A.g.os

Hypoxia-Inducible Factor-1a mRNA Contains Internal Ribosome EntrY Site That Allows Efficient Translation During Normöxia And Hypoxia

Kenneth Lang,B.Sc., B Health Sc. (Hons)

A thesis submitted to the University of Adelaide for the degree of Doctor of Philosophy

ADE[.AIDE UNIVERSITY HANSON AUSTHALIA +l INSTITUTE

CFUDE

Division of Human ImmunologY

Hanson Centre for Cancer Research

Through the Department of Medicine

UniversitY of Adelaide

Adelaide, South Australia

March, 2003 Table of Contents

Table of Contents......

Summary.

Statement of Originality......

Acknowledgements

Publications arising from this thesis'

Abbreviations...

Chapter 1

1 Introduction...... ,'1 1.1 Expression and Regulation of ' expression ..1 1.1.1 Transcriptional regulation of ) re gul ating 1 . 1 .2 post_transcriptionál mechanisms ...J L.l.2.I Nonsense-mediated mRNA decay' ' ' ' I.I.2.2 mRNA sPlicing. ...4 ...4 L1.2.3 mRNA stabilitY. ...5 1.1.2.4 Translation

1.2 Eukaryotic Translation Initiation' " ...... 6 t.i.t Vto¿ification of messenger RNA's ,.....'.6 L.2.2 Cap-dePendent initiation...... 7 1.2.3 Formation of the 43S pre-initiation complex' ...... 7 L2.4Btnding of mRNA to ribosomes' " " codon' ...... 7 I.2.5 Migrati-on of the 43S pre-initiation complex to the initiation " " 8 1.2.6 Elongation and Termination" " " 8 1.2.7 Regulation of translation initiation" " " 9 1.2.7 .1 PolY(A) tail.' . 9 1.2.7 .zRegulation of initiatio t factor activity by phosphorylation.. ' I.2.1.2.I eß2.. 9 10 1.2.7.2.2 eIF4E' t.2.7.2.3 4E-BP. 11 t2 1.2.7.2.4 eIF4G. I.2.7.3 Structural features regulating translation' " T3 t4 Variations of the cap-dependent scanning model" ' ' 1.2.8 t4 1.2.8.1 LeakY Initiation' .15 I.2.8.2 Re-Initiation... " ' .15 1.2.8.3 Ribosome shunting' .16 1.2.9 Internal Ribosome EntrY. .n I.z.LO Cellular IRES elements. ' .18 I.2.Il Vascular Endothelial Growth Factor IRES' .21 I.z.tZ c- IRES. .22 1.3 Angiogenesis. .23 1.3.1 Angiogenesis and cancer ,.23 1.3.2 Role of VEGF in angiogenesis" ' .24 1.3.3 Activation of VEGF by hypoxia" ' ..25 1.4 Hypoxia-Inducible Factor' '. " ' ..26 1.4.1 HIF-1 target genes. ..27 r.4.zrfß-rp / ARNT. ..28 1.4.3 HIF-1cx mRNA exPression ..28 1.4.4 The HIF-1cr . ...29 1.4.5 Dimerisation and DNA binding domains' 29 1.4.6 Protein stability and degradation' 30 1.4.7 Degradation of HIF-lcr is mediated by VHL' 3L 1.4.8 proline hydroxylation determines HIF-19 protein stability 33 1.4.9 Transactivation properties of HIF-1o' potential" .JJ 1.4.10 Asparagine hyãroxylation regulates HIF-1cr transactivation " " .35 14Jl Activation of HIF-1o by other mechanisms' " " " " " 35 1.4.11.1 ERK / MAPK PathwaY' .35 1.4.11.2 '.. .36 1.4.1I.3 p14o*t Tumour Suppressor .37 I.4.11.4 PI3 Kinase signaling pathway' .38 I.4.12 Role of HIF-1o in development" " ..39 I.4.13 Role of HIF-1 in disease. ..39 1.4.14 Role of HIF-I in cancer. .42 1.5 Project Rationale

Chapter 2 ..44 Materials and Methods...... 44 2.1 Chemicals, reagents and consumables" " ' 44 2.2Bnzymes and protein molecular weight markers" " .45 2.3 Oligonucleotides. .46 2.4 Radiochemicals. .46 2.5 Buffers and Solutions' '...... 50 2.6 E.coli Bacterial strains. ..50 2.7 Plasmids...... 50 2.8 Eukaryotic cell lines. ysis method) ..51 2.9 Miniprep purification rf plasmid DNA (Alkaline I ..51 2.l0Larfe scale preparation of plasmid DNA' ..53 2.tt purification of DNA fragments using Geneclean kit .53 2.12 DNA ligation' transformation' ' .53 2.13 preparfiion of compete rt bacteria for calcium chl e mediated " .54 2.14 T r insformation of bacterial competent cells' .54 2.15 Sequencing'...... 54 2.16 Polymerase chain reaction. cells' 55 2.I7 Transient transfection of NIH3T3, HeLa, IßK293 and MCFT 55 2.18 Stimulation of fos promoter in pfGH' " ' 56 2.19 Secreted alkaline phosphatase assay' " " .57 2.20 Dlual luciferase assay. .57 2.21 in vitro transcription to generate RNA probes .57 2.21.1Preparation of plasmid templates" " .58 2.2I.2 in vitro transcription'''''' 58 2.21.3 Purification of the RNA probes by PAGE 2.21. Elution of the RNA probes from polyacrylamide" 59 59 2.21.5 Hybridising the probe with RNA' .60 2.22 RNase protection assay. ..60 2.22.1Digestion with RNase 4. " .60 2.22.2 Electrophoresis of RNase A protection samples" " " 2.22.3 Quantitation and analysis of specific mRNAs' 2.23 Northern blot assay using radio-labelled DNA probe' z.z3.lNorthern transfer of RNA from agarose gel to nylon membrane by downward caPillarY transfer. 6l 62 2.23.2 Hybridisation. .' 62 2.23.3 Labelling of DNA Probes' 62 2,23.4Washing of nylon filters for visualisation of bands 3s 62 2.24 S-methionine incorporation. . . . 63 2.25 Polysome analYsis...... 64 2.26 Westem blot.

Chapter 3 site..."'65 Hypoxia-Inducible Factor-lcr mRIIA contains an Internal Ribosome Entry

.ó5 3.1 Introduction. cells.. .66 3.2 Construction of HIF-1Cr reporter plasmids for analysis in mammalian .69 3.3 Characteristics of the HIF-1ü 5'UTR. .10 3.4 System to determine the function of the HIF-Icr 5'UTR' .10 3.5 The HIF-Icr 5'UTR allows efficient translation .71 3.6 The HIF-lcr 5',UTR contains an Internal Ribosome Entry Site.. ' IRESs. ..73 3.7 Relative efficiency of the HIF-Io IRES compared with other cellular ..74 3.8 Mapping of the HIF-1o IRES. 79 3.9 Summary and Discussion..

Chapter 4

Hypoxia-Inducible Factor -lcr mRNA is spared the general reduction of translation o.rå". hypoxia, which is mediated by the internal ribosome entry site...... """"""83

4.1 Introduction. 4.2Totaltranslation is reduced during hypoxia but translation of HIF-lcx, mRNA is ...... 84 unaffected ...... 85 4.3 HIF-IG IRES activity during hypoxia and serum deprivation ...... 86 4.4Theeffect of hypoxiâ and serum deprivation on the VEGF and c-myc IRES' ' " ...... 88 4.5 Summary and Discussion

Chapter 5

Activation of the phosphatidylinositol 3-kinase signaling pathway increases hypoxia- inducible factor-lo, internal ribosome entry site activity .' " " " ""'91

5.1 Introduction. """"91 5.2 OverexpressionAkt constructs...' """""92 5.3 Heregulin stimulation increases HIF-1cr protein, but not mRNA levels. " ' ""' ' '93 up-regulated in 5.4 Cap-dependent translation and HIF-Icr IRES activily are concomitantly ,".pon^r" to heregulin stimulation'... " "" " "94 5.5 Stimulation of serum-starved MCFT cells with heregulin does not alter firefly .96 luciferase mRNA levels. .97 5.6 The PI3K signaling pathway regulates HIF-Iü IRES activity .99 5.7 Summary and Discussion

Chapter 6

Long G + C rich S'UTRs containing internal ribosome entry sites may be more suscãpfible to mRNA instability """""103

6.1 Introduction. """103 6.2 Constructs of reporter plasmids to determine IRES activity versus mRNA instability. 6.3 VEGF 5'UTR mRNA destabilisati on correlates with IRES activity..... 6.4 The XIAP IRES cannot destabilise fGH mRNA destabilisation 6.5 G + C rich 5'UTRs containing IRES elements may also contain mRNA ..110 elements 111 6.6 Summary and Discussion

Chapter 7

115 Final Discussion

7.1 Final Discussion

Chapter 8 r23 Sumry

HIF-lcr is the regulated subunit of the HIF-I , which induces

The HIF- transcription of a number of genes involved in the cellular response to hypoxia'

but is stabilised in 1ct protein is rapidly degraded in cells supplied with adequate oxygen,

mRNA hypoxic cells. using polysome profile analysis, I found that translation of HIF-1cx' in NIH3T3 cells is spared the general reduction in translation rate that occurs during an internal hypoxia. To assess whether the 5'uTR of the HIF-14 mRNA contains HIF-lct 5'UTR ribosome entry site (IRES), I constructed a dicistronic reporter with the

promoted inserted between the two reporter coding regions. I found the HIF-lcr 5'UTR IRES' IRES activity translation of the downstream reporter, indicating the presence of an

was not affected by hypoxic conditions that caused a reduction in cap-dependent than was cap- translation, and IRES activity was less affected by serum-starvation

in the HIF-lcr 5'UTR is dependent translation. This indicates that the presence of the IRES

to allow translation to be maintained under conditions that are inhibitory to cap-dependent

translation.

HIF-lcx, protein Several reports have implicated the 5'UTR to be important for

(PI3K) signal transduction synthesis upon activation of the phosphatidylinositol 3-kinase

synthesis is pathway. I hypothesised that this specific induction of HIF-Iø protein

increased in response to mediated by the HIF-1cr IRES. I found HIF-lCr IRES activity was

activation of the pI3K signaling pathway, with a concomitant increase in cap-dependent of Akt (a translation. Results also indicate that activation of the IRES is independent

the regulation of HIF- downstream targefof PI3K), implicating other signaling pathways in

lu IRES function. mRNA I also demonstrate that GC rich 5'UTRs containing an IRES may stimulate tested (vascular destabilisation. This mode of regulation was found in three IRESs all cellular endothelial growth factor, HIF-lct and c-myc), but is not a mechanism of a reporter IRESs, as the X-linked inhibitor of apoptosis 5'UTR could not destabilise is subject to mRNA. Data presented in this thesis indicates that the HIF-lcr 5',UTR

and this is regulated by multiple modes of regulation, including translation by an IRES, signal transduction pathways, and mRNA instability' Statement of Orieinalitv

This thesis contains no material that has been accepted for tho award of any degree or diploma by any other university. To the best of my knowledge it contains no material that has previously been published by any other person, except where due reference has library, been made in the text. I consent to this thesis, when deposited in the university being available for photocopying and loan.

Kenneth Lang Acknowledgements

This epic journey would have gone nowhere without the help and assistance of a knowledge was number of people. t must firstly thank Greg Goodall, whose guidance and graciously invaluable. I also thank Greg ior allowing me "to do my own thing", and for reading numerous versions of thesis chapters. Thankyou for using red pen somewhat sparinlly. A big thanks goes to the people who provided.me with plasmids to undertake ,ã*" óf this work. To Anne Willis for providing the dual luciferase reporters and the c- for the myc 5'UTR, Andreas Kappel, who cloned the HIF-lcr S'UTR; and Martin Holcik Xinp 5'UTRs. To Mark CìtttlAg" and Angel Lopez for donating their time in an attempt reagents. to get me to understand the PI3K signalling pathway, as well as advice and Lab' I also need to extend my thanks tõ past and present members of the Goodall in fGH and To Justin Dibbens for much advice and for making the VEGF 5'UTR deletions for sure performing the instability assays. John Harvey... what can I say? At least I know "humourous" e- that flatulence really is finny!îo Steven Polyak for a continual supply of mails as well u, **" exierimental advice. To the cuffent members, Leeanne coles, Lagnado and Lidia Rosemary Sladic, Antonettá Bartley, Andrew Bert, Rod Putland, Cathy controls would Lambrusco for endless helpful comments and advice. I'm sure most of the "evil" bay have been left out if not for you guys! Last, but certainly not least, to my basis' companion, Peter Diamond, who provided on a daily occasion' To Seriåusly though, thanks for the scientific advi ear on my not so the lab in genãral, thanks for listening to my some of politically correct and line-crossing ones' in An extended thanks to the division of human immunology for interesting chats the tearoom, and for providing a friendly place to work' three the Of course, none of this would have been possible without the help of of most important people in my life. To my wife, Tamara, who not only gave invaluable to do a financiaf support, plãced beliefs in me that I was doing the right thing in going on phD, and ltrãt f could actually accomplish it. And to my two daughters, Caitlyn and Jacinta, who provided an endless .uppty of entertainment (and sometimes annoyance) particularly during the writing period. They c the will to keep if it tcilled me (anã ii nearly did, or )' A big thanks to ioing, I would love Mum and"u.n Dad for continual belief and support life. longer than to mention everyone, but apparently the acknowledgements are not meant to be friends (you all the actual thesis, so in thaf ôase, a big thanks goes to all of my family and just know know who you are) for just being th"i". You really did help you probably don't ir. Finally, I must thank coca-cola, especially for putting coke on special almost every week during ihe writing period. I'm so glad you put caffeine in it. Publications arisins from work presented in this thesis

factor-lcr is Lang, K.J.D., Goodall, G.J. (2001) Translation of hypoxia-inducible Conference' medîated by an internal ribosome entry site l3tt' Lorne Cancer factor-lü mRNA Lang,K.J.D., Kappel, 4., Goodall, G.J. (2002) Hypoxia inducible translation during contains an internal ribosome entry site that allows efficient of the ;ñ;ì; lS^ io*, Genome Conferànce on the Organisation and Expression Genome. factor-lcr mRNA Lang, K.J.D., Kappel, 4., Goodall, G.J. (2002) Hypoxia inducible translation during contains an internal ribosome entry site that allows efficient normoxia and hypoxi a MoI Biol CeII 13: I'792-I8OI' IRES that allows Lang, K.J.D., Goodall, G.J. (2002) HIF-10 mRNA contains an Medical efficient translation during normoxia and hypoxia Australian Society for Research factor-lcr mRNA Lang,K.J.D., Kappel, 4., Goodall, G.J. (2002) Hypoxia inducible translation during contains an internal ribosome entry site that allows efficient normoxia and hYPoxia ComBio 2002' (2003) Goodall, G.J., Coles, L.S., Bartley, M.4., Lang, K.J.D., Post-transcriptional Oxford' U'K' regulation of VEGF. Genetics of Angioge¡n¿sls BIOS Scientific Ltd' ABBREVIATIONS

in the All abbreviations used throughout this thesis are in accordance with those described below' Journal of Biological Chemistry; additional and alternate abbreviations are shown

APS ammonium persulPhate Amp ampicillin ARE AU-rich element ATP adenosine triphosPhate bp base pairs BSA bovine serum albumin CHX cycloheximide

CIP c alf intestinal PhosPhatase DEPC diethyl pyrocarbonate DMEM Dulbecco's modifîed Eagle' s Medium DMSO dimethylsulphoxide DNA deoxyribonucleic acid DNase deoxyribonuclease DTT dithiothreitol EDTA ethylenediaminetetra-acetic acid eIF eukaryotic initiation factor FCS foetal calf serum rp firefly GAPDH glyceraldehyde-3 -phosphate dehydro genase IIEPES N-2-hydroxyethylpiperazine-N' -2-ethane-sulfonic acid HIF hypoxia-inducible factor IRES Internal ribosome entrY site kDa kilodalton mA milliamps MEN Mops EDTA sodium acetate Met methionine mins minutes mRNA messenger RNA NP-40 Nonident @ P 40 nt nucleotides OD optical density PAGE polyacrylamide gel electrophoresis PBS phosphate buffered saline PCR polymerase chain reaction PPT polypyrimidine tract RL renilla RNA ribonucleic acid RNase A ribonuclease A

rpm revolutions Per minute rRNA ribosomal RNA

SeAP Secreted alkaline PhosPhatase

SDS sodium dodecYl sulPhate

secs seconds SEM standard error of the mean

SSC Saline sodium citrate TAE tris-acetic acid EDTA TBE tris-boric acid EDTA TE tris-EDTA TEMED N,N,N',N' -tetramethyl-ethene-diamine tRNA transfer RNA UTR untranslated region try ultra-violet VEGF vascular endothelial growth factor VHL von-Hippel Lindau Protein XIAP X-linked inhibitor of aPoPtosis Chapter 1

Introduction 1.L Exnression and Reeulation of Genes

factors, oncogenes and The expression of certain classes of genes, such as growth

function and hence survival of the kinases are required to be tightly controlled for correct cell cellular growth, cell-cycle or stress organism. These types of genes are often expressed during to disease' consequently' for conditions and inappropriate expression of these genes may lead most genes in every cell of the an organism to remain viable, the appropriate expression of

body must be regulated correctlY' activation and Regulation of gene expression has primarily focused on transcriptional with mRNA expression repression with the amount of protein produced directly correlating

have been recognised as having levels. However, in the past 10 years or so, other mechanisms

post-transcriptional, translational and an effect on the regulation of gene expression, including

post-translational mechanisms'

l.l.L Transcriptional regulation of gene expression global regulation of a Transcriptional regulation is mediated by two mechanisms,

transcription factors' Both of region of DNA in the context of chromatin and gene specific

play imporlant roles in gene regulation. these mechanisms are intimately linked and appear to form structures known as In eukaryotes, DNA is packaged with histone to mechanism that allows up to one nucleosomes. The formation of chromatin is a physiological The histone proteins have a thousand_fold compaction of the DNA length in . overall negative charge on globular body and a highly basic tail, which helps neutralise the structure (wolffe et al'' DNA, hence facilitating DNA folding into this compact chromatin

1 1 on

dynamic part of the 2000). It is now clear that histonelDNA interactions are an integral and machinery responsible for regulating gene transcription'

The degree of DNA compaction of chromatin appears to be one of the major

packed in chromatin controlling factors in regulation of gene expression. DNA that is tightly

that is not tightly packed in is associated with regions of poor gene expression whereas DNA regulation of chromatin chromatin is associated with regions of high gene expression. The

involves histone modifications, particularly by acetylation, however other effective correlated with whether mechanisms do exist. The acetylation state of histones has been

histones are associated with associated DNA regions are active or silenced. Hyper acetylated

afe associated transcriptionally active regions of chromatin, whereas deacetylated histones link between with transcriptionally silent regions of chromatin (Strahl et al',2000)' A direct that coactivation chromatin function and acetylation was only established by the discovery

acetyltransferases, and complexes required for transcriptional activation contained histone (van Holde 1998)' conversely, co-repressor complexes contained histone deacetylases

the gene specific Open regions of chromatin provide a region of DNA that can recruit

to the promoter region transcription factors. These gene specific transcription factors can bind

of the gene and activate transcription. Therefore transcriptional activation requires the to bind to the promoter chromatin to be opened up and the gene specific transcription factors

conclusion of these two region. Transcription of the DNA can only be completed upon the

events.

to To control the expression of certain genes, cells have gained several mechanisms correct place' ensure that these genes afe expressed at the correct time and at the 2 gene Transcriptional activation has been well characterised as a major site of controlling

expression are also expression of a number of genes, however other mechanisms that govern

involves a utilised. These include post-transcriptional regulation of gene expression, which

and mRNA number of processes, including nonsense mediated mRNA decay, mRNA splicing

stability. These methods of regulation are discussed briefly below.

1.L.2.1 Nonsense'mediated mRNA decav

and Nonsense-mediated-decay (NMD) is a conserved mechanism used to detect

sefves as a mRNA selectively degrade mRNAs that contain pfemature stop codons' NMD

that could act surveillance mechanism to eliminate mRNAs encoding truncated polypeptides (reviewed in Byers in a dominant-negative fashion or yield potentially hazardous proteins extensive 2002). This function is of particular importance in genes that are subject to

mRNAs recombination and somatic mutation, such as the immunoglobulin and T-cell of mutations in (Li et al.,2112).premature termination codons (PTC) can arise from a number

yield a several ways. These may include the introduction of a nonsense mutation to

a frame-shift; termination codon; insertion or deletion of a number of nucleotides may create or intron mutations that may lead to the creation of cryptic splice sites; exon skipping,

inclusion

In yeast, exonic downstream sequence elements are responsible for the sensing and (Reviewed in degrading of RNA transcripts that contain a premature termination codon.

for degradation when Hentze et al., ßgg).This protective mechanism therefore targets RNAs

the quality of mRNA a termination codon is detected upstream of a coding sequence ensuring

and hence the Protein Product.

3 a.

1.L.2.2 mRNA Splicine

pre-messenger RNAs (pre-mRNAs) are the primary transcripts of protein-encoding

length (Lander 2001); genes, which on average are about 27,000 to 28,000 nucleotides in

on average (Venter 2001). The majority of these sequences are located within introns, which

can be grouped into four span 3,365 bases and numbetT per transcript. Altemative splicing exclusion of an intron' The categories. The simplest mechanism involves the inclusion or

the extension of the 5' and 3' alternative use of 5' splice sites, or 3' splice sites resulting in

exon inclusion and exon skipping borders respectively. The final, and most complex involves then result in the (reviewed in Goldstrohm et a1.,200I). These differently spliced mRNAs

functions' synthesis of different proteins, often with distinctly different cellular

1.L.2.3 mRNA stabilitv

The stability of the 6RNA is often determined by specific cis-acting elements and the 3'uTR of many trans-acting proteins. The majority of studies focus on regions within rich element (ARE), which is unstable mRNAs. One well-characterised element is the A + U mRNAs' These motifs act present in a number of cytokine, growth factor and proto-oncogene by the nonameric as de-stabilising elements and the consensus sequence is characterised turnover mechanisms sequence UUAIJWA(U/AXU/A) (Lagnado et al., Lgg4). ARE-directed (presumably arising from the are heterogeneous in respect to decay and decay characteristics

the numerous RNA-protein and diverse RNA-binding factors that recognise the AREs) and by

protein-protein interactions that presumably regulate turnover. the instability and Several ARE-binding proteins have been described involving both

functions. AUF1 has been the stabilisation of the message, with some proteins capable of both

a multi-subunit complex, shown to activate ARE-mediated mRNA decay in trans as part of 4 1

such as and can also act in stabilising complexes targeting AREs of specific mRNAs, parathyroid hormone (Laroia et aL, 1999); (Sela-Brown et al',2000)' A well-characterised

are the ELAV proteins' This class of proteins involved in stabilising mRNAs containing AREs specifically to AREs class includes FIuC, HuD and HuR, which have all been shown to bind

(Ma et al'' 1996); (Ma et and stabilise the message (Chung et al., 1996); (Levine et al',1993);

a1.,1997); (Myer et a1.,1997).

that are The mRNA decay rate plays an important role in the regulation of mRNAs

transcription, allows required to be translated for only short periods. This, in conjunction with shut off for a rapid response to a stimulus, but also provides a mechanism to rapidly

expression when it is no longer required'

1.1

The process of translation consists of three stages: initiation, elongation and

the initiation stage and is termination. The rate-limiting step of translation is predominantly at regulating global tightly regulated by cells to control translation rates. The primary mechanism

protein synthesis involves the phosphorylation / dephosphorylation of translational

process of translation in eukaryotes is components, in particular initiation factors. This and the

discussed in more detail in section 1'2'

1.2 Eukarvotic Translation Initiation and The process of translation is divided into three phases: initiation, elongation

at the initiation phase and termination. The rate-limiting step of translation is predominantly The most evident therefore is the step most often used to control the rate of translation'

5 1

the regulation of the initiation factors, mechanism of controlling translation initiation involves which is discussed in more detail below'

1.2.1 Modification of messenger RNA's eukaryotic mRNA molecule Before RNA transcription is completed, the 5' end of the

a 7-methyl Gppp "cap" structure is is modified. Mediated by a series of enzymatic reactions,

(Pain 1996). This cap structure is thought to added to the 5' end of each primary transcript translation and also enhance protect the mRNA from exonucleolytic degradation, enhance 1998); (Jackson et al'' 1990); nucleocytoplasmic transport of the mRNA (Imataka et al',

(Michel et a\.,2001); (Morales et aI',1997); (Pain 1996)' polyadenylated soon after At the 3' end of the transcript, mammalian mRNAs are

residues as they are transported into transcription in the nucleus, and carry 200-250 adenylate

thecytoplasm.Thepoly(A)tailsaregenerallyshortenedinthecytoplasmtoabout50-70 mRNA stability and translational residues, which plays a crucial role in the regulation of

efficiency.

1.2.2 CaP-dePendentinitiation three stages' The first stage The process of translational initiation can be divided into

several initiation factors with the 40s involves the association of an initiator tRNA along with

The second step involves the binding ribosomal subunit to form the 43s preinitiation complex. start codon and to the followed by its migration to the translation of the 43s complex 'RNA, subunit, resulting in the assembly of the third step involves the addition of the 60s ribosomal is ready to commence the ggs ribosome at the initiation codon. At this point the ribosome

6 1 on

this process is translation of the coding sequence (reviewed in Pain 1996). A summary of illustrated in figure 1.1.

1.2.3 tr'ormation the 43S

Formation o¡ ¡¡s43S, preinitiation complex involves the association of the eukaryotic initiation initiation factors, elF2, eIFIA and eIF3 with the l0S ribosomal subunit' Eukaryotic

to the z[]5 factor 2 recruits the initiator tRNA and conducts it as a Met-tRNA-GTP complex other protein ribosomal subunit (reviewed in Pain 1996). eIFIA acts as a bridge between an RNA initiation factors and the ribosome (Dever et aI', 1994), while eIF3 contains

(Evans eî aL" 1995)' recognition domain, which is probably involved in ribosome binding

L.2.4 Bindine of mRNA to ribosomes

Binding of the 43S preinitiation complex to mRNA is facilitated by the cap-binding

contains a motif involved complex eIF4F, which consists of oIF4E, eIF4A and oIF4G. eIF4E eIF4A is a helicase and in the recognition of the 5' terminal m?GTP cap structure of mRNA. mRNA' eIF4G is involved in the unwinding or melting of secondary structures in the the unwinding of functions to bring together eIF4A and other components necessary for the preinitiation secondary structure and appears to have a role in the placement of 43S

end of eIF4G interacts complex (Joshi et a1.,1994); (Lamphear et a1.,1995). The N-terminal

(Morley et al',1997). with eIF4E and the C-terminal end interacts with eIF3 and eIF4A

must migrate Upon the formation of the initiation complex, the 43S ibosomal complex

to the 5' end' The 43S to the initiation codon, which in most cases is the AUG codon nearest 7 Figure L.L

Mechanism of translation initiation

The initiator tRNA (MeGtRNA) binds with eIF2 and GTP to form a ternary complex.

Dissociation of 80S ribosomes occurs by the action of eIF3, and binding with eIFIA and eIF3 captures 40S subunits for initiation. The 43S pre-initiation complex is formed when the ternary complex and the 40S subunit bind. The complex binds to mRNA to the mRNA at the 5' terminal mTGTP cap structure, and then migrates along the mRNA towards the

AUG codon. The initial binding requires the eIF4F complex (containing factors eIF4E, eIF4G and eIF4A), which is involved in binding to the 5' terminus of the mRNA, which creates conditions that allow the meting of intramolecular secondary structures within the mRNA that would otherwise prevent the binding of the 43S pre-initiation complex. The binding of these two complexes to the mRNA is collectively referred to as the 48S pre- initiation complex. When the 48S pre-initiation complex reaches a favourable AUG codon, the GTP molecule is hydrolysed to GDP, which powers the ejection of the initiation factors bound to the 40S ribosomal subunit, which also involves eIF5. The removal of these factors from the 40S ribosomal subunit allows the association of a native 605 ribosomal subunit, to reconstitute an 80S ribosome at the initiation codon, ready to commence the elongation stage of translation. The continuity of initiation events requires the recycling of initiation factor molecules. eIF2 is released as a binary complex with GDP and requires oIF2B

(which acts as a guanine nucleotide exchange factor) to catalyse the regeneration of the eIF2-GTP complex. This newly formed complex then recruits the next Met-tRNA molecule to form a new ternary complex, and the cycle is repeated. 80S ribosomal eIF2. GTP subunits Met -

-eIF2'GTP

Ternary /oi.rociatio' (eIF3) complex ,

eIFIA eIF3

43 S pre-initiation complex formation

eIF3

eIF4F

mRNA binding

eIF4 association

48S pre-initiation comPlex eIF3

AU

eIF release selection .Z 2F5

m7G 80S initiation 6os j complex 1

start codon by codon-anticodon complex scans along the mRNA until recognition of the codon is reached, the ribosome recognition involving the initiator IRNA. Once the start

subunit' The addition of the 695 complex stops and awaits the addition of the 605 ribosomal bound to the 40s ribosomal subunit ribosomal subunit requires the release of factors that are reaction is dependent on the (Gingras et al., L999a); (Pestova et a1.,2001). The dissociation

by another factor, eIF5 (reviewed hydrolysis of GTP which is bound to eIF2 and is catalysed that eIF5 and eIF2 associate' in (Gingras et aI., 1999a); (Pain 1996)). It has been suggested elF2-bound GTP molecule and ejection resulting in the activation of GTPase, hydrolysis of the

binding, forming the 80s ribosome' of eIF2-GDP-eIF3 initiation complex, upon 60s subunit

1.2.6 Elongation and Termination that adds one amino acid The elongation phase of protein synthesis is a cyclic process

chain per turn of the cycle. The cycle residue to the C-terminal end of the nascent polypeptide which are involved in this rapid is promoted by four proteins, termed elongation factors,

pfocess. and when reached' a Termination involves the recognition of termination codon' peptidyl-tRNA, releasing the protein release factor promotes cleavage of the completed

(reviewed in Gingras et al.,l999a)'

1.2.7 Resulation of translation initiation expression, with the initiation Translation is an important step in regulation of gene

In the process of elongation' the rates stage as the most commonly observed point of control' of initiation efficiency' There are are constant, therefore changes in translation is an indication

to be subject to regulation; the initial two particular steps of the initiation pathway that appear 8 1

by eIF4E and binding of the 43s preinitiation complex to the 5' end of mRNA mediated the ribosomal subunit associated factors (pain 1996) and binding of Met-tRNA to 40s

have been well characterised, mediated by eIF2. Two mechanisms of translational regulation

structural features in the 5' namely phosphorylation of initiation factors and the influence of and 3' UTRs of the mRNAs

1.2.7.1 Polv(A) tail

systems, including yeast, The poly(A) tail is stimulatory for translation in a number of

multiple copies of a highly plant and mammals. This occurs by coating of the poly(A) tail by binding protein (PABP) (Adam conserved, approximarely 70kDA polypeptide, called poly(A)

and the cap structure act et a1.,1986); (Sachs et a1.,1936). The finding that the poly(A) tail may exist as circularised synergistically to up-regulate translation, suggests that mRNAs bound eIF4G, and the 3' bound molecules via the protein-protein interaction between the 5' method may pABP (Imataka et a1.,1998); (Tarun et al.,1996). mRNA circularisation via this

transfer of 40S ribosomal enhance translation by allowing ribosome reinitiation through without dissociation from the subunits from the 3,uTR directly to the 5' end of the message,

mRNA

1.2.7.2. elF2 have been Many physiological conditions that inhibit initiation of protein synthesis

Loss of eIF2 activity impairs shown to decrease the activity of eIF2 (reviewed in Pain 1996). recruitment of the initiator the formation of the 43S preinitiation complexes by inhibiting the this complex rRNA (pollard et al.,lggg). eIF2 binds GTP and the iniriator IRNA and delivers 9 1In

The GTP is hydrolysed at the initiator to the small ribosomal subunit (Dholakia et aL, 1990). eIF2-GDP is released, leaving AUG, prior to the joining of the large ribosomal subunit' where Two mechanisms appear to regulate a charged initiator IRNA in place (oldfield et al',Igg4)' factor eIF2' The first involves the recycling step involving the guanine nucleotide exchange

in an increased affinity of eIF2 for phosphorylation of the cr-subunit of eIF2 at Ser51, resulting

guanine nucleotide exchange, resulting in eIF2B. This formed complex is unable to.carry out The second mechanism is an inhibition of translation (reviewed in Gray et al', 1998)' involves regulation of eIF2B activity independent of phosphorylation changes in eIF2, and

directly, however the mechanism is unknown'

1.2.7 .2.2 4E regarded as important in The activity of the cap binding protein, eIF4E has long been recruitment' This factor is the regulation of initiation, as it forms the initial step in *RNA .IF4E is phosphorylated in response believed to have a regulatory role for two reasons. Firstly, oIF4E is present at vefy low molar to a wide variety of physiological stimuli and secondly, factors (Duncan et al'' 1987); concentrations relative to ribosomes and other initiation

(Hiremath et al', 1985).

the recruitment of mRNA .IF4E is implicated as the limiting factor in the regulation of activation by mitogens or T-cell as concentrations of this factor can be increased upon of oIF4E has been shown to activation (BoaI et al., L993); (Mao et al., lgg})' Overexpression morphology' increased focus have profound effects on cell growth, resulting in aberrant (De Benedetti et a1.,1990); (Lazaris- formation and the ability to form tumours in nude mice

Karatzas et a1.,1990).

