structure, such as isolation-by- distance, within the Saskatchewan population of A mormo. Another direction for future study would be to build upon the study of wing pattern variation and broad genetic sampling of the diversity of the Apodemia mormo species complex in the southwestern United States and Mexico to outline the evolutionary history of the A mormo species complex. With several species and many subspecies already named (Pelham 2008) and a wide diversity not only in wing patterns but in phenology, habitat selection and hostplant use (e.g. Opler & Powell 1961, Davenport 2004), only the tip of the iceberg has been reached in documenting the evolutionary history of this group of butterflies. For example, our preliminary data, based on only 648 base pairs of the COI gene (the "barcode region"), the subspecies A mejicanus pueblo in Colorado is not only divergent in wing pattern from its neighbouring A mormo populations, but is more divergent 82 genetically from its geographic neighbours and from its conspecifics than any other pair of populations in the entire A mormo species complex. More research may confirm that it should be given separate species status. In conclusion, this research has tested a number of hypotheses on several populations of Apodemia mormo of conservation importance. These conclusions will have implications for future management and conservation of these populations, and also open up future avenues of research into the biology and evolution of a charismatic and fascinating group of butterflies. 83
Literature Cited
Arunkumar K, Kifayathullah L, Nagaraju J (2009) Microsatellite markers for the Indian golden silkmoth, .dnt/ieraea assama (Saturniidae: Lepidoptera). Mol Ecol Res 9:268-270
Behura SK (2006) Molecular marker systems in insects: current trends and future avenues. Mol Ecol 25:3087-3113
Bernard AM, Ferguson MM, Noakes DLG, Morrison BJ, Wilson CC (2009) How different is different? Defining management and conservation units for a problematic exploited species. Can J Fish Aquat Sci 66:1617-1630
Briscoe AD (2008) Reconstructing the ancestral butterfly eye: Focus on the opsins. J Exp Biol 211:1805-1813
Canada Gazette (2004) 138:408-479
COSEWIC (2010a) COSEWIC's Assessment Process and Criteria. http://www.cosewic.gc.ca/eng/sctO/assessment_process_e.cfm Accessed 04 Nov 201
COSEWIC (2010b) Guidelines for Recognizing Designatable Units. http://www.cosewic.gc.ca/eng/sct2/sct2_5_e.cfm Accessed 04 Nov 2010
Crandall KA, Bininda-Emonds ORP, Mace G, Wayne RK (2000) Considering evolutionary processes in conservation biology. Trends Ecol Evol 15:290-295
Crawford et al. In review. Fine-scale genetic structure of an endangered population of the Mormon metalmark butterfly (Apodemia mormd) revealed using AFLPs.
Davenport K (2004) A concise update of the information provided in The Butterflies of Southern California (1973) by Thomas C Emmel and John F Emmel. The Taxonomic Report of the International Lepidoptera Survey 4:1-23 de Guia APO, Saitoh T (2007) The gap between the concept and definitions in the evolutionarily significant unit: the need to integrate neutral genetic variation and adaptive variation. Ecol Res 22:604-612
Funk DJ, Omland K (2003) Species-level paraphyly and polyphyly: frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annu Rev Ecol Evol Syst 34:397-423
Green DM (2005) Designatable units for status assessment of endangered species ConservBiol 19:1813-1820 84
Haasl RJ, Payseur BA (2010) Multi-locus inference of population structure: a comparison between single nucleotide polymorphisms and microsatellites. Heredity doi:10.1038/hdy.2010.21
Leo ST, Pybus M, Sperling FAH (2010) Deep mitochondrial DNA lineage divergences within alberta populations of Dermacentor albipictus (Acari: Ixodidae) do not indicate distinct species. J Med Entomol 47:565-574
Lukey J, Crawford S (2009) Consistency of COSEWIC species at risk designations: freshwater fishes as a case study. Can J Fish Aquat Sci 66:959-971
Mooers A0, Prugh LR, Festa-Bianchet M (2007) Biases in legal listing under Canadian endangered species legislation. Conserv Biol 21:572-575
Moritz C (1994) Defining 'Evolutionarily Significant Units' for Conservation. Trends Ecol Evol 9:373-375
Opler P, Powell JA (1961) Taxonomic and distributional studies on the Western components of the Apodemia mormo complex (Riodinidae). J Lep Soc 15:145-171
Paplinska JZ, Taggart DA, Corrigan T (2010) Using DNA from museum specimens to preserve the integrity of evolutionarily significant unit boundaries in threatened species. Biol Conserv doi:101016/jbiocon201009005