10 elF4Eisphosphorylateduponstimulationofcellsbycertainhormones,growthfactors ormitogens,resultinginanup-regulationoftranslation.Conversely,phosphorylationis

cells are undergoing mitosis or cellular stress decreased when translation is inhibited, or when

(reviewedinHersheylggl)'ThesefindingsareconsistentwiththepatternofelF4E eIF4E phosphorylation is low in G0' phosphorylation observed throughout the cell cycle. dramatically reduced in M phase, in direct increases throughout Gl and S phases and is

et a\,,1990). correlation with translation activity (De Benedetti

t.2.7.2.3 F,-BP is its interaction with a family of An important regulatory mechanism of oIF4E activity proteins (4E-BPs)' The 4E-BPs are small repressor proteins termed the elF4E-binding inhibit cap-dependent translation (approximately 10-12 kDa), heat stable proteins, which can of 4E-BPs to eIF4E does not appear to (Pause et al., 1994);(Poulin et a1.,1998)' The binding (Pause et al'' lgg4)' but rather inhibit the alter the affinity of eIF4E for the cap structure the formation of the .IF4F complex association of eIF4E with .IF4G, thereby preventing

(Haghighat et al', 1995)'

Thebindingof4E-BPtoelF4Eisregulatedbythephosphorylationofspecificserine 4E-Bps bind efficiently to eIF4E, and threonine residues in 4E-Bp. Hypophosphorylared

of residues in the 4E-BPs abrogates this binding however phosphorylation of a critical number (Marcotrigiano et al" 1999); (Fadden et al., L997);(Gingras et a1.,1998); (Lin et at.,1994);

(Pauseetal',1g94).Anincreasein4E-BPphosphorylationinvariablycorrelateswitha

in increased translation initiation' decrease in binding affinity to eIF4E, resulting

ThePI3K-AKT-FRAP/mToRsignalingpathwayregulatesthephosphorylationof rapamycin, results in an 4E-Bp. Inhibition of mTOR activity by the immunosuppressant 11 1

of 4E-BP phosphorylation inhibition of cap-dependent translation due to the sensitivity in rapid and complete (Beretta et al., I996a). Although rapamycin tfeatment results synthesis and growth rates is only dephosphorylation of 4E-BP, the affect on protein

1996a); (Feigenblum et aI'' 1996)' Therefore' suppressed approximately 507o (Beretta et al.,

types and conditions and may primarily the importance of 4E-Bp may vary in different cell function through specific subsets of mRNA's'

1.2.7.2.4 eIF. G the interaction of .IF4G is phosphorylated at several distinct sites, which increases the binding of mRNA to the 43s eIF4G with the cap binding protein eIF4E, and stimulates phosphorylation correlates with preinitiation complex (Morley eî al., l9g1).Increased oIF4G phosphorylation modulates eIF4F levels an increase in eIF4F formation, suggesting that eIF4G by the 4E-BP's which compete (Bu et at., 1993) however, this interpretation is complicated stimulation (Haghighat et al" 1995); for binding and are also phosphorylated after cell 'IF4E (Pause et a1.,1994)' translation' via the poliovirus infection results in a specific inhibition of cap-dependent

1993)' Both of the cleavage products are cleavage of eIF4G by a viral protease (Gradi et al', with oIF4A and eIF3 (Lamphear et al'' stable, with the c-terminal fragment able to interact (Borman eî al',I99','t); (ohlmann et al'' 1995) and function in internal initiation of translation fragment does not function in cap- I996);(Pestova et al., I996a). However, the C-terminal

with the N-terminal fragment (Lampheat et dependent translation, as eIF4E remains associated

at., 1995); (Mader et a\.,1995)'

12 1,.2.7.3 Structural features regulating translation

Structural features in the 6RNA can regulate translation both positively and negatively, dependent on location and the stability of the structure. mRNAs with a high potential to form stable secondary structures in the 5' UTR tend to be translated inefficiently

(Kozak lggg); (Kozak 1gg1). This effect is position dependent, particularly for secondary

(Kozak 1991)' This suggests structures that form in close proximity to the 5' cap of the 6RNA

mRNA is more that the initial binding of initiation factors or the 40s ribosomal subunits to the

the ribosome is sensitive to impairment than subsequent scanning (Kozak 1991). In fact, once

(Kozak 1989), however the bound it has a considerable ability to penetrate secondary structure

when located presence of a very stable stem loop (-50/61 kcal/mol) can block translation even

downstream of the cap (Kozak 1989); (Kozak 1991)'

The presence of upstream AUG or CUG codons in the 5'UTR of the message can add or further complexity to translation efficiency. Some 5'UTRs that contain upstream AUG

CUG codons that are not followed by in frame stop codons are not generally utilised as a

do translation initiation codon (Kozak 1989); (Kozak 1991). However, several mRNAs

produce full-length proteins from alternative AUG, or CUG codons' A well-characterised

is an mRNA which utilises this mode of producing several proteins from the single transcript

AUG and FGF related protein, Int-Z.During development, the mRNA utilises both an initiator

protein produced an upstream initiator CUG to synthesise an N-terminal extended protein. The

from the CUG is targeted to the nucleus, while the AUG-initiated protein is shuttled to the

endoplasmic reticulum and golgi (Acland et aI',1990)'

proteins can regulate translation by interacting with target sequences within the

5'UTR. The iron regulatory protein (IR.P) can repress translation initiation of ferritin synthesis (reviewed in Hentze by binding to a hairpin loop structure in the 5'UTR of the ferritin mRNA 13 etal.,Igg6).ThebindingsiteforlRPistheironresponseelement(RE)'whichislocatedat a relatively early mRNA-dependent step in the 5' end of the mRNA, suggesting it inhibits of the 43S pre-initiation complex to the translation initiation. The IRp inhibits the binding mRNA(Grayetal',lgg4).onlyasmallnumberofmRNAsexhibitthisformoftranslation (Schafer et al'' 1990)' mouse superoxide suppression, including Mst87F (Kempe et a|.,1993); of poly(A) binding protein (de Melo Neto dismutase (Gu et at., L996) and the auto regulation et a\.,1995). in translational control and can Elements in the 3' UTR have also been implicated

Translational control has been observed repress or activate translation (ostareck et al.,lggl)' the 3' UTR of the message' Reporter gene with the lipoxygenase gene via sequences within in early ervthroid cells if lacking the 3' UTR' studies show gene expression is not increased

that have the ability to increase or decrease This indicates there are regions within the 3' UTR

1997)' translation rates when required (Ostareck et al''

1 v the the variation of the cap- There are cuffently three different models explaining initiation, re-initiation and discontinuous dependent scanning model. These include reaky

scanning or shunting.

1.2.8.L LeakvInitiation model relating to the choice of initiation Leaky initiation is a variation of the scanning

codon.Ingeneral,thefirstAUGencounteredbyascanningribosomeisselectedasthesiteof AUG or non-AUG initiator codon may initiation (Kozak 1983); (Kozak 1987)' However, an

in a poor context (Kozak 1984); (Kozak 1989); be inefficiently recognised or ignored if it lies 14 (Kozak1984);(Kozak1986),orislocatedclosetothe5'cap(Kozak1991).Inefficient 43S pre-initiation complexes recognition of an initiator codon results in a portion of continuing to scan and initiating at a downstream site'

1.2.8.2 Re'Initiation mechanism where a second Re-initiation is a relatively rare and inefficient initiation open reading frame' By initiation event occurs following the translation of an upstream are dicistronic or polycistronic. A definition, re_initiation can only occur on mRNAs which which contains two open reading genuine dicistronic *RNA has been reported in Drosophila,

the downstream open reading frame is by frames, however it is not clear whether translation of lgg7)' It remains to be determined re-initiation or internal ribosome entry (Brogna et al', initiation machinery remain associated with which, if any, of the components of the translation

reading frames' the mRNA after translation of upstream open

L.2.8.3 Ribosomeshuntine described as ribosome shunting' Another deviation from the scanning model has been bind in a cap-dependent jumping or repositioning. Ribosomes utilising this mechanism

a stretch of the 5'UTR to resume scanning mechanism, commence scanning, but then bypass described for the 35S mRNA of the at a downstfeam position. This mechanism was first now extended to other viral transcripts, cauliflower mosaic virus (Futt erer et ar., 1993) and has (Yeuh et aI', 1996) and heat-shock protein 70 including the adenovirus major late mRNAs but requires specialised sequence (yeuh et a:.,2000). The mechanism of the shunt is unclear,

elements.

15 Chapter 1 Introduction

r.2.9 Entrv

Internal ribosome entry was first reported in picornaviral 5'UTRs as these mRNAs do

(Pelletier not contain the common 5' cap structure like cellular mRNAs (Jang et rt\.,1988); et at., ISBB). Furthermore, translation of picomaviral mRNA is unaffected when oIF4E is

This led sequestered, suggesting an alternative mechanism of initiation (Canaani et al',1976)' to the discovery of cap-independent translation initiation, or internal ribosome entry. This was verified when the insertion of the EMCV and poliovirus 5'UTRs into the intercistronic region

of a dicistronic mRNA resulted in the expression of the second cistron (Jang et al., 1988);

(pelletier et aI., lgSS). Essentially all the translation initiation factors required for cap-

dependent translation are also required for IRES mediated translation, with the exception of

eIF4E, PABP and a large N-terminal region of eIF4G (Hellen et a1.,2001).

The dicistronic assay has been used to identify a number of internal ribosome entry

sites (IRES) in viral genomes. There are few, if any, convincing similarities between IRES

elements in terms of sequence, size, or structure. The implication is there is no universal

mechanism of internal ribosome entry, or that an elusive Shine-Dalgarno sequence, perhaps

(Pestova et al., created by secondary or tertiary structure, cannot be easily detected in IRESs

1ee8).

The mechanism utilised by the picornaviral mRNAs to initiate internal translation is

split into two groups. One group contains the encephalomyocarditis virus (EMCV)' foot and

mouth disease virus (FMDV) and Theiler's murine encephalomyelitis virus (TMEV), where

ribosomes bind directly to the AUG codon, without scanning (Kaminski et al., 1990);

(Kaminski et al., 1994); (Pilipenko et al., t994). The second group contains poliovirus and

rhinovirus, where ribosomes bind approximately 160 nucleotides upstream of the AUG and

16 1

(Hellen I99Ð; (Ohlmann et aI', hence require some ribosome scanning (Belsham 1992); et al',

1999); (Pestova et a1.,1994). the rate of A number of cellular proteins have been shown to act in trans to affect protein (PTB) has been translation of the picornaviral mRNAs. Polypyrimidine tract binding (Kolupaeva et al', 1996); shown to bind to all picornaviral 5'UTRs, with varying effects

(Kaminski ¿/ (pilipenko et a1.,2000). pTB results in a modest activation of the EMCV IRES

is significantly aI., l99g); (pestova et a1.,1996b), but the requirement of PTB for initiation (Kaminski et al', 1998)' increased upon mutation of residues adjacent to the initiation codon factors bind the These observations are more consistent with a model in which trans-acting

is able to bind initiation 5,UTR to help attain, or maintain an active conformation in which it

factors (Kaminski et a\.,1998).

L.2.L0 Cellular IRES elements in their Like the viral RNAs, a number of cellular mRNAs posses structural features

cap-dependent scanning 5,UTRs which make them unlikely to be translated efficiently by a 5' when cap- mechanism. Moreover, a few cellular mRNAs are translated preferentially

elements in cellular dependent translation is impaired, which led to the discovery of IRES the immunoglobulin mRNAs. The flrst IRES element discovered in a cellular RNA, was translational activity heavy chain binding protein, Bip. It was discovered due to its continuous (Macejak and Sarnow, l99l) (Yang et al',1991)' in poliovirus infected cells, at a time when host cell translation had ceased growing (See table Although the list of cellular mRNAs containing IRES elements is capture 40S 1.1), little is known about the mechanism by which cellular IRES elements although there subunits. The structural features of cellular IRESs remains largely unknown, different mechanisms now appears to be three distinct groups of cellular IRESs, which utilise 17 TableL.1

Properties of S'UTRs containing internal ribosome entry sites

A list of all reported mRNAs containing internal ribosome entry sites is presented. The

length of the 5'UTR (NCBD is indicated. The number of in-frame' AUG or CUG codons

within the 5'UTR with the authentic start codon are shown. The role of the IRES and the

GC content (7o) is also shown. GC% Reference IRES 5'UTR Size AUG CUG Role 1 Differentiation 47' Pozner 2000 AMLl/RunX1 446 0 39 Ye 97 Antennapedia 1164 2 0 Development 67 Coldwell2000 Apafl (human apoptotic protease activating factor 1) 578 0 4 67 Pinkstaff 2001 ARC (Rat activity-regulated cytoskeletal) 188 0 2 Heatshock 63 Coldwell2001 BAG-1 (RAPa6; HAP46) 224 0 0 63 Johannes & Sarnow 98 BiP/GRP78 593 3 6 77 Pinkstaff 2001 CaM kinase ll 122 0 1 amino acid availabilitY 57 Fernandez 2001 cat-1 (cationic amino acid transporter 1) 148 0 2 68 Sehgal 2000 c-jun 306 0 0 65 Nambru 97 I 2OO1l StoneleY 98 c-myc 398 0 2 apoptosis 64 Hudder & Werner 2OOO lWerner 2000 Connexin 32 (human gap junction protein) 127 2 1 43 Shiavi 1999 Connexin 43 200 0 1 2 79 Johannes 99 Cyr61 (human secreted heparin binding protein) 224 0 56 Pinkstaff 2001 Dendrin 147 0 1 57 Johannes & Sarnow 98 elF4G1 369 2 6 66 Baraille 99 alPha 363 1 3 30 lzquierdo & Cuezva 2000 F1-ATPase beta 46 1 0 57 Vagner 95 / Arnaud 99 Fibroblast growth factor-2 384 2 2 56 Chiang 2001 FMRl (fragile X mental retardation) 381 0 0 0 3 68 Chappel 2000 Gtx (homeodomain Protein) 196 58 Buck 2001 HIV-1 gag RNA 118 0 1 56 Giraud 2001 lnsulin-like growth factor 1 receptor 108 0 0 49 Negulescu 98 KV.14 (K+ Channel) 1 156 7 11 4 52 Carter 2000 La autoantigen 466 2 35 Pinkstaff 2001 rat microtubule associated protein 2 60 0 1 62 Stoneley 2001 Mnt 406 0 5 4 42 Kim 98 Myt-2 1156 2 69 Maser 2001 NBSI (DNA repair) 134 0 1 72 Pinkstaff 2001 Neurogrannin / RC3 208 1 0 70 Watada 2000 Nkx 6.1 (homeodomain transcription factor) 789 0 2 49 Jopling 2001 N-myc 71 0 0 59 Lauring 2000 Notch 2 511 0 10 48 Oumard 2000 NRF (huma NF-kappa B repressor protein) 150 1 1 1 Cell Cycle 65 Pyronnet 2000 ODC (Ornithine decarboxYlase) 300 I Miskimmins 2001 211 0 0 50 p27 (cyclin dependent kinase inhibitor) Cornelis 2000 273 0 4 CellClcle 75 p5Spitslre Protei n kinase Henis-Korenblit2000 171 0 1 apoptosis 51 p77 IDAPï / NATI 71 Bernstein 97 1022 1 4 Differentaition PDGF2 (c-sis) Johannes 99 364 0 2 75 Pim-1 ChaPPel 2001 721 5 3 Mild hypothermia 43 Rbm3 Shiroki2002 132 1 3 42 Smad 5 38 7hou2ÛO1 529 1 3 TtF 4631 Ye 97 1164 2 2 Development 39 Ultrabithorax Stein 98 / Akiri 98 / Miller 98 / Huez 98 / 2001 1016 1 5 Hypoxia 64 Vascular endothelial growth factor A Holcik 99 993 11 6 Stress, þoPtosis 30 X-linked inhibitor of aPoPtosis Zhou2OO'l 163 1 1 37 Yap-1 Chanter 1 T

in the recruitment of the 40S ribosome. The first of these involves the formation of secondary structure, and is the major determinant of IRES function. It is believed the RNA forms a structural scaffold in which precisely positioned RNA tertiary structures contact the 40S ribosomal subunit through a number of specific intermolecular interactions (Hellen et aI.,

2001). This scenario seems likely for a number of cellular IRES elements due to the finding that non-contiguous sequence elements display IRES activity, suggesting multiple regions are required in the formation of the IRES element. Le and Maizel have predicted that a Y-shaped

double hairpin structure followed by a small hairpin constitutes an RNA motif that can be

found upstream of the start codon in a variety of cellular IRESs (Le et aI.,1997).

The second type of IRES element involves a pyrimidine stretch in the 5'UTR, which

upon deletion ablates IRES activity. This type of IRES has been well characterised in the

XIAp IRES, where a small stretch of pyrimidines is essential for IRES function (Holcik et al.,

Lggg).Furthermore,Laautoantigen, has been shown to bind to this 5'UTR and is essential for

IRES activity (Holcik et aL,2000). The function of La autoantigen may be the stabilisation of

secondary structure in the 5'UTR to attain or maintain an active conformation of the IRES.

The final class of IRES element is exemplified by the gene, Gtx. IRES activity was

shown to function through a critical 9-nucleotide stretch, which showed 1007o

complementarity to a region of 18s rRNA (Chappell et a1.,2000a). Cross linking resulted in

the identification of 40S ribosomal subunits binding to this 9 nucleotide stretch, suggesting a

direct mechanism of ribosome binding to initiate translation (Hu et aI',I999a).

1.2.LL Vascular Endothelial Growth Factor IRES

The VEGF 5'UTR was suspected to contain an IRES due to its length (1016 nt) and a

requirement for its synthesis under cellular stress conditions. This was first shown by 18 1 troducti

mRNA was efficiently translated polysome analysis where the translation status of the VEGF of the message was unaltered by under normoxic conditions, however the translation status

(Stein et aI',199S)' This finding indicates that hypoxia, despite a global translational decrease

supporting efficient translation despite its the vEGF message contains sequences capabre of

the VEGF 5'UTR was not inhibitory to long and cumbersome 5',UTR. Further indication that

of a reporter gene' In all cases' the translation was determined by cloning the 5'UTR upstream control reporter (Akiri et a\" 1998); VEGF 5'UTR reporter gene was at least as efficient as the These findings indicate the (Huez et a1.,1998); (Miller et a1.,1998); (Stein et al., 1993)'

programs indicated the potential potential for the 5'uTR to contain an IRES, and RNA folding

toformthe"Y"structure,asdescribedbyLeandMaizel(1997)' was inserted in the Dicistronic reporters were constructed where the VEGF 5'UTR cistron measured' The vEGF 5',UTR intercistronic region and activity of the downstream the presence of an IRES (Akiri e/ could enhance translation of the second cistron, indicating

(Stein et al" 1998)' a:.,1998);(Huez et al.,1998); (Miller et al'' 1998);

SinceVEGFsynthesisisrequiredunderhypoxicconditions'duringwhichglobal

examined under low oxygen to determine if translation rates are suppressed,IRES activity was that the IRES activity was not the IRES was activated (Stein et al., 1998). It was found however expression from the IRES increased under hypoxic conditions (stein et a1.,1998), translation. This indicates the IRES is was not compromised when compared to cap-dependent

translation of vEGF is efficient' even most likely acting as a protective mechanism, to ensure

is not optimal' under conditions where cap-dependent translation of the VEGF 5'UTR were made To determine the location of the IRES, serial deletions

shows IRES activity is negligible from and IRES activity was determined. The mouse 5'UTR is found from nucleotides 474 to the nucleotide 343 to g39, however harf of the IRES activity 19 Chanter 1 Tn

the first start codon (I023),indicating that the other half of the IRES activity must come from

343 nucleotides (Akin et al., 1998). Interestingly, fusing the first 32 and the last 132 nucleotides of the mouse 5'UTR together results in the formation of a "super" IRES, which

(Stein et al., shows 4.5 fold higher activity than the entire VEGF 5'UTR in a dicistronic assay

any 1993). Deletion of either or both of these regions from the 5'UTR completely abrogates

IRES activity, indicating that these regions are essential for IRES activity. Both of these

be regions are predicted to form secondary structure in the "Y" shape IRES which appears to

important for IRES function in several cellular 5' UTR's. The human VEGF 5'UTR has been of more carefully defined showing there is a gradual loss of IRES activity from any deletion

the 5,UTR. It has been shown that the human 5'UTR contains two independent IRES

1038, and elements. IRES A lies at the 3' end of the 5'UTR, between nucleotides 745 and

IRES B lies between nucleotides 91 to 483. IRES B appears to be utilised to initiate translation

(Htez et of a longer species of VEGF protein which initiates just 3' of the IRES B boundary

a1.,1998) although this is yet to be shown. This suggests that each of these two independent

IRES elements in the VEGF s'UTR may function to synthesise different species of VEGF

protein.

Several RNA binding proteins have been implicated in regulating IRES activity. One

of the most common proteins is polypyrimidine tract binding protein (PTB), which has been

thought shown to be important in the function of several viral IRESs (Huez et a1.,1998)' It is

these proteins act as translation chaperones by binding to the secondary structure in the 5'UTR

and stabilising it, such that it forms a favourable template for the binding of the translation

initiation factors or ribosomes directly. Two proteins thus far have been reported to bind to the

5'UTR of VEGF, one of which binds within the region of IRES A. This protein, termed p100,

(Huez has yet to be identified, however its binding correlated with IRES activity et a1.,1998). 20 1

the s'UTR, pTB has also been shown to bind to a region in the first 475 nucleotides of may be involved in however its binding appears to be independent to IRES activity' PTB regulating other mechanisms of VEGF expression, such as mRNA stability'

1.2. c-mvc

has a long and Like some other genes that are involved in cell growth, c-myc mRNA

gene, giving rise to highly structured 5'UTR. Multiple transcription start sites exist within the

and 2'0 kb four transcripts (P0, Pl,P2 and P3) with sizes of approximately 3'1,2'4,2'25 1985)' The c-myc respectively (Battey et aI., 1983); (Bentley et aI., 1986); (Yang et al',

(Nanbru et al.,1997); (Stoneley er 5,UTR was found to contain an IRES in a dicistronic assay Deletions from aI., I99g).To define the boundaries of the IRES, serial deletions were made' the larger the deletion the 5, end resulted in a loss of activity, which was more dramatic with from the 3' end indicated of the 5'uTR (Nanbru et aI.,1991); (Stoneley et a\.,1998). Deletion

however further deletion of the last 56 nucleotides of the 5'UTR contained no IRES activity, nucleotides 1-340 of the 5,UTR resulted in a loss of IRES activity, indicating the IRES spans

the viral IRESS, where 3', the 396 long 5',UTR (Stoneley et aL,1998). This is in contrast to (Borman et al', 1992); deletion of the 5'urR results in complete ablation of IRES activity

(Borman et a\.,1995); (Pelletier et a\.,198S); (Reynolds e|a\.,1995).

1998); During apoptosis, eIF4G is cleaved (Bushell et al., 1999); (Clemens et al',

resulting in the suppression of global translation rates, however,

Although c-myc protein expression of the c-myc IRES is unaffected (Stoneley et a\.,2000a)'

it does not appear to levels are maintained during apoptosis due to IRES-mediated translation, likely that c-myc is be required ¡or cell death (Stoneley et a1.,2000a). It therefore seems

cell death' involved in the transcriptional activation of other genes, resulting in 21 1

protein expresslon can occur There have been reports showing that increased c-myc

t996); (West et al', 1995)' For example' in from aberrant translational regulation (Paul in et al., is up to a 20-fold increase in c- cell lines derived from patients with multiple myeloma, there (Paulin et al" 1996)' This myc protein levels that occurs by a translational mechanism in the region of the c-myc DNA that increased expression correlates with a c-T mutation IRES is more active in a number of cell contains the IRES (Paulin et al.,lgg6).The mutated The c-T mutation results in the lines, ranging from 1.5 to 6 fold (chappell et al',2000b)' of the IRES (Chappell et al',2000b)' The stabilisation of a stem loop structure in the 3' end result in an enhanced interaction of RNA increased expression from the mutated IRES may This is the first example of a mutation in a binding proteins to the structurally altered region. initiation by internal ribosome entry' eukaryotic IRES that results in increased translation

L.3

vessels are formed from a pre- Angiogenesis is the process by which new blood into four stages' Firstly' endothelial cells existing blood vessel. This process can be divided In the second stage, endothelial cells are activated from a quiescent to a proliferative state.

basement membranes occurs at proliferate and thirdly, selective degradation of the vascular

proteases and collagenases' The final stage surrounding extracellular matrix by the release of

Angiogenesis is essential in reproduction, involves lumen formation and capillary branching. requirements in the adult' under most development and wound repair, however, has limited controlled' however under some circumstances, the pfocess of angiogenesis is tightly

pathologicalconditions,suchastumourgrowth,rheumatoidarthritisandauto-immune

to the disease state (Folkman et al" 1992)' diseases, new capillary blood vessels contribute

22 l.3.L Angiogenesis and cancer nutrients and oxygen by Tumours the size of t-2 mm in diameter can receive all

of an adequate blood supply diffusion, however further growth depends on the development Once a blood supply has through angiogenesis (Fidler et al', 1994); (Folkman 1995)' the tumour has the ability to established in the tumour, further growth can occur and

shown to play a crucial role in the metastasise. Two prominent angiogenic growth factors factor (bFGF) and vascular activation of endothelial cells are basic fibroblast growth activity of both bFGF and vEGF endorhelial growth factor (VEGF) (].iilo.¡- et al., I99l)' The

suggesting that tumour growth may be have been shown to be inhibited by antibodies in vivo, Blocking bFGF antibodies limited by the obstruction of angiogenesis (Kim et aI., 1993). inhibits r007o of growth, inhibits j\To of growth, whereas blocking VEGF antibodies of angiogenesis (Kim et al'' indicating tumours rely on VEGF as an essential component

re93).

a simple up-regulation of The switch to the angiogenic phenotype involves more than inhibitors, naturally present angiogenic activity. concomitant down-regulation of endothelial (Folkman L994)' in cells before and after they become neoplastic is also necessary

1.3.2 Role of VEGF in aneioeenesis

a potent angiogenic growth In vivo, vascular endothelial growth factor (VEGF) acts as

(Kim et aI., 1993); (Shweiki et al',1995)' factor as well as a blood vessel permeabilising agent VEGF may also act as a vascular In addition to its role as an endothelial cell-specific mitogen,

vessels as well as immature survival factor as it is required for the maintenance of tumour

blood vessels (Alon et aL,1995)'

23 in the initial During development, angiogenesis is an essential process that is involved

(Ferrara et al', L996); (l{tm et establishment of the vascular system (carmeliet et al., 1996); result showing aI., 1993). The importance of the VEGF gene is exemplified by the of blood vessels, heterozygous vEGF deficient (vEGF*f) embryos have abnormal formation

embryos die in utero resulting in embryonic lethality. Homozygous vEGF-deficient (VEGF/)

(Carmeliet et al', 1996); (Ferrara at embryonic days 8.5 to 9.5 due to a more severe phenotype et aL.,1996).

pathological processes As well as a developmental role, VEGF has been implicated in such aS coronary occlusive disease, rheumatoid arthritis, auto-immune disease and

(Plate et al.,1992); (Shweiki et al', tumourigenesis (Benjamin et at.,I99l); (Kim e/ al.,1993);

lees).

1.3.3 Activation of VEGF expression bv hvpoxia

All organisms posses mechanisms to maintain oxygen homeostasis to enhance sufficient ATP to survival. Lack of oxygen (hypoxia) can result in a failure to generate

generation of reactive maintain essential cellular functions, however hyperoxia results in the Thus, cellular oxygen intermediates which potentially can damage membranes and DNA.

physiological range' oxygen concentrations must be tightly regulated within a naffow mRNA VEGF protein expression is increased in the hypoxic regions of tumours, with

severe hypoxia levels found to be highest in cells that presumably experience the most normal oxygen (Shweiki et aL,1995). This effect is rapidly reversible, with cells returned to

synthesis (Benjamin e/ conditions rapidly degrading their mRNA and ceasing VEGF protein

al.,1997).

24 Chanter 1 Tnfrorhlction

VEGF and erythropoietin (Epo) appear to share a conìmon oxygen-senslng mechanism, suggesting they also share common cis regulatory elements (Goldbetg et al.,

Igg4). The Epo 3' UTR sequence, that binds Hypoxia lnducible Eactor (HIF-1), is also found in the VEGF 5'-flanking region (Liu et al,, 1998) (see Section 1.3). The 5'-flanking region of

VEGF contains a HIF-I binding site and disruption of this core site eliminates hypoxia inducibility (Levy et a1.,1995); (Liuet at., 1998). The overall increase in VEGF mRNA in response to hypoxia, which is of the order of 10 fold, cannot be accounted for by

transcriptional activation alone with the remaining increase due to the stabilisation of the

normally labile VEGF mRNA (Dibbens et aL,1999); (Ikeda et a1.,1995); (Levy et a1.,1995);

(Stein et a1.,1995).

The normal lability of VEGF mRNA is thought to be in part due to regions in the 3'

UTR including the AREs (Lagnado et aI., 1994) (see Section I.I.2.3). There are multiple

elements in the VEGF 6RNA which are capable of independently destabilising the mRNA (3'

UTR, 5' UTR, and coding region) whereas all three regions are required for stabilisation of the

VEGF 6RNA in response to hypoxia (Dibbens et al., L999). This indicates VEGF mRNA is

regulated by a complex mechanism in low oxygen conditions, where multiple regions are

required for stabilisation of the message.

1.4 Hvpoxia Inducible Factor

Although cells have numerous adaptive responses to hypoxia, a single transcription

factor, Hypoxia Inducible Factor-l (HIF-l), appears to play a critical role in cellular and

systemic oxygen homeostasis during both development and in adults.

25 Chanter 1 Tnfrodlrction

The HIF-I transcription factor is a ubiquitously expressed heterodimeric protein, consisting of an cr and B subunit. The HIF-1p subunit is identical to the previously characterised Aryl Receptor Nuclear Translocator (ARNT) protein (Discussed in section

I.4.2), containing a basic helix-loop-helix motif (bHLH), which is known to mediate dimerisation and DNA binding in a large number of transcription factors. The members of one subfamily of these bHLH factors also contain an additional dimerisation motif, the PAS domain (acronym referring to PER, ARNT, SnvÐ. HIF-lct contains a bHLH motif and PAS

domain and is the critical hypoxia-induced subunit. The expression of the HIF-14 subunit is

tightly regulated by cellular oxygen concentration, with protein levels increasing exponentially

as oxygen concentration decreases (Jiang et al., L996a); (Semenza et aI., L996); (Wang et al.,

I995a). The regulation of HIF-1cr by oxygen is discussed in Section I.4.6.

1.4.1 HIF-I tareet eenes

The discovery of HIF-1 as a global regulator of oxygen homeostasis initially resulted

from analysis of the molecular mechanisms by which Epo gene expression was activated in

response to hypoxia. The identification of a DNase I hypersensitive site in the 3' flanking

region of the Epo gene led to the characterisation of a 50 sequence that functioned as

a hypoxia response element (HRE) (Semenza et al',1991)'

The discovery that HIF-1 is a global regulator of oxygen homeostasis, and not only a target for

Epo expression resulted from studies showing HIF-I was ubiquitously expressed, including

both Epo-expressing and non-expressing cells (Beck et al., 1993); (Wang et al', I993a)'

Subsequent studies have revealed essential HIF-1 binding sites in genes encoding proteins that

mediate a variety of essential adaptive responses to hypoxia (Table 1.2). HIF-1c)[ deficiency is

26 Table L.2

HIF-1o target genes.

A list of HIF-1 target genes reported to date is presented' HIF-l Tarset Genes Reference

Metabolism

Adenylate Kinase-3 (Wood et a1.,1998) Aldolase A (Iyer et aL, L998); (Ryan er al., 1998) Aldolase C (Iyer et al.,1998) Carbonic Anhydrase (Wykoff et al.,20OO) Enolase-1 (Iyer et al., 1998) (Wood et aI'' 1998) Glut-1 (Iyer et al., 1998); (Ryan e/ al., 1998); Glut-3 (Iyer et ø1.,1998) Glyceraldehyde-phosphate dehygro genase (lyer et a|.,1998); (Wood et al.,1998) Hexokinase-1 (Iyer et al., 1998) Hexokinase-2 (Iyer et ø1., 1998) Lactate dehydrogenase A (lyer et aI., 1998); (Ryan er al', 1998) Phosphofructokinase L (Iyer et al., t998) (Iyer et ctl.,1998); (Ryan e/ aI.,1998) Phosphoglycerate Kinase- 1 (iarmeliet et at.,1998); Pyruvate Kinase M (Iyer et aI.,1998)

Vascular Biologv

Aderenergic Receptor (Eckhart et al.,1997) Endothelin-l (Ht et aL,1998) Flr-1 (Gerber et a1.,1997) Nitric Oxide SyntYhase II (Palmer et a1.,7998) PAI-1 (Kietzmann et aL,1999) (Iyer (Ryan et al',1998) Vascular Endothelial Growth Factor (Carmeliet et at.,1998); et al',1998);

Proliferation / Survival

Adrenomedullin (Cormier-Reg ad et al., 1998) pzl (Carmeliet et aL,1998) . (Bhattacharya 1998) P35"1 Insulin-like growth factor binding protein-1 (Tazuke et a1.,1998) Insulin-like growth factor binding protein-2 (Feldser et a1.,1999) Insulin-like growth factor binding protein-3 (Feldser et al.,1999) Insulin-like growth factor 2 (Feldser et al.,1999) Transforming growth factor-P3 (Scheid et a\.,2002) Cyclin G2 (Wykoff et al.,2OOO) NIP3 (Bruick 2000); (Sowter et a\.,2001) (Wood et aI.,1998) Heme-Oxygenase- 1 (Lee et aI.,1997);

Iron / Erythropoiesis

Erythropoietin (Iiang et al.,1996) Transferrin (Rolfs et a1.,1997) Ceruloplasmin (Mukhopadhyay et al., 2OOO) Transferrin Receptor (Tacchini et aL.,1999)

Apoptosis

RTP8OI (Shoshani et aI.,2002) genes encoding both glucose associated with decreased expression of a number of different

mediates increased transporters and glycolytic enzymes (Iyer et al.,I998a). Therefore, HIF-I

oxygen availability (via oxygen delivery to cells (via Epo and vEGF), adaptation to decreased hypoxia (via glucose transporters and glycolytic enzymes) as well as apoptosis in severe (Ryan et al'' RTP801) (Carmeliet et a1.,1998); (Iyer et al., 1998a); (Maltepe et aI', 1991); r998)

and named Factors related to HIF-lcr that dimerise with ARNT have been described, (HIF-Iø like HIF-2cr (also known as EPAS1 (endothelial PAS domain protein 1), HLF

2)) and HIF-3cr (Ema facror), HRF (HlF-related factor), MOP2 (Member of PAS superfamily

et (Tian et al'' et al.,1997); (Flamme et aL,1997); (Gu et at.,1998); (Hogenesch al',1997);

domains well IggT). HIF-2ø is highly similar to HIF-lcr with the structure of functional

is not as widely conserved (O'Rourke et a|.,1999); (Wiesener et a\.,1998), however HIF-20

detected, suggesting a distinct role for each protein in hypoxic conditions'

1.4.2 HIF.1ß / ARNT

ARNT was first identified as a binding partner for the aryl hydrocarbon receptor

(AHR), which is also a bHLH protein (Hoffman et al., 1991). The AHR and ARNT

the conversion of possibly heterodimer is involved in the xenobiotic response, which involves

fatal compounds into water-soluble chemicals that can be readily excreted'

and protein ARNT expression is unaffected by oxygen tension, with both the mRNA

found predominantly in levels unaltered by hypoxic stress (Kallio et al.,lgg7)' ARNT is also

to the formation of the nucleus (Ikuta eî a1.,1998), suggesting the HIF-lcr subunit is limiting

the translocation of the HIF- the HIF-l complex. The formation of the HIF-1 complex requires

27 I

of its lcr protein from the cytoplasm to the nucleus to allow dimerisation and transactivation target genes.

1.4.3 HIF-14 mRNA exPression

is unaltered in The mRNA level of HIF-1c(, in both normoxic and hypoxic conditions

1996), indicating either most cases and most tissues (Pugh et al', 1997); (Wood et al',

gene expression. There translation or protein stability as the major regulation point in HIF-lcx

mRNA in response to is however, conflicting data demonstrating an increase of HIF-lcr This increase in hypoxia (Bergeron et al., 1997); (Wiener et al., 1996); (Yu et aI., L998)'

there is no evidence expression is likely to occur at the level of mRNA stabilisation as 'RNA the 3' UTR contains of induction of the human HIF-I promoter in response to hypoxia and

(Wang et al'' 1995a)' several AU-rich elements (Iyet et al., 1998b); (Lagnado et al',1994);

t.4.4 The HIF-lcr

HIF-1g is a 826 amino acid, evolutionary important protein, which is highly

between mouse' rat conserved, displaying greatet than 907o amino acid sequence similarity (L\ et 1996); (Luo et al'' and human (Hogenesch et al., 1997); (Ladoux et aI., 1997); al',

protein is almost undetectable 1997);(Wang et al.,I995a);(Wenger et al.,1996). The HIF-1cr HIF-10 in normoxic cells, however when cells are transferred to hypoxic conditions,

hours of continuous hypoxia' expression is detected within 30 minutes, peaking between 4 to 8

a half-life of less than upon re-exposure to oxygen, HIF-1cr protein levels rapidly decay, with

is discussed in section 5 minutes (wang et a\.,1993b). The regulation of HIF-lcr by oxygen

r.4.6

28 1,.4.5 Dimerisation and DNA bindine domains

Dimerisation of HIF-1g and ARNT is required for binding to the DNA promoter of its

the target genes. The N-terminal region of the HIF-lcr (which contains the HLH domain and

N-terminal half of the pAS domain) is critical for dimerisation with ARNT (Jiang et al',

1996b). Dimerisation with ARNT induces a conformational change in HIF-lcx,, giving it a structure capable of binding to DNA. The amino acids 1-407 of ARNT are sufficient for dimerisation, but lack high affinity DNA binding suggesting interactions between the C- terminal regulatory domains of HIF-lcr and ARNT may affect the conformation and DNA binding activity of the N-terminal bHLH-PAS domains (Kallio et a\.,1991)'

The core binding site sequence, 5'-CGTGC-3' or 5'-CGTGNC-3', which are located in

single rhe DNA major groove are involved in DNA binding of HIF-1 (Okino et al',1998). A methylation of the 5' cytosine residue results in the loss of HIF-I binding in vitro and results in the lack of expression of HIF-I target genes (Wenger et a1.,1998).

L.4.6 Protein stabilitv and deeradation

The HIF-lcr subunit is predominantly regulated by oxygen tension in vitro and in vivo.

HIF-lcr protein levels are increased dramatically in the absence of oxygen, with little change

in levels indicating regulation is either at the level of protein synthesis or the inhibition 'RNA of protein degradation (Gradin et aI., t996); (Huang et al., 1996) (summarised in Figure 1.2).

The first demonstration that HIF-lcr was rapidly degraded in normoxic cells by the ubiquitin i

proteasome pathway was by Salceda and Caro (1991) who showed HIF-lcr levels are

increased in a ubiquitin-proteasome deficient cell-line. The use of specific ubiquitin-

29 Figure L.2

Regulation of HIF-1c expression by cellular Oz conc€ntration

Shown schematically is HIF-1cr with its basic helix-loop-helix (bHLH) motif, PAS domain, oxygen dependent degradation domain (ODDD) and C-terminal transactivation domain

(CAD). A. Oz availability determines the rate at which HIF-lcr is subject to degradation. In normal oxygen conditions, HIF-lcr is subject to prolyl and aspariginyl hydroxylation by

PHD's 1-3 and FIH-I respectively. Proline hydroxylation, which occurs at amino acid residues 402 and 564 in the ODDD, is required for the interaction of HIF-lcr with VHL, which recruits elongins B and C, Cullin 2 (Cul2) and RBXI to constitute a functional E3 ubiquitin-protein ligase complex. Ubiquitination of HIF-14 targets the protein for degradation by the 265 proteasome. Asparagine hydroxylation at amino acid 803 in the

CAD leads to displacement of the p300 and CBP co-activators. B. In hypoxic conditions, hydroxylation of the proline and asparagine residues is prevented, which blocks recognition by VHL and allows interaction with the co-activators p300/CBP, respectively. Escaping prolyl hydroxlation, prevents ubiquitination and degradation, leading to its translocation to the nucleus and formation of the HIF-1 heterodimer with ARNT. A I 402 564 803 826 ol)Dl) CAD

P P A OH OH OH T CBP/p300

HIF-Icr \" Degraded via Ubiquitin / proteasome sYstem

B

803 826 1 402 564 oDt)t) CAD IP IP IA OH OH OH

803 826 1 402 564 oDt)l) C

P P A II I Recognitionby VHL CBP/p300 { Protein stabilisation and Increase in transactivation potential prevention of degradation degradation (Huang et al', proteasome inhibitors further established this as the mechanism of tee6). is responsible for Truncation mutants have revealed the C-terminal half of the protein for regulation of its instability in normoxic cells, with amino acids 401-605 being sufficient 1998); (Jiang et al'' protein stability in response to oxygen concentration (Huang et al''

1997a).

1.4.7 Deeradation of HIF-La is mediated bv VHL with the von- The von-Hippel Lindau (VIil-) tumour suppressor protein is associated Germline inactivation Hippel Lindau cancef syndrome and the majority of kidney cancefs' predisposition to tumourigenesis mutations of VHL are associated with a dominantly inherited

the kidney' VHL germline in the central nervous system, retina, pancreas, adrenal gland and

B07o of renal-cell mutations are quite rare, however vHL is inactivated in approximately

carcinomas (Maher et a1.,1991).

HIF-lcr protein stability is regulated by increases in ubiquitination and proteasomal that lack a functional degradation under normal oxygen conditions. Renal-cell carcinomas role in the VHL protein fail to degrade HIF-10, suggesting that VHL plays an important fact, VHL has been oxygen-regulated proteolysis of HIF-lct (Mazure et al', 1996)' In

and has been shown implicated in the pfocess of protein ubiquitination (Stebbins et aI',1999),

1999). to form complexes with HIF- 1 a in vivo (Maxwell et al. , complex' VHL has been shown to be a component of an active E3 ubiquitin-ligase (Iwai et al',1999); which transfers ubiquitin onto substrates that are destined for degradation forming the (Lisztwan et aI., Iggg). vHL is associated with elongins B and c and cullin-2

30 1

There are vHL-BC-Cul2 complex (summarised in Figure 1.2) (Kaelin, Jr. eî aI., 1998)'

tumours, one of which is located several mutational hotspots of the vHL-BC-cul2 complex in the p-domain of vHL in the p-domain of vHL (Kaelin, h. et aL,1998). Mutations within

Complementary data shows result in complete loss of all binding to HIF-1cr (Ohh et al',2000)' (ODDD) (amino vHL binds to HIF-Iü through the oxygen dependent degradation domain proteasomal degradation acids 530- 652), and targets it for ubiquitination and ultimately

(Huang et a\.,1998); (Ohh er a\.,2000)'

once HIF-10 is ubiquitinated, it is degraded by the ubiquitin dependent 265

composed of two large pfoteasome, which is a ubiquitous multicatalytic protease complex complex (Gerards et al" complexes: the 20S catalytic cofe complex and thel9S regulatory

proteasome core consists of an cr- 1998); (Kallio et al., 1999); (Sutter et a1.,2000). The 20S

interact with HIF-lcx (Cho et al'' type subunit, PSMA7, which has been shown to physically

of HIF-14, amino acids 2001). This interaction involves two co-operative binding regions

binding however' is not regulated by 726-7g5 and 401-603, which lies within the ODDD. This complex involved in normoxic oxygen tension, suggesting it is not part of the recognition

hepatitis B virus X-protein' has degradation (Cho et aI.,2O}I).In addition to HIF-lcr, human (Hu et rtl" L999b)' also been shown to bind PSMA7, resulting in its rapid degradation

proteins, such as HIF-lcr' may be Therefore, it appears that the binding of PSMAT with other

in part to facilitate rapid degradation of these targets'

.4.8

via its interaction The regulation of HIF-lcr expression in normal oxygen conditions HIF-lct in hypoxic cells with vHL is well depicted. In hypoxia, the lack of ubiquitination of

31 1 on

recognise HIF-lcr, appears to be governed by the inability of the VHL-BC-cul2 complex to of indicating the VHL-HIF-1cr interaction is controlled by post-translational modifications

(Jaakkola et al',2001)' HIF-1cr which are oxygen dependent (Figure 1.2) (Ivan et a\.,2001);

were To determine the region of VHL binding to HIF-lcx, deletion mutants of HIF-lcr

VHL and mutation made. Amino acids 556-5 75 ofthe HIF-lcr protein were capable of binding

(Ivan (Iaakola et of the conserved pros6a totally abolished interaction with VHL et al.,20oI); normoxic a1.,2001); (yu et a1.,200I). The Pros6a residue is modified by hydroxylation in a family of conditions by a prolyl-4-hydroxylase (Jaakkola et al., 20oI), which belongs to

use oxygen as a hydroxylases that are2-oxoglutarate-dependent and related dioxygenases, and

provides a co-substrate (Annunen et a\.,1998). Therefore, this family of proline hydroxylases

protein' link in the understanding of how oxygen regulates the stability of the HIF-1o

(2001) searched To identify the prolyl-4-hydroxylases that modify Pro564, Epstein et al

the 2- the C. elegans genome database for sequences which may encode a member of

gene, which had oxoglutarate-dependent oxygenases superfamily. This search led to the egl-9

also not been assigned a known function, however like VHL mutants, egl-9 mutants found in constitutively expressed HIF-lcr (Epstein et a1.,2001). Three egl-9 homologs are

and 3. Each mammals, designated pHD (Prolyl-hydroxylase domain containing protein) 1,2

(Bruick 2001); of the hydroxylases is capable of hydroxylating HIF-lcx, at Pros6a et al', site of (Epstein et a1.,2001), whereas only PHD1 and2 can hydroxylate Proa02, a second

that the proline hydroxylation (Epstein et a1.,2001). The investigators were able to show

modification of HIF-lcr by pHDl is dependent on oxygen concentration, indicating oxygen as

by rate-limiting for proline hydroxylase activity. Thus, proline hydroxylation of HIF-lcr

32 1

provides a mechanism of oxygen PHD1, 2 and3 of the oxygen dependent degradation domain transcription factor' sensing which leads to the appropriate expression levels of the HIF-1

L.4.9 Transactivation properties of HIF-l'cr

of mediating HIF-lcx truncation mutants reveal the last 436 amino acids is capable

deletions reveal the last 295 hypoxia-induced transactivation (Jiang eî a|.,1996b). Further

(TAD) a number of cell lines' amino acids function as a powerful transactivation domain in dramatically increased in Moreover, the ability of this region to activate transcription is

specific transcriptional hypoxic cells, demonstrating the expression of the HIF-1cr protein and

oxygen concentration activity of the HIF-10 TAD are independently regulated by cellular

has been delineated to (Jiang et al.,I991a); (Li et aI., 1996); (Pugh et al., lgg7). The TAD (786-826). The region contain 2 regions of activation, rhe TAD-N (531-575) and TAD-C TAD function, intervening these 2 TAD,s functions as an inhibitory domain that represses

particularly under non-hypoxic conditions (Pugh et al'' 1997)'

1 1 TAD-C (CAD) 846- Lando et aI., (Z11z)recently discovered a peptide sequence in the

16 Da' indicating the YDCEVNVPVPGSSTLLQGR-846, which contains an extra peak of when the cells are grown in presence of an extra oxygen atom. This extra 16 Da peak is lost to contain the extra oxygen hypoxia or treated with hypoxic mimics. Asparagines't was found by the ability of the atom and was also regulated by a yet unidentified aspariginyl hydroxylase

the same extent as hydroxylase inhibitor, di-methyl-oxylglycine, to activate HIF-10 to

hypoxia (Lando et a1.,2002)'

33 Chanter 1 Tnfrodrrction

The HIF-1g TADs interact with co-activators, which have both structural and catalytic roles. The co-activators CBP and p300 appear to mediate the effects of many transcriptional activators, including HIF-lcx, and direct interaction between p300 and HIF-lcr has been demonstrated (Arany et aI., 1996); (Ebert et al., 1998); (Kallio et al., 1998). CBP/p300 contains 2 transcriptional adapter zinc-binding G^Z) motifs (Ponting et al., 1996), which

function as the sites of interaction with the CAD (Arany et al., 1996); (Kallio et aI., 1998).

Crystal structure revealed a highly intimate complex in which HIF-lcx wraps almost entirely

around the TAZI domain with the hydroxylated asparagine residue located on the cxB-helix

and deeply buried in the protein-protein interface (Dames et a\.,2002)'

Asparagine hydroxylation silences the COOH-terminal transactivation domains of

HIF-lq by prevenring its interaction with CBP/p300 (Figurc 1.2) (Lando et a\.,2002); (Sang

et a1.,2002). During hypoxia, the non-hydroxylated CAD is free to bind the CH1 domain of

CBP/p300 and to assemble transcriptional co-activator complexes. Furthermore, mutations in

the CHl domain of p300 abrogate the transactivation activity of HIF-14 (Gt et a1.,2001);

(Kung et a\.,2000); (Sang et a\.,2002)'

FIH-1 (factor-inhibiting HIF-1) has been found to interact with both HIF-10 and VHL,

and can inhibit the HIF-lcr transactivation domain in normoxic conditions (Mahon et al',

2001). FIH-1 can bind to HIF-10¿ in the inhibitory domain (amino acids 576-784), however

optimal binding requires additional amino acids within the CAD. FIH-I has similar features of

a 2-oxoglutarate-dependent protein hydroxylase, like PHD1, 2 and 3 which are responsible for

the hydroxylation of the proline residues regulating HIF-lcx protein stability (Section 1.4'8)

(Lando et a1.,2002). This inhibition of HIF CAD function by FIH-I dependent asparaginyl

hydroxylation appears to function by inhibiting association with co-activators, such as p300.

34 1

1..4.11, Activation of HIF'Lcr bv other mechanisms

1.4.11.1 ERK / MAPK PathwaY conditions due to It is well established that HIF-lcr protein levels increase in hypoxic

phosphorylation HIF-lcr residues in response to post_translational modifications. changes of

the protein (Salceda et al'' hypoxia are required to increase the transactivation potential of to hypoxia' suggesting a I997);(Wang et ø1.,1995b). The levels of ERK increase in response of HIF-14 (Minet ¿r possible involvement of the ERITMAPK pathway in the phosphorylation nucleus and have an at.,2000). Furthermore, ERK was shown to be translocated to the stability nor DNA binding was increased activity in hypoxia, however no effect on HIF-lcr

HIF-1cr is phosphorylated by p42lp44 observed (Minet et a;.,2000). Further analysis revealed

(Vagner eî a\" 2001)' MAPK, however p38 and JNK were not able to phosphorylate HIF-lcx involved in the This indicates a specific pathway of the ERK/\4APK pathway is is unknown, although the phosphorylation of HIF-14. The role of HIF-lcr phosphorylation conformational change' evidence points towards transactivation, which may involve a

providing a cleft for the interaction of CBP/p300'

1.4.11.2 p53 genes can It is well established that mutation of oncogenes and tumour suppressof

(Jiang et al', 1997); (Maxwell er result in changes in the expression and/or activity of HIF-lcx The most frequently mutated tumour al., 1999); (Ravi et a1.,2000); (ztjfrldel et a1.,2000). of HIF-I' The human p53 suppressor protein, p53, can also negatively affect the activity factor that mediates cellular tumour suppressor gene encodes a multi-functional transcription (reviewed in (Giaccia et al'' fesponses to diverse stimuli, including DNA damage and hypoxia

35 Chanter I Tnfrorf uction

1993)). Furthermore, p53 is involved in mediating hypoxia-induced apoptosis (Graeber et aI., ree6).

Ravi er al (2000) have shown p53 inhibits HIF-I activity by targeting the HIF-Iø subunit for Mdm2-mediated ubiquitination and proteasomal degradation. Conversely, the loss of p53 enhances hypoxia-induced HIF-1a levels and augments HlF-l-dependent expression of

VEGF in tumour cells. In addition, p53 limits hypoxia-induced expression of HIF-lcx by promoting its ubiquitination and proteasomal degradation (Ravi et a\.,2000)' This mechanism

is distinct from the proposal that p53 inhibits HIF-I transactivation by competition for the

CBp-p300 co-activator (Blagosklonny 2001) and is analogous to the proposed role of the VHL

protein (Maxwell et al., L999).

r.4.tt.3 n14Am Tumour

p53 can affecr the srability of HIF-lcr through the regulation of the HDM2 proto-

oncogene ((Ravi et a1.,2000) and secrion I.4.II.2). HDM2 is an E3-ubiquitin ligase that

inactivates p53 primarily by accelerating its degradation through the ubiquitin-proteasome

pathway (Honda et al., Ig97). HDM2 can form a ternary complex with HIF-10 and p53,

which may preferentially promote the degradation of HIF-1o (Ravi et a\.,2000). The p14ARF

tumour suppressor protein has recently been recognised as an important negative regulator of

HDM2 (Sherr et a1.,2000). p14o"o can bindHDM2 and facilitate its translocation from the

nucleus to the nucleolus, which may prevent HDM2 from promoting the degradation of p53,

resulting in high p53 activity and an increase in HIF-1o protein levels (Lohrum et a\.,2000).

36 1

1.4 .4 PI3 rnase v

by a number of growth The phophatidyl-inositol-3-kinase (PI3K) pathway is activated insulin (Guthridge et a\" 2000)' factors receptors, including IL-3, GM-CSF, PDGF, EGF and and phosphatidylinositol PI3K catalyses the conversion of phosphatidylinositol 4-phosphate phosphatidylinositol 3'4'5 tri- 4,5 bi-phosphate to phosphatidylinositol 3,4 bi-phosphate and These products are allosteric phosphate respectively (reviewed in (Cantley et at', 1999))' phosphorylate and activate Akt activators of phosphatidylinositol-dependent kinase-1, which and FRAP' an (protein kinase B). Targets of Akt include BAP, an inhibitor of apoptosis'

and cell-cycle progression activator of p70'6k, which is required for ribosomal biosynthesis PTEN' which (Reviewedby (cantley et aL,1999)). This pathway is negatively regulatedby phosphatidylinositol 3'4'5 tri- dephosphorylates phosphatidylinositol 3,4 bi-phosphate and

phosphate.

activation of the EGF / PI3K / Increases in HIF-lcr protein levels can result from either (Zhong et al'' 2000); Akt / mTOR pathway, or loss of PTEN activity (Jiang et al',2001); mechanisms, as mRNA (Zundel et a1.,2000). These increases are due to post-transcriptional

and may involve either an levels remain unaltered (Jiang et al',2001); (Zundel et al',2000), Both modes of regulation have been increase in translation rates or increased protein stability. (2000) showing Akt implicated in increasing HIF-Iü protein levels, with Zundel et al with vHL, whereas Laughner stabilises HIF_1o protein by possibly interfering its interaction

activation of the PI3K et al (2000) implicated an up-regulation of HIF-lcr translation upon HIF-1ct translation upon pathway via FIER2 signaling. The mechanism of up-regulation of of 4E-BP1 by mTOR activation of pI3K is unknown, but may involve the phosphorylation which is known to (Gingras et al., 1999b); (Hara et aL, 1991); (Peterson et al', 1999),

37 positively regulate translation. Therefore, it seems possible that activation of the PI3K

affect on pathway may up-regulate the translation of the HIF-lcr protein rather than a direct protein stabilitY.

t.4.r2 Role of HIF- 1a in

To determine the role of HIF-lcr in development, HIF-lcr gene knockout embryonic

(Carmeliet et a1.,1998); stem (ES) cells were generated and injected into mouse blastocysts

embryos (Iyer et at., I998a); (Ryan et a1.,1998). Although Hifla*^ mice are viable, Hifla-/-

arch and neural arrest in development by E9.0 and die at E10.5 with cardiac, vascular, brachial

regions (Iyet et tube defects and extensive cell death, especially in the brachial and cephalic similar at.,lggga); (Kotch et al.,lggg); (Ryan et a\.,1998). Hifla-/- and Hifla*/* embryos are

is a marked in morphology and vascular development at E8.5-88.75, however by F9'25 there

embryo regression of blood vessels and numerous enlarged vascular structures in the Hifla-/-

is (Iyer et aI., 1998a). During the period of E8.5 and E9.5, HIF-lcr protein expression

(Iyer et aI., increased, which is the period where malformations appear in the Hifla-/- embryos

as VEGF 199ga). Vascular defects observed in Hifla-/- are also seen in VEGF/- embryos

expression is not induced by hypoxia in Hifla/- ES cells (Carmeliet et al., 1996); 'RNA (Carmeliet et al., 1998); (Ferrara et al., 1996); (Iyer et aI., 1998a); (Ryan et al" 1998)'

pRNA to Surprisingly, Hifla/- embryos show an increased expression of VEGF compared

wild-type embryos (Kotch et aI., lggg). The mechanism of increased vEGF mRNA

a known expression in Hifla-/- embryos probably involves activation by glucose deprivation,

regulator of VEGF (Iyer et al.,I998a); (Kotch et al',1999)'

38 Chaoter I Tntroduction

1.4.13 Role of HIF-I in disease

The regulation of oxygen homeostasis is of utmost importance for human development and physiology. Hence, cellular and systemic oxygen concentrations are tightly regulated via short and long acting response pathways. Many diseases, including heart disease, cancer, and cerebrovascular disease have this delicate balance disrupted (Folkman 1994); (Folkman 1995).

A key step in the progression of all these diseases involves the process of angiogenesis, where

VEGF levels increase in response to cellular hypoxia (Allalunis-Turner et al., 1999);

(Chiarotto et a1.,1999); (Damert et aI.,1991); (Ikeda et a1.,1995); (Levy et al',1996); (Plate

et al.,1992); (Shweiki et al.,lgg2). The binding of HIF-1 to the promoter region of VEGF is

essential for transcriptional activation (Blancher et aL, 2000); (Forsythe et al', 1996);

(Goldberg et aI., I9g4). Hence, the progression of certain disease states, such as tumour

angiogenesis, is a result of the increase in activity of HIF-1.

t.4.14 Role of HIF-1 in cancer

Adaptation of cancer cells to hypoxia is critical for tumour growth, as neither primary

tumours nor metastases will grow beyond a volume of several rnm' in the absence of

vascularisation (Folkman 1994); (Folkman 1995). Tumour hypoxia may develop by either a

high rate of cellular proliferation that outpaces the rate of angiogenesis, or defective tumour

microcirculation, where cells adjacent to blood vessels may be hypoxic (Helmlinger et aI',

l99i); (Vaupel et a\.,19S9). Therefore, the progression of tumour grade to a lethal phenotype

is likely to involve the adaptation to hypoxia. Overexpression of HIF-I in cancer cells can

result from tumour hypoxia, loss of tumour suppressor gene function, or oncogenic activation

(Blancher et a1.,2000); (Carmeliet et aI., 1998); (Elson et a1.,2000); (Fang et a1.,2001);

39 1

(Ratcliffe et a\" 2000); (Ryan (Haddad et a:.,2001); (Jiang et al.,1997b); (Kotch et a\.,1999); et a\.,1998); (Semenza 2000a)' VEGF expression is Experimental data suggests in tumour angiogenesis, increased (Folkman et al., 1992); (Folkman 1994); required to initiate and sustain tumour growth the synergistic effects of tumour (Folkman 1995). These increases in vEGF levels result from

hypoxiaandtumourspecificgeneticalterations(Benjaminetal',1997);(Gerberetal''1998); 1998); (Pages et aL' 2000)' (Haddad et a1.,2001); (Mazure et al., 1996); (Okada et al., of both high vascular density and Therefore, most solid tumours that contain characteristics

(Jin et at,, 2000); (saaristo et al'' 2000); tnmour hypoxia often result in poor clinical outcome

(Vaupel et a1.,1989).

AnexampleoftheroleofHlF-lintumourangiogenesisisinhumangliomas,wherea ¿¡d HIF-lcx levels is observed significant correlation between tumour grade, vascularisation

shows characteristics of rapidly (zagzag et a:.,2000). In particular, glioblastoma multiforme resulting in extensive necrosis' proliferating tumour cells which outstrip their blood supply high levels of HIF-tcr protein The viable tumour cells surrounding necrotic regions express

(Plate et al" L992); (Shweiki er (Zagzag et a:.,2000); (Zhong et al',2000) and VEGF mRNA responding to hypoxia by at., I992).This pattern of expression suggests the tumour cells afe

HlF-l-mediatedVEGFexpressionasdemonstratedintissueculturecellsandmouse (Iyer et al', 1998a); (Maxwell ¿t xenografts (carmeliet et a1.,1998); (Forsythe et al',1996);

at.,1997);(Ryanetal.,1998).Furthermore,thesegliomascontainnumerousmutationsthat

prEN (Ishii er ar., 1999) or activate inactivate tumour suppressor genes, including p14o^t and Mutations in oncogenes and oncogenes, including EGFR and MDM2 (Holland et al',1993)'

40 1

expression, tumour suppfessor genes which had previously been shown to increase VEGF have now been shown to function through the induction of HIF-1.

growth in The loss of function of a tumour suppressor gene is a known cause of tumour

which certain cancers. An example of this is the role HIF-I plays in hemangioblastomas, high level of produce an abnormally high level of VEGF 6RNA (Zagzag et al',2000)' This

is induced by VEGF is responsible for the high vascularisation seen in these tumours, which

Hippel-Lindau gene an overexpression of HIF-1a due to a functional inactivation of the von

in normoxic (Gnarra et aI.,lgg4). Since loss of VHL results in constitutive HIF-1cr expression

in these tumours conditions, this provides a mechanism for the high level of VEGF expression

(Maxwell et a|.,1999)'

or In most human cancers, overexpression of HIF-lcr occurs as a response to hypoxia

greater than genetic alterations (Zhong et a1.,2000). HIF-lcr overexpression is detected in

least a third of all brain 907o ofcolon, lung, ovary, prostate, skin and stomach cancers and at

observed in cancer cells and breast cancers (Zhong et a\.,2000). The degree of overexpression

progression' provides strong evidence supporting an important role for HIF-lcr in tumour

provide novel Therefore, therapeutic strategies designed to inhibit HIF-I activity may hypoxic than normal approaches in cancer treatment. Additionally, since cancer cells are more

effects, cells, it is possible that tumour cells could be killed without major systemic side

increase tumour especially under conditions where other agents could be added to further

hypoxia, such as angiogenic inhibitors (Boehm et al.,1997); (Jekunen et al',1991)'

41 lIn

1.5 Proiect Rationale

An objective of our laboratory over the years has been to investigate the mechanisms

to hypoxia' Most of regulating the expression of vascular endothelial growth factor in response VEGF gene the emphasis has been on understanding post-transcriptional regulation of mRNA in normoxic expression, particularly mechanisms involved in the lability of the

focus our laboratory has conditions and the hypoxic stabilisation of the message. Another of

discovered the presence of an been on alternative mechanisms of VEGF translation, where we internal ribosome entry site (Miller et aL,1998)' region of When hypoxia-inducible factor-l was discovered to bind to the promoter

(Forsythe et aI', VEGF in hypoxic conditions and lead to an induction of VEGF transcription regulation under tgg6), we wanted to investigate the possibility of post-transcriptional

hypoxia indicated hypoxic conditions. Gene expression analysis of HIF-lcr in response to

mRNA levels were unaffected by hypoxia, suggesting post-transcriptional mechanisms This led us to primarily regulate its expression (Semenza 2O0Ob); (wiener eî al., 1996)'

long and G + c rich, a investigate the properties of the HIF-Iü 5'UTR, which was quite 'We regulation. also wanted to characteristic of several cellular mRNAs subject to translational

of HIF-lcr, and whether determine the effect hypoxic stress had on the translational efficiency during periods of other mechanisms were utilised to ensure its correct expression levels

hypoxic stress. in the During the course of this work, several signaling pathways were implicated

(Fatyol al., 2001); accumulation of the HIF-1a protein in non-hypoxic conditions et

are also implicated (Laughner et aI.,2O0l); (Minet et a\.,2000). since many of these pathways (Lin et al'' with translational up-regulation (Beretta et al., 1996b); (Gingras et aI'' 1998);

42 Chanter 1 Tntroduction

Igg4),I wanted to determine whether the HIF-lcr 5'UTR was involved in the accumulation of the protein.

Previous work in the laboratory determined that the VEGF 5'UTR contains instability elements (Dibbens et aI., lggg), and Huez et al (2001) showed the presence of two internal ribosome entry sites. I therefore wanted to determine whether there was a link between mRNA

instability and IRES activity of the VEGF s'UTR, and if this type of regulation is common

with 5'UTRs containing an IRES.

The specifÏc aims of this proiect are:

1) To investigate whether the HIF-lcr 5'UTR is inhibitory to translation.

2) To determine whether the HIF-1o 5'UTR contains an internal ribosome entry site.

3) To characterise regions of the HIF-lcr 5'UTR that contain IRES activity.

4) To compare the translation efficiency of HIF-lcr to housekeeping genes, B-actin and

GAPDH under normoxic and hypoxic conditions.

5) To investigate the effect of hypoxia and other cellular stresses on HIF-lcr IRES activity,

and determine whether this effect is specific for hypoxically regulated genes, or a common

feature of cellular IRESs.

6) To determine whether the PI3K signaling pathway regulates HIF-10 IRES function in

non-hypoxic conditions.

7) To establish a potential link between VEGF mRNA instability and IRES activity and

whether this effect is specific for VEGF, or a common mechanism for cellular IRESs.