Pelham JP (2008) A catalogue of the butterflies of the United States and Canada with a complete bibliography of the descriptive and systematic literature. J Res Lepid 40:1-652
Penz C, DeVries P (2006) Systematic position of Apodemia paucipuncta (Riodinidae), and a critical evaluation of the nymphidiine transtilla. Zootaxa 1190:1-50
Piercey-Normore MD, Coxson D, Goward T, Goffinet B (2006) Phylogenetic position of a Pacific Northwest North American endemic cyanolichen, Nephroma occultum (Ascomycota, Peltigerales). Lichenologist 38:441-456
Renoult J, Geniez P, Bacquet P, Benoit L, Crochet P (2009) Morphology and nuclear markers reveal extensive mitochondrial introgressions in the Iberian Wall Lizard species complex. Mol Ecol 18:4298-4315
Roe AD, Sperling FAH (2007) Patterns of evolution of mitochondrial cytochrome c oxidase I and II DNA and implications for DNA barcoding. Mol Phylogenet Evol 44:325-345
Spielman D, Brook B, Frankham R (2004) Most species are not driven to extinction before genetic factors impact them. P Natl Acad Sci USA 101:15261-15264 85
Taylor EB, Tamkee P, Keeley ER, Parkinson EA (2010) Conservation prioritization in widespread species: the use of genetic and morphological data to assess population distinctiveness in rainbow trout [Oncorhynchus mykiss) from British Columbia, Canada. Evol Appl doi:101111/jl752-4571201000136x
Van't Hof A, Brakefield P, Saccheri I, Zwaan B (2007) Evolutionary dynamics of multilocus microsatellite arrangements in the genome of the butterfly Bicyclus anynana, with implications for other Lepidoptera. Heredity 98:320-328
Zhang DX (2004) Lepidopteran microsatellite DNA: redundant but promising. Trends Ecol Evol 19:507-509 Appendixl Collection localities data location Map number taxonomic hypothesis most likely hostplant observation date collector latitude longitude number ofSSRs generated number ofmtDNA sequences generated and mtDNAhaplotypes represented Map numbers correspond to locations in Fig 2
Region Location apA Taxonomy" Enogonum present Coll Date Collector Lat fdeg) Long fdeel SSR In] mtDNA fnl mtDNA haplotypes fn) CAN BC near Keremeos site Nl 01 Amor E niveum 23 Aug 2008 L Crawford S Desjardins 49 26469 119 82383 5 10 h356 CAN BC near Keremeos site CI 01 A mor E niveum 12 Aug 2008 L Crawford S Desjardins 49 20787 119 8246 5 10 h356 CAN BC near Keremeos siteWB 01 Amor E niveum 17 Aug 2008 L Crawford S Desjardins 49 20681 119 85524 3 5 h356 CAN BC near Keremeos siteW6 01 A. mor E niveum 5 Sep 2008 B Proshek S Desjardins 49 20430 119 86720 10 10 h350 h356 CAN BC near Keremeos site E2 01 A mor E niveum 18 Aug 2008 L Crawford S Desjardins 49 17759 119 7803 8 9 h350 h356 USA WA Shanker s Bend Similkameen River Cyn WofOroville 02 A mor E niveum 22 Aug 2008 L Crawford S Desjardins 48 97314 119 50821 5 8 SHK02 350 USA WA ToatsCouleeCk. WofSinlahekinCk SofPaimerLake 03 A mor E niveum 6 Sep 2008 B Proshek 48 83255 119 67781 10 10 h350 h371 USA WA Bluffs E of the Okanogan River at Riverside 04 A mor E niveum 4 Sep 2008 B Proshek 48 50761 120 46909 10 11 h350 h352 H356 h358 USA WA UmtanumCkoffHwy281 SofEllensburg 05 A mor E niveum 3 Sep 2008 B Proshek 46 85023 120 48841 8 9 h341 h342 h343 h344 h345 h346 USA ID Bluffs E of Graves Creek Rd 8 km S of Cottonwood 06 A mor E niveum 30 Aug 2008 B Proshek 45 97489 116 36036 11 11 K318 321 h323 326 USA OR )ust N of function US 395 & OR 74 07 A mor E niveum 1 Sep 2008 B Proshek 45 46236 118 98676 9 12 h329 h330 h332h335 USA CA Hull Mountain Lake/Mendocino Co line 08 A mor E umbellatum 19 Sep 1995 J Powell 39 52 122 94 10 10 h046 053 054 055 USA CA 2 mi W of Ladoga Colusa Co 09 Amor E umbellatum var bahnforme 17 Sep 1997 j Powell F Sperling 39 09 122 24 10 10 h081 h082 h083 085 USA CA NE Vallejo St John s Mine Solano Co 10 A mor possibly/: nudum 21 Aug 1997 J Powell F Sperling 38 14 122 20 10 10 h066 USA CA Antioch Dunes Sardis Section Contra Costa Co 11 A mor Ian E nudum var aunculatum 18 Sep 1997 F Sperling, R Reed A Cognato 38 02 12180 9 10 091 h092 093 h094 h096 USA CA Below Mount Diablo s main summit. Contra Costa Co 12 A mor E umbellatum var bahliforme 21 Aug 1997 J Powell F Sperling 37 88 12191 10 10 h056 h058 h059 060 h061 USA CA Del Peurto Canyon Stanislaus Co 13 A mor E nudum var bahliforme 14 Sep 1995 | Powell 37 42 12135 10 10 h036 h038 039 h040 USA CA Arroyo Bayo Santa Clara Co 14 A mor E umbellatumvar bahnforme 14 Sep 1995 J Powell 37 38 12157 10 10 h026 027 028 029 h031 032 033 035 