43 Chapter 2 aterials ds

i ¡*

i¡ I ¡ t

I I I a Chaoter Materials and

2.1 Chemicals reasents and

The following chemicals were obtained from Sigma Chemicals: agarose (type 1),

ampicillin, ATP (disodium, grade I), BSA, bromophenol blue, xylene cyanol, DTT, ethidium

bromide, lysozyme, SDS, tRNA, DEPC Triton X-100 Heregulin-cx and nitrophenolphosphate'

TEMED, acrylamide and bisacrylamide were purchased from BioRad Laboratories' Agar,

foetal calf serum, ammonium persulphate, LipofectAMINE 2000 and Trizol were purchased

from Gibco BRL. Trypsin, DMEM, Met-free DMEM, L-glutamine, Penicillin, streptamycin

were purchased from CSL laboratories. Phenol was purchased from WAKO Pure Chemical

Industries Ltd. Random primed oligonucleotide Northern probe kit and ribonucleotide

triphosphates were purchased from Amersham Pharmacia Biotec. Proteinase K and glycogen

were purchased from Boehringer Mannheim. Dual luciferase reporter assay kit was purchased

from promega Corporation. ExpressHYBrM was purchased from Clontech. Wortmannin and

purchased L.g2g4OOZ were purchased from Cayman Chemicals. All other fine chemicals were

from Merck.

2.2 Enzymes and protein molecular weiqht markers

All restriction enzymes were purchased from New England Biolabs or Promega. T4

DNA ligase andT4 polynucleotide kinase were purchased from New England Biolabs. Calf

intestinal phosphatase and RNaseA were purchased from Boehringer Mannheim' RNasin,

Re-DNase, SP6 RNA polymerase and T7 RNA polymerase were purchased from Promega

Corporation. BenchmarkrM prestained protein ladder was purchased from GIBCO BRL.

44 2 S

2.3 o

Adelaide, All oligonucleotides used in this study were purchased from Geneworks, and mutagenic South Australia. The restriction sites in the oligonucleotide are underlined

afe as follows' changes are in bold. The sequences of the oligonucleotides

RLprobe 5' CCGGATCCGCAAGAAGATGCACCTGATG 3'

FFprobe 5'CCCAA ATCTCTTCATAGCCT 3'

HIF-1 5' GTACTAGTGAGTGCACAGAGCCT 3' -, HIF2 5'GTA -)

HIF3 5' GTACTAGTGACAGAGCCGGCGTT 3'

HIF4 5' GT -)

HIF5 5' GAATTCCATGGGGTGGGAGGCGGG 3'

HIF6 5' GAATTCCATGGCCGCGCGCGGAGAAA 3'

HIFT 5' GAATTCCATGGCCCCGGGCTCGCTCG 3'

HIFS 5' GAATTCCATGGCGAATCGGTG 3'

HIF68 5' GTACTAGTCAGGCCCTGACAAGC 3'

HIFdeIPPT

3' 5, CCGCCTCTGGACTTGACTATGTATCCGCGCGCGGGACAGAG

HIFdeIPPTREV

3, 5, CTCTGTCCCGCGCGCGGATACATAGTCRRCTCCAGAGGCGG

48124V 5' CGGCCTCTCCATGGCCGAGCTAGC 3' 4glzTv5,GTCCGTCAGCGCCCATGGTCCGATGCA3' 5OI26V 5' CCTTGACTTCTCCATGGAGCTCTTGA3' 5II32V 5' TCTAGAAGCTTCAGAGAGAAGTCAAGGAAGAG3'

45 52132V 5' TCTAGAAGCTTCGATCTTGCATCGGACCAGGT3' 53/33V 5'TCTAGAAGCTTGGCCCTGGAGAGGCCGGGGCCC3' 23135V 5' TCTAGAAGCTTAGCGCAGAGGCTTGGGGCAGCCGA3'

24t2gv5,GAATTCCATGGTTTCGGAGGCCGTCCGGG3, 5'V48 5' ATACTAGTGAGAGAGACCGGTCA 3' 3'V48 5' ATCCATGGCCGCCTCACCCGTCC 3'

XIAPSHind5,CCCAAGCTTGCTGTTGTCCCAGTGTGA3'

XIAP3WT 5' CATGCCATGGCTTCTCTTGAAAATAGGACT 3'

XIAP3MUT 5' CATGCCATGGAAAAAGAGAACATTATATTA 3'

XIAP5Spe 5'GG 3

Myc5Hind 5' CCCAAGCTTAATTCCAGCGAGAGGCAGA 3'

Myc3Nco 5' CTAGCCATGGTCGCGGGAGGCTGCT 3'

2.4 Radiochemicals 35S-methionine(l'175 (4,000 Ci/mmol), L- [cr-32p]Lnp (3,000 Cilmmol), [Y-32p]¡.tp Cilmmol) were purchased from Geneworks'

,i!1

2.5 Buffers and Solutions

(DEPC), 100 rnM MgCl2, 10x DNase buffer 100 mM Tris pH 8'0

(DEPC), 10 mM DTT. Stored at -20oC.

10 mM EDTA, 50 mM sodium 10x MEN 200 mM MOPS,

acetate pH 7.0.

46 (vlv) Formaldehyde sample buffer 1.2x MEN, 8.47o (vlv) formaldehyde ,647o

formamide.

Formamide loading buffer 957o (vlv) formamide, 20 mM EDTA, 0'057o

bromophenol blue, 0.057o xylene cyanol FF.

Stored at -20"C.

Hybridisation Solution 40 mM PIPES PIJ6.7 (DEPC), 400 mM NaCl

(DEPC), 1 mM EDTA (DEPC), 80Vo (vlv)

formamide. Stored at -2OoC.

6x Type III Loading solution 0.257o (w/v) bromophenol blue,I'2íVo xylene

cyanol FF,307o glycerol. Stored at -20"C.

Phenol Includes 0.L%o 8-hy droxyquinoline. Stored,

equilibrated with appropriate buffer, in the dark

at 4oC.

Proteinase K Solution 0.2 M TrisHCl, pH 7'5, 25 mM EDTA, 0.3 M

NaCl, 2Vo SDS,200 ¡t"glml proteinase K.

pglml RNase A, 50 mM TrisHCl, 10 mM Qiagen Pl buffer 100

EDTA, pH 8.0. Stored at 4"C.

47 2

200 mM NaOH, 1% SDS Qiagen P2 buffer

3.0 M potassium acetate, pH 5.5. Stored at Qiagen P3 buffer

4"C.

750 mM NaCl, 50 mM MOPS, l57o ethanol, Qiagen QT buffer

pH 7.0, 0.157o Triton X-100.

1.0 M NaCl, 50 mM MOPS, 15% ethanol, PH Qiagen QC buffer

7.0

MNaCl, 50 mM TrisHCl, L57o ethanol, Qiagen QF buffer I.25

pH 8.5

(DEPC), 5 mM EDTA RNase buffer 10 mM TrisHCl PH 7'5

(DEPC), 200 mM NaCl (DEPC), 100 mM LiCl

(DEPC).

7.5 (DEPC), 50 mM MgCl2, 5x T7 RNA polYmerase buffer 200 mM Tris-Cl, pH

(DEPC), 10 mM spermidine. Stored at -20oC'

Tris-Cl, pIF'7 .5 (DEPC), 30 mM MgCl2 5x SP6 RNA PolYmerase buffer 200 mM

(DEPC), 10 mM spermidine' Stored at -20oC' 48 2

mM RNA probe elution buffer 0.5 M ammonium acetate (DEPC),0.1

EDTA (DEPC),0.1% sDS.

citrate pIJ7.4 lx SSC 150 mM NaCl, 15 mM sodium

lx TAE 40 mM Tris, 20 mM acetic acid,0.9mM EDTA'

1 EDTA lx TBE 50 mM Tns,42 mM boric acid' mM

EDTA. TE 10 mM TrisHCl P}J7.5,0.1 mM

TELT 50 mM TrisHCl plF'7.5,62.5 mM F,DTA,0.47o

Triton X-100, 2.5M LiCl.

2.5 mM 5x SEAP buffer 1 M TrisHCl pH 8.8, 1.4 M NaCl,

MgCl2.

L-agar L-broth, L.57o (wlv) agar. Autoclaved

Luria broth (L-broth) 170 mM NaCl, 0.57o (wlv) yeast extract,l'07o

(w/v) tryptone or peptone. Autoclaved.

49 2 S

(wlv) yeast extract, Super-broth 3.27o (wlv) bacto tryptone, 2.0Vo

0.57o (wlv) NaCl. pH at 7 '2. Atttoclaved.

2.6 E. coli

galK16, rpsl, MC1061 F-, hsdR2, arcDl39,A(araABC-let)7696, LLacXT4 galEl5, galU,

(Stf), (rr mr*), mcrA, mcrB1, thi thi-|, DH5cr supB44\,, IacIJl1g(pSOIacZLMIS), hsdRl7, rec|l, endAAl, gyr\96,

relAI

2.7 Plasmids

pGl3-Promoter firefly luciferase vector (Promega Corporation) (Figure 2'1)

pRL-TK Renillaluciferase vector (Promega Corporation) (Figure 2.2)

pRL-CMV Renillaluciferase vector (Promega Corporation) (Fi gure 2'3)

pBluescript II SK(+) cloning vector (Statagene) (Figure 2'4)

pGFJM'42 cloning vector (Clontech) (Fi gure 2'5)

pfGH reporter vector (Lagnado et al., L994) (Figure 2'6)

2.8 cell lines

NIH3T3 Mouse fibroblast

HeLa Cell line derived from a patient with breast carcinoma

HEK293 Human embryonic kidneY

MCFT Cell line derived from a patient with breast carcinoma

50 Figure 2.1

Plasmid map of the luciferase expression vector pGL3

The plasmid map of pGL3 is shown. The luciferase coding region (Firefly Luciferase) is

shown in red. The synthetic poly(A) upstream of the SV40 promoter and Luciferase

poly(A) signal is indicated. The ampicillin resistance cassette and origin of replication (ori)

are also shown. The multiple cloning site is presented. Svnthetic poly(A) signal / trânscriotional pause site Amp' (for baikgrounä reduction)

Kpn 5 f1 ori Sac 11 Mlu 15 Nhe 21 Sma 28 on pGL3-Promoter Xho 32 Vector Bgl óo (5010bP) SV40 Promoter 2202 Sa/ I 2196 BamHl Hind lll245 luc+ SV40late Ncol 278 (for Hpa Xbal 1934 Figure 2.2

Plasmid map of the Renilla luciferase expression vector pRL'TK (Renilla The plasmid map of pRL-TK is shown. The coding region encoding sea pansy

Luciferase) is shown in blue. The HSV TK promoter is illustrated in black and the

and origin luciferase poly(A) signal is indicated in grey. The ampicillin resistance cassette of replication (ori) are also shown. Ampt

or¡ 2223 BamH I SV40 late poly(A) pRL-TK Bgtlt 1 Uectot 1971 Xbal (4045bp)

Rluc HSU TK Promoter T7 Promoter EcoR I 649 Hind lll 760 (1040) Csfií t Nhe I 1024 Figure 2.3

Plasmid map of the Renilla luciferase expression vector pRL'CMV pansy (Renilla The plasmid map of pRL-CMV is shown. The coding region encoding sea region is Luciferase) is shown in blue. The CMV immediate early promoter and enhancer ampicillin illustrated in black and the luciferase poly(A) signal is indicated in grey. The resistance cassette and origin ofreplication (ori) are also indicated' Ampt

2257 BamH I ori SV40 late poly(A) pRL-GMV Bglll 1 2005 Xbal Vector (407ebp)

Rluc CMV lmmediate Eatly 17 Enhancer/Promoter

EcolCR | 725 Hind lll754 1O74 Csp45l Psf I 836 Nhe I 1058 Figure 2.4

Plasmid map of pBluescript SK.

The plasmid map of pBluescript SK+ is shown. The ampicillin resistance gene (Amp'), pUC origin of replication and the multiple cloning site (MCS) is indicated. The multiple cloning site has indicated within it the T7 and T3 RNA polymerase promoters. lÏ [iIe*

omçici{lim 1

il Ëlt pElucetriPt I+l Süc I 30hb rPloc

À'liltlffiÉ Cloning Siir Fo¡¡ion -¡rr'qumcrpülurrt¡ipl ll$l( t+/-l ¡hermr 59[#2ó¡ a{irt t ù*l l¿r,l I Iho I 5ol I r {,r T*r I I I ÅTûAûTTAOTA l pn Fr úñnÊ. rH l",lûlÊ ¡ lVl , Ibo I I kû.| fsql tîçñ |lo Í*'n, 1*' I ll* lll

u | -, -!t!rl,*ht lf4 {F'¡¡ln'fiq¡txtl TIßÍ¡CÍII , CÊ¿GCTITTÛT tE0tËf Figure 2.5

Plasmid map of cloning vector pGEMAZ

The plasmid map of pGEM4Z is shown. The ampicillin resistance gene (Amp') and the multiple cloning site (MCS) is indicated. ssp Xmn I 1939 21 44 Aat ll 2262 Sca I 1820

Nde I sP6 1 start 2511 I EcoR I 7 Nar I Ampt Sac I 17 2563 Kpn I 23

Ava I 23

Xma I 23 pGEM@-¿Z Sma I 25 lacZ BamH I 28 Vector Xba I 34 Q7 a6bp) Sa/ I 40 Acc I 41 Hinc ll 42

Psf I 50 Sph I 56 Hind lll 58 ltt 70 on Figure 2.6

Plasmid map of pfGH

The plasmid map of pfGH is illustrated. The plasmid is as previously described (Lagnado er aI., 1994). The coding region of human growth hormone (HGH) is shown in blue. The chicken fos (c-fos) promoter is illustrated in black and the bovine growth hormone poly(A)

signal is indicated in purple. The ampicillin resistance gene and neomycin (Neo) cassette is

shown in green and red respectively. Amp

Neo pfGH 5635 bp c-fos promoter

Hindlll 634

BGH Poly(A) signal Ncol 651 HGH

Kpnl 313 Chaoter 2 Materials and Methods

2.9 Mini-Pren nurifica of nlasmid DNA (Alkaline Lvsis Method)

A single colony was used to inoculate 3 mls of L-Broth + 100 ttdml Ampicillin and grown overnight in a 37"C shaking incubator. One and a half millilitres of the culture was transferred to a 1.5 ml Microcentrifuge tube and centrifuged at 13000 xg for 20 seconds. (The rest of this method was done at room temperature unless otherwise indicated.) The L-Broth supernatant was completely removed by aspiration and the cell pellet was resuspended in 100

plus small ¡rl of Solution 1 (25 mM Tris-HCL pH 8.0, 10 mM EDTA pIJ7.6,157o Sucrose) a

amount of Lysozyme powder. The cells were incubated for 1 minute then 200 pl of Solution 2

was added (0.2 M NaOH, 17o SDS). The tubes were inverted to achieve mixing and then

incubated for 5 minutes. To this mixture L25 pl of 3 M Sodium Acetate pH 4.6 was added and

again the tubes were inverted to achieve mixing and incubated for 15 minutes. The mixture

was then spun at 13000 xg for 15 minutes to pellet chromosomal and cellular debris. The

supernatant was removed to a new 1.5 ml Microcentrifuge tube, 2 ¡tl of a 10 mg/ml solution of

RNaseA added and incubated, at3l"C for 15 minutes to digest RNA. After incubation 100 pl

of TE buffered phenol and 100 pl of chloroform were added, the tube vortexed briefly, spun at

13000 xg for 5 minutes and the supernatant was removed to a new Microcentrifuge tube. To

precipitate the plasmid DNA 1 ml of I0O7o ethanol was added and spun at 13000 xg for 5

minutes. The DNA pellet was washed with 30 pl of '707o ethanol and spun again for 1 minute.

The DNA pellet was then resuspended in 20 ¡ll of TE Buffer'

2.L0 scale DreDaration of plasmid DNA

This method of preparation of plasmid DNA utilises a modified alkaline lysis procedure

with a commercial resin column (Qiagen, Hilden, FRG) which binds the DNA. A single, fresh

51 C.hanter 2 Materi als and Methods

bacterial colony harbouring the desired plasmid was inoculated into 100 mls of L-broth, conraining ampicillin (100pg/ml) and incubated overnight at 37oC with shaking. The cells were pelleted by centrifugation at 4,200 rpm for 15 min at 4oC in aJA-4.2 rotor. The pellet was resuspended in 4 mls of cold Pl buffer, transferred to a 50 ml centrifuge tube and 4 mls of

P2 buffer added. The cells were mixed by gentle inversion several times and incubated at room temperature for 5 min. 4 mls of cold P3 buffer was added and mixed by inversion. Cell debris and chromosomal DNA were removed by passing the solution through a Qiagen column.

The resulting solution containing the plasmid DNA was applied to a pre-equilibrated eiagen column with 5 mls QT buffer. The column was washed twice with 10 mls QC buffer and the DNA was eluted with 5 mls QF buffer. The DNA was precipitated by the addition of

3.5 mls iso-propanol and centrifugation at 18,000 rpm for 30 min at 4"C in a JA-20 rotor

(Beckman Instruments). The DNA was washed with 707o (vlv) ethanol, dried and resuspended

in 200 pl TE. The DNA was then re-precipitated by the addition of 20 ¡ll 3 M sodium acetàte

min at and 440 ¡tl I00Vo ethanol, chilled at -20oC for 15 min and pelleted at 13,000 rpm for 15

4oC in an MSE microcentaur centrifuge. The DNA was finally washed in 707o ethanol, dried

and resuspended in 100 pl TE and the concentration determined by measuring the OD26s¡¡¡ and

assuming lAU = 50 Pglml.

52 2

2.Il of DNA fragments using the kir Gene

Worksl

A slice of agarose containing a DNA fragment was excised under uv- the agarose gel transillumination and put in a 1.5 ml microtube. DNA was eluted from fragment according to the procedure of the manufacturer.

2.L2 DNA Lieation

plasmid DNA and the DNA insert were digested with restriction enzymes that

volume of 10 pl generated compatible ends. The ligation was routinely carried out in a total (50 mM Tris-HCL pH containing DNA insert:vector of 3:1 (molar ratio), 1 x ligation buffer ligase at room 7.8, 10 mM MgCl2, 10 mM DTT, 1 mM ATP) and 2 units of T4 DNA

temperature for one hour.

L3 for

transformation

a 37"C A single colony was inoculated into 10 mls of L-Broth grown overnight in

inoculate 50 mls of L- shaking incubator. One millilitre of this starter culture was used to of 0'6' The broth and was gfown at 37"C, with shaking until the culture reached OD ooo

and the cells bacteria were pelleted in pre-cooled tubes at 3000 xg, 4oC for 5 minutes

again at 3000 xg, 4oC for 5 resuspended in ice cold 0.1 M MgCl2. The cells were then pelleted

on ice minutes. The pellet was resuspended in 2 mls of ice cold 0.1 M CaClz and incubated

for one hour. (200 ¡rl of cells were used per transformation).

53 Chznter 2 Materials and Methods

2. t4 of bacterial Comneten t cells

For transformation of ligations, the entire ligation reaction was added to 200 pl of

were heat competent cells, gently mixed and incubated on ice for 30 minutes. The cells of L- shocked at42"C for 2 minutes then placed back on ice for 5 minutes. One millilitre

pelleted, Broth was added and incubated at 37"C for 30 minutes. The cells were briefly

100 pg/ml resuspended in a small volume of L-Broth and plated onto L-Agar plates containing

to Ampicillin and incubat ed at 37"C overnight. Transformed colonies were picked and used

shaking inoculate 3 mls of L-Broth with 100 ¡r,g/ml Ampicillin and grown overnight in a37"C incubator. Miniprep purification of the plasmid was then undertaken followed by diagnostic

restriction enzyme digests and sequencing analysis'

2.t5 uencrng

plasmid DNA was isolated and purified as described previously' Sequencing was kit undertaken using the ABI PRISMTM dye terminator cycle sequencing ready reaction

according to the procedure of the manufacturer, Perkin Elmer. Sequencing reactions were

analysed by the sequencing service at the Institute of Medical and Veterinary Science,

Adelaide.

2.16 Polvmerase chain reaction

A standard pCR protocol was used to amplify defined DNA fragments with terminal

restriction sites. The typical reaction contained lx Pfu buffer, 1.25 mM dATP, dGTP, dCTP P/u DNA and dTTP, 100 ng of each oligonucleotide primer, 100 ng template DNA, 2'5 U

54 polymerase. The reaction mix was overlayed with 30 pl mineral oil and subjected to 30-35 cycles of PCR with a Perkin-Elmer cetus DNA thermal cycler.

The typical PCR profile consisted of a 4 min incubation at 95oC to denature the DNA,

at a 1 min incubation at 50oC to anneal primers and template, followed by a 2min incubation

72oC for primer extension. Typically, 35 cycles were performed and was followed by an extension cycle of incubation at'72oC for 10 min.

MCFT

The day before transfection, cells were typsinised and counted. 1 x 10s viable cells were plated per well in 24 wellplates in DMEM and lOTo foetal calf serum. This gave cells at

6O-80%o confluency the day of transfection.

DNA for transfection was prepared by diluting 500 ng DNA into 100 pl serum free

DMEM for each well. 3 pl LipofectAMINE 2000 reagent was diluted into 100 ¡rl of serum

free DMEM in a separate microfuge tube and incubated at room temperature for 5 mins. 100

pl of the LipoFECTAMINE 2000 mix was added to the diluted DNA mix and incubated for a

further 20 mins at room temperature. The DNA-LipofectAMINE reagent complexes were

added to each well, mixed gently and incubated at 37"C at 57o COz.

Six hours post-transfection, the medium was replaced with fresh DMEM. Cell extracts

were assayed for reporter gene activity approximately 24 hours post-transfection.

2.1.8 Stimulation of fos promoter in pfGH

Cells (2 x 106) NIH3T3 cells were transfected with 2 ttg of plasmid (linearised with Scø[¡

by LipofectAMINE 2000 essentially as described in section 2.17), grown for 24 to 48 h and

55 (containing at selected in 400 pg of G418 per ml. After 10 to 12 days the resulting colonies

Cells were least 100 independent clones) were pooled and maintained in 200 pdml of G418'

containing 10 plated at a concentration of 8 x 105 cells per 6 cm dish, and incubated in DMEM

Vo FCS) for 48 hours, Vo FCS for 24 hours. Cells were serum starved (DMEM containing O'5 and stimulation was initiated by the additions of DMEM containing 15 7o FCS' At various

isolated times after stimulation, cells were washed with PBS and total RNA was harvested and

was analysed using Trizol reagent as recommended by the manufacturer (Gibco-BRL). RNA

by RNase protection analysis as described\n section2'22'

2.19 alkaline nhosphatase assaY

Upon induction of cells with media (DMEM supplemented with l0 7o FCS) for

approximately 24 hours,750 pl was removed, incubated for 30 min at 65oC to inactivate

endogenous serum phosphatases and stored at 4"C until ready to assay.

For each sample, 150 pl was added to a well of a96 well titertek plate' To each well,

parts SEAP reaction buffer and 1 part 100 mM alkaline 50 ¡^ú of a mixture containing 4 5x

phosphatase substrate (nitrophenolphosphate) was added, and incubated at room temperature

for 15 min. The absorbance was read at 405 nm in a Biorad model 3550 microplate reader. linear The plate was then incubated at37oC, measuring the absorbance at t hour intervals. A

the relative slope was attained by plotting absorbance vs time, with the slope of the line giving

alkaline phosphatase activity of the sample'

56 Chaoter 2 Materials and Methods

2.20 Dual I erase assav

Cells growntn24 well dishes were harvested by washing in lx PBS and lysed in 1x passive lysis buffer (Promega). Plates were mixed on a rotating platform for 15 mins and lysates transferred to a fresh microfuge tube. Firefly luciferase and Renilla luciferase activities were measured in a luminometer (Model TD 20120; Turner Designs) using the reagents provided with the dual luciferase reporter kit (Promega) as recommended by the manufacturer.

luciferase assay Briefly, 2 ¡tl of cell lysate was placed in a fresh microfuge tube, and 25 ¡il of reagent (LAR II) was added and counted for 10 seconds to measure firefly luciferase activity.

Renilla luciferase activity was measured by the addition of 25 pl of Stop and Glo@ and

counting for 10 seconds. Transfection efficiency and extract preparations were corrected

normalising the data to the corresponding Renilla luciferase activity for each construct.

2.21 in vitro transcri to senerate RNA Drobes

2.21.1 Preparation of plasmid template

sequence to be used as a 2-4 lLg of plasmid DNA, harbouring the desired template

probe, was digested with the appropriate restriction enzyme to create a probe of an appropriate

size. Digestion was monitored by agarose gel electrophoresis and if digested, the solution was

TE-saturated phenol / then made up to 100 ¡r,l with TE and extracted with an equal volume of

chloroform (1:0.8). The aqueous phase was transferred to a fresh microfuge tube and ethanol

precipitated under RNase free conditions. The DNA template was washed in DEPC-treated

707o ethanol, dried briefly and resuspended in 30-40 ¡rl DEPC-treated TE'

57 Chaoter Materials and efhods

2.21.2 In vìtro transcription

Depending on which RNA polymerase was to be used, 2 pú of the appropriate 5x buffer was added to the bottom of an RNase-free microfuge tube, and to this was added 0.5 pl

500 mM DTT, 0.5 pl of 100 pM UTP, 2.0 ¡tl of 2.5 mM CTP, ATP and GTP, 0.5 ¡tl 40 U/pl

pl of RNA RNasin, 2 ¡Ã of 3000Ci/mmol ¡cr-32P1 UTP, 0.5p1 of 2.55 mg/ml BSA and 0.5 polymerase, as appropriate. Finally 1.5 ¡rl of the RNase-free template was added and the reaction was incubated at 37oC for t hour, after which time any remaining DNA was digested

with 1 U RQ-DNase by incubating at 37oC fot a further 15 min.

Most probes were prepared using the conditions described above. For very abundant

mRNA's (e.g. GAPDH), the specific activity of the probe was reduced by increasing the level

of cold UTp in the reaction. For GAPDH a fourfold reduction in specific activity was achieved

by the inclusion of 400 pM UTP in the in vitro synthesis reaction.

2.21.3 of the RNA probes bv PAGE

After RQ-DNase digestion of the in vitro synthesis reaction, RNA was precipitated by

adding 100 pl DEPC{reated TE, 2 ¡tl of 10 mg/ml IRNA, 67 ¡tl of 5 M DEPC-treated

ammonium acetate and 420 ¡tl1007o ethanol and incubated at -20oC for 15 min or ovemight.

The probe was pelleted by centrifugation in an MSE microcentaur centrifuge at 13,000rpm for

25 min at 4oC.

A 6Vo poly-acrylamide / 8 M Urea gel (15 cm x 15 cm) was prepared using a comb

containing 1 cm slots. The pelleted probe was washed with 70Vo ethanol, dried briefly at37oC,

resuspended in 5 pl formamide loading buffer and denatured for 3 min at 100oC. The RNA

58 C.hanfer 2 Mate.rials and Methods

was then loaded onto a pre-electrophoresed gel and electrophoresed until the bromophenol blue dye had just run off the end of the gel.

2.21.4 Elution of the RNA probes from polvacrvlamide

Activated fluorescent markers were used to facilitate the location of the bands corresponding to probe by autoradiography. The autoradiograph was used as a template to cut

out each of the probes and the gel fragment was placed in an RNase-free microfuge tube and

centrifuged briefly. The gel fragment was then mashed with a pipette tip until homogenous

and the probe eluted by adding 300 pl DEPC-treated elution buffer and shakin g for 2 hours at

room temperature.

The eluted probe was separated from the polyacrylamide fragments by centrifugation

for 5 min at 13,000 rpm in an MSE microcentaur centrifuge. The upper, 200 pl probe phase,

was ethanol precipitated by the addition of 84 ¡rl 5 M DEPC-treated ammonium acetate, 1 Pl

of 10 mg/ml tRNA and 696 ¡tl L007o ethanol. The precipitated probe was washed with 707o

ethanol, dried very briefly and resuspended in 100 ¡rl of RNase protection assay hybridising

solution. 5 pl of the probe was counted using a Bioscan QC 2000 p counter (Bioscan Inc.

Washington D.C.) to determine activity of the probe.

2.2L.5 Hvbridisine the probe with RNA.

Generally, 30,000-60,000 cpm of probe was used, depending on the probe yield and

expression of RNA. This ensured that probe was in excess over RNA to facilitate

hybridisation of RNA and probe. The probe / RNA mixture was denatured at 80oC for 5 mins

and hybridised for at least 16 hours in a 45oC incubator.

59 Chanter 2 Maferials anrl

2.22 RNase A ASSAY

2.22.1 Disestion with RNase A.

Following hybridisation, single-stranded RNA was removed by digestion for 40 min at

26oC with 100 pl RNase A at the concentration suitable for efficient removal of single- stranded RNA. This was determined for each new probe by initial titration experiments using

RNase-A at increasing concentrations, typically 2.5, IO and 40 pdml in RNase-A buffer'

Where 2 or more probes with different RNase A requirements were used simultaneously, the

RNase A concentration appropriate for the RNA of interest was used.

After digestion, the reaction was inhibited by the addition of SDS to a final

concentration of 0.I77o (v/v) and proteinase-K to a final concentration of 260 pglml' The

reaction mix was incubated at3'loc for 15 min and 110 ¡rl was transferred to a fresh RNase-

free microfuge tube containing 1 pl of 10 mg/ml tRNA and 100 pl of TE saturated phenol /

chloroform (1:0.8).

The reaction was phenol extracted and the aqueous phase removed to a fresh RNase-

free microfuge tube containing 250 ¡tl IO07o ethanol. The RNA was precipitated and the pellet

was then briefly dried and resuspended in 4 ¡rl formamide loading buffer.

2.22.2 ectronhoresis of D samnles.

The products of RNase protection were separated on a 67o polyacrylamide / 8 M urea

gel (usually Z}cmx 40cm) using combs with 4 mm teeth. The gel was pre-elecrtophoresed for

30 min at 58 mAmps. The samples were denatured for 3 min at 100oC and loaded into the

wells. The gel was run until the xylene cyanol dye had migrated 10 cm into the gel. The gel

was fixed in l07o (v/v) ethan ol, L07o (v/v) acetic acid and dried for t hour at 80oC on a Bio-

60 Chaoter Materials and

Rad gel drier. The dried gel \r/as exposed to a phosphor-imager screen (Molecular dynamics,

Sunnyvale CA.) as required and relative intensity of bands corresponding to protected mRNA fragments quantitated by using the associated Imagequant software (Section 2.22.3)

2.22.3 Ouantitation and analvsis of specifTc mRNA's.

The amount of specific RNA was quantitated by Phosphor-imager analysis of RNase protection gels. The data was represented in graph form using GraphPad Prism (version 1.03)

software.

2.23 orthern blot ustng -labelled DN Drobe

capillarY transfer.

Upon the completion of the electrophoresis of the agarose gel, it was soaked in transfer

buffer (5 x SSC, 10 mM NaOH). The RNA was then transferred onto a piece of Hybond N

membrane by downward elution. Briefly, paper towels and filter paper cut to the size of the

gel were placed in a stack, with a piece of 3MM (pre-wetted) placed in between the towels and

filter. The gel was placed on top, followed by pre-wetted pieces of 3MM' 3 lengths of 3MM

were used to create a bridge from the buffer tank to the paper stack and transfer was allowed

to occur for 2 hours. The membrane was removed from the gels and placed into blotting paper.

The RNA was bonded to the nylon membrane by UV x-linking'

61 Chanter 2 Materials and efhods

2.23.2 Hvbridisation

The membrane was pre-hybridised by placing into a Hybaid hybridisation cylinder wirh 5 ml of ExpressHyb (Clontech) for 30 mins at 65'C with rotation. The labelled probe

(described in section 2.23.3) was added to the ExpressHyb and allowed to hybridise to ihe membrane for 2 hours at 65oC with rotation.

2.23.3 of DN nrobes

The Firefly luciferase gene was labelled by using the MegaPrime kit (Amersham lLife

Sciences) as recommended by the manufacturer. The probe was then purified from

unincorporated label by loading onto a G-25 sephadex spin column. The collected probe was

counted in a Bioscan bench top counter and the entire probe was added to the pre-

hybridisation mix and hybridisation allowed to occur for 2 hours at 65oC.

2.23.4 Washins of Nvlon filters for visualisation of bands

The filter was rinsed in2x SSC,0.17o SDS to remove the unbound probe. The filter

was washed twice in 2x SSC,O.IVo SDS for 10 min each at 65oC, then washed in 0.lx SSC,

containing 0.l7o (vlv) SDS for 15 mins at 68oC. The filters were sealed in a plastic bag and

either exposed to a phosphor-image screen or X-ray film'

2.24 3sS-Methionine Incorporation

NIH3T3 cells were plated at a density of 5 x 105 cells per 24 well dish and incubated for

24 hours, followed by a further incubation under either normoxic or hypoxic conditions. Cells

were then washed with PBS, and incubated in methionine-free DMEM, but containing 30

62 Chaoter 2 Materials and ods

pCi/ml L-3sS-methionine / cysteine. Cells were subsequently washed twice with PBS, four times with TCA, and twice with ethanol, air dried and dissolved in 0.4 ml of 0.3 M NaOH'

After neutralisation with 80 pl of 1.5 M HCl, one half of the sample was subjected to liquid scintillation counting (United Technology), and the other half used for measurement of total protein concentration using Bradford reagent (Bio-Rad).

2.25 Analvsis

polysome analysis was performed essentially as described (Savant-Bhonsale et al''

IggZ). Briefly, three 100-mm' dishes of NIH3T3 cells at just sub-confluent density were used

for each polysome distribution analysis. Cells were washed three times with ice cold PBS

containing 100 pglml CHX, removed using a cell scraper, and lysed in polysome lysis buffer

(100 mM KCl, 5 mM MgCl2, 10 mM HEPES (p}j'7.4),100 ¡rgiml CHX, 0.5 7o NP-40, 20 U

RNasin. Nuclei were pelleted by centrifugation at 12,000 xg at 4"C for 5 min. Total RNA in

the resulting supernantent was determined by OD266, and equivalent amounts of RNA was

loaded onto each 15-50 7o (wtlvol) linear sucrose gradient. Gradients were centrifuged at

38,000 rpm for 2 hours at 4"C in a Beckman SW4lTi rotor. Gradients were analysed by

passing the contents through a Pharmacia single-path UV-l optical unit to monitor continual

oDzoo.

Total RNA from each fraction was extracted with phenol / chloroform, followed by

chloroform alone after incubation with SDS / proteinase K. The identities of the 40S and 605

ribosome peaks were confirmed by comparison to profiles from extracts to which EDTA was

added before centrifugation.

63 Chanfer 2 Meferi als nnd efhods

2.26 W Blot

proteins were separated on a Laemmli SDS-PAGE protein gel and then transferred to nitrocellulose using a BIO-RAD protein transfer apparatus in SDS-PAGE transfer buffer at

100 mA over night. (20 mM Tris-HCL, 150 mM Glycine, 207o Methanol (v/v) 0.17o SDS).

The filter was then blocked in a I7o Boehringer blocking reagent made up in a PBS/Tween 20 solution, (pBS plus 0.2Vo Tween 2O (v/v)) for I hour. The blocking reagent was then removed, the filter placed in an appropriate volume of PBS/Tween 20 solution plus 17o BSA

(w/v) and primary antibody and left gently shaking overnight. To remove any excess binding the filter was washed 2 times in PBS/Tween 20 + I7o BSA followed by 4 washes in the pBS/Tween 20 solution. Each wash was for a duration of 10 minutes. The secondary

antibody (Horseradish peroxidase conjugated goat-anti-rabbit, DAKO) was diluted 1:2000 in

pBS/Tween 20 solution and incubated with the filter for t hour, gently shaking' The

secondary antibody solution was removed and the filters were washed as described above.

Antibody binding was detected using ECL reagents as described by the manufacturer

(Amersham Pharmacia Biotec) and exposed to X-ray film'

64 Chapter 3

Hypoxia-Inducible Factor-Lø mRNA contains an Internal Ribosome EntrySite

i Chanter 3 Hvnoxi a-Tnducihle 1cx, mRNA contains an infernal rihosome entrv site

3.1

At the commencement of this thesis, only a handful of cellular IRESs had been identified, and the mRNAs containing these elements were either expressed under stress conditions, or required to be tightly regulated for correct cellular function. These cellular

IRESs, although lacking any obvious similarities with the viral IRESs, all contained relatively long, G + C rich 5' UTRs. Of the six cellular IRESs found before 1998, all contained long

S'UTRs (ranging from 384 to 1164 nucleotides in length) and four of the six were G + C rich

(>57 7o) (Bernstein et a1.,1997); (Johannes et a1.,1998); (Nanbru et a1.,1997); (Stoneley er a.t.., L998); (Vagner et a1.,1995); (Ye et at.,1997). Since the HIF-lcr 5'UTR is quite long (286

nucleotides) and G + C nch (72 7o),I hypothesised that it may be subject to translational

regulation, and is a good candidate to contain an IRES.

Gene expression of HIF-lcr is predominantly regulated at the protein level, which is

almost undetectable in normal oxygen conditions (Wang et al., 1993b)' The protein is

however, rapidly accumulated in response to hypoxia, suggesting that the regulation of HIF-

lcr be either via translational up-regulation, or the inhibition of protein degradation (Wang et

al., 1993b). Accumulation of the HIF-lct protein in hypoxic conditions requires de novo

protein synthesis, and since translation of the mRNA is likely to occur under conditions that

may not be favourable to maximal rates of protein synthesis, the 5'UTR may contain

specialised elements, which provides an alternative mechanism of translation initiation.

Together, this suggests that cap-dependent translation of HIF-lclt, may be compromised under

hypoxia, and alternate mechanisms of translation initiation may be present in the 5'UTR.

Here the translational regulation of HIF-lcx is investigated, and data is presented

indicating the HIF-lcx 5'UTR contains an internal ribosome entry site. I also show the HIF-1d

65 1cr

IRES has similar activity to the c-myc IRES and deletion studies indicate that several regions of the HIF-14 5'UTR are required for complete IRES function.

3.2 Construction of HIF-Lg reporter nlasmids for analvsis in mammalian cells

To analyse the function of the HIF-lct 5'UTR, a series of constructs were made in luciferase reporter vectors. Reporter vector pGL3 is shown in Figure 2.I of the material and methods. The dicistronic pRF vector is shown in Figure 3.2, and all other reporter constructs used in this chapter are shown in Figure 3.1 through 3.8.

The mouse HIF-lcr 5'UTR was cloned by 5'-RACE using a kit (Roche Laboratories) and gene specific oligonucleotides 5'-GCCTTCCATGGCGAATCG-3', 5'-AACGCCGGCT-

CTGTCCGCG-3' and 5'-AAGAGACAAGTCCAGAGGCG-3, AS firSt, SECONd, ANd thiTd primer, respectively. The HIF-1cr PCR product was digested with SalI, subcloned into the SølI

site of pKSBluescript II, cut with NheI and NotI, and ligated into the NheI and NolI digested

mouse HIF-lcx cDNA that was amplified by PCR as described (Kappel et al., 1999) to

generate pKSHIFIRES (A kind gift from Dr' A. Kappel).

The monocistronic luciferase reporter containing the HIF-lcx 5'UTR was made by

excising the HIF-1o 5'UTR from pKSHIFIRES by digesting with ApaLI, blunt-ending, and

digesting with Nco.I. The resulting236 base pair fragment was ligated in pGL3 digested with

PvuII and NcoI (Figure 3.1).

The dicistronic luciferase reporter construct, pRF, was a kind gift from Dr. A. Willis

(University of Leicester). The construction of this plasmid is shown in Figure 3'2. Briefly, the

coding region of the Renilla luciferase gene was obtained from pRL-CMV (Figure 2.3 of the

66 Figure 3.L

Construction of a monocistronic reporter containing the HIF'1ø 5'UTR

The creation of pGL3HIF is shown. The 286 base pair HIF-lcr 5'UTR was excised from pKSHIFIRES, and ligated into pGL3 as indicated. Cloning at the 3' end of the HIF-Iø

5'UTR utilised the NcoI site to ensure that the luciferase coding region remained 'in- frame'.

Abbreviations: Amp', Ampicillin resistance gene; ori, origin of replication; luc*, firefly luciferase; HIF-1q 5'IJTR, hypoxia-inducible factor-1o 5' untranslated region' Amp'

ApaLI-fill Ncol f1 ori I I I on pGL3HIF poly sv40

NcoI luc+ Figure 3.2

Construction of the pRF dicistronic reporter

Construction of the pRF dicistronic reporter which contains two different luciferase genes is shown. The coding region of the Renilla luciferase (RL) gene was excised from the vector pRL-CMV by digestion with NheI andXbaI. To extend the length of the 3'UTR, this fragement was blunt-end ligated into the HindIII site of pSKBluescript and subsequently excised using EcoRY and XhoL The DNA segment was blunt-end ligated into the EcoRY

site of pGL3, generating pRF. This plasmid was created by Stoneley et al (1998). Amp'

or SV40ootvtA)ptrlL-CMV lâte

CMV lmmod¡ale Early Rluc Enìanco/Promolol r7

NheI XbaI NheI XbaI I I I I I

ú

om¡icillin HindlII pBlucrcript ll SK (+) MriS

P luc

EcoRV SrtJC c¡i XhoI

EcoRV XhoI Ampt I I I f1 ori

or Poly

PRF SV4O

EcoRV luc+ I

à 5 t

Renill¡ o E PRF

Fircfly Lwifem* Chanter Hvnoxi a-Tnducible factor-1cr mRNA confatns ân I nl nhosome en sì te

Materials and Methods section) by digestion with NheI and XbaI. To extend the Renilla luciferase 3'UTR, this fragment was blunt end ligated into the HindnI site of pSKBluescript

(Figure 2.4 of the Materials and Methods section) and subsequently excised using EcoRV and

Xho1.This DNA segment was blunt end ligated into the EcoRV site of pGL3 to create plasmid pRF (Figure3.2).

To create a plasmid containing a stable stem loop at the 5'end of the transcript of pRF, an oligonucleotide cassette 5' -AGATCTGGTACCGAGCTCCCCGGGCTGCAGGAT-3' and

5'-ATCCTGCAGCCCGGGGACCTCGGTACCAGATCT-3' containing an internal PsrI site was inserted into the EcoRV site of pRF. This vector was digested with PsrI and EcoRV and the same oligonucletide cassette was ligated into these sites following digestion with PsrI,

such that two oligonucleotide cassettes were inserted into the EcoRY site. This resulted in the formation of a 60 base pair palindromic sequence upstream of the Renilla luciferase coding

sequence to create pstemRF (Figure 3.3).

The dicistronic reporter containing the HIF-1cx 5'UTR was made by excising the HIF-lcx

5,UTR from pKSHIFIRES by digesting with ApaLI, blunt ending, and digesting with NcoI.

The resulting236 base pair fragment was isolated and ligated into pRF digested with Pvun' I

NcoI and pstemRF with SpeI, blunt-ended and digested with NcoI, to create pRhifF and

pstemRhifF respectively (Figure 3.4)

To construct a plasmid to use as a template for RNase protection probe synthesis to

detect the presence of dicistonic mRNAs, a624 nucleotide DNA fragment was PCR amplified

from pRhifF using primers Rlprobe and FFprobe (see section 2.3 of the Materials and

Methods). This product was digested with BamHI and Hind\I, and ligated into pGEM4Z

(Figure 2.5 ofthe Material and Methods section) to create plasmid pGemRhifF (Figure 3.5).

67 Figure 3.3

Construction of dicistronic reporter with stable stem loop inserted near the 5' cap to inhibit translation of the upstream cistron

Construction of pstemRF is shown. This plasmid is based on the pRF vector but contains an additional oligonucleotide cassette inserted to create a stable stem loop. The cassette was made by the insertion of the oligonucleotides 5'-AGATCTGGTACCGAGCTCCCC-

GGGCTGCAGGAT-3, and 5'-ATCCTGCAGCCCGGGGACCTCGGTACCAGATCT-3'

containing an internal Psfl site into the EcoRY site of pRF. This vector was digested with

PsrI and EcoRY and the same oligonucleotide cassette was excised with PsrI and ligated

into these sites creating a 60 bp palindronic sequence upstream of the Renilla coding

region. This results in the production of a hairpin structure with an energy of -55 Kcal/mol

(Stoneley et al, 1998). EcoRV EcoRV

EcoRV

s vo ¡É o U) o o. r

Renilla Luciferase ä E pstemRF

(A)

Firefly Luciferase Figure 3.4

Construction of dicistronic reporters containing the HIF-lcr 5'UTR to assay IRES activity

The creation of plasmids A. pRhifF or B. pstemRhifF is shown. Cloning at the 3' end of the

HIF-1.4 5'UTR utilised the NcoI site to ensure that the luciferase coding region remained

'in-frame'.

Abbreviations: Amp', Ampicillin resistance gene; ori, origin of replication; SV40, simian

virus early promoter. à (ò o R ApaLI-fill Ncol I Renilla Lucifer¿se b € pRhifF

NcoI

Firefly Luciferase

à o R ApaLI-fill NcoI I I I Renilla o- € pstemRhifF

Firctìy Luciferase Figure 3.5

Construction of plasmid pGEMRhifF to be utilised as a template for RNase protection

probe synthesis

The construction of pGEMRhifF is shown. The intercistronic region of the pRhifF plasmid

was amplified by PCR, and cloned into the pGE,Ìll44Z vector as indicated (For details see

Figure 2.5). The ampicillin resistance gene and origin of replication are also shown. The

SP6 and T7 RNA polymerase promoters are indicated.

Abbreviations: Amp', Ampicillin resistance gene; ori, origin of replication; MCS, multiple

cloning site; RL, renilla luciferase; FF, firefly luciferase; HIF-lcr 5'UTR, hypoxia-

inducible factor- 1 c¡¿ 5' untranslated region. BamHI HindIII

Ssp I Xmn 11939 2144 Aatll 2262 Sca I 1820

Nde I 2511 Ampt Nar I 2563 SP6 MCS BamHI pGEMRhifF lacZ

on Chanter 3 Hvnoxia- cih 1e factor-1rr mRNA contains an internal entrv site

Dicistronic repofier plasmids containing the VEGF 5'UTR were generated by digesting pBSV5 (Miller et al., 1998) with Hindlll and blunt ended, followed by digestion with NcoIto excise the 1013 base pair murine VEGF 5'UTR. This fragment was ligated into pRF digested

with PwilI lNcol and pstemRF digested with SpeI, blunt-ended and digested with Ncol to generate plasmids pRvegfF and pstemRvegfF respectively (Figure 3.6). pstemRmycF was a kind gift from Dr. A. Willis, and contains the 396 nucleotide mouse c-myc 5'UTR amplified by PCR as described (Stoneley et al., 1998). pRmycF was constructed by digesting pstemRmycF with SpeI I NcoI and ligating the 396 base pair 5'UTR into similarly digested

pRF (Figure3.7).

Dicistronic deletion mutants of the HIF-lcr 5'UTR were generated by cloning into the

pRF vector (Figure 3.2). Construct pRhiffAl-136 was generated by digestion of pRhifF with

Psfl, blunt-ended followed by digestion with Ncol and the 150 base pair fragment ligated into

the SpeI I NcoI sites of pRF. pRhifF Ll36-286, was generated by digestion with PsrI, blunt-

ended, and digested with Spel, and the 136 base pair fragment ligated into the SpeI lNcoI sites

of pRF. All other deletions were generated by PCR amplification with primers containing a 5'-

Spel and a3' Ncol site (see section 2.3 of the Materials and Methods) and ligated into the SpeI

I NcoI sites of pRF, as shown in Figure 3.8. The following primer combinations were used for

the generation of the deletions. pRhifFAl-178 : HIF1 and HIF5 generating a 108 base pair

fragment; pRhifFA t-210 : HIF1 and HIF6, generating a 66 base pair fragment; pRhifFAl-

245 : geterating a 43 base pair fragment; pRhifFA245-286: HIF4 and HIF8, generating a245

base pair fragment; pRhifFA2l0-286 : HIF3 and HIF8, generating a 210 base pair product;

pRhifFAlT8-286 : HIF2 and HIF8, generating a 178 base pair fragment; pRhiffAl-68 :

HIF68 and HIF8, generating a 218 base pair product. The Stratagene QuickChangerM Site-

68 Figure 3.6

Construction of dicistronic reporters containing the YEGF S'UTR to assay IRES activity

The construction of plasmids A. pRvegfF and B. pstemRvegfF is shown. Cloning at the 3' end of the VEGF 5'UTR utilised the NcoI site to ensure that the luciferase coding region remained 'in-frame'.

Abbreviations: Amp', Ampicillin resistance gene; ori, origin of replication; SV40, simian

virus early promoter; VEGF, vascular endothelial growth factor; 5'IJTR, 5' untranslated region. A

-à I HindIII-fi11 Ncol

Renilla o. tr pRvegfF

NcoI

Firefly Lucifem*

B

à o t HindIII-fì11 NcoI I I I I I I Renilla Luci[eøre €" pstemRvegfF

SpeI-fill NcoI

Firefly Luciferas Figure 3.7

Construction of dicistronic reporters containing the c-myc 5'UTR to assay IRES activity

Creation of plasmids A. pRmycF and B. pstemRmycF is shown. Cloning at the 3' end of the c-myc 5'UTR utilised the Ncol site to ensure that the luciferase coding region remained

'in-frame'.

Abbreviations: Amp', Ampicillin resistance gene; ori, origin of replication; SV40, simian

virus early promoter. A

o q & SpeI NcoI I I I I Renilla a E pRmycF

NcoI

Fircfly Lucifemæ

B

à o e SpeI NcoI I I I I I Renilla €" pstemRmycF

NcoI

Firefìy Lucifems Figure 3.8

Dicistronic reporter constructs containing various deletions of the HIF-14 S'UTR to measure IRES activity.

The control dicistonic reporter pRF is shown in linear form (Refer to Figure 3.2). The entire

HIF-1cr 5'UTR (pRhifF) is shown, with the deletions represented below. The numbers refer to the nucleotide sequence of the HIF-1o 5'UTR. All HIF-14 5'UTR deletions were generated by PCR amplification, with subsequent SpeI I NcoI digestion and ligation into pRF. The 'X' in pRhifFAPPT indicates where substitution mutations (5'-

TCTCTTTCTCC-3' to 5'-ACTATGTATCC-3') were made by "site-directed mutagenesis".

Abbreviations: SV40, simian virus early promoter; Luc, Luciferase, PPT, polypyrimidine

tract. SpeI NcoI I I I

PRF SV4O illtron

1 286 pRhifF HIF-Ia 5'UTR

1 6 pRhifFal-136 HIF-lcr 5'UTR

1 286 pRhifFal-178 HIF-lcr 5'UTR

2t0 286 pRhifFar-2r0 HIF-lcr 5'UTR

pRhiffA 1-245 HIF-Ia 5'UTR

I 245 pRhifFA245-286 HIF-Ia 5'UTR

1 210 pRhifFA210-286 HIF-Io 5'UTR

1 t78 pRhifFA 178-286 HIF-1cr 5'UTR

1 t36 pRhifFA136-286 HIF-1cr 5'UTR

1 pRhiffA68-286 -1cr 5'

I 286 pRhifFAPPT HIF-1o 5'UTR X Chapter 3 Hwoxia-Inducible factor-ltx mRNA contains an internal ribosome entry site

Directed Mutagenesis kit was used to mutate the polypyrimidine tract (PPT) in the HIF-lcr

5'UTR from 5'-TCTCTTTCTCC-3' to 5'-ACTATGTATCC-3' to create pRhifFAPPT.

Mutation of the PPT in the pRhifFAPPT construct is represented with an "X" in the 5'UTR

(Figure 3.8).

3.3 s of the HIF-lcr S'UTR

Numerous long, G + C rich 5'UTRs have been shown to be translationally regulated, including vascular endothelial growth factor, basic fibroblast growth factor and platelet derived growth factor (Akiri et al., 1998); (Arnaud et al., 1999); (Bernstein et al., 1997);

(Kevil et a\.,1996); (Miller et a\.,1998); (Stein et aL.,1998); (Vagner et a|.,1995). The mouse

HIF-1c¡¿ 5'UTR is unusually long (286 nucleotides) and G + C rich (72%), indicating it may

also be regulated at the translational level of gene expression. To determine regions of the

5'UTR that may play a role in regulation, sequence alignment was performed. The sequences

of the HIF-lcr 5'UTR was available for four species (human, mouse, Xenopus and rainbow

trout), which were quite divergent across the different species, but the identity between human

and mouse was extremely high (80%) (Figure 3.9). The homology between human and mouse

was highest towards the 3' end of the 5'UTR, particularly the last 125 nucleotides, with only

several mismatches, suggesting this region may be important in HIF-1cx regulation. The HIF-

la coding region also shows a high conservation, with greater than 90 % identity between

human and mouse sequences at the amino acid level.

To determine a potential role of secondary structure formations, Figure 3.10 shows the

predicated folding pattern of the HIF-14 5'UTR using Ztkef s 'mfold' program. Extended

base pairing was apparent along the entire 5'UTR, containing several hairpin structures. The

69 Figure 3.9

RNA of the HIF-1c 5'UTR

Sequence homology of the HIF-14 5'UTR among human, mouse, Xenopus and rainbow trout is presented. Numbers represent the base count of the human HIF-1o 5'UTR. Green coloured doxes represent regions of high homology and blue boxes represent regions of extremely high homology between the species is shown. The red box represents the translation initiation start codon. 1 50 human tgctg ccÈcgtctga t mouse Xenopus ...acgcggg aaagcagÈgg taacaacgca t trout ggcaacctct ccagcgtggc acctcafgcc acttcgaagg aattaa

51 100 human tcg gggct mouse .c tagcc Xenopus ttt tgttÈgcgÈt gatttaggag tcacagactg aaccgggcga trouÈ tcttsctg cact,catgtt ttgactttcc gcgatggagg ctÈgacctct

101 1_50 human aggc tcggagcc mouÊ¡e cgcc taggaacc XenopuE aaaa agagacac trout tgca Ètgatcaa 200 human mouse xenopus t,rou! :Ë: :'#' 20t 2so human mouse xenopus caaaagccc trout gacaaacaca gÈUtgatagc agc taacgtcaca gtac 251 300 human mou€ie Xenopus ccct t trout tac t t gctcagaaag tgtcc catcctgaa

301 human mouse xenopus ErouÈ Figure 3.L0

Model for secondary structure of the HIF-1ø S'UTR 'mfold' A predicted secondary str-ueture of the mouse HIF-14 5'UTR using M' Zukers

program is shown. 5, and 3i ends of the mouse HIF-1o 5'UTR are indicated. Numbers

structure is predicted to be represent the nucleotides of the HIF-lcr 5'UTR (1-286). This

are-formed in the I most likely formed by free energy. The Yl andY2 hairpin structures

first 7 of the 20 predicted süuctures. é

/ '"1 H

F.

* Chanter 3 Hr¡noxia-Inducible factor-1cr A contains an ìnternal rìbosome entrv site

structure folded quite readily with a free energy of -126 Kcal/mol and contained two "Y"- shaped stmctures, of which similar structures have been implicated to function in internal ribosome entry (Le et al., 1997). This finding led to the possibility that the HIF-1u 5'UTR

contains sequences that may regulate its translation.

3.4 Svstem to determine the of the HIF-lcr 5'UTR

To test the function of the HIF-1o 5'UTR, the dual luciferase repofier system was

employed. To determine the optimal conditions for reporter function in 24 well dishes, cell

density, DNA quantity and transfection reagent volumes were tested. To test the amount of

DNA required for transfection to obtain maximal activity, NIH3T3 and HeLa cells were

transiently transfected with increasing amounts of either pRL-TK or pGL3 DNA (See Figure

2.2 and Figure 2.1, respectively). Figure 3.11 shows increasing DNA amounts (up to 500 ng)

increased reporter expression whereas fuither increases in DNA resulted in a decrease in

activity for both reporters in both cell lines. Cell density was optimised such that cells were

confluent at harvesting. A transfection reagent volume titration was performed, with an

increase in activity up to 3 pl, with further addition not correlating with a substantial increase

in reporter expression (data not shown). The reporter system was therefore set up to yield

maximal expression of the reporters in the cell lines to test HIF-1o 5'UTR function.

3.5 The HIF-14 S'UTR allows efficient translation

To investigate the influence the long, G + C rich HIF-lcr 5'UTR has on translational

efficiency, luciferase mRNA reporters were constructed with or without the insertion of the

HIF-Icr 5'UTR. The complete HIF-1cr 5'UTR was inserted into pGL3 (Figure 3.1) so that the

70 Figure 3.1L

Effect of DNA quantity on Luciferase Activity

Different quantities of pGL3 DNA (right columns) or pRL-TK (left columns) were transiently transfected into A. NIH3T3 fibroblasts or B. HeLa cells. Renilla and firefly luciferase activities were me as ured 24 h post-tran sfecti on' A

50 >¡ 1 0000 I>' €

I () o 40 7500

C) o (A c/) (Ë lr 30 *r e (*a) 5000 ()) 20 )a J J (g >r Ë 2500 1 0 c) o ti ú tri 0 0 50 100 200 500 10001500 50 100 200 500 1000 1500 Amount DNA transfected (ng) Amount DNA transfected (ng) pRL-TK pGL3

B

-20 1 250

åls O 1 000 o o (t) cA (Ë 150 ti ë10 (*a) O () J ) 500 I Fl (€5 >l çi 250 c) o t< lri ú0 0 50 100 200 500 1000 1500 50 100 200 500 1000 1500 Amount DNA transfected (ng) Amount DNA transfected (ng) pRL-TK pGL3 Chaoter 3 Hvooxia- Inducible factor- 1 cr mRNA contains an internal ribosome entrv site

luciferase initiation codon replaced the HIF-lcr initiation codon, thereby creating pGL3HIF. pGL3HIF and a transfection control þSeAP-Control) were transiently co-transfected (at a ratio of 10:1) into either NIH3T3 fibroblasts or HeLa cells and the levels of the reporters measured 24 hours post-transfection. Contrary to expectation, insertion of the highly structured HIF-1g 5'UTR had no inhibitory effect on the ratio of luciferase activity to SeAP expression (Figure 3.I2), indicating the HIF-1o 5'UTR allows translation to proceed efficiently.

3.6 The HIF-lcr 5'UTR contains an Internal Ribosome Entrv Site

Because the 5'UTR of HIF-Icr mRNA is rather long and G + C rich, but nevertheless

allows effrcient translation of the luciferase reporter gene, it was suspected it may contain an

internal ribosome entry site. To test this, the HIF-lcr 5'UTR was inserted into a dicistronic

reporter gene, between the cDNAs encoding two distinct luciferase enzymes (Renilla

luciferase and Firefly luciferase). The effect the HIF-lcr segment had on the relative

expression of activity from the downstream firefly luciferase cistron was examined. The

plasmids pRF (Figure 3.2), which contains a short linker sequence between the two luciferase

cistrons, and pRhifF (Figure 3.4A) which contains the HIF-1u 5'UTR between the cistrons,

were transiently transfected into NIH3T3, HEK293 and HeLa cells. The presence of the HIF-

la 5'UTR increased the expression of the downstream firefly luciferase relative to the renilla

luciferase by 3O-fold in NIH3T3 cells, 19-fold in HEK293 cells and 18O-fold in HeLa cells

(Figure 3.13), suggesting that the HIF-1o 5'UTR can indeed promote translation by internal

ribosome entry.

71 Figure 3.12

Effect of HIF-1c on the translational efficiency of luciferase

The control plasmid pGL3 or pGL3HIF were transiently co-transfected with pSeAP-

Control into A. NIH3T3 fibroblasts or B. HeLa cells. 24 hours post-transfection, the media was harvested and assayed for SeAP expression, and the cells lysed and assayed for luciferase enzymatic activity. Translational activity is presented as ratios of Luciferase to

SeAP expression. The data is represented as the mean (t SEM) from triplicate samples from three independent experiments. EÉ

Relative Luciferase Activity Relative Luciferase Activity (Luc / SeAP) (Luc / SeAP) N)u)5 NJ OOOO O OOOO O O ÕOOO

Eo rr o (¿) (,ri

¡ó o o (,F li u) Ér Ìl Frl Figure 3.L3

Relative enhancement of expression of the downstream reporter enzyme by the HIF' la 5'UTR in various cell tYPes

NIH3T3, IßK2g3 and HeLa cells were transiently transfected with pRF or pRhifF (see

Figure 3.2 and3.4, respectively) as indicated. Renilla and firefly luciferase activities were

determined 24 hours post-transfection. IRES activities are represented as ratios of firefly to

renilla luciferase. The ratios for each cell line are graphed relative to pRF, which was given

a value of 1. Data presented are the mean (tSEM) of triplicate samples from three

independent experiments. :¡ 200 :Jo ,^. d\S a !lì J 15 150 Li \) .a Ê< 1 100 (t-ì ¡i- () o.! 1 5 50 > iFr +¡ C€ 0 úC) pRF pRhifF pRF pRhifF pRF pRhifF NIH3T3 HEK293 HeLa Chanter 3 Hvooxia- factor-lcr mRNA contains an internal ome entrv slte

To check that firefly luciferase was translated by internal ribosome entry, and not as a result of re-initiation of ribosomes that failed to dissociate from the mRNA after encountering the stop codon of the upstream renilla luciferase, a 60-base pair palindrome sequence \ryas

inserted at the transcription start site, so that the transcript would have a strong stem-loop

structure adjacent to the 5'cap. This stem loop has previously been shown to inhibit cap-

dependent translation (Stoneley et al., 199S). The presence of the stem loop in pstemRhifF

(Figure 3.48) reduced expression of renilla luciferase without affecting expression of firefly

luciferase activity in both NIH3T3 and HeLa cells (Figure 3.14). This result demonstrates that

the translation of the hrefly luciferase does not result primarily from failure of ribosomes to

dissociate after translation ofthe upstream cistron.

To verify that the frrefly luciferase protein was slmthesised by translation of the

downstream cistron of an intact dicistronic transcript, rather than from a functionally

monocistronic mRNA generated by splicing or by use of a cryptic promoter within the

dicistronic gene, RNase protection mapping of the region spanning the end of the renilla

luciferase open reading frame into the firefly luciferase open reading frame was performed.

Assay of RNA from transfected NIH3T3 cells produced a major band of 490 nucleotides

which is the size expected from intact dicistronic mRNA, and a second band of 286

nucleotides, which is the size expected from protection by endogenous HIF-1cr mRNA (Figure

3.15, Lane 3). When RNA from mock-transfected NIH3T3 cells was assayed, only the

endogenous HIF-lcx product was seen, verifying the identity of this band (Figure 3.15, Lane

4). Assay of RNA from transfected HeLa cells produced a single major product of the size

expected from protection by intact dicistronic mRNA (Figure 3.15, Lane 6). No endogenous

HIF-1g from HeLa cells was seen because the probe only detects mouse HIF-lcr mRNA

72 Figure 3.L4

Effect of a 5' stem-loop on relative expression of the downstream reporter enzyme

A. NIH3T3 and B. }JeLa cells were transiently transfected with pRF, pRhifF or pstemRhifF

(See Figure 3.2 and 3.4) as indicated. IRES activities are represented as ratios of firefly to renilla luciferase. All luciferase ratios are graphed relative to pRF, which was given a value of 1. Data are presented as mean (tSEM) of triplicate samples from three independent experiments. EÉ

Relative luciferase activþ Relative luciferase activity (fireflylRenilla) (fireflylRenilla) N('l (tt o ('l N (¡ \,1 o oo o o('lo(¡ ,?r, oq

""*^ "3 "% Figure 3.15

Ribonuclease protection mapping of the intercistronic region of the dicistronic nRNA

A. A schematic showing the dicistonic mRNA containing the HIF-1cr 5'UTR hybridised to

the antisense RNA probe used for RNA protection analysis is shown. The lengths of probe

regions protected by the renilla luciferase coding region, HIF-14 5'UTR and firefly

luciferase coding region are indicated. B. The RNase protection gel is shown, with the size

relative to molecular weight markers indicated. Lane 1, undigested RNA probe; Lane 2,2

pg yeast tRNA; Lane 3, Poly(A)+ mRNA from NIH3T3 cells transfected with pRhifF;Lane

4, Poly(A)* mRNA from mock transfected NIH3T3 cells; Lane 5, Poly(A)* mRNA from

mock transfected HeLa cells; Lane 6, Poly(A)* mRNA from HeLa cells transfected with

pRhifF. A

76 286 101 FF m7G EI a\

490 nt

B r23456 546+ 490+ '*

286+

101+ Chanfer J A-Inducible factor-1cr mRNA contains an internal some entrv site

(Figure 3.15, Lane 5). No product of a size that would indicate the presence of a cryptic promoter or alternative splicing event was seen either in NIH3T3 or HeLa cells. Importantly,

apart from the endogenous HIF-Iø product in NIH3T3 cells, there was no product of a size

intermediate between the 490 nucleotide fragment protected by dicistronic transcript and 101 nucleotides, which is the minimal size product required from a transcript that encodes firefly

luciferase open reading frame. Hence, the increased expression of firefly luciferase that results

from insertion of the HIF-14 5'UTR must result from translation of dicistronic mRNA. To

fuither demonstrate the firefly luciferase expression was from an intact dicistronic mRNA,

Northern analysis was performed on RNA isolated from NIH3T3 cells transfected with pRhifF. Probes for both renilla luciferase and f,rrefly luciferase detected a single RNA species

corresponding to the size expected of the dicistronic mRNA (3.2 kb) in transfected cells but

not in mock transfected cells (Figure 3.16).