USA CA Monocline Ridge Mendota Fresno Co 15 A mor nr Ian E. latlfolwm var mdictum 11 Sep 1995 J Powell F Sperling 36 75 120 38 10 10 001 h002 h003 004 006 007 USA CA Tumey Hilts Fresno Co 16 A mor E latl/olium var mdictum 11 Sep 1995 J Powell F Sperling 36 61 120 67 10 10 h013 h017 018 019 020 022 USA CA Limestone Camp KemCyn m[7]tn 99 Tulare Co 17 A cyt tuo no data 25 Aug 2002 K Davenport 36 09 118 45 1 1 425 USA CA Monterey Co Parkfield Grade 18 A mej no data 30 Aug 2000 K Davenport 35 985 120 474 0 1 hl471 USA CA Goldledge Kern Cyn Tulare Co 19 A cyt tuo no data 25 Aug 1989 K Davenport 35 95 118 46 0 0 USA CA Nine Mile Cyn Inyo Co 20 A mej no data 22 Jul 2008 K Davenport 35 837 117 906 0 1 hi 142 USA CA Nine Mile Cyn Inyo Co 20 A me) no data 05 Aug 2008 K. Davenport 35 837 117 906 0 1 hll42 USA CA Nine Mile Cyn Inyo Co 20 A cyt tuo no data 23 Aug 2008 K Davenport 35 837 117 906 0 1 1160 USA CA N of Hospital Flat KernRd Cyn Tulare Co 21 A cyt no data 15 Sep 2002 K Davenport 35 79 118 44 1 1 h412 USA CA S Corral Ck, Tulare Co 21 A cyt A cyt tuo no data 30 Oct 2002 K Davenport 35 79 118 44 4 4 h412 414 USA CA Kern Cyn Corral Ck. Tulare Co 21 A cyt A cyt tuo no data 5 Oct 2002 K Davenport 35 79 118 44 3 3 h412 415 419 USA CA Kern Cyn S of Corral Ck Tulare Co 21 A cyt cyt tuo no data 6 Nov 2002 K Davenport 35 79 118 44 3 3 h412 417 USA CA Corral Ck. 1 mi S of Kern Cyn Tulare Co 21 A cyt tuo no data 14 Nov 2001 K Davenport 35 79 118 44 1 1 421 USA CA S of Corral Ck Kern Cyn Tulare Co 21 A cyt A cyt tuo no data 23 Oct 2002 K Davenport 35 79 118 44 3 3 h412 429 USA CA 1 5 mi S of Kernville Kern Co 22 no data 09 Oct 2004 K. Davenport 35 734 118 456 0 5 1174 1175 hll76 M471 hll63 USA CA S of Kernville E side Greenhorn Mountains 22 A* cf mor no data 22 Oct 2005 K Davenport 35 734 118 456 0 4 hll63 USA CA 2miS of Kernville 22 A vir no data 12 Nov 2007 K Davenport 35 734 118 456 0 6 hll76 USA CA Greenhorn Mountains Old State Rd Kern Co 23 A cyt no data 21 Aug 2006 K Davenport 35 714 118 517 0 2 hll86 1187 USA CA Greenhorn Mountains Old State Rd Kern Co 23 A cyt no data 21 Aug 2004 K Davenport 35 714 118 517 0 2 M186 USA CA Lake Isabella Sierra Highway Stive Cove Kern Co 24 A mej A cf mor no data 20 Sep 2008 K Davenport 35 680 118 410 0 2 hll76 1159 USA CA Walker Pass Kern Co 25 A cyt tuo no data 31 Aug 2002 K Davenport 35 66 118 03 1 1 422 USA CA Jawbone Cyn, Kern Co 26 A me) E inflatum 13 Apr 2000 | Powell 35 41 118 10 1 2 h431A h431B USA CA Sand Cyn Tehachapi Mountains Kern Co 27 A vtr no data 13 May 2001 K Davenport 35 309 118 429 0 2 1154 1167 USA CA Last Chance Cyn Kern Co 28 A me] E inflatum 10 Apr 2000 J Powell 35 29 118 46 4 5 h431A h431B USA CA Tehachapi Mountains Willow Springs Rd Kern Co 29 A mej A cf mor no data 03 May 2008 K. Davenport 35 073 118 398 0 2 hll55 USA CA Bates Canyon Santa Barbara Co 30 A cyt no data 08 Sep 2002 K Davenport 34 953 119 907 0 2 hll65 USA CA Dry & Santa Barbara Canyons Santa Barbara Co 31 A cyt no data 21 Aug 2004 K Davenport 34 947 119 691 0 1189 USA CA Valle Vista Camp Kern Co 32 A cyt no data 05 Sep 2006 K Davenport 34 878 119 340 0 hll63 USA CA McGiU Camp Mount Pinos Kern Co 33 A cyt no data 05 Sep 2006 K Davenport 34819 119 095 0 hll63 USA CA Old Rider Route [Old Ridge Route?) LA Co 34 A cyt A cyt tuo no data 02 Sep 2007 K Davenport 34 605 118 692 0 hll6l USA CA Lake Hughes Rd E LakeCastaic LA Co 35 A vir no data 07 Oct 2007 K Davenport 34 596 118 563 0 1149 USA CA Lake Hughes Road Warm Springs L A Co 35 A vir A cyt no data 14 Oct 2007 K Davenport 34 596 118 563 0 1148 1152 hll61 USA CA Lake Hughes Road Warm Springs L A Co 35 A vir no data 30 Sep 2007 K Davenport 34 596 118563 0 1150 USA CA Lake Hughes Road Warm Springs L A Co 35 A vir no data 04 Oct 2007 K Davenport 34 596 118 563 0 1151 USA CA Three Points Los Angeles Co 36 A vir no data 28 Aug 1999 K Davenport 34 343 117 982 0 hll61 USA CA Rock Corral San Bernardino Co 37 A mej E inflatum 11 Apr 2000 j Powell 34 27 116 47 2 435B 435C USA CA near Onyx Summit San Bernardino National Forest 38 A cf mor no data 26 Jun 1998 S Cho J Powell F Sperling 34 20 116 81 10 10 125 126 127 hl28 130 USA CA MilPotreroRd Ventura Co 39 A cyt no data 05 Sep 2006 K Davenport 34140 118 881 0 1476 USA CA Colton PepperSt &SloverAve San Bernardino Co 40 A vir nig no data 12 Apr 2006 K Davenport 34 074 117 314 0 5 1180 1181 1182 1183 1184