3-7 Relative effÏciencv of the HIF-I ü IRES compared with other cellular

IRESs

A number of mRNAs that encode proteins involved in regulation of cell growth or response to stress have been found to contain IRESs. These include eIF4G, X-linked inhibitor of apoptosis (XIAP), NF-KB repressing factor (NRF), c-myc and vascular endothelial growth factor (VEGF) (Akiri et al., 1998); (Gan et al., 1996); (Holcik et al., 1999): (Miller et al.,

1998); (Oumard et a\.,2000); (Stein et al., 1998); (Stoneley et al., 1998). To compare the activity of the HIF-1o IRES with other cellular IRESs, NIH3T3 and HeLa cells were transiently transfected with dicistronic reporters containing the HIF-1o 5'UTR (Figure 3.4), c- myc (Figure 3.7) or the VEGF 5'UTR (Figure 3.6) (Figure 3.I7).In both cell types, the HIF-

73 Figure 3.16

Northern Analysis of pRhifF mRNA in NIH3T3 cells poly(A)* 6RNA was isolated from NIH3T3 cells either transiently transfected with pRhifF 32P-labelled or mock transfected as indicated. Northern analysis was performed using DNA probes for the renilla (RL) of firefly (FF) luciferase regions as indicated. The migration of

RNA size standards is indicated' RL FF e*".r, ù,8V

5000 +

3000 ---> 2000 -> 1000+ Figure 3.17

Comparison of the activities of the HIF-10I, c-myc and VEGF IRESs

A. NIH3T3 and B. HeLa cells were transiently transfected with the various dicistronic reporters described in Figures 3 .4, 3 .6 and 3.7 . Renilla and firefly luciferase activities were determined 24 hours post-transfection and IRES activities are represented as ratios of firefly to renilla luciferase, relative to the ratio obtained with pRF which is given a value of

1. Data are presented as the mean (tSEM) of triplicate samples from three independent experiments. EÉ

Relative Luciferase activity Relative Luciferase activity frefly I Renilla firefly lRenilla N ql o o(rl o ('r o o o o o o tâ eò 9,6 9,ø

\ \ ,fa^ qâ "-" Chaoter 3 Hvooxia-Inducible factor-1o mRNA contains an internal ribosome entrv site

1cr IRES had activity comparable to the c-myc IRES, whereas the VEGF 5'UTR was two- to threefold more active. All three IRESs were considerably more active in HeLa cells than in

NIH3T3 cells. A similar relationship between the activities of the different IRESs was seen when a stem-loop was inserted upstream of the renilla luciferase cistron to inhibit cap- dependent translation. The relative ratio of f,rrefly to renilla luciferase was increased two- to threefold for each IRES, and in both cell types.

3.8 Mapping the HIF-Iü IRES

There have been repofts to date of up to 45 cellular mRNAs containing IRESs, however their precise location within the 5'UTR or their mechanism remains poorly understood. There are three themes appearing on potentially different mechanisms of IRES function. The majority of cellular IRESs appear to require the formation of secondary structure, as the larger the deletion, the greater the loss of IRES activity. It is therefore possible that multiple regions are required for correct folding of the IRES, which seems to be the most likely scenario for the c-myc IRES (Stoneley et al., 1998). The second class of

Chemical probing of the c-myc IRES has led to the derivation of two structural motifs " g ¡ that are required for function, with the ribosome landing downstream of these Mo rf ft pseudoknots in a mechanism similar to several viral IRES elements (Le Quesne et. al. -¿ gr200l)' ^v v,rv'r1,',çu Dy rne utx mru\a, wnere a g-nucleottde sequence can function independently as an IRES module (Chappell et al., 2000a). This 9-nucleotide sequence can directly bind to 40S ribosomal subunits by base pairing to 18S rRNA (}{tt et ø1.,

1999a), providing a direct mechanism for ribosome recruitment to the mRNA.

74 Figure 3.L8

HIF-1o 5'UTR analysis

A. HIF-lcr 5'UTR hot spots. The sequence of the mouse HIF-lcr 5'UTR is shown. The numbers represent the length of the HIF-lct 5'UTR as indicated. The region of 18S rRNA complementarity is shown in green and the polypyrimidine tract is shown in blue. The

translation initiation codon is shown in red. B. Complementarity region of the HIF-lcx

5'UTR and 18S rRNA. The region of the HIF-1cx 5'UTR with complementarity to the 18S

rRNA is shown. The corresponding sequence of the 18S rRNA is presented. The potential

base pairing between the sequences is represented by the black bars. The bracket represents

the region of 1007o complementarity between the two sequences. A 152 GCACAGAGCCTCCTCGGCTGAGGGGACGCGAGGACTGTCCTCGCCGCCGTCG

53 105 CGGGCAGTGTCTAGC CAGGCC CT GACAAGCTAGCC GGAGGAGC GCCTAGGAA

106 1s5 156 CCCGAGCCGGAGCTCAGCGAGCGCAGCCTGCAGCTCCCGCCTCGCCGTCCCG

157 r64 193 203 209 CCACCCCGCCTCTGGACTTGTCTCTTTCTC CGCGCGC

210 260 GCGGACAGAGCCGGCGTTTAGGCCCGAGCGAGCCCGGGGGCCGCCGGCCGG

261 286 GAAGACAACGCGGGCACCGATTC GGC ATG

B

5' 144 CCUCGCCGUCCCGGGGGGCGUCC 166 3' HIF 5'UTR

3' 338 GCAGCGGCGGUGCCCCCCGCACG 316 5' l8s rRNA

10 nt Chanter 3 Hvooxia-Inducible factor-lcr mRNA contains an intemal ribosome entrv site

The presence of either a pyrimidine tract or a region of complementarity to 18S rRNA was searched for in the HIF-1clc 5'UTR. A region of 100% complementarity to 18s rRNA was found in the mouse HIF-1o 5'UTR at nucleotides 155 to 164 (Figure 3.18). The region of 144 to 166 of the HIF-lcr 5'UTR has only 3 mismatches with the 18S IRNA (nucleotides 316 to

338) (Figure 3.188). Additionally, the HIF-1o 5'UTR contains an 1l-nucleotide stretch of pyrimidines from bases 193-203, which makes these regions potential "hot-spots" for IRES

function.

To determine whether the 18S rRNA complementarity region, the pyrimidine tract, or

secondary structure were important in HIF-14 IRES function, serial deletions of the HIF-lcr

5'UTR were made (Figure 3.8). The ability of these truncated sequences to promote internal

ribosome entry on a dicistronic mRNA \¡/as compared to the full-length 5'UTR in NIH3T3

cells. Removal of the first 136 nucleotides from the 5' end decreased activity of the

downstream cistron by 86Yo, and larger deletions of 178, 210 and 245 nucleotides resulted in a

reduction of IRES activity by 92,60 and 96%o respectively (Figure 3.19). Deletion of the 18S

rRNA complementarityregion (pRhifFAl-178) resulted in only a slight decrease in activity

from the slightly shorter deletion þRhifFAl-136), indicating this region may not play a

critical role in HIF-lcr IRES function. However, deletion of the pyrimidine stretch

úrRhifFAl-210) resulted in an increase in downstream reporter activity when compared to the

shorter deletion (pRhifFA l-I78), suggesting the pyrimidine tract may function as a repressor

site of HIF-19IRES function.

At the 3' end, deletion of 41 nucleotides (pRhifFA245-286) resulted in a reduction of

IRES activity by 20Yo. However, further deletion of another 35 nucleotides þRhiff L2I0-

75 Figure 3.L9

Deletion analysis of the IRES activity of the HIF-1c 5'UTR in NIH3T3 fTbroblasts

A schematic representation of the dicistronic constructs used in this analysis is shown.

Constructs are based on the pRF vector. Inserts include the entire HIF-14 5'UTR (pRhifF) and deletions and fragments of this sequence is indicated. The HIF-lcx 5'UTR construct designations indicate the exact nucleotide sequences deleted in each construct. Constructs were transiently transfected into NIH3T3 cells and renilla and firefly luciferase activities measured 24 hours post-transfection. IRES activities are represented as a percentage of the full HIF-lcr j'UTR. Data are presented as the mean (tSEM) of triplicate samples from four

independent experiments. PRF

pRhifF I 2

pRhifFal-136 t36 28

pRhifFal-178 178

pRhifFal-210 2r0 286

pRhiffa 1-245 245 286 pRhifFa245-286 I 245 pRhifFa210-286 I 2t0

pRhifFalT3-286 1 t78 pRhifFar36-286 I 136

25 50 100 125 Relative Luciferase ActivitY (Firefly I Renilla) Chanter i Hr¡noxia-Inducible factor-1n mRNA contains an intemal entrv site

286)resultedinadecreaseof activity of 77%o. Anyfurtherdeletionfromthe3'enddidnot result in any further loss of IRES activity.

The HIF-Ig 5'UTR deletions were also analysed in HeLa cells, as they had previously been shown to contain higher IRES activity than any other cell line analysed (Figure 3.13).

Deletion of the HIF-lg 5'UTR at the 5' end, of 136 nucleotides (pRhifFAl-136) resulted in a

90Yo decrease in IRES activity. Deletion of the next 42 nucleotides (pRhifFAl-178), which

removed the 18S rRNA complementarity region, resulted in only a slight decrease in activity

(94%), however deletion of the pollpyrimidine tract (pRhifFAl-2I0) gave an increase in

IRES activity (36% of the total 5'UTR) (Figure 3.20). Further deletion, leaving just the last 41

nucleotides (pRhifFAl -245) completely abrogated activity. Deletion of 42,76, 108 and 150

nucleotides from the 3'end resulted in a decrease in IRES activity of 50%o, 84yo,85yo and 86Yo

respectively. These data indicate the l8S rRNA complementarity region is probably not

required in HIF-1cr IRES function, however, the polypyrimidine tract appears to be involved

in negative regulation of IRES function. Deletion of the first 136 nucleotides resulted in a

dramatic loss of IRES activity, indicating sequences within the 5' half of the 5'UTR are

important for IRES function. Additionally, the region of nucleotides 210-245 is important in

IRES activity, as deletion of this region from either end resulted in a large decrease in

downstream reporter activity, in both cell lines. This region is extremely G + C rich (74%),

suggesting it may be important in the fotmation of secondary structure to enhance HIF-lcr

IRES function.

Due to the dramatic loss of IRES function from several HIF-lcx, 5'UTR deletions,

secondary structure folds were predicated using Zuker's 'mfold' program in an attempt to find

regions of conserved secondary structure to explain loss of IRES function. Deletion of the first

76 Figure 3.20

Deletion analysis of the IRES activity of the HIF-1c 5'UTR in HeLa cells

A schematic representation of the dicistronic constructs used in this analysis is shown.

Constructs are based on the pRF vector. Inserts include the entire HIF-lcr 5'UTR (pRhifF)

and deletions and fragments of this sequence are indicated. The HIF-lcr 5'UTR construct

designations indicate the exact nucleotide sequences deleted in each construct. Constructs

were transiently transfected into HeLa cells and renilla and firefly luciferase activities

measured 24 hours post-transfection. IRES activities are represented as a percentage of the

full HIF-lcr 5'UTR. Data are presented as the mean (ISEM) of triplicate samples from four

independent experiments. PRF

pRhifF I

pRhifFal-136 136

pRhifFal-178 t78

pRhifFal-210 2t0 286

pRhifFal-245 245 28

pRhiffa24s-286 1 24

pRhifFa210-286 1 210

pRhiffa 178-286 1 1

pRhifFal36-286 1 1 36

0 50 5 I 1 Relative Luciferase ActivitY (Firefly I Renilla) Chapter 3 Hwoxia-Inducible factor-lcx mRNA contains an internal ribosome entrv site

136 nucleotides resulted in a different predicated structure when compared to the entire

5'UTR (Figure 3.2IA vs. 3.10), with the absence of the Yl region and the presence of three strong stem-loop structures. Deletion of the first 178 nucleotides resulted in a secondary structure containing three stem loops, but lacked formation of either Y1 or Y2, resulting in minimal IRES activity (Figure 3.218). Deletion of the first 210 nucleotides gave a predicted secondary structure of a single stem-loop with four bulges in the stem (Figure 3.21C). There is no clear indication of how this stem loop can initiate internal translation, particularly since there is no structure maintained when compared to the full-length 5'UTR. Deletion from the 5' end, leaving only 41 nucleotides resulted in a short stem loop structure, containing two bulges within the loop, with a 9-nucleotide loop (Figure 3.21D). This structure did not resemble any structure of the full-length 5'UTR, and lacked IRES activity.

Deletion from the 3' end of 41 nucleotides resulted in a structure that was similar to that of the full-length 5'UTR (Figure 3.22A). The Yl structure and a number of bulges and stem-loops v/ere completely conserved; giving indication why there is only a slight decrease in

IRES activity of this deletion. Removal of the last 71 nucleotides of the 5'UTR resulted in a predicted secondary structure that changed quite noticeably. The Yl structure and several stem-loops were maintained, however the arrangement of the loops were altered (Figure

3.228). This deletion resulted in a dramatic loss of IRES activity (Figure 3.19 and 3.20), suggesting the Yl structure is not sufficient for IRES function. Further deletion from the 3' end of 108 or 150 nucleotides, which did not show any further loss of IRES activity (Figure

3.19 and 3.20), had conserved the Y1 structure, but lost the other stem-loops in the centre of the structure which appear to be important in the function of the IRES (Figur e 3 22C and D).

77 Figure 3.21

Model for secondary structure of the HIF-14 s'UTR deletions

The predicted secondary structure of the mouse HIF-1Cr 5'UTR deletions using M. Zuker's

.mfold'program is shown.5' and 3' ends of the mouse deletions are indicated. Numbers represent the nucleotides of the HIF-lc¡¿ 5'UTR deletions. A. A1-136 B. A1-178 C. A1-

2r0D. Lr-24s. A

3'

B

6ø

C

D Figure 3.22

Model for secondary structure of the HIF-1o 5'UTR deletions

The predicted secondary structure of the mouse HIF-1cr 5'UTR deletions using M. Zuker's

'mfold'program is shown. 5' and 3' ends of the mouse deletions are indicated. Numbers

represent the nucleotides of the HIF-Ict 5'UTR deletions. A. L245-286 B. A210-286 C.

Lt78-286 D.4136-286. A B

40

5È

I 3'

D /G\ C n a\ n E I I 20 '--6 \ R G

E I 10 .- t ,G c\t

0

3

s J arL

To further characterise the location of the HIF-1o IRES, two further deletion constructs were created. The first involved the deletion of the first 68 nucleotides (pRhifFAl-

68) to determine which region of the hrst 136 nucleotides was important in IRES function.

The second construct involved a substitution mutation of the polypyrimidine tract (5'-

TCTCTTTCTCC-3' to 5'-ACTATGTATCC-3') to determine whether the tract acts as a

repressor site as indicated by the deletion series (Figure 3.19 and 3.20). Each of these

constructs were transiently transfected into NIH3T3 and HeLa cells and compared to the full-

length 5'UTR. Removal of 68 nucleotides from the 5' end decreased the activity of the

downstream cistron by 32% and 37Yo in NIH3T3 and HeLa cells respectively (Figure 3.23).

Mutation of the polypyrimidine tract resulted in a dramatic increase in IRES activity in both

NIH3T3 and HeLa cells. When compared to the fulI length HIF-lcr 5'UTR, the increase in

activity was 21 fold in NIH3T3 cells and 17 fold in HeLa cells (Figure 3.23), suggesting this

site is acting as a repressor site.

To determine the effect of these deletions on the predicted secondary structure folding

patterns, Zuker's 'mfold' program was used. Deletion of the first 68 nucleotides gave a

predicted secondary structure which lacked both the Yl and Y2 structures (Figure 3.24A),

however still contained several of the internal bulges and stem-loops that were present in the

full length 5'UTR. This supports the notion that the Yl structure is not essential for IRES

function, with the internal loop outs and stem-loops likely to be the important regions for

activity. The four base substitution of the polypyrimidine tract (pRhifFAPPT), folded

identically to the wild-type 5'UTR (Figure 3.248), suggesting the polypyrimidine tract

probably acts as a specif,rc site for repressing IRES activity'

78 Figure 3.23

Deletion and mutation analysis of IRES activity of the HIF-1ø 5'UTR

A schematic representation of the dicistronic constructs used in this analysis is shown.

Constructs are based on the pRF vector. Inserts include the entire HIF-lcr 5'UTR (pRhifF)

and deletions and fragments of this sequence. The HIF-1o 5'UTR construct designation

indicate the exact nucleotide sequence deleted in each construct. Constructs were

transiently transfected into A. NIH3T3 cells or B. HeLa cells and renilla and firefly

luciferase activities measured 24 hours post-transfection. IRES activities are represented as

a percentage of the full HIF-lcr 5'UTR. Data are presented as the mean (tSEM) of

triplicate samples from four independent experiments. A PRF NIH3T3

pRhifF 1 286

pRhifFAl-68 68

286 pRhifFaPPT 1 X l-.---1 0 50 100 2000 2500 B

HeLa PRF

pRhiff 1 286

pRhifFAl-68 68

pRhifFAPPT 1 X 286 F-t 0 50 100 1400 1800

Relative Luciferase ActivitY (Firefly I Renilla) Figure 3.24

Model for secondary structure of the HIF-lcr 5'UTR deletions

The predicted secondary structure of the mouse HIF-14 5'UTR deletions using M. Zuker's

'mfold' program is shown. 5' and 3' ends of the mouse deletions are indicated. Numbers represent the nucleotides of the HIF-1u 5'UTR deletions. A. A 1-68 B. APPT. A

5\

B

PPT

3', Chanfer 3 Hl¡noxia-In rlucihle factor-lcr mRNA contains an internal entrv site

3.9 Summarv and Discussion

Initiation of translation of most eukaryotic mRNAs involves binding of the mRNA 5' cap structure by the initiation factor eIF4E. The concentration of eIF4E in the cytoplasm is rate limiting, creating a competitive environment for mRNAs to recruit eIF4E, which limits the production of certain cellular proteins. This is particularly important for key regulators of

cell growth, especially those containing long and highly structured 5'UTRs (De Benedetti et

al., 1990); (Lazaris-Karatzas et al., 1 990).

Viruses such as poliovirus have developed an effective mechanism to bypass this

competition, allowing translation of viral mRNAs despite the limitation of eIF4E (Sachs et al.,

lgg7). These viruses turn off cellular translation of its host by cleaving eIF4G, which

uncouples the cap-binding protein from the rest of the initiation machinery. The viral mRNAs

continue to be translated because they contain internal ribosome entry sites, which allow

ribosome binding, and therefore translation, without the involvement of the 5' cap.

Here I show that, in contrast to the predicted structure of the 5'UTR, HIF-10 is

eff,rciently translated. This is shown by the insertion of the 5'UTR upstream of a reporter gene,

which has no effect on expression (Figure 3.I2). This observation and rationale led me to

explore the possibility that the HIF-1clt 5'UTR contained an internal ribosome entry site.

To determine whether the 5'UTR of HIF-10( can direct internal initiation, I used a

dicistronic 6RNA assay. This assay is considered the most valid test, but only if

complemented by a clear demonstration that the downstream cistron is translated from a

dicistronic 6RNA (Kozak 2001). The experiments in Figures 3.13 provided compelling

evidence that the 5'UTR of HIF-lcr contains a functional IRES. The possibility that the

inserted 5'UTR acted to facilitate re-initiation was unlikely since Figure 3.14 showed insertion

79 Chaoter 3 Hypoxia-Inducible factor-lo mRNA contains an internal ribosome entry¡ site

of a stem-loop near the cap structure increased the ratio of firefly to renilla luciferase expression.

A pattem that is emerging from studies of cellular IRESs relates to the large size and G

-| C richness of the 5'UTRs. In fact, I was first alerted to the possibility that HIF-Icr contains an IRES by this property, and suggest that any gene found to have a 5'UTR that is G + C rich and longer than approximately 250 nucleotides is a good candidate for containing an IRES.

Whether there are more specific features that are universally essential to IRES activity remains to be determined, but the likely negative effect on cap-dependent translation of a large G + C rich 5'UTR, combined with the frequency with which genes contain a long, G + C rich 5'UTR makes it a good indicator.

Predicting the relative strengths of IRESs does not appear possible, because only a few comparisons have been made, and no feature that correlates with IRES strength is evident. I found that the HIF-1o IRES had a similar strength in the dicistronic assay to the c-myc IRES and about half the activity of the VEGF 5'UTR in both a mouse and human cell line. The greater activity of the VEGF 5'UTR does not appear to relate to its greater size, or to the fact that it contains two independent IRES elements (Huez et al., 1998), because deletion of a considerable portion of the 5'UTR can produce an even more active IRES (Stein et aL.,1998).

This is fuither supported by the finding that the c-myc 5'UTR contains two IRES elements, and is of similar to size to the HIF- I a 5'UTR (Nanbru et al. , 2001). In fact, the efficiency of the IRES may be influenced by the length between the two cistrons, indicating that IRESs must be introduced in a precise position to allow efhcient expression of the second cistron in dicistronic mRNAs (Attal et a1.,1999).

80 H A

Several observations suggest that the relative activity of an IRES may depend on the

cell tlpe. I found that the activity of the HIF-1o, c-myc and VEGF IRESs is greater in HeLa

cells than in mouse NIH3T3 fibroblasts. The c-myc IRES has also been found to be more

active in HeLa cells than in a number of other cell lines, including mouse Balb/c 3T3 and

COST cells (Stoneley et a1.,2000b). Presumably a factor that participates in IRES function is

present at limiting levels in some cells. Although I found IRES activity to be considerably

greater in HeLa than NIH3T3 cells, there was good concordance between the relative activities

of the different IRESs in the two cell lines.

The analysis of deleted versions of the 5'UTR may shed more light on the poorly

understood structure-function relationship of IRES elements in general, or may precisely

locate the IRES, depending on the type of IRES the HIF-1o 5'UTR contains (refer Section

1.2'10).In various viral IRESs, 3' end deletions that lie within the IRES completely ablate

internal ribosome entry (Borman et al., 1992); (Borman et al., 1995); (Pelletier et a\.,1988);

(Reynolds et al., 1995), whereas the HIF-14 IRES 3' end deletions resulted in a gradual loss

of activity, similar to the c-myc IRES (Stoneley et al., 1998). Deletion of specific regions of

the IRES that could be involved in mediating IRES function, such as the region with

complementarityto the 18S rRNA, had no apparent effect. Interestingly, no pair of HIF-1a

5'UTR truncation mutants (e.g. pRhifFA 1-136 and pRhifF A136-286) could recapitulate full

IRES function, indicating that numerous regions within the 5'UTR co-operate with each other for complete function. This suggests that RNA interactions with trans-acting factors are likely to involve specific recognition of sequence and / or structural elements. This has led to the identif,rcation of a putative RNA structural motif that is conseryed in several IRES elements, and is characterised by the presence of a "Y"-shaped hairpin close to the initiator AUG (Le er

81 Chanfer 3H vYìox.lâ- úrducible factor-1cr mRNA contains an internal some entry site

al., 1997). Secondary structure folding of the HIF-19 5'UTR failed to reveal a "Y"-shaped structure near the AUG codon, however deletion analysis, associated with secondary structure folding indicates that several stem-loop structures are essential for function (Figures 3.19,

3.20, 3.21, 3.22, 3.23, and 3.24).

Finally, initial deletion of the pyrimidine tract, slightly increased IRES activity in the dicistronic reporter, suggesting it may be a repressor site of IRES function (Figure 3.23).ln fact, mutation of four bases in this region with respect to the entire 5'UTR resulted in an enhancement of IRES activity, which possibly indicates the disruption of a binding site for a trans-acting factor involved in inhibiting IRES function. Several IRES-trans-acting factors

(such as polypyrimidine tract binding protein, La autoantigen and unr) have been implicated in regulating IRES activity both positively (Holcik et al., 2000); (Kaminski et al., 1998);

(Mitchell et aL.,2001); (Pestova et al.,l996b); (Pilipenko et a|.,2000), and negatively (Kim e/ a1.,2000). Fufher studies are required to characterise this site of the HIF-Icr IRES, as it may have therapeutic benefits in the activation, or suppression of HIF-1o protein expression for treatment of ischemic tissues, or blocking tumour angiogenesis.

This is the first demonstration that translation of HIF-1o is mediated by an internal ribosome entry site, and its activity is comparable to the efficiency of the c-myc IRES

(Johannes et al., 1998); (Nanbru et al., 1997); (Nanbru et a1.,2001); (Stoneley et aL.,1998).

Deletion studies suggest multiple and complex secondary structures are required for IRES activify, and the polypyrimidine tract may act as a repressor site for regulating HIF-lcr IRES function.

82 Cha ter 4

Hypoxia-Inducible Factor -L0r mRNA is spared the general reduction of translation under hypoxia, which is mediated by the internal ribosome a en STte

ì

I

t Chanter 4 HIF-1cr mRNA is snared the sen reduction of translation under hvnoxia

4.1, Introduction

When vertebrate tissues are deprived of oxygen, cellular metabolic responses are initiated to conserve energy and enhance survival. These changes include affest in the cell cycle (Amellem et aL, l99l); (Schmaltz et al., 1998), suppression of protein synthesis

(Kraggerud et aL,1995); (Tinton et a1.,1999), and increased expression of a number of genes involved in energy metabolism. The mechanism regulating translation under hypoxia is poorly understood, however hypoxia has been shown to reduce the availability of eIF4E by increasing its association with 4E-BP1, although it is suspected that there are other mechanisms that contribute to the suppression of protein synthesis (Tinton et aI., 1999). Therefore, it seems likely that the lack of oxygen suppresses several regulatory steps of translation, including the phosphorylation state of the initiation factors and other trans-acting factors.

The mRNA expression level of HIF-lct is unaffected by hypoxia (Wang et aL,1993b), suggesting that de novo protein synthesis may be required under conditions not favourable to maximal rates of translation during hypoxic stress. I wanted to determine the effect that hypoxia had on total protein synthesis and whether the endogenous HIF-lcr mRNA could bypass this suppression. In the previous chapter, data was presented indicating the HIF-lcx

5'UTR was not inhibitory to reporter gene expression, and contains an internal ribosome entry site. Therefore, it was of interest to compare the effect of the reporter gene driven by the HIF- lct IRES and a cap-dependent driven reporter gene in normoxic and hypoxic conditions to determine whether the IRES functions in conditions that are not favourable to maximal rates of protein synthesis.

In this chapter I show data indicating that protein synthesis is suppressed 50 7o in

NIH3T3 cells incubated in hypoxic conditions. I also show endogenous HIF-1a mRNA is

83 Chanfer 4 HIF-lcr mRNA is snared the I rerhrction of translation hvnoxìa

translated efficiently in normoxic conditions, but is unaffected by hypoxia which may be a function of the IRES present in the 5'UTR as indicated by experiments utilising the dicistronic reporter mRNA.

4.2 Total translation is reduced durine hvpoxia but translation of HIF-14

mRNA is not affected

To determine the extent to which translation in NIH3T3 cells was suppressed by

hypoxia, the comparison of the rate of ¡3sS1 methionine incorporation into cells that had been

exposed to hypoxia for 6, 18 or 24 hours or cultured under normoxic conditions were

compared. Hypoxia caused no decrease in the rate of methionine incorporation after 6 hours

(Figure 4.14), a207o decrease after 18 hours (Figure 4.1B) and a 507o deqease after 24 hours

of exposure(Figure 4.lC).Incellsexposedtohypoxiafor5, I7 or23 hoursbutreturnedto

normoxia for t hour before measurement of methionine incorporation, the incorporation rate

returned to that of the control cells that had not been exposed to hypoxia, indicating that the

effect of hypoxia on translation was reversible'

To investigate whether the translation rate of HIF-lcr mRNA is reduced under hypoxia,

or whether there might be a mechanism that spares HIF-1o from the overall reduction in

translation, polysome profiles of HIF-1cx, under normoxic and hypoxic growth conditions were

examined. The HIF-lcr profiles v/ere compared with those of B-actin, a protein that is not

induced during hypoxia, and GAPDH, which, although often considered a housekeeping gene,

is induced during hypoxia. Cytoplasmic extracts from NIH3T3 cells grown under normoxic or

hypoxic conditions were sedimented through sucrose gradients (Figure 4.2A). The location of

the HIF-lcx, B-actin and GAPDH mRNAs within the gradient was determined by RNase

84 Figure 4.1.

Effect of hypoxia on protein synthesis

3sS-methionine Time course of incorporation of / cystein into TCA-precipitable protein. A.

NIH3T3 cells were pre-incubated for 6 hours under normoxia or hypoxia (I7o O) or incubated for 5 hours under hypoxia, followed by t hour of normoxia. B. NIH3T3 cells were pre-incubated for 18 hours under normoxia or hypoxia or incubated in hypoxiafor I7 hours followed by t hour of normoxia. C. NIH3T3 cells were pre-incubated for 24 hours under normoxia or hypoxia, or incubated in hypoxia for 23 hours, followed by I hour of normoxia. Also shown is the incorporation into normoxic cells in the presence of 10 ttdml cycloheximide. Each measurement was nonnalised with respect to total protein as determined by Bradford assay.

The data represent the mean (+SEM) from 3 independent experiments. A 3000

o + 2000 Reoxygenated d ti * Hvooxia O. {- Nóimoxia o¡r o (n 1 000

+Cycloheximide 0 10 20 30 40 50 60 Time (mins) B 1250

1 000 o +Normoxia ofr -æReoxygenated È 750 o +Hypoxia C)

(t) 500

250 + Cycloheximide 0 10 20 30 40 50 60 Time (mins) C

2000

1500 o 9

(t) -+HYPoxia 500

+Çyçl6heximide 0 1 0 20 30 40 50 60 Time (mins) Figure 4.2

Effect of hypoxia on the translation of HIF-1c, B-actin and GAPDH mRNA's determined by polysome analysis

NIH3T3 cells were incubated for 24 hours in normoxia or hypoxia (l7o Où, and cytoplasmic extracts were fractionated by I5-507o sucrose gradient centrifugation. A.

Examples of polysome profiles showing the location of 80S ribosomes and free ribosome subunits are presented. The affow indicates where the sensitivity of the UV monitor was increased five-fold. Transcripts that were being translated at the time of extract preparation are polysome associated and sediment in fractionsJ-16, with the most actively translated transcripts toward the bottom of the gradient. B. Cytoplasmic extracts from cells grown under normoxic or hypoxic conditions were fractionated, RNA was prepared from each fraction and the HIF-lcr, B-actin and GAPDH mRNAs were detected by RNase protection assay. Each mRNA from the RNase protection assay was quantitated by phosphorlmager and calculated as a percentage of the total for that mRNA. Data for fractions 1-6 and 7-16 were pooled and represented as translated or untranslated regions of the gradient, respectively. Black bars show data for normoxic cells and white bars show data for hypoxic cells. The data represent the mean (tSEM) from three independent experiments. A

Normoxia Hypoxia

Untranslated Untranslated l¡ted I rfed + +

1.5 1.5 \o N oì 60s â 60s o 1.0 o 1.0 40s

0.-s ROS 0.5

2 4 6 8 101214 16 2 4 6 8 10121416 Top Fraction Number Bottom Top Fraction Number Bottom

B

HIF-1cr B-Actin GAPDH 100 100 7 <15 75 z 4so 50 szs 25

0 0 Translated Untranslated Translated Untranslated Translated Untranslated .l ahante.r 4 HIF-1a rnRNA is snared the re.drrctinn nf transl ation ììn hvnnxia

protection assay of fractions from the gradient and the proportion of mRNA that was associated with polysomes was quantitated (Figure 4.28). In cells grown under noünoxic conditions, the majority of the p-actin mRNA was found in the polysomal fraction, with only

237o of the mRNA in the fractions corïesponding to untranslated mRNA. However, the proportion of untranslated B-actin mRNA was substantially increased in cells grown under hypoxia, with 467o of the mRNA located in the nonpolysomal region of the gradient' In contrast, the proportion of HIF-lcx mRNA associated with polysomes was unaffected by hypoxia, indicating the translation rate of HIF-1ct was maintained. The proportion of GAPDH mRNA within the polysome region of the gradient was also largely unaffected by hypoxia.

The GAPDH 6RNA was less efficiently translated than either HIF-1o or p-actin under both growth conditions with only 50-607o of the mRNA sedimenting within the polysome region.

These results indicate that translation of the HIF-1cr and GAPDH mRNAs is not suppressed by hypoxia. The maintenance of translation of GAPDH mRNA under hypoxia has not been investigated further. Unlike HIF-14, the GAPDH 5'UTR is of average length and base composition, although it does contain a 5' terminal polypyrimidine tract.

4.3 HIF-1 cx IRES activitv d hvnoxia and serum vation

The function of the IRES in the HIF-lcx 5'UTR might be to allow efficient translation during hypoxia. If this were the case, the translation of firefly luciferase from the dicistronic

RhifF pRNA would be expected to be relatively unaffected by hypoxia. To test this, NIH3T3 cells transfected with the dicistronic pRhifF gene were subjected to hypoxia fot 24 hours and the relative luciferase activities were measured (Figure 4.3). Under hypoxia, renilla luciferase

activity was reduced50Vo of the level seen in normoxic cells (Figure 4.3A), consistent with

85 Figure 4.3

IRES activity is maintained during hypoxia

NIH3T3 cells were transiently transfected with pRhifF (Figure 3.44). Four hours post- transfection, cells were subject to either hypoxia or left under control conditions for a further 24 hours before harvesting and assay for renilla and firefly luciferase. Each luciferase activity is shown relative to the activity under normoxia, which is expressed as

lO0 %o. A. The histogram shows renilla luciferase activity with N = Normoxia (black bars) and H= hypoxia (Red bars). B. The histogram shows firefly luciferase activity. C. Shows the ratio of firefly to renilla luciferase activity. The ratios are graphed relative to the ratio obtained with pRF under normoxia, which was given a value of 1. The data shown are means (tSEM) of triplicate samples from each of five independent experiments. Statistical significance of the difference between normoxia and hypoxia was tested using the two- tailed Students / test (x** p<0.0001). ô tÉ

Relative Luciferase Activity % Firefly Luciferase %o Renilla Luciferase QireflylRenilla) Activity Activity (/r (Jr l.J { ì.J L¡l qtr O(¡r (r¡ (Jr 9r{ O lct z l4 z

|Ji z )ji * Ér * Chaoter 4 HIF- 1cr mRNA is soared the I reduction of translation under hvnoxla

the effect of hypoxia on total translation rate measured by incorporation of [3sS] methionine

(Figure 4.1). In contrast, firefly luciferase activity was the same in normoxic and hypoxic cells, indicating that IRES-mediated translation is unaffected by hypoxia (Figure 4.38).