CO ON USA CA Camp Pendleton San Diego Co 41 A vir no data 14 Oct 1997 D Rubinoff 33 32 117 43 5 5 111 112 113 hll4 115 USA CA Camp Pendleton San Diego Co 41 A vir no data 15 Oct 1997 D Rubinoff 33 32 117 43 1 1 121 USA CA Camp Pendleton San Diego Co 41 A. vir no data 27 Oct 1997 D Rubinoff 33 32 117 43 4 4 hll4 116 USA CA Camp Pendleton San Diego Co 41 A. vir no data 27 Oct 1998 D Rubinoff 33 32 117 43 1 1 120 USA CA Point Loma Cabnllo National Monument San Diego 42 A vir no data ' May 1997 D Rubinoff 32 67 117 24 10 10 h071 072 h073 079 CAN SK West Block Grasslands National Park Laounenan 43 A mor mor E pauaflorum 15 Aug 2008 B Proshek M Fairbairn 49 20603 107 56911 6 5 hl56 hl57 CAN SK West Block Grasslands National Park Timbergulch 43 A mor mor E pauaflorum 15 Aug 2008 B Proshek, M Fairbairn 49 19856 107 50081 4 4 hl39 hl56 CAN SK West Block Grasslands National Park Police Coulee 43 A mor mor E pauaflorum 15 Aug 2008 B Proshek M Fairbairn 49 17960 107 52509 4 4 hl56 hl66 CAN SK West Block Grasslands National Park Police Coulee 43 A mor mor E pauaflorum 17 Aug 2007 A Henderson 49 17960 107 52509 3 3 hl39 hl56 CAN SK West Block, Grasslands National Park Timmons Coulee 43 A mor mor E pauaflorum 15 Aug 2008 B Proshek M Fairbairn 4918259 107 54510 4 4 hl35 hlS6 171 CAN SK West Block Grasslands National Park Timmons Coulee 43 A mor mor E pauaflorum 16 Aug 2007 (unknown) 49 18259 107 54510 2 2 hl56 CAN SK West Block, Grasslands National Park Mid 70 Mile 43 A mor mor E pauaflorum 15 Aug 2008 B Proshek, M Fairbairn 49 18724 107 66578 4 4 hl37 hl56 hl57 CAN SK West Block Grasslands National Park Broken Hills 43 A mor mor E pauaflorum 16 Aug 2008 B Proshek 49 15049 107 56326 8 8 hl37 hl39 hl78 hl80 CAN SK West Block Grasslands National Park Broken Hills 43 A mor mor E pauclflorum 20 Aug 2007 A Henderson 49 15049 107 56326 4 4 hl37 hl80 CAN SK West Block Grasslands National Park 70 Mile 43 A mor mor E pauciflorum 19 Aug 2008 K Fink C Dutchak 49 20295 107 65740 7 7 hl35 hl37 hl39 hl56 hl80 CAN SK West Block, Grasslands National Park Broken Hills 43 A mor mor E pauaflorum 21 Aug 2007 A Henderson 49 20295 107 65740 3 3 hl37 hl56 400 CAN SK West Block, Grasslands National Park S 70 Mile 43 A mor mor E pauaflorum 29 Aug 2008 A Henderson 49 15450 107 68015 3 3 hl39 hl56 CAN SK West Block, Grasslands National Park S Gillespie 43 A mor mor E pauaflorum 29 Aug 2008 A Henderson 49 01783 107 27961 1 1 hl37 CAN SK West Block, Grasslands National Park S Gillespie 43 A mor mor E pauaflorum 12 Aug 2008 A Henderson 49 01783 107 27961 4 4 hl37 hl66 CAN SK West Block, Grasslands National Park S Gillespie 43 A mor mor E pauaflorum 16 Aug 2007 A Henderson 49 01783 107 27961 1 1 405 CAN SK West Block, Grasslands National Park N Gillespie 43 A mor mor E pauaflorum 15 Aug 2007 A Henderson 49 12839 107 25547 1 1 hl37 CAN SK East Block Grasslands National Park 1 44 A mor mor E pauciflorum 11 Aug 2008 A Henderson C Dutchak B Proshek 49 04011 106 57832 6 6 hl35 136 hl37 hl39 140 CAN SK East Block Grasslands National Park 1 44 A mor mor E pauaflorum 12 Aug 2008 A Henderson M Fairbairn 49 04011 106 57832 1 1 hl37 CAN SK East Block Grasslands National Park 1 44 A mor mor E pauaflorum 13 Aug 2008 C Dutchak K Fink 49 04011 106 57832 2 2 hl3S hl37 CAN SK East Block, Grasslands National Park 2 44 A mor mor E pauclflorum 12 Aug 2008 A Henderson M Fairbairn 49 05735 106 57436 4 4 hl35 hl37 CAN SK East Block, Grasslands National Park 3 44 A mor mor E pauaflorum 12 Aug 2008 B Proshek 49 01677 106 54233 6 6 hl37 hl39 CAN SK East Block Grasslands National Park 4 44 A mor mor E pauaflorum 12 Aug 2008 B Proshek 49 02457 106 54509 2 2 hl37 USA MT Dry bluffs justs of Hinsdale 45 A mor mor E pauciflorum 17 Aug 2008 B Proshek 48 37247 107 09170 10 10 hl39 hl56 hl80 USA MT Missouri River bluffs E of Hwy 16 SofCulbertson 46 A mor mor E pauaflorum 18 Aug 2008 B Proshek 48 12879 104 47260 16 16 hl96 hl97 198 199 h202 206 h207 208 USA MT EofSidney near junction of SR 23 and Hwy261 47 A mor mor E pauaflorum 19 Aug 2008 B Proshek 47 66215 10413214 7 7 212 213 h214 216 217 218 USA MT Co Rd467 S of Circle 48 A mor mor E pauaflorum 20 Aug 2008 B Proshek 47 31305 105 59655 5 5 h219 220 h223 USA MT Badlands Just E of Makoshika SP near Glendive 49 A mor mor E pauaflorum 21 Aug 2008 B Proshek 47 04881 104 66299 30 29 hl97 h202 h225 h226 228 232 h237 240 USA ND Burning Coal Vein Campground NWofAmidon SO A mor mor E pauaflorum 23 Aug 2008 B Proshek 46 59727 103 44460 10 10 h225 h254 255 256 258 h259 260 261 USA MT Dry bluffs 7 mi N of Laurel on Hwy 532 51 A mor mor E pauaflorum 28 Aug 2008 B Proshek 45 80759 108 83447 11 11 h287 h307 309 h311 USA MT HollenbeckDraw 5 mi SofBelfrey 52 A mor mor E pauaflorum 27 Aug 2008 B Proshek 45 07076 109 03241 21 21 286 h287 295 h297 298 300 USA SD McNenny Fish Hatchery near Spearfish 53 A mor mor E pauclflorum 25 Aug 2008 B Proshek 44 56734 104 01652 10 10 h207 h259 h26S USA WY Upper Powder River Rd exit 88 off US 90 W 54 A mor mor no data 26 Aug 2008 B Proshek 44 22189 106 15839 12 12 h223 h226 274 h275 278 h281 283 285 USA CO 1 milenorth northeastofVirgima Dale LarimerCo 55 A me) pue no data 09 Aug 2007 P Opler 40 955 105 334 0 1 0366 USA CO Golden Gate S P Knott Cr Jefferson Co 56 A nais no data 04 Jul 2004 P Opler 39 819 105 378 0 4 hl293 1295 USA CO Mt Zion Jefferson Co 57 A nais no data 05 Jul 1992 R E Stanford 39 744 105 242 0 1 hl293 USA CO Dolores River 2 mi S. Gateway Mena Co 58 A mor mor no data 06 Sep 2001 PA Opler EM Buckner 39 471 104885 0 4 hll69 1170 1171 1172 USA CO Peterson Creek, Saguache Co 59 A me| pue no data 11 Aug 1996 RE Stanford 38 306 105 984 0 2 hl472 USA CO Big Gypsum Valley San Miguel Co 60 A mor mor no data 06 Sep 2001 PA Opler E M Buckner 38120 108 870 0 1 hll69 USA NV SEofPahrump Hwy 160 Mohave Desert, Clark Co 61 A mef no data 30 Apr 2001 Chuck & Cindy Harp 36026 115 691 0 1 1185 USA AZ Reveg site Cibola NWR La Paz Co 62 A palmeni no data 19jun 1996 SMN 33 307 114 704 0 1 1488 USA CA Box Cyn San Diego Co 63 C wrl no data 12 Apr 2000 J Powell 33 01 116 45 0 3 1401 1402 1403 MEX SO Cananaea 64 A mej no data 22 Apr 2003 P Opler 30 983 110301 2 2 438 MEX SO Cananaea 64 A mej no data 22 Mar 2003 P Opler 30 983 110 301 2 2 439 MEX SO NacopuliCyn 5 ml N of San Carlos 65 A me) no data 23 Mar 2004 P & E Opler 28 388 111312 0 3 1288 1289 1290 MEX SO San Carlos vie OfNacapuliCyn 65 A mej no data 26 Mar 2003 | Brock 28 388 111312 0 1 1287 MEX. SO MunicipioYecora 66 A hep no data 19 Mar 1998 R E Stanford 28 481 109 060 0 1 1479 MEX BS Bahia Concepcion Playa Santispac 67 C wri A cf hep no data 07 Apr 2004 E Runquist 26 870 111918 0 3 1455 1298 1299 MEX SI ChinmollosHwy40 68 A hep no data 02 Dec 2003 P & E Opler 23 444 106 005 0 1 1292 MEX SI Mazatlan 69 E emesia no data 25 Nov 2002 P Opler 23 321 106 402 0 1 1297 "A mor A mej A mor A cf mor A cyt tuo aA Apodemia mor mormo Ian langei cyt cythera tuo tuolumnensis mej mejicanus vir virgultf nig. nigrescens pue pueblo wri wrighti hep hepburm E Emesia
00 88
Structure Structure taxa N Grouping Location Grouping f\ 2 3 5 6 B • 1171 mor 1 CO 58 CA 08 ^— 1170 mor 1 CO 58 CA 08 mor 1 CO 58 CA 08 hi 169 mor 2 CO 58 60 CA 08 . 278 mor 1 1 WY 54 CA 12 —J.h223 mor 2 2 MT 48 WY 54 CA 10 94"" Lf-h311 mor 3 1 2 HT 51 CA 12 1 285 mor 1 1 WY 57 CA 12 •- 228 mor 1 1 MT 49 CA 12 r hl35 mor 7(6} 5 SK.43 44 CA 12 r hl57 mor 2 2 SK 43 CA 11 V 400 mor 1 1 SK 43 CA 11 'hl56 mor 21 19 2 SK. 43 44 MT 45 CA 11 hl39 mor 16 9 7 SK. 43 44 MT 45 CA 11 r 405 mor 1 1 SK 43 CA 11 140 mor 1 1 SK.44 CA 09 r — 171 mor 1 1 SK.43 CA 09 - h!78 mor 2 2 SK 43 CA 09 - hl66 mor 3 1 2 SK 43 CA 09 136 mor 1 1 SK 44 CA 31 hl37 mor 31 26 5 SK 43 44 CA 13 L hl80 mor 4 2 2 SK 43 MT 45 CA 13 L 258 mor 1 1 ND 50 CA 16 - 255 1 1 ND 50 CA 14 r 274 mor 1 1 WY 54 CA 14 "j- 232 mor 1 1 MT 49 CA 14 'h226 mor 12 2 11 MT 49 WY 54 CA 14 - h281 mor 2 1 1 WY 54 CA 14 h259 mor 8 2 6 ND- 50 WY 54 CA 14 r 198 mor 1 1 MT 46 CA 15 hl97 mor 8 8 MT 4649 CA 13 - h237 mor 2 2 MT 49 CA 15 hi 96 mor 3 3 MT 46 CA 15 - 206 mor 1 1 MT 46 CA 15 - 261 mor 1 1 ND 50 CA 15 • 208 mor 1 1 MT 46 CA 15 L 1 199 mor 1 1 MT 46 CA 16 L 240 mor 1 1 MT 49 CA 16 r 220 mor 1 1 MT 48 CA 16 1 h219 mor 3 3 MT 48 CA 16 • h225 mor 10 1 9 MT 49 ND 50 CA 16 1| h254 mor 2 2 ND 50 CA 13 T- 260 mor 1 1 ND 54 CA 14 1- 218 mor 1 1 MT 47 CA 14 H- 217 mor 1 1 MT 47 CA 41 1 213 mor 1 1 MT 47 CA 41 •— 216 mor 1 1 MT 47 CA 41 — 212 mor 1 1 MT 47 CA 41 r 298 mor 1 1 MT 52 CA 42 •• 286 mor 1 1 MT 52 CA 42 — - h297 mor 2 2 MT 52 CA 41 r h307 mor 6 2 4 MT 51 CA 41 1h295 mor 2 2 MT 52 CA 28 - 309 mor 1 1 MT 51 CA 20 - 300 mor 1 1 MT 52 CA 28 h287 mor 15 11 4 MT 51,52 CA 29 1- h214 mor 2 2 MT 47 CA 42 j- h202 mor 3 1 2 MT 46 49 CA 42 1 h207 mor 5 1 4 MT 46 SD 53 CA 18 24 - 283 mor 1 1 WY 54 CA 40 - h265 mor 4 1 3 SD 53 _P 1149 CA 38 - 256 mor 1 1 ND 50 j— 1167 CA 27 1289 J mej 1 SO 65 L- 1154 CA 27 1 438 me) 1 1 SO 64 — hll65 CA 30 1290 me) 1 SO 65 •— 1175 CA 22 — 1287 me) SO 65 • 113 CA 41 63 r •— 1288 me) 1 SO 65 CA 41 1 439 me) 1 1 SO 64 CA 37 !