Together, these findings result in a significant increase in the ratio of firefly to renilla luciferase activity, due to the decrease in cap-dependent translation (Figure 4.3C).

To examine whether the HIF-1cx IRES also conferred a translational advantage during other forms of cellular stress, cells were also subjected to serum starvation for 24 hours.

Serum starvation reduced expression of both renilla luciferase and firefly luciferase (Figure

4.4A and B), but the renilla luciferase activity was the more affected, suggesting that IRES- dependent translation was less sensitive than cap-dependent translation to the serum starvation. When serum starved cells were subjected to hypoxia, the renilla luciferase activity was further reduced by 507o (Figure 4.4^), but firefly luciferase activity was maintained at the same level as in normoxic serum starved cells (Figure 4.48). Thus the ratio of firefly to renilla luciferase was greatest in cells subjected to deprivation of both serum and oxygen (Figure

4.4C). The results are consistent with the function of the IRES being to maintain efficient translation of HIF-1o during hypoxia.

4.4 The effect of hvnoxia and serum denrivation on the VEGF and c-mYc

IRES

The property of the HIF-lcx IRES of protecting translation from suppression by hypoxia might be a specific feature of the HIF-lcr 5'UTR, or could be a general property of all hypoxically induced genes. To investigate whether this property might be shared by other hypoxically regulated mRNAs containing an IRES, the effect of hypoxia and serum

86 Figure 4.4

IRES activity is maintain during hypoxia

NIH3T3 cells were transiently transfected with pRhifF (Figure 3.44). Fours hours post- transfection, cells were subjected to either hypoxia (H, red bars), serum starvation (SS, blue bars), serum starvation and hypoxia (H + SS, green bars) or were left under control conditions (N, black bars) for a further 24 hours before harvesting and assay for renilla and firefly luciferase. Each luciferase activity is shown relative to the activity under normoxia, which is expressed as 100 7o. A¡. The histogram shows renilla luciferase activity. B. The histogram shows firefly luciferase activity. C. The histogram shows the ratio of firefly to renilla luciferase activity. The ratios are graphed relative to the ratio obtained with pRF under normoxia, which was given a value of 1. The data shown are means (tSEM) of triplicate samples from each of five independent experiments. Statistical significance of the difference between normoxic and treatments was tested using the two-tailed Students / test.

(** p< 0.001; xxx p<0.0001). The effect of hypoxia on serum starved cells (H + SS vs SS) is shown in brackets. ô EÉ

Relative Luciferase Activity % Firefly Luciferase %o Renilla Luciferase (Firefly/rRenilla) Activity Activity HIJ (.,rO(Jr U¡ l.J \¡ ì.J\¡ o o O(,r L'I (r¡ (Jr oooo lct z 14 z

Éi z l¡{ (A * Ë CA (t) .* F V) h + U) * Fd + (t) V) * ct) (A (A + V) U) deprivation was tested on the VEGF IRES, which also functions during hypoxia (Stein et al.,

1998). To test this, NIH3T3 cells were transfected with pRvegfF and subjected to hypoxia, serum deprivation or hypoxia and serum deprivation for 24 hours and the relative luciferase activities measured. Under hypoxia, renilla luciferase activity was reduced 507o of the level seen in normoxic cells (Figure 4.54), whereas firefly luciferase activity was only marginally reduced (Figure 4.5B). The VEGF IRES resembled the HIF-lcx IRES in being less sensitive to serum starvation than was the cap-dependent translation of renilla luciferase, indicated by the approximately two fold increase in the ratio of firefly to renilla luciferase (Figure 4.5C). The differential sensitivity to hypoxia was maintained in cells starved of serum.

To investigate whether this property of the IRES was limited to IRESs in hypoxically regulated genes, or a general property of cellular IRESs, the effect of hypoxia or serum starvation was tested on the c-myc IRES, which is notknownto play a role in the response to hypoxia. The dicistronic pRmycF gene was transfected into NIH3T3 cells, and subjected to hypoxia, serum deprivation or hypoxia and serum starvation for 24 hours prior to harvesting and assay for renilla and firefly luciferase activity. Firefly luciferase activity from the c-myc dicistronic reporter was only marginally reduced by hypoxia, whereas renilla luciferase activity was significantly reduced (507o) (Figure 4.6A and B). Serum starvation reduced expression of both renilla luciferase and firefly luciferase, but renilla luciferase activity was the more affected. When serum-starved cells were subjected to hypoxia, there was a further

507o reduction of renilla luciferase (Figure 4.61'), but firefly luciferase activity was maintained at the same level of normoxic serum starved cells (Figure 4.6B). Therefore, the ratio of firefly luciferase to renilla luciferase was greatest in cells subjected to both hypoxia

87 Figure 4.5

IRES activity is maintain during hypoxia

NIH3T3 cells were transiently transfected with pRvegfF (Figure 3.64). Fours hours post- transfection, cells were subjected to either hypoxia (H, red bars), serum starvation (SS, blue bars), serum starvation and hypoxia (H + SS, green bars) or were left under control conditions (N, black bars) for a further 24 hours before harvesting and assay for renilla and firefly luciferase. Each luciferase activity is shown relative to the activity under normoxia, which is expressed as 100 7o. A,. The histogram shows renilla luciferase activity. B. The histogram shows firefly luciferase activity. C. The histogram shows the ratio of firefly to renilla luciferase activity. The ratios are graphed relative to the ratio obtained with pRF under normoxia, which was given a value of 1. The data shown afe means (+SEM) of triplicate samples from each of five independent experiments. Statistical significance of the difference between normoxic and treatments was tested using the two-tailed Students / test.

(** p< 0.001; *xx p<0.0001). The effect of hypoxia on serum starved cells (H + SS vs SS) is shown in brackets. c) EÉ

Relative Luciferase Activity % Firefly Luciferase Yo Renilla Luciferase (Firefly/Renilla) Activity Activity l.J (.ho(,¡ O oooo O IE z z l4 z * (t) (A H * (t) V) |Jr .* F * o Éi V) * 0a + + (A * H V) (A 4 (A (A * + * V) * U) Figure 4.6

IRES activity is maintain during hypoxia

NIH3T3 cells were transiently transfected with pRmycF (Figure 3.7A). Fours hours post- transfection, cells were subjected to either hypoxia (H, red bars), serum starvation (SS, blue bars), serum starvation and hypoxia (H + SS, green bars) or were left under control conditions (N, black bars) for a further 24 hours before harvesting and assay for renilla and firefly luciferase. Each luciferase activity is shown relative to the activity under normoxia, which is expressed as 100 7o. 4,. The histogram shows renilla luciferase activity. B. The histogram shows firefly luciferase activity. C. The histogram shows the ratio of firefly to renilla luciferase activity. The ratios are graphed relative to the ratio obtained with pRF under normoxia, which was given a value of 1. The data shown are means (ISEM) of triplicate samples from each of five independent experiments. Statistical significance of the difference between normoxic and treatments was tested using the two-tailed Students t test.

(* p< 0.01;xx p< 0.001, xxx p<0.0001). The effect of hypoxia on serum starved cells (H +

SS vs SS) is shown in brackets. c) EÉ

Relative Luciferase Activity % Firefly Luciferase Yo Renilla Luciferase (Firefly/Renilla) Activity Activity Ê l.J \¡ l..) (,,¡ O L¡I L'I Our (J¡ (,¡¡ OOOO o IE l4 z z z (A (t) * v) V)

(A * + + V) * (A u) U) V) + V) V) Chanter 4 HIF-lcr mRNA is snarerl the qen reduction of translation rrnder hvnoxia

and serum deprivation (Figure 4.6C). Thus, the maintenance of activity during hypoxia may be a general property of IRES-mediated initiation of translation.

4.5 Summary and Discussion

The data presented in this chapter show that protein synthesis in NIH3T3 cells is reduced when cells are cultured under hypoxic (I7o C'2) conditions. Total protein synthesis measured by methionine plus cysteine incorporation was reduced by 50 7o after 24 hours exposure to hypoxia, and a similar reduction was seen in the level of cap-dependent luciferase reporter in transfected cells subjected to hypoxia. These observations are consistent with previous reports that hypoxia causes a suppression of protein synthesis by 55 Vo inrat astrocytes (Stein et aL,

1998), 70 - 85 7o in rat hepatocytes (Tinton et al., 1999) and 60 - 70 7o in the human cervical cell line NHIK 3025 (Kraggerud et aL, 1995). Interestingly, the suppression of protein synthesis was delayed upon exposure to hypoxia, as after 6 hours of treatment, protein synthesis rates were relatively unaffected. This suggests that either cells can synthesise proteins for a relatively long time as oxygen tension decreases, or the diffusion of oxygen out of the cell is slow in this system. However, the former seems most likely as reoxygenation of hypoxic cells for t hour resumed protein synthesis rates to normal, indicating diffusion of oxygen back into the cell is a rapid process. Rapid reoxygenation of hypoxically cultured cells is consistent with a previous report, in which cells exposed to hypoxia recovered to normal rates of protein synthesis within 30 minutes (Lefebvre et aI., 1993).

Using polysome profile analysis to assess the effect of hypoxia on the proportion of B- actin mRNA that cosedimented with polysomes, I found it was reduced in hypoxia, consistent with the reduction in overall protein synthesis. However, the association of HIF-lcx mRNA

88 1À Chanter 4 I{TF- 1 cx, mRNA is the seneral reduction of translation under h

with polysomes was unaffected by hypoxia, suggesting the HIF-14 mRNA is translated

equally well under normoxia and hypoxia. This finding is consistent with a recent report of the

effect of hypoxia on polysome profiles in HeLaS3 cells, in which the translational activities of

p-actin and the ribosomal protein L28 were reduced by hypoxia, but HIF-1o was unaffected

(Gorlach et a\.,2000).

In chapter 3, I presented data, using a dicistronic reporter, that the HIF-lcr mRNA

5'UTR contains an internal ribosome entry site. Because IRES elements do not require

association with the rate-limiting oIF4E cap-binding protein, and hypoxia had no effect on

HIF-1g translation efficiency as seen in polysome profiles, it was possible the IRES was

utilised to maintain efficient translation under low oxygen conditions. Indeed, I found using

the dicistronic reporter that the HIF-lcr IRES was unaffected by hypoxia when compared to

the effect of the cap-driven reporter. A number of cellular proteins that function during stress

conditions have also been found to contain an IRES, and it is reasonable to postulate that these

mRNAs contain IRESs to ensure their translation is not compromised during the stress

condition (Holcik et aI., 1999); (Stoneley et aL,2000a); (Vagner et a\.,1996)' This has been

proposed to be the function of the IRES in VEGF mRNA, which like HIF-lcr has an important

function during hypoxia (Stein et al., 1998). Although additional regulatory mechanisms

contribute to the expression of both HIF-1ø and VEGF during hypoxia, polysome profile

analysis indicates that both transcripts remain efficiently translated during hypoxia (Gotlach et

at.,2000); (Stein et a\.,1998) (Figure 4.2).

The maintenance of translation rate during hypoxia is not restricted to hypoxia-induced

genes, because the c-myc IRES also had this property. Furthermore, I also found that

translation from the HIF-Iø, VEGF and c-myc IRESs was less inhibited by serum starvation

89 than was the translation of a cap-dependent reporter, and a similar observation has recently been made with the IRES from the X-linked inhibitor of apoptosis (XIAP) mRNA (Holcik e/ al., 1999). Thus, the preservation of translational efficiency during cellular stress may be a common feature of all cellular IRESs.

90 Chapter 5

Activation of the phosphatidylinositol 3-kinase signaling pathway increases hypoxia-inducible factor- 1 cr internal ribosome entry. sffe'aqtivitY

Ê

t I t ¡ **.

t

I !

t I

"l t ,

I I Chanter 5 Acfivafion of the PI3K si snalin s nathwav increases HTF-1cr TRES vit

5.1

The accumulation of HIF-lcr protein can be increased by genetic alterations that affect either HIF-1cr protein synthesis or prevent ubiquitination and proteasomal degradation. These genetic alterations can include loss of function mutations in tumour suppressor genes encoding p53, PTEN, and VHL, as well as gain of function mutations in oncogenes that activate the phosphatidylinositol-3 kinase (PI3K), Src, and mitogen activated protein (MAP) kinase signal transduction pathways (Jiang et al., 1997b); (Maxwell et al., 1999); (Ravi et al., 2000);

(Zhong et a1.,2000); (Zundel et a1.,2000). Notably, loss or gain of HIF-I activity is negatively and positively correlated, respectively, with tumour growth and angiogenesis (Carmeliet et ctl.,

1998); (Jiang et aI., I991b); (Kung et a1.,2000); (Maxwell et al', 1997); (Ravi et a1.,2000);

(Ryan et a\.,1998); (Ryan et a\.,2000).

One of the most recognised genetic alterations identified in breast cancer is the increased activity of the ImR2 receptor kinase, which is encoded by the ERBB2 gene (Pegram et aI., 1998). IIER2 overexpression is associated with activation of AKT via the PI3K signaling pathway and this overexpression, or stimulation of cells with heregulin, has been

shown to induce VEGF mRNA and protein expression in cancer cells (Baghei-Yarmand et

a\.,2000); (Ltu et a\.,1999); (Yen et a|.,2000); (Zhou et a\.,2000).

Because HIF-I has been shown to lie downstream of FIER2 and PI3K-AKT signaling

and upstream of VEGF expression in tumour cells (Feldser et a\.,1999); (Zhong et aL.,2000),

it is likely HIF-1a levels are also increased. Indeed, upon stimulation of cells with heregulin,

an accumulation of HIF-1a protein in non-hypoxic conditions is observed. This accumulation

of HIF-lcr protein through activation of the PI3K pathway by heregulin does not affect HIF-

lcr protein stability, but dramatically increases the rate of protein synthesis (Laughner et aI.,

91 Chaoter 5 vation of the PI3K sisnalins wav increases HIF-1cr IRES activitv

2001). mTOR, a downstream target of AKT has also been shown to be required for HIF-lcr protein synthesis, by the observation that addition of rapamycin markedly inhibited heregulin induced HIF-lcx translation (Laughner et al., 2001). A potential mechanism involves the phosphorylation of 4E-BP by mTOR (Gingras et a\.,1999b); (Hara et a\.,1997); (Peterson e/ al., 1999), decreasing its ability to bind to eIF4E, and thereby enhancing cellular translation rates. However, this mechanism provides a general mechanism of translation up-regulation, rather than a specific activation of HIF-lcr protein synthesis.

Laughner et al (2001) showed a luciferase reporter driven by the HIF-1cx promoter, and containing the 5'UTR, increased expression approximately five-fold upon heregulin stimulation. However, deletion of the last 252 nucleotides of the 5'UTR abolished the heregulin stimulated gene reporter expression. In chapter 3, I showed data indicating the HIF- lcl¿ 5'UTR contains an internal ribosome entry site. This led me to hypothesise that the mechanism of HIF-1a protein up-regulation in response to heregulin stimulation may involve a specific activation of the IRES.

To assess whether the HIF-lcx IRES was activated by heregulin stimulation, MCFT breast cancer cells were transfected with the HIF-Iø dicistronic IRES reporters. Data in this chapter indicate activation of the PI3K pathway by heregulin can concomitantly increase both cap-dependent translation and HIF-lcr IRES activity and this activation of the HIF-1o IRES

appears to act in an Akt-independent signaling pathway.

5.2 Akt constructs

To assess whether Akt is involved in the up-regulation of the HIF-lcr IRES, two Akt

constructs were used (A kind gift from Dr. Mark Guthridge) as described (Guthridge et al.,

92 Chaoter 5 vation of the PI3K sisnalins wav increases HIF-1cr IRES actrvrtv

2000). Briefly, pHA-AKT contains the Akt coding region, driven by the CMV promoter

(Figure 5.1). pmyrAKT-HA contains the SRC-myristylation signal, resulting in a constitutively active AKT protein. These constructs can be utilised to determine the difference between overexpression of Akt in cells, and an overexpression of a constitutively phosphorylated form of Akt to determine whether upstream signaling is required to activate

Akt, and exert its affect on its target genes.

s.3 H stimulation increases HIF-14 Drotein. but not levels

There is conflicting data in the literature on the accumulation of HIF-lcx in response to activation of the PI3K signaling pathway. Several groups have shown data suggesting the

PI3K pathway can increase HIF-1cr protein levels in non-hypoxic conditions, with little effect on mRNA levels (Alvarez-Tejado et al., 2002); (Jiang et a1.,2001); (Stiehl et al., 2002);

(Treins et a1.,2002). However, this accumulation appears to be cell line specific, because in certain cell lines, activation of the PI3K pathway has little effect on HIF-1o protein levels

(Alvarez-Tejado et a1.,2002); (Arsham et a1.,2002). Since the PI3K pathway has been shown to increase HIF-1cx protein expression in response to activation by epidermal growth factor; I wanted to determine whether this same accumulation of HIF-14 protein occurred by a translational mechanism that utilised the IRES present in the 5'UTR of the HIF-lcx mRNA.

Heregulin stimulation will mimic the effect of I{ER2 overexpression, and allow the

determination of the involvement of HIF-1o expression in breast cancer cells.

MCFT cells were serum starved, and subjected to stimulation by fetal calf serum (FCS),

heregulin, or FCS and heregulin, followed by RNA and protein extraction. Stimulation of

serum-starved MCFT cells did not affect HIF-14 mRNA levels, however GAPDH mRNA

93 Figure 5.1.

Plasmid maps of the Akt expression vectors pHA-Akt and pmyc-Akt-HA.

A. The plasmid map of pHA-AKT is shown. The AKT coding region is driven from the

CMV Early promoter, which contains an N-terminal HA-tag. The ampicillin resistance cassette and origin of replication (ori) are also shown. B. The plasmid map of pmyrAKT-

HA is shown. The AKT coding region is driven from the CMV Early promoter, containing the sequence of the myristylated c-src (myr). The C-terminal HA-tag is shown. The ampicillin resistance cassette and origin of replication (ori) are also shown. The sequence from the HindIII to the XbaI site, containing the SRC myristylated residues is also shown. A

Amp'

or

BamH I pHA-AKT

lmmediate Early Enhancer/Promoter HA-

H/nd lll

B

Amp'

ori EcoRI HA-tag pmyrAKT-HA

AKT

Xba Hind lll

AAGCTTATGGGGAGCAGCAAGAGC AAGCCCAAGTCTAGAATGAAC --HindlII src-myr signal -- XbaI Chanter 5 Acti vation of the PI3K sisnalins nafhwav increases F{TF- cx TRES acfivifv

levels were increased approximately three-fold in response to all stimuli (Figure 5.2 A and B).

Stimulation with heregulin, or FCS, did not alter HIF-1a mRNA, consistent with previous

results (Laughner et al.,20Ol). HIF-lcx, protein was undetectable in non-stimulated cells, but

upon stimulation with FCS for 24 hours, a band of the approximate size of HIF-lcr was

detected (Figure 5.2C). This same band was also present with cells stimulated with heregulin, however, to confirm equal loading, blotting with a control is required. This data suggests that stimulation with heregulin, an additional band at approximately 40 kDa was activUpon o observed. The identity of this band is unknown, but may represent cross-reactivity with trans.-^_-

the secondary antibody.

5.4 Cap-dependent translation and HIF.lcr IRES activity are concomitantlv up-regulated in response to herequlin stimulation

Laughner et al (2001) has shown that the 5'UTR of HIF-lcr is essential for increased protein synthesis in response to heregulin treatment. To test whether this increase in expression was mediated by the HIF-14 IRES, I subjected stable transfectants of MCFT cancer cells expressing the dicistronic reporters, pRF, pRhifF, or pstemRhifF to stimulation with FCS, heregulin, or FCS and heregulin together.

Treatment of serum-starved MCFT cells with FCS, expressing pRF (which is the control dicistronic reporter construct, containing only a linker sequence between the two reporter genes), stimulated Renilla luciferase activity (cap-dependent translation) approximately two-fold, whereas heregulin stimulation resulted in a six-fold increase (Figure

5.34). Treatment of serum starved cells with heregulin and FCS had a more modest stimulation of the Renilla reporter gene expression (less than three-fold). Firefly luciferase expression was extremely low, but detectable above background (refer Chapter 3) and in

94 Figure 5.2

Endogenous HIF-1a protein levels increase upon heregulin stimulation

MCFT cells were serum starved for 24 hours and exposed to no treatment (SS), 10 Vo FCS

(FCS), 100 nglml heregulin -o (Her) or 10 7o FCS and 100 nglml heregulin-a together

(H+F) for 24 hours prior to harvesting for RNA. A. RNA analysed by RNase protection

assay, using an HIF-lcr specific probe (top panel) or GAPDH internal control (bottom panel) is indicated. B. RNA was subjected to quantitation by phosphorlmager. The histogram on left shows HIF-1o mRNA levels, the middle histogram shows GAPDH counts and the histogram on right shows the ratio of HIF-lcx mRNA to GAPDH mRNA.

The data presented is the mean (tSEM) of duplicate samples from two independent experiments. C. Western analysis. Cell lysates were prepared from stimulated and unstimulated cells as indicated and subjected to immunoblot assay with an anti-HlF-lq polyclonal antibody. The HIF-lcr protein is indicated. The migration of protein size standards is shown. A

SS FCS Her Her + FCS È.È" +. p eAr HIF-1cr*ff lf !I* :',r.: a-)-

GAPDH+

B

Io m ôO x I Hl 0 t 940 Ê U) 830 È 7 É 1 É (, 5 o âro ð 5 ð I Eto t f¡r t\ SS FCS Her H+F Ofo SS FCS Her H+F SS FCS Her H+F o /,RI

C %" sût,{il%

1r3.7 + 80.9+ €HIF-1cr 63.8+ 49.5+

37.4+ Figure 5.3

Effect of heregulin stimulation on cap-dependent translation

Stably transfected MCFT cells expressing pRF (See Fig 3.2) were serum starved and exposed to no growth factor (SS, black bars), 10 % FCS (blue bars), 100 ng/ml heregulin

(Her, yellow bars) 10 7o FCS and heregulin together (green bars) for 24 hours and cell lysates were prepared for dual luciferase assays. A. Histogram showing renilla luciferase activity. B. Histogram showing firefly luciferase activity. C. Histogram showing the ratio of firefly to renilla luciferase, with the ratio obtained under serum free conditions given a value of l. The data shown are means (ISEM) of triplicate samples from each of three independent experiments. Statistical significance of the difference between SS and ** *x* treatment was tested using the two-tailed Students / test (* p< 0.05; p< 0.001; p<

0.0001). o tË

Relative Luciferase Activity Firefly Luciferase Activity Firefly lRenilla O Renilla Luciferase Activity OOP9 O I (Jr{ (/r O b oo N (-r¡ o (-¡¡

(A (A V) V) V) V)

t-ÎJ ÞrJ +1 tÊ o * o (t)o * V) (/)

Ér lç lê (D lÊ (D .lÊ o lÉ r-t 4

|Ji (D o r-to r-t t lÊ + lË + + åÊ Fd Frl oFrJ o o V) (A V) Chanter 5 Activation of fhe PTSK siqnalins wav increases HIF-1cx IRES activitv

contrast, to renilla luciferase expression, was unaffected by stimulation with FCS or heregulin

(Figure 5.38). This suggests stimulation of serum-starved MCFT cells with heregulin or FCS, results in a significant increase in renilla luciferase expression, indicating these stimuli can increase the rate of cap-dependent translation.

Treatment of serum starved MCFT cells expressing pRhifF with FCS or heregulin, stimulated renilla luciferase activity approximately two fold indicating an up-regulation of cap-dependent translation, (similar to pRF, Figure 5.34) (Figure 5.44). Firefly luciferase expression, driven from the HIF-lcr IRES was also increased between 1.5- to 2-fold upon stimulation with FCS, heregulin, or a combination of the two (Figure 5.48). Due to the concomitant increase in both renilla and firefly luciferase activity, the ratio of renilla to firefly luciferase remained largely unaltered in response to all of the stimuli (Figure 5.4C).

To confirm activation of the HIF-lcr IRES in response to heregulin stimulation, and avoiding the effect of translation of the upstream reporter, (since serum-starvation may create a more competitive environment for cap-dependent translation of certain mRNAs) the pstemRhifF dicistronic reporter plasmid was expressed in MCFT cells. Cells were serum starved and subjected to stimulation with FCS or heregulin, and luciferase activities measured

24 hours post-stimulation. Renilla luciferase activities were low, and unaffected by FCS or heregulin stimulation, indicating the stem-loop at the 5'end of the mRNA transcript was suppressing cap-dependent translation (Figure 5.54). The expression of firefly luciferase upon stimulation with FCS resulted in only a modest increase in activity (1.5 fold), whereas stimulation with heregulin gave an increase of l.8-fold (Figure 5.58). Exposure to both heregulin and FCS resulted in l.7-fold increase in firefly luciferase expression, suggesting heregulin stimulation can saturate HIF-1o IRES expression via PI3K signaling. This results in

95 Figure 5.4

Effect of heregulin stimulation on the HIF'1a IRES reporter

Stably transfected MCFT cells expressing pRhifF (See Figure 3.4A) were serum starved

and exposed to no growth factor (SS, black bars), I0 7o FCS (blue bars), 100 ng/ml heregulin (Her, yellow bars) 10 7o FCS and heregulin together (green bars) for 24 hours

and cell lysates were prepared for dual luciferase assays. A. Histogram showing renilla

luciferase activity. B. Histogram showing firefly luciferase activity. C. Histogram showing

the ratio of firefly to renilla luciferase, relative to the ratio obtained for pRF (Figure 5.2)

under serum free conditions, which was given a value of 1. The data shown are means

(tSEM) of triplicate samples from each of three independent experiments. Statistical

significance of the difference between SS and treatment was tested using the two-tailed

Students / test (* p< 0.01; x* p( 0.001; t

Relative Luciferase Activity Renilla Luciferase Activity Firefly lRenilla Firefly Luciferase Activþ O O I (,r I N) (r¡ \ì O O Ll¡ o ì\J u.) Þ o L¡r O (r¡ o

V) (t) V) (t) V) (A

|:n ÞIl rl ,F * o o ,þ o * V) V) U) *

H Éi Ér |Ji CD (D * o :r ¡-t n ,þ r-t

Éi o (D (D n i ,F |l + + :|. + * Frl Fd ,F Fí o o o V) V) (A Figure 5.5

Effect of heregulin stimulation on HIF-a IRBS activity

Stably transfected MCFT cells expressing pstemRhifF (See Figure 3.48) were serum starved and exposed to no growth factor (SS, black bars), 10 % FCS (blue bars), 100 nglml heregulin (Her, yellow bars) 10 7o FCS and heregulin together (green bars) for 24 hours

and cell lysates were prepared for dual luciferase assays. A. Histogram showing renilla

luciferase activity. B. Histogram showing firefly luciferase activity. C. Histogram showing

the ratio of firefly to renilla luciferase, relative to the ratio obtained for pRF (Figure 5.2)

under serum free conditions, which was given a value of 1. The data shown are means

(ISEM) of triplicate samples from each of three independent experiments. Statistical

significance of the difference between SS and treatment was tested using the two-tailed

Students / test (* p< 0.05; ** p< 0.01; xx* p< 0.001). ô EÉ Relative Luciferase Activity Firefly I Renilla Firefly Luciferase Activity ol.J Renilla Luciferase Activity O P (-r¡ \¡ P 9P9P O O (,¡¡ (,¡¡ o O HI.JUJS

(A (t) u) (A V) V)

Þ1l r1 Þ11 ,þ c) ô r& ô (A V) (t)

H H Ér * |Ji r¡ (D IE (D * (D 4 E * Ë

H H (D É{ t-t o o Ft * 4 + !F + åF + Þ1l ìl * ÞIl o o o (/) V) V) Chanter 5 Activafion of the PI3K si snalins nathwav HTF-1crIRES activitv

a ratio of firefly to renilla luciferase that increases significantly in response to stimulation with heregulin (Figure 5.5C), indicating HIF-1o IRES driven firefly luciferase expression may be increased in response to activation of the PI3K pathway by heregulin.

5.5 of serum-starved MCFT cells with hereeulin does not alter fTreflv luciferase mRNA levels

The increase of renilla and / or firefly luciferase expression seen in serum starved MCFT cells containing the pRF, pRhifF, or pstemRhifF reporters stimulated with heregulin or FCS could be due to an increase in mRNA levels rather than a concomitant increase in reporter expression due to an up-regulation of translation. To determine the effect of heregulin and

FCS on 6RNA expression levels, RNase protection analysis was performed on RNA extracted

from serum-starved MCFT cells expressing pRF (Figure 5.6A), pRhifF (Figure 5.68), or

pstemRhifF (Figure 5.6C), stimulated with FCS, heregulin, or FCS and heregulin together.

Firefly luciferase mRNA levels for all three reporter plasmids (pRF, pRhifF, and

pstemRhifF) were relatively unaffected upon stimulation with FCS or heregulin (Figure 5.7,

left histograms), indicating the RNA levels of the dicistronic reporter were unaffected by

exposure to stimulus. Quantitation of the internal control, GAPDH, was also measured, and as

seen in Figure 5.2, GAPDH mRNA levels were increased approximately two-fold upon the

stimulation of serum starved cells with FCS, or heregulin (Figure 5.7, middle histograms).

Because the level of GAPDH mRNA, which is used as an internal standard, is increased as a

result of stimulation with FCS or heregulin, data is presented without normalisation, to show

that there is no apparent bias of the HIF-1cr mRNA levels. The levels of GAPDH mRNA were

consistently increased two- to three-fold upon stimulation of MCFT cells with FCS or

96 Figure 5.6

Analysis of mRNA levels following Heregulin-c stimulation in MCFT cells

MCFT cells expressing A. pRF, B. pRhifF, C. pstemRhifF were serum starved and exposed to no growth factor (SS), 10 Vo FCS, 100 nglml heregulin-ø or 10 7o FCS and 100 nglml heregulin-cx for 24 hours prior to harvesting for RNA. RNA from duplicate samples in

separate dishes was analysed by RNase protection assay and protection products for probe to firefly luciferase of the reporter plasmid and the protected product for the GAPDH internal control is indicated. A PRF SS FCS Her I{er + fCS

FF Luciferase*

GAPDH+

B

pRhifF

SS FCS Her Her + FCS

FF Luciferase* GAPDH+ ffi*

C pstemRhifF

SS FCS Her Her + FCS d FFluciferase* Ü *.* dÊfe * ? GAPDH+ Figure 5.7

RNA levels upon Heregulin-ctr treatment in MCFT cells remains relatively unaltered

RNA from figure 5.6 was subjected to quantitation by phosphorlmager. Firefly luciferase counts are shown in the left histograms and GAPDH counts are shown in the right histograms. RNA from MCFT stable cell lines expressing A. pRF; B. pRhifF; C' pstemRhifF are shown. The stimulation of the serum starved cells were 10 % FCS (Blue bars), 100 nglml heregulin-ø (yellow bars), 10 % FCS and heregulin-cr (green bars) and no growth factor (Black bars). Data is presented as the mean (tSEM) from duplicate samples from three independent experiments. c) EÉ

Firefly Luciferase Firefly Luciferase Firefly Luciferase (l0a) Counts (lOa) Counts (104) Counts(, o (.,r OO (A V) (t)U) ct) (A Fd Þrl ÞIl o o o V) CA u) (D (D (Dä Ft |¡r |Jr + + rfl+ r! E

U' (D E F ,AJ F !+ 4l ãt counts (106) GAPDH counts (106) Ë GAPDH counts (106) GAPDH (j \¡ l..J \¡ l.J -l (-tl Ltr (lr V) V) (A (A V) (A o41 oÞ1l (A V) Ér (D CD tslo Ft ä É{ + + + FÎI Ìl ÞrJ Chnnfer 5 A vâfion of the PI?K si qnalin o wav lncreases HTF-1¡-r TR acfivitv

heregulin, resulting in GAPDH not being an ideal internal control in normalising HIF-1g

mRNA levels. Since HIF-14 mRNA levels were unaltered without normalisation to the

fluctuations observed with GAPDH mRNA levels, this indicates the increased expression of

both renilla and firefly luciferase protein levels (Figures 5.3, 5.4 and 5.5) was due to an up-

regulation of translation, and not increased mRNA expression.