_j 435C me) 1 1 CA 37 \~ 1182 CA 40 me) 1 NV 61 1 1181 CA 40 125 CA 38 j- 13. CA 38 phi CA 38 68 4—1 CA 38 1 < 1^1 CA 38 - 132 CA 38 127 CA 38 1180 CA 40 •— 1183 CA 40 Appendix 2 Maximum-likelihood trees of all unique hi 176 CA 22 24 421 CA 21 COI haplotypes generated in GARLI 1 0 (Zwickl 2006) 58 .r - 425 CA 17 [A) Lineage ofhaplotypes from east of the Rockies, (B) - 4 414 CA 21 Lineage of haplotypes from west of the Rockies 429 CA 21 - 1476 CA 39 (Appendix 1) Haplotype names of four digits indicate hi 163 CA 22 32 33 648 bp haplotypes, haplotype names of three digits h412 cyt, tuo CA 21 1174 me) CA 22 indicate haplotypes of 1498 bp Numbers above - 1159 cf mor CA 24 branches or pointing to nodes indicate bootstrap sup - 1151 CA 35 — 1148 CA 35 port based on 250 repetitions Scale bars proportional hll61 CA 34 35 36 to changes per site ' Taxa" column indicates our best - 1152 CA.35 1150 CA 35 estimate of the specimens represented by each haplo h330 OR. 07 type A = Apodemia, mor = mormo, mej = mejicamts, 1— 344 WA 05 P- h341 WA 05 vir = virgulu, nig = virgulti mgrescens, cyt = mormo 334 OR 07 cythera, tuo = mormo tuolumnensis, Ian = mormo h335 WA 05/OR 07 L h332 OR 07 langei N indicates the number of samples represented r SHK02 WA 02 by each haplotype, a number m parentheses indicates h350 BC 01/WA 07 01 the number of samples in that haplotype represented 352 WA 04 - 358 WA 04 m the Structure groupings, if different Structure - h371 WA 03 groupings indicate the number of samples represented - h356 mor 43(2 BC 01/WA 04 ih318 mor ID 06 by each haplotype that are found in each the six Q •- 326 ID 06 groupings found by analysis of microsatelhte allele — 346 WA 05 • 321 ID 06 frequencies in Fig 2 Location ID numbers correspond h323 ID 06 to Appendix 1 • h329 OR 06 343 WA 05 *- h345 WA 05 1 hi186 CA 23 •— 1187 CA 23 CA 20 42: CA 25 _r CA 21 ' 41' CA.21 * vir mej cf mor ** tuo cyt mor cf mor 89
Appendix 3. Taxon names assigned to specimens of the Apodemia mormo species complex based on geographical information and 11 wing characters (Table 3-2, Fig 3-1). Character states that could not be determined are displayed as "?". ID number Assigned name FA FB FC FD FE FF HG HH HI HJ BK 001 A. mormo nr. langei 1 1 1 0 1 1 0 0 2 1 1 002 A. mormo nr. langei 1 1 1 0 1 1 1 0 2 1 1 003 A. mormo nr. langei 1 1 1 0 0 0 0 0 2 0 1 004 A. mormo nr. langei 1 1 1 0 1 1 0 0 2 1 1 005 A. mormo nr. langei 1 1 1 0 1 1 0 0 2 1 1 006 A. mormo nr. langei 1 1 1 0 1 1 0 0 2 1 1 007 A. mormo nr. langei 1 1 1 0 1 1 0 1 2 1 1 008 A. mormo nr. langei 1 1 1 0 1 1 0 0 2 0 1 009 A. mormo nr. langei 1 1 1 0 1 1 0 0 2 1 1 010 A. mormo nr. langei 1 1 1 0 1 1 1 0 2 1 1 013 A. mormo 1 1 1 0 1 1 0 0 0 1 1 014 A. mormo 1 1 1 0 1 1 0 0 0 1 1 015 A. mormo 1 1 1 0 1 1 0 0 0 1 1 016 A. mormo 1 1 1 0 1 1 0 0 0 1 0 017 A. mormo 1 1 1 0 1 1 0 0 0 1 1 018 A. mormo 1 1 1 0 0 1 0 0 1 1 0 019 A. mormo 1 1 1 0 0 1 0 0 1 1 1 020 A. mormo 1 1 1 0 1 1 0 0 1 1 1 021 A. mormo 1 1 1 0 1 1 0 0 1 1 1 022 A. mormo 1 1 1 0 0 1 0 0 1 1 1 026 A. mormo 1 1 0 0 0 1 0 0 1 1 1 027 A. mormo 1 1 1 0 0 1 0 0 0 1 1 028 A. mormo 1 1 1 0 0 1 0 0 0 0 0 029 A. mormo 1 1 1 0 0 1 0 0 0 1 1 030 A. mormo 1 1 0 0 0 1 0 0 0 1 1 031 A. mormo 1 1 1 0 0 1 0 0 1 1 1 032 A. mormo 1 1 0 0 0 1 0 0 0 1 1 033 A. mormo 1 1 0 0 0 1 0 0 0 1 1 034 A. mormo 1 1 0 0 0 1 0 0 0 1 1 035 A. mormo 1 1 0 0 0 1 0 0 0 1 1 036 A. mormo 1 1 0 0 0 0 0 0 0 0 0 037 A. mormo 1 1 1 0 0 1 0 0 0 1 1 038 A. mormo 1 1 0 0 0 0 0 0 1 0 0 039 A. mormo 1 1 0 0 0 0 0 0 1 0 0 040 A. mormo 1 1 0 0 0 1 0 0 1 0 0 041 A. mormo 1 1 0 0 0 1 0 0 1 0 0 042 A. mormo 1 1 0 0 0 1 0 0 1 1 0 043 A. mormo 1 1 0 0 0 1 0 0 1 0 0 044 A. mormo 1 1 1 0 0 0 0 0 1 0 0 045 A. mormo 1 1 0 0 0 1 0 0 0 1 1 046 A. mormo 0 1 0 0 0 1 0 0 0 1 1 047 A. mormo 0 0 0 0 0 1 0 0 0 1 0 048 A. mormo 0 0 0 0 0 1 0 0 0 1 1 049 A. mormo 0 1 0 0 0 1 0 0 1 1 1 050 A. mormo 0 1 0 0 0 1 0 0 1 1 1 051 A. mormo 0 1 0 0 0 1 0 0 0 1 1 052 A. mormo 0 0 0 0 0 1 0 0 0 1 1 053 A. mormo 0 0 0 0 0 1 0 0 0 1 1 054 A. mormo 0 0 0 0 0 1 0 0 1 1 1 055 A. mormo 0 0 0 0 0 1 0 0 1 1 1 056 A. mormo 1 1 0 0 0 0 0 0 0 0 0 057 A. mormo 1 1 0 0 0 0 0 0 0 0 0 058 A. mormo 1 1 0 0 0 1 0 0 0 1 0 059 A. mormo 1 1 0 0 0 1 0 0 0 1 0 060 A. mormo 1 1 0 0 0 1 0 0 0 1 0 061 A. mormo 1 1 0 0 0 1 0 0 0 1 0 062 A. mormo 1 1 0 0 0 1 0 0 0 0 0 063 A. mormo 1 1 0 0 0 1 0 0 0 0 0 064 A. mormo 1 1 0 0 0 1 0 0 0 0 0 065 A. mormo 1 1 0 0 0 1 0 0 1 1 0 066 A. mormo 1 1 0 1 0 1 0 0 0 1 1 067 A. mormo 1 1 0 1 0 1 0 0 1 1 1 068 A. mormo 1 1 0 1 0 1 0 0 0 1 1 069 A. mormo 1 1 0 1 0 1 0 0 1 1 1 070 A. mormo 1 1 0 1 0 1 0 0 1 1 1 071 A. virgulti 2 1 0 0 0 1 0 2 0 0 1 072 A. virgulti 2 0 1 0 0 0 0 2 0 0 0 073 A. virgulti 2 0 1 0 0 0 0 2 0 0 0 074 A. virgulti 2 0 1 1 0 0 0 2 0 0 0 075 A. virgulti 2 1 1 1 0 1 0 2 0 0 0 076 A. virgulti 2 0 1 0 0 0 0 2 1 0 0 077 A. virgulti 2 1 0 0 0 1 0 2 1 0 0 078 A. virgulti 2 0 1 0 0 0 0 2 1 0 0 079 A. virgulti 2 0 1 0 0 0 0 2 1 0 0 080 A. virgulti 2 1 1 0 0 1 0 2 1 0 0 081 A. mormo 1 0 0 0 0 1 0 0 0 0 1 082 A. mormo 1 0 1 0 0 1 0 0 0 0 1 083 A. mormo 1 0 0 0 0 1 0 0 0 0 1 084 A. mormo 1 0 0 0 0 1 0 0 0 0 1 085 A. mormo 1 0 0 0 0 1 0 0 0 1 1 086 A. mormo 1 0 0 0 0 1 0 0 0 1 1 087 A. mormo 1 0 0 0 0 1 0 0 0 1 1 088 A. mormo 1 0 0 0 0 1 0 0 0 1 1 089 A. mormo 1 0 0 0 0 1 0 0 0 1 1 090 A. mormo 1 0 0 0 0 1 0 0 0 0 1 091 A. mormo langei 1 1 1 0 1 1 1 0 2 0 1 092 A. mormo langei 1 1 2 0 1 1 1 0 0 1 1 093 A. mormo langei 1 1 1 0 1 1 0 0 0 1 1 094 A. mormo langei 1 1 1 0 1 1 1 0 2 1 1 095 A. mormo langei 1 1 2 0 1 1 1 0 2 1 1 096 A. mormo langei 1 1 2 0 0 1 1 0 0 1 1 097 A. mormo langei 7 7 7 7 7 7 ? 7 7 7 7 098 A. mormo langei 1 1 1 0 1 1 0 0 0 0 1 099 A. mormo langei ? 7 7 ? 7 ? 7 7 7 7 7 100 A. mormo langei 1 1 2 0 1 1 1 0 2 1 1 101 A mormo 1 1 0 1 0 1 0 0 1 1 1 103 A. mormo 1 1 0 1 0 1 0 0 0 1 1 104 A. mormo 1 1 0 1 0 1 0 0 0 1 1 105 A. mormo 1 1 0 1 0 1 0 0 0 1 1 106 A. mormo 1 0 0 1 0 1 0 0 0 0 1 111 A. virgulti 2 0 0 0 0 0 0 2 0 0 1 112 A virgulti 2 0 0 0 0 0 0 2 0 0 1 113 A. virgulti 2 0 0 0 0 0 0 2 0 0 1 114 A. virgulti 2 0 0 0 0 0 0 2 0 0 1 115 A. virgulti 2 0 0 0 0 0 0 2 0 0 1 116 A. virgulti 2 0 0 0 0 0 0 2 1 0 1 117 A. virgulti 2 0 0 0 0 0 0 2 0 0 1 118 A. virgulti 2 0 0 0 0 1 0 2 0 0 1 119 A. virgulti 2 0 0 0 0 1 0 2 0 0 1 91
120 A. virgulti 7 7 7 7 7 7 7 7 7 7 7 121 A. virgulti 2 0 0 0 0 1 0 2 1 0 1 125 A. cf. mormo 1 0 0 1 0 1 0 0 1 1 1 126 A. cf. mormo 1 0 0 1 0 1 0 0 1 1 1 127 A. cf. mormo 1 1 0 1 0 1 0 1 1 1 1 128 A. cf. mormo 1 0 0 1 0 1 0 1 1 1 1 129 A. cf. mormo 1 0 0 1 0 1 0 0 1 1 1 130 A. cf. mormo 7 7 7 7 7 7 7 7 7 7 7 131 A. cf. mormo 1 0 0 1 0 1 0 1 1 1 1 132 A. cf. mormo 1 0 0 1 0 1 0 0 1 1 1 133 A. cf. mormo 1 0 0 1 0 1 0 0 1 1 1 134 A. cf. mormo 1 0 0 1 0 1 0 0 1 1 1 412 A. cythera tuolumnensis 2 1 2 0 0 1 0 2 1 0 1 413 A. cythera 2 1 2 0 0 1 1 2 1 0 1 414 A. cythera tuolumnensis 2 1 2 0 0 1 0 2 0 0 1 415 A cythera tuolumnensis 2 1 2 0 0 0 1 2 0 0 1 416 A. cythera tuolumnensis 2 1 2 0 0 1 0 2 1 0 1 418 A. cythera tuolumnensis 2 1 2 0 0 1 1 2 0 0 1 419 A. cythera 2 1 2 0 0 0 1 2 0 0 1 420 A. cythera 2 1 2 0 0 0 1 2 1 0 1 421 A. cythera tuolumnensis 2 1 2 0 0 1 1 2 0 0 1 422 A. cythera tuolumnensis 2 1 2 0 0 0 0 2 0 0 0 423 A. cythera 2 1 2 0 0 1 1 2 1 0 0 424 A. cythera 2 1 2 0 0 0 1 2 1 0 0 425 A. cythera tuolumnensis 2 1 2 0 0 0 0 2 0 0 0 426 A. cythera 2 1 2 0 0 0 1 2 0 0 0 427 A. cythera tuolumnensis 2 1 2 0 0 0 0 2 0 0 0 428 A. cythera 2 1 2 0 0 1 1 2 1 0 0 429 A cythera tuolumnensis 2 1 2 0 0 0 1 2 0 0 0 430 A. cythera tuolumnensis 2 1 2 0 0 0 0 2 1 0 0 431A. A. mejicanus 1 1 1 0 0 1 0 0 1 1 1 43 IB. A. mejicanus 1 1 2 0 0 1 0 0 1 1 1 43 2 A. A. mejicanus 1 1 2 0 0 1 0 0 1 1 1 432B. A. mejicanus 1 1 2 1 0 1 0 0 1 1 1 43 3A. A. mejicanus 1 1 2 1 0 1 0 0 1 1 1 433B. A. mejicanus 1 1 2 0 0 1 0 0 0 1 1 434 A. mejicanus 1 1 2 0 0 1 0 0 0 1 1 435A A. mejicanus 1 1 1 0 0 1 0 0 0 1 1 435B A. mejicanus 1 1 1 0 0 1 0 0 7 1 1 435C A. mejicanus 1 1 1 0 0 1 0 0 1 1 1 43 6A A. mejicanus 1 1 2 0 0 1 0 0 0 1 1 436B A. mejicanus 1 1 1 0 0 1 0 0 0 1 1 437 A. mejicanus 1 0 1 0 0 1 0 0 0 1 1 438 A. mejicanus 1 1 1 0 0 1 0 2 0 1 1 439 A. mejicanus 1 1 1 1 0 1 0 2 0 1 1 0366 A. mejicanus pueblo 2 0 1 0 0 0 0 2 0 0 1 1142 A. mejicanus 1 1 1 1 0 1 0 0 1 1 1 1143 A. mejicanus 1 1 1 1 0 1 0 0 1 1 1 1148 A. virgulti 2 0 1 0 0 1 0 2 1 0 0 1149 A. virgulti 2 1 1 0 0 0 0 2 0 0 1 1150 A. virgulti 2 1 2 0 0 1 0 2 1 0 0 1151 A. virgulti 2 1 1 1 0 1 0 2 1 0 1 1152 A. virgulti 2 0 1 0 0 0 0 2 1 0 0 1153 A. virgulti 2 1 2 0 0 0 0 2 1 0 1 1154 A. virgulti 2 0 1 0 0 0 0 2 0 0 0 1155 A. mejicanus 2 1 1 1 0 1 0 1 1 1 1 1156 A. cf. mormo 1 1 2 0 0 1 0 0 1 1 1 1157 A virgulti 1 1 2 0 0 1 0 1 1 0 1 1158 A. mejicanus 2 1 2 0 0 1 0 1 0 0 1 1159 A cf. mormo 2 1 2 0 0 1 0 0 1 1 0 1160 A. cythera tuolumnensis 2 1 2 0 0 1 0 2 1 0 0 1161 A. cythera 2 1 2 0 0 1 0 2 0 0 0 1162 A. cythera tuolumnensis 2 1 2 0 0 0 0 2 1 0 0 1163 A. cythera tuolumnensis 2 1 2 0 0 0 0 2 1 0 0 1164 A. cythera 2 1 1 0 0 1 0 2 1 1 1 1165 A. cythera 2 1 2 0 0 1 0 2 1 0 0 1166 A. cythera 2 1 2 0 0 1 1 2 0 1 1 1167 A virgulti 2 0 0 0 0 0 0 2 0 0 1 1169 A. mormo 1 0 1 0 0 1 0 0 1 1 0 1170 A mormo 1 0 1 0 0 1 0 0 0 1 0 1171 A mormo 1 0 0 0 0 1 0 0 0 1 0 1172 A mormo 1 1 1 0 0 1 0 0 0 0 0 1173 A. mormo ? ? ? ? 7 7 7 ? ? 7 7 1174 A. mejicanus 2 1 2 0 0 1 0 1 0 0 0 1175 A. cf. mormo 2 0 2 0 0 1 0 0 1 1 1 1176 A. cf. mormo 2 1 1 0 0 1 0 0 0 1 1 1177 A. cythera tuolumnensis 2 1 2 0 0 1 0 2 1 1 1 1178 A. cf. mormo 2 1 2 0 0 1 0 0 1 1 1 1179 A. mormo 1 0 1 0 0 1 0 0 1 1 0 1180 A virgulti nigrescens 2 0 0 0 0 0 0 2 1 0 0 1181 A. virgulti nigrescens 2 0 0 0 0 0 0 2 0 0 0 1182 A. virgulti nigrescens 2 0 0 0 0 0 0 2 1 0 0 1183 A virgulti nigrescens 2 0 0 0 0 0 0 2 0 0 0 1184 A. virgulti nigrescens 2 0 0 0 0 0 0 2 1 0 0 1185 A. mejicanus 1 1 2 1 0 1 0 1 1 1 1 1186 A. cythera 2 1 2 0 0 0 1 2 0 0 0 1187 A. cythera 2 1 2 0 0 0 1 2 1 0 0 1188 A. cythera 2 1 2 0 0 1 0 2 1 0 0 1189 A. cythera 2 1 2 0 0 1 0 2 1 0 0 1190 A. cythera 2 1 2 0 0 0 1 2 1 0 0 1287 A. mejicanus 2 0 2 1 0 1 1 2 1 1 1 1288 A. mejicanus 2 0 2 1 0 1 1 2 1 1 1 1289 A. mejicanus 2 0 0 1 0 1 0 1 1 1 1 1290 A. mejicanus 2 0 1 1 0 1 1 2 1 1 1 1448 A. cythera 2 1 2 0 0 0 1 2 0 0 0 1471 A. mejicanus 2 1 1 0 0 1 1 1 0 1 1 1472 A. mejicanus pueblo 2 0 0 1 0 1 0 2 1 0 0 1473 A. mejicanus pueblo 2 0 0 1 0 0 1 2 0 0 0 1474 A. virgulti 2 0 1 0 0 0 0 2 0 0 0 1475 A. virgulti 2 0 1 0 0 0 0 2 1 0 0 1476 A. cythera 2 1 1 0 0 0 1 2 1 0 1 1477 A. virgulti 2 0 1 0 0 0 0 2 1 0 0 1478 A. cythera 2 1 2 0 0 1 0 2 0 0 0 93
AUTOBIOGRAPHY
I was born on 14 April 1985 in Toledo, Ohio, the second child of Wesley and Diane Proshek. After spending the first six months of my life in Toledo, my family moved outside the city to the semi-rural area of Monclova Township, Ohio. I grew up in a house full of females, as our family eventually grew to seven children—but not until the last of them did I finally get a brother. I've since taught him everything I know about bugs. Sisters are fun too, though. I've taught them a thing or two about bugs as well. Growing up, whenever I wasn't devouring works of fiction or playing baseball, I spent a great deal of time in the green outdoors. We had a fairly spacious backyard, with plenty of space to hide in the bushes, run around hitting things with sticks, throw rotten apples, and hunt insect pests in the garden. Since my parents were avid naturalists and birders, the whole family also spent a lot of time in the local park system. To them I owe my interest in the natural world. My education has been a bit unorthodox. After I attended kindergarten at the elementary school down the road, my parents pulled my sister and I from the public school system and educated us at home from then on. I'm grateful for my home school education. It enabled me to not only bond more closely with my family, but I came to appreciate the flexibility in lessons plans and study habits that it afforded me. Thankfully, we belonged to a large home schooling community, so I never lacked close friends. The only drawback was that I didn't have the opportunity to play baseball for the local high school. After graduating from high school in 2007 I attended Hillsdale College, a small (~1,400 students), private, liberal-arts school in Hillsdale, Michigan. I will be forever grateful for my time at Hillsdale. Not only did I receive a first-class education, completing a research thesis on the taxonomy of the Phyciodes thaws (crescentspot butterfly) species complex using mtDNA for my biology major and studying the Latin language for my Classics major, but I grew up and a matured as a person among my wonderful peers and professors. 94
My jobs during school mostly consisted of working at a local butterfly house, where I ended up assisting at nearly all levels of the operation. My favorite part was taking care of the exotic butterflies and saturniid moths that were shipped in weekly from places like Costa Rica, Malaysia, and the Philippines. I also spent many hours collecting local insects in the fabulous outdoor gardens during my lunch breaks. That is where I cultivated my love of biology. I graduated from Hillsdale in the spring of 2007 and came to Felix Sperling's lab at the University of Alberta the following fall. I've had too many adventures here to count, including arriving in Edmonton from Helena, MT via bicycle, and getting the opportunity to spend a month in August and September of 2008 road-tripping solo and collecting my study species across the northern and western part of Canada and the States. Once again, at the U of A1 grew up and matured in ways I never would have predicted, thanks to the peers and mentors here who have guided me in science and in life in general. I will forever be grateful for my time here.