5.6 The PI3K sienaline nathway resulates HIF-La IRES activity

In section 5.4 and 5.5, results indicated that stimulation of MCFT cells with heregulin

causes an increase in HIF-14 IRES activity. To determine whether this increase in HIF-lcx

IRES activity was regulated via the PI3IIAKT signaling pathway, MCFT cells were treated

withLY294002, or wortmannin, which act to specifically inhibit PI3K activity. Treatment of

cells expressing the control dicistronic reporter, pRF, with LY294002, or \ /ortmannin, resulted

in a decrease of renilla luciferase activity (Figure 5.84 left histogram). The decrease in expression of renilla luciferase was noticeable after 5 hours of treatment, with longer exposure resulting in a more dramatic loss of expression, holever secondary effects of these chemicals may contribute to loss of reporter expression at the 24 hour time-point. Firefly luciferase expression appeared to be decreased to a more modest extent upon treatment with LY294002 or wortmannin, however the expression from the downstream cistron in the absence of an

IRES is extremely low, and quantitation is not reliable (Figure 5.84, middle histogram). This results in a ratio of firefly to renilla luciferase that remains largely unaffected by treatment with the PI3K inhibitors (Figure 5.84, right histogram)

MCFT cells expressing the dicistronic reporter plasmid containing the HIF-lcr IRES

(pRhifF) were subjected to the PI3K inhibitors, LY294002 and wortmannin. Renilla luciferase

97 Figure 5.8

Effects of PI3 kinase inhibitors on HIF'La IRES function

MCFT cells were transiently transfected with A. pRF or B. pRhifF. Four hours post- transfection, cells were subjected to either 2 pt}d Wortmannin (W; white bars) or 10 pM

Ly2g4OO2 (LY; blue bars) or left under control conditions (black bars) for either 5 hours or

24 hours as indicated. Cells were harvested and renilla and firefly luciferase acitivities were

measured. The histograms at left show renilla luciferase activity, the middle histograms

show firefly luciferase activity and the histograms at right show the ratio of firefly to renilla

luciferase. The ratios are graphed relative to the ratio obtained for pRF under normal

conditions, which was given a value of 1. The data shown are means (tSEM) of triplicate

samples from two independent experiments. -táJ Renilla Luciferase Activity Renill a Luciferase Activity H ì'J L,I uro (.¡¡ o oo OO O %o \, tÞ à.tt tot lì. lb +4 +4 è t4 è t¿ + (¡ +¿ +¿

Firefly Luciferase Activity Firefly Luciferase Activity O o O %o %un ll- ll. t¿ t4 lù lù +4 F l5 tt *4 |=jF B +t4 è +¿

Relative Luciferase Activity Relative Luciferase Activity firefly I Renilla firefly I Renilla NJu) OO (¡ o (,r \n ll- t4 +.t4 ÌÞ tt, +ô +4 <À tö +tö ¿jt. ¿/- +ô +ô Chapter 5 Activation of the PI3K sisnalins nathwav HIF-loIRES activitv

expression was reduced in cells exposed to both of these inhibitors and to a similar extent to the control plasmid (pRF) (Figure 5.88, left histogram). Firefly luciferase expression was also decreased concomitantly with renilla luciferase expression (Figure 5.88, middle histogram).

This indicates either there is a decrease in mRNA levels upon exposure to the inhibitors, or inhibition of the pI3K pathway results in a decrease of both cap-dependent or IRES mediated translation initiation.

The activation of the PI3K signaling pathway results in the phosphorylation of several

proteins implicated in translation. Signaling from PI3K to AKT and its downstream target,

mammalian target of rapamycin (mTOR) has been shown to phosphorylate 4E-BP, which

positively regulates translation (Gingras et al., 1999b); (Hara et al., 1997); (Peterson et al',

lggg). Other targets of mTOR include the p70 and p85 kinases, which phosphorylate the 56

protein of the 40S ribosomal subunit (Peterson et al., L999), up-regulating translation. Since

HIF-lcr IRES activity increased in response to heregulin (which activates PI3K), and was

suppressed upon inhibition of the PI3K pathway, it was possible that the PI3K-AKT-mTOR

signaling pathway regulates HIF-1o IRES activity. To determine the role of AKT in the

regulation of HIF-lcr IRES function, co-transfection experiments were performed with an

AKT expression vector (pHA-AKT) and a constitutively phosphorylated AKT vector

(pmyrAKT-HA) (Figure 5.1). Co-transfection of pHA-AKT with the dicistronic control

reporter (pRF) resulted in no change in expression of renilla or firefly luciferase when

compared to empty vector (Figure 5.94). Approximately, a l.S-fold increase in renilla

luciferase activity was observed in cells transfected with the constitutively active AKT

plasmid (pmyrAKT-HA), with a more modest effect seen on the downstream cistron. The

AKT plasmids had no effect on firefly luciferase activity when co-transfected with the HIF-1cx,

98 Figure 5.9

Regulation of the HIF-14 IRES is not downstream of AKT

MCFT cells transiently co-transfected with A. pRF or B. pRhifF, with empty vector (8.V.), pHA-AKT (AKT) or pmyrAKT-HA (Akt*) is indicated. Cells were harvested 24 hours post-transfection and renilla and firefly luciferase activities \ryere measured. The histograms

at left show renilla luciferase activity, the middle histograms show firefly luciferase activity

and the histograms at right show the ratio of firefly to renilla luciferase. The ratios are

graphed relative to the ratio obtained with pRF co-transfected with empty vector, which

was given a value of 1. The data shown are thee mean (tSEM) of triplicate samples from

two independent experiments. tË

Renilla Luciferase Activity Renilla Luciferase Acti vity lr N.J LÀ \¡ 9r O lJr O(JtOLrr oooo

F F I s

X X È È

X X È È tç

Firefly Luciferase Activity Firefl y Luciferase Activity OOO \ì N)

F F IftJ I FT rd

X X È È

X X È È l(

Relative Luciferase Activity Relative Luciferase Activity firefly I Renilla firefly lRenilla

lJt

lrl E 3 r

X X È È

X E È ^ Chapter 5 Activation of the PI3K si snalins oathwav increases HIF-1cr IRES activitv

IRES, whereas renilla luciferase expression was increased 1.5 and 2-fold with pHA-AKT and pmyrAKT-HA, respectively (Figure 5.98). This suggests that AKT can positively regulate cap-dependent translation, however activation of the HIF-lcx IRES may be via another

signaling molecule.

5-7 Summarv and Discussion

The phosphatidylinositol-3 kinase (PI3K) signaling pathway is activated by several

growth factor receptors, including the receptors for IL-3, GM-CSF, PDGF, EGF and insulin

(Guthridge et a1.,2000). The FIER2/neu receptor tyrosine kinase, which is encoded by the

ERBB2 gene, can also activate the PI3K signaling pathway, and this mutation is a common

mutation in breast cancer cells (Pegram et aI., 1998). A downstream target of PI3K is the

serine-threonine kinase, Akt, which, like HIF-I, can induce VEGF mRNA and protein

expression (Barthel et al., 1999); (Jiang et a1.,2000); (Zundel et a1.,2000). An antagonist of

the PI3K signaling pathway is the protein phosphatase, PTEN, which blocks Akt activity and

is frequently mutated in tumour cells (Zundel et al',2000).

The accumulation of HIF-1cr in response to PI3K signaling is somewhat controversial'

Several reports indicate that activation of the PI3K pathway results in an accumulation of HIF-

lcr protein at normal oxygen tension (Jiang et al.,2O0L); (Stiehl et a1.,2002); (Treins et al.,

2OO2); (Zhong et aI., 2000), whereas other groups indicate it is not absolutely required

(Alvarez-Tejado et al., 2002); (Arsham et aI., 2002). Nevertheless, it appears that PI3K-

dependent signals can regulate both the synthesis and stabilisation of HIF-10¿ in tumour cells

(Hudson et a\.,2002); (Laughner et a\.,2001); (Zundel et a\.,2000)'

99 Chaoter 5 Activation of the PI3K sisnalins oathwav increases HIF-lcr IRES activitv

The regulation of HIF-1o translation upon stimulation of the PI3K signaling pathway was first suggested in a study of MDA-MB-Z3I and MDA-MB-468 breast cancer cells, which have a constitutively activated PI3IlAkt pathway due to a ras mutation and PTEN mutation, respectively. Blancher et al (2001) showed VEGF expression was reduced in both normoxic

and hypoxic conditions by an inhibitor of PI3K, LY29400} and additionally, HIF-1cr protein

levels were also reduced by the inhibitor under hypoxia. To determine the mechanism of HIF-

lcx protein accumulation via PI3K signaling they utilised a cell line deficient in the VHL

protein, of which VHL is known to be required for ubiquitination and proteasomal degradation

of the HIF-I protein. Their observation was HIF-14 protein levels were regulated in this cell

line, suggesting PI3K signaling may regulate the translation of HIF-lcr. Furthermore, the

synthesis of HIF-lcx protein in response to activation of the PI3K signaling pathway by

heregulin has been shown to be dependent on the 5'UTR (Laughner et a1.,2001). I have

further extended this finding, by showing that stimulation of PI3K by heregulin can up-

regulate the HIF-1o IRES in a dicistronic mRNA. Unlike Laughner et al (2001), who showed

HIF-lcr translation was increased by the PI3K pathway in an Akt - mTOR dependent

pathway, the HIF-1a IRES was not activated by Akt overexpression or a constitutively active

form. This contrast in results may reflect a differing mechanism between the human and the

mouse HIF-1cr 5'UTRs as the human 5'UTR contains three polypyrimidine tracts of 8, 9, and

17 residues (Iyer et aI., 1998b), whereas the mouse 5'UTR contains only one pyrimidine

stretch of 11 nucleotides (Figure 3.9), and these pyrimidine rich regions are potential binding

sites for many proteins implicated in translational regulation.

Laughner et al (2001) showed an approximate 8-fold increase in expression of a

luciferase reporter in response to heregulin, whereas I found IRES activity was increased by

100 Chenfer 5 Aetivafion of fhe PI3K si qnalinq n cfh rxr n rr i n¡-re.e ses T{ftr- 1 rv TR F.S :rcti vi f v

less than 2-fold. This difference can, in part, be explained by activation of cap-dependent translation in response to PI3K signaling. Since both the cap-dependent reporter (Renilla luciferase) and the HIF-lcr IRES driven reporter (firefly luciferase) in the dicistronic reporter had a combined increase in activity of approximately 4 -5-fold, this possibly suggests the increase observed from the monocistronic reporter gene may partially be due to an increase in cap-dependent translation (Laughner et al., 2O0l).

The mechanism by which PI3K signaling increases translation rates of certain classes of mRNAs is poorly understood, however several key translation factors could be involved. The most likely involves the phosphorylation of the 4E-BPs, which releases the rateJimiting translation initiation factor, eIF4E, and positively regulates translation (Raught et a\.,2001). I have also demonstrated that overexpression of Akt can increase cap-dependent translation, but has no effect on HIF-1cr IRES activity.

The observation that renilla luciferase activity was increased in response to heregulin and overexpression of Akt, probably suggests cap-dependent translation of all mRNAs was increased, suggesting that the total cellular protein levels were also increased. This is however, not the case as renilla luciferase is likely to be more affected than that of the bulk cellular protein due to its short half-life, and is therefore more susceptible to stimulated cell growth and / or cell division. Furthermore, since total cellular protein concentration is with respect to a number of highly expressed, stable proteins (e.g. p-actin, tubulin, etc.), total protein is not likely change within the timecourse of the experiments.

Surprisingly, heregulin stimulation had a more dramatic effect on renilla luciferase activity with the no IRES control reporter (pRF) compared to the plasmid containing the HIF-

1cr IRES (pRhifF). The reason for this difference is unknown, however one possibility is that

101 -lcr

the presence of two potential translation initiation sites in the HIFlcr lRES-containing mRNA may compete for binding factors, whereas this competition does not exist in the pRF control.

How the pI3K pathway up-regulates translation of the HIF-1o IRES is unknown, as there has been no implication of any translation initiation factors involved in IRES-mediated

translation (Gingras et aI.,I999a); (Raught et a\.,2001). A plausible explanation involves the

activation of a trans-acting factor, which may bind to the HIF-IG IRES upon stimulation with

heregulin. Surprisingly, Akt overexpression had no effect on HIF-14 IRES function (Figure

5.8), suggesting the IRES may be activated by a pathway independent of Akt and mTOR. In a

recent review, Raught et al (2001), suggest PI3K signaling can activate several translation

initiation factors, such as eIF4G, oIF4B, and inhibit the activity of the 4E-BPs in an mTOR

independent manner, through the activity of unknown kinases. Therefore, the increase in HIF-

la IRES expression from PI3K signaling may involve the activation of other signaling

molecules, by an Akt-mTOR independent mechanism. protein expression' but only a since there is approximately a 3 fold-increase in HIF-1d

like the c-myc mRNA, the HIF- 1.5 fold increase in IRES activity, it seems possible that

mechanisms' 1g mRNA is also translated by cap-dependent and cap-independent

102 Cha ter 6

Long G + C rich S'UTRs containing internal ribosome entry sites may be more susceptible instability

è I Chanter 6 T.onq G C rich S'UTRs containìns TRESs ma be more sì hle to mRNA instability

6.L Introduction

A major control point in gene expression is the regulation of mRNA decay. Specific interactions between mRNA structural elements and RNA-binding proteins, which can be general or mRNA-specific, regulate the stability of a particular mRNA. Regulated mRNA stability is achieved through fluctuations in half-lives in response to developmental or environmental stimuli such as nutrient levels, cytokines, hormones and temperature shifts as well as environmental stresses such as hypoxia, hypocalcemia, viral infection and tissue injury

(Henriksson et aI., 1996); (Levy et al., 1996); (Moallem et al., 1998); (Short et a1.,2000);

(Staton et a1.,2000); (Trawick et aL,1997).

Several regions of mRNAs have been implicated in the regulation of mRNA decay. Of these, the 3'UTR has emerged as having a major role in containing elements that control mRNA decay. The AU-rich element (ARE), has been recognised as a potent destabilising element in the 3'UTR of a wide variety of short-lived mRNAs such as proto-oncogenes and cytokines (Section L1.2.3). The codingregion of mRNAs such as c-fos, c-myc and B-tubulin have been shown to contain decay elements, indicating several regions of these classes of mRNAs contain elements capable of regulating their gene expression (Bachurski e/ at.,1994);

(Schiavi et a1.,1994); (Wisdom et a1.,1991).

The 5'UTR has often been considered as the region of the mRNA involved in regulation of translation, but is now being recognised as playing a potential role in mRNA stability. For example, studies have identified elements within the 5'UTR of the interleukin-2 mRNA, which in part, is involved in its stabilisation during T-cell activation (Chen et aI.,

103 Chanter 6 Lons G C rich 5'IITRs containinq IRESs mav be more suscentihl to mRNA instability

2000). Therefore, mRNAs subject to this mode of regulation may provide a link between

mRNA stability and translation in the expression of genes.

Our laboratory has investigated the stabilisation of VEGF mRNA in response to

hypoxia. Surprisingly, the VEGF mRNA contains destabilising regions within the 5'UTR,

coding region, and 3'UTR, which can independently promote mRNA degradation, and act in

concert to cause rapid degradation (Dibbens et a\.,1999). Stabilisation of the VEGF mRNA in

response to low oxygen tension requires cooperation of elements in each of the 5'UTR, coding

and 3'UTR. In addition, our laboratory and others have shown that the VEGF 5'UTR contains

an internal ribosome entry site (Akiri et al., 1998); (Huez et a1.,1998); (Miller et aL,1998);

(Stein et aI., 1998). This led me to hypothesise that VEGF IRES activity may be associated

with mRNA destabilisation.

In this chapter, data from deletions of the mouse VEGF 5'UTR indicate a link between

VEGF IRES activity and mRNA instability. Analysis of mRNA instabiliry of 5'UTRs

containing IRESs (X-linked inhibitor of. apoptosis (XIAP), HIF-lcx and c-myc) is also

presented.

mRNA instabilitv

To determine the region(s) of instability in the VEGF 5'IJTR, a series of deletion constructs were made in the pfGH reporter vector (Figure 2.6 of the Materials and Methods

section). The entire mouse VEGF 5'UTR was cloned into the 5'UTR of the pfGH vector by incorporating an NcoI site at the growth hormone initiation codon by PCR amplification with oligonucleotides 23135V and 24129Y from pV5NBgl163 (Damert et al., 1997) and cloning a

104 Chanter 6 s G C rich 5'UTRs containins IRESs mav be more suscentihl to mRNA instability

HindIIIto NcoI fragment (sequence coordinates 1218 to 2234 (Shima et al., L996)) into the

same sites of pfGH (Dibbens et a1.,1999) (Figure 6.1) (forprimer sequences, referto section

2.3 of the Materials and Methods). Deletions were made by PCR amplification of pfvegfGH,

using oligonucleotides containing a 5' HindIII and 3' NcoI site to clone into the 5'UTR of

growth hormone (Figure 6.1). pfv42GH contains the first 738 nucleotides (coordinates l2l1 -

1955) of the \IEGF 5'UTR and was PCR amplified using oligonucleotides 48124Y and

23/35V. To construct pfv43GH, PCR amplification was performed using oligonucleotides

49127V and 23135Y, producing a 480 base pair fragment (coordinates l2l7 - 1697), and, cloned into pfGH. pfv44GH contains the first 325 nucleotides (coordinates l2l7 - 1542) of the VEGF 5'UTR and was PCR amplified using oligonucleotides 50/26V and23l35Y.To

generate pfv45GH, PCR amplification was performed using oligonucleotides 5I/32Y and

24129V, producing a 685 base pair fragment (coordinates 1594 - 2234), and cloned into pfGH.

To construct pfv46GH and pfv47GH, PCR amplification was performed using

oligonucleotides 52/32V and 24/29V and 53/33V and 24/29Y, producing a 685 (coordinates

1677 - 2234) and a 282 (coordinates L952 - 2234) base pair fragment and cloned into pfGH,

respectively. pfv48GH was constructed by digesting pV5NBgl163 (Damert et a1.,1997) with

B glI and EagI, generating an 499 base pair fragment (coordinate s 1562 - 2061), and blunt-end

ligated into pfGH (Figure 6.1).

The same VEGF 5'UTR deletion series was inserted into the dicistronic reporter, pRF, to

measure relative IRES activity. To clone the same VEGF deletions into pRF, the VEGF

deletions were excised from the pfGH vector by digestion with NheI and NcoI, and ligated into the reporter plasmid digested with SpeI and NcoI, to produce pRv42F through pRv47F (Figure

6.2). The dicistronic reporter containing the v48 deletion was created by PCR amplification

105 Figure 6.L fGH reporter constructs containing various deletions of the VEGF S'UTR to measure instability

Constructs shown in this figure were made by Dr. Justin Dibbens. A. and B. The creation of the reporter plasmid pfvegfGH (Figure A) and the corresponding deletions (Figure B) is

shown. The numbers refer to the nucleotide sequence of the VEGF 5'UTR, where 1

represents nucleotide number L2l7 of Genbank accession number U41383. All VEGF

5'UTR deletions were generated by PCR, digestion with HindnI and NcoI, and ligation into

pfGH. The NcoI site was utilised to ensure the VEGF 5'UTR was 'in-frame' with the

growth hormone coding region.

Abbreviations: c-fos, chicken fos promoter; HGH, human growth hormone; VEGF,

vascular endothelial growth factor; Neo, neomycin; BGH, bovine growth hormone poly(A)

signal; Amp, ampicillin resistance gene A

Amp

HindlII NcoI I I I pfvegfGH 7 c_ros

Poly(A) NcoI signal

HGH

KpnI 313

B HindIII NcoI

pfv42GH

HindlII Ncol

pfi/43GH 480

HindIII NcoI

pfi/44GH

HindIII Ncol

pfi/46GH 7

HindIII NcoI I l. ptu47GH 735 I 017

HindIII Ncol

pfi/48GH Figure 6.2

Dicistronic reporter constructs containing various deletions of the VEGF S'UTR to

measure IRES activity.

The control dicistonic reporter pRF is shown in linear form (refer to Figure 3.2).The entire

VEGF 5'UTR (pRvegfF) is shown, with the various deletions below. The numbers refer to

the nucleotide sequence of the VEGF 5'UTR. All VEGF 5'UTR deletions were generated

by digestion of their corresponding pfGH vectors (See Figure 6.1) with NheI and NcoI, and

ligation into pRF, except Rv48F, which was generated by PCR amplification.

Abbreviations: SV40, SV40 early promoter; Luc, Luciferase; VEGF, vascular endothelial

growth factor. SpeI NcoI I I

PRF SV4O intron

1 r0t7 pRvegff VEGF 5'UTR

8 pRv42F VEGF 5'UTR

1 pRv43F VEGF 5'UTR

1 325 pRv44F VEGF 5'UTR

3 7 pRv45F VEGF 5'UTR

460 t0t7 pRv46F VEGF 5'UTR

735 t0t7 pRv47F VEGF 5'UTR

345 844 pRv48F VEGF 5'UTR 6 C IRESs more to instabilit)¡

using oligonucleotides 5'V48 and 3'V48 containing an SpeI and NcoI site, respectively,

generating a fragment of 499 base pairs, and ligated into pRF'

To create the plasmids pRxiapF and pRxiap(-43144^A)F, the XIAP 5'UTRs were PCR

amplified from plasmids ppgal/huTR/cAT and ppgal/Py(-43l44AAyCAT (A kind gift from

Dr. M. Holcik) with oligonucleotides XIAP5Spe and XIAP3wt; and XIAP5Spe and

XIAp3mut respectively (see section 2.3 of the Materials and Methods). This generated (Figure fragments of 990 base pairs, which were ligated into pRF digested with SpeI and NcoI

amplification, 6.3). The same 5'UTRs were inserted into the pfGH reporter vector by PCR

and the using the dicistronic reporters as the templates and oligonucleotides XIAPSHind pfGH, appropriate 3'primer as described above. These PCR products were cloned into

(Figure 6.4)' digested with HindIII and NcoIto generate pfxiapGH and pfxiap(-43144A^)GH

pRhifF and To create pflrifGH and pfmycGH, the respective S'UTRs were excised from

286 and396 pRmycF, respectively, and digested with spel and NcoI (generating fragments of

hormone of pfGH base pairs). These PCR fragments were ligated into the 5'UTR of growth

digested with NheI and NcoI (Figure 6.5)'

6.3 VEGF 5'UTR mRNA bilisation correlates with IRES activitv

confer mRNA On the basis of previous results, the VEGF 5'UTR contains elements that

instability in normal oxygen condition (Dibbens et al., 1999). To further investigate the

(these region(s) of the 1017 nucleotide 5'UTR, deletions into pfGH were constructed

constructs, along constructs were created by Dr. Justin Dibbens) (Figure 6.1). These deletion

with, pfGH (refer Figure 2.6) and the full length VEGF 5'UTR (Figure 6'1) were transfected

into NIH3T3 cells, and a polyclonal population of G418 resistant cells was established'

106 Figure 6.3

Construction of dicistronic reporters containing the XIAP 5'UTR to assay IRES activity

A. and B. The construction of the reporter plasmids, pRxiapF (Figure A) and pRxiap(

43,44AA)F is shown. The XIAP 5'UTRs (As described in Holcik et al, 1999; Figure

6.104) were amplified by PCR and inserted into the pRF vector. Cloning at the 3' end of the XIAP S'UTRs utilised the NcoI site to ensure that the firefly luciferase coding region remained 'in-frame'.

Abbreviations: Amp', Ampicillin resistance gene; ori, origin of replication; SV40, SV40 early promoter; XIAP, X-linked inhibitor of apoptosis' A

à o ôo Spel NcoI I

Renilla Lucifems ä F pRxiapF

SpeI NcoI

Firefly Lucifemæ

B

à èo Spel NcoI I I I I Renilla Luc ä E "pRxiap(-43,44.44)F

Firefly Lrcifems Figure 6.4

Construction of pfGH reporters containing the XIAP 5'UTR to assay mRNA instability

A. and B. The creation of plasmids pfxiapGH (Figure A) and pfxiap(-43,4444)GH (Figure

B) is shown. The XIAP S'IJTR's are as described previously (Holcik et al, 1999; and

Figure 6.104). Cloning at the 3' end of the XIAP 5'UTRs utilised the NcoI site to ensure the HGH coding region remained 'in-frame'. The 'X' represents the region of mutation in the XIAP 5'UTR of 5,-UGUUCUCUUUUU-3' tO 5'-AGAACUCUUULIU-3,.

Abbreviations: Amp', Ampicillin resistance gene; HGH, human growth hormone; Neo, neomycin; BGH, bovine growth hormone poly(A) signal; c-fos, chicken fos promoter;

XIAP, X-linked inhibitor of apoptosis. A

Amp

HindIII NcoI I

pfxiapGH c-fos

Poly(A) NcoI signal H(;H

KpnI t3

B

Amp

HindIII NcoI

pfxiap(-43,4444)GH

Poly(A) NcoI signal

HGH

Kpnl t3 Figure 6.5

Construction of pfGH reporters containing the HIF-1o or c-myc S'UTRs to assay mRNA instability

A. and B. The creation of the reporter plasmids pftrifGH (Figure A) and pfmycGH (Figure

B) is shown. Cloning at the 3' end of the HIF-lcr and c-myc 5'UTR utilised the NcoI site to ensure that the HGH coding region remained 'in-frame'.

Abbreviations: Amp', Ampicillin resistance gene; HGH, human growth hormone; Neo, neomycin; BGH, bovine growth hormone poly(A) signal; c-fos, chicken fos promoter; HIF-

1ø, hypoxia-inducible factor-1cx. A

Amp

SpeI NcoI I Neo pfhifGH c-fos

Poly(A) signal NcoI

H(;H

Kpnl' t3

B

Amp

SpeI NcoI I I I I Neo I I pfmycGH c-fos

Poly(A) signal NcoI

HGH

Kpnt t3 Chanfer 6 Lon I G C rich 5'T TTR s cnnfainin o TRF.S S mâv be mofe hle fo mRNA instabilit)¡

Transcription of the normally stable fGH mRNA is driven from the c-fos promoter, from which a brief pulse of transcription can be generated by serum stimulation, allowing subsequent degradation of the mRNA to be monitored (Dibbens et al., 1999); (Lagnado et aI.,

L994). This system allows a direct means of determining the stability of mRNAs, rather than an indirect means, such as changes in the steady-state levels of reporter enzymes or the use of nonspecific inhibitors of transcription.

Insertion of the VEGF 5'UTR into the reporter gene substantially destabilised the fGH reporter mRNA under normoxic conditions (Figure 6.6 A and B), demonstrating the presence of destabilising elements in the 5'UTR. Deletion of the VEGF 5'UTR from the 5'end resulted in a more stable reporter mRNA when compared to the full length S'UTR, with the larger the deletion, the more stable the mRNA (Figure 6.64). Deletion from the 3' end gave a similar result, with the larger the 5'UTR inserted into the pfGH reporter, the more unstable the mRNA. Additionally, pfv48GH, which contains an intemal region of the VEGF 5'UTR

(coordinates 345 - 844) could recapitulate the instability observed with the full length 5'UTR,

indicating this 499 nucleotide region contains elements sufficient for destabilisation of the

fGH reporter mRNA.

To determine whether mRNA destabilisation and IRES activity were linked, the same

VEGF 5'UTR deletions were cloned into the pRF dicistronic reporter vector (Figure 6.2).

These constructs were transiently transfected into NIH3T3 and HeLa cells, and renilla and

firefly luciferase activities measured 24 hours post-transfection. Deletion of the last 279

nucleotides of the VEGF 5'UTR (pRv42F), resulted in no loss of IRES activity compared to

the full length 5'UTR in both NIH3T3 and HeLa cells (Figure 6.7 and 6.8 respectively). A

further deletion from the 3' end of the 5'UTR of 258 nucleotides (pRv43F) resulted in more

107 Figure 6.6

The effect of deletions of the VEGF s'UTR on the reporter mRNA

Total RNA was isolated after serum stimulation of NIH3T3 cells expressing the fGH transcript, the fvegfGH transcript or various deletions of the VEGF 5'UTR and subjected to

RNase protection analysis. Time courses of the RNase protection data is shown- Each line

on the graphs is labeled with the sequence name. Data presented is representative of 3

independent experiments. Data presented in this figure is work performed by Dr. Justin

Dibbens. A

1 *fGH

b0 -fv44GH *fv42GH. fv43GH lro) z 1 *fvegfGH ú tr s

1 012345678 Time (hours)

B

1 +fGH

òo +fv47GH ,= +fV46GH í) lr . fV48GH 1 0 +fvegfGH z útr ñ

1 012345678 Time (hours) Figure 6.7

Deletion analysis of IRES activity of the VEGF S'UTR in NIH3T3 fibroblasts

A schematic representation of the dicistronic constructs used in this analysis is shown.

Constructs are based on the pRF vector. Inserts include the entire VEGF 5'UTR (pRvegfF) and deletions and fragments of this sequence are indicated. The VEGF 5'UTR construct designation indicates the exact nucleotide sequence deleted in each construct. Constructs

were transiently transfected into NIH3T3 cells and renilla and firefly luciferase activities

measured 24 hours post-transfection. IRES activities are represented as a percentage of the

full VEGF 5'UTR. Dafa arc presented as the mean (tSEM) of triplicate samples from four

independent experiments. PRF

1 101

pRv42F 1 738

pRv43F 1 480 pRv44F I 325 pRv45F 332 101? pRv46F 460 101? pRv47F 735 101? pRv48F 345 844

0 25 75 1 150 Relative Luciferase Activity firefly lReniIIa Chanter LonsGCrich5 'UTRs containins IRESs mav be susceotible to A instabilit)¡

than a 70 7o reduction in IRES activity, with further deletion from the 3'end having only a

modest effect on VEGF IRES function in both NIH3T3 and HeLa cells (Figure 6.7 and 6.8).

Deletion of the VEGF 5'UTR from the 5' end resulted in only a mild decrease in IRES

activity in both cell lines when 332 nucleotides were removed (pRv45F). Deletion of 460 and

735 nucleotides from the 5'end showed a gradual loss of firefly luciferase reporter expression

in NIH3T3 cells (Figure 6.7). However, in HeLa cells, deletion of 460 nucleotides did not

result in any further loss of activity, whereas removal of 735 nucleotides saw a loss of 70 7o

(Figure 6.8). Deletion of both the 5' and 3'ends (pRv48F) showed a45 %o decrease in IRES

activity in both cell lines, indicating multiple regions of the VEGF 5'UTR are required for maximal IRES function. These findings are consistent with other VEGF 5'UTR deletion studies on IRES function, which indicate that multiple regions are required for maximal IRES function (Akiri et a\.,1998); (Huez et a\.,1998); (Miller et aL,199g); (stein et al.,l99s).

To compare the effect of VEGF mRNA destabilisation in the fGH reporter, pRNA half-lives were calculated and compared to the 7o of IRES activity (Figure 6.9). The half-life of the fGH mRNA without any insert was greater than 8 hours, however, with the VEGF

5'UTR inserted upstream of the growth hormone coding region, the half-life was shortened to

0.9 hours. Deletion of the last 279 nucleotides of the VEGF 5'UTR (construct v42) resulted in a further increase in stabilisation of the reporter mRNA, with no loss of IRES activity.

However, a further deletion of 258 nucleotides (constructs v43) resulted in a further increase in mRNA stabilisation, and a dramatic loss of IRES function. Further deletion from the 3, end

(construct v44) results in a further loss of both IRES function in both cell types, and a gain in mRNA stability, suggesting there may be regions within the VEGF 5'UTR that share function with IRES activity and mRNA destabilisation.

108 Figure 6.8

Deletion analysis of IRES activity of the VEGF 5'UTR in HeLa cells

A schematic representation of the dicistronic constructs used in this analysis is shown'

Constructs are based on the pRF vector. Inserts include the entire VEGF 5'UTR (pRvegfF)

and deletions and fragments of this sequence are indicated. The VEGF 5'UTR construct

designation indicates the exact nucleotide sequence deleted in each construct- Constructs

were transiently transfected into HeLa cells and renilla and firefly luciferase activities

measured 24 hours post-transfection. IRES activities are represented as a percentage of the

full VEGF 5'UTR. Data are presented as the mean (tSEM) of triplicate samples from four

independent experiments. PRF

pRvegfF 1 101

pRv42F I 73 pRv43F I 48

pRv44F 1 325 pRv45F 32 101 pRv46F 460 101 pRv47F 735 101 pRv48F 345

0 25 50 75 100 125 Relative Luciferase Activity firefly lRenilla Figure 6.9 correlation between VEGF IRBS activity and mRNA instability

A schematic representation of the VEGF regions used in the analysis of IRES activity and

6RNA stability is shown. VEGF regions include full length 5'UTR (vegÐ with deletions and fragments of this sequence. Control plasmids for IRES activity (pRF) and mRNA

stability (pfGH) are indicated. ND, not determined. mRNA Ll2llfe 7o IRES Activity (Hours) NIH3T3 HeLa

vegf 1 101? 0.9 100 100

v42 1 73f r.6 98.2 r02.2

v43 1 480 I.4 27.1 31.1

v44 1 325 2.9 t9.3 18.8

v45 332 101t ND 79.7 77.5

v46 460 rcL'l 1.0 62.r 97.8

v47 735 toL'l 1.9 46.9 2r.3

v48 345 844 1.0 49.7 48.7

PRF ND 1 1 pfGH 7.r ND ND to instability

Deletion from the 5' end indicates the larger the deletion into the 5'UTR, the more

stable the reporter mRNA becomes, and the greater the loss of IRES activity is observed,

consistent with there being a direct correlation between IRES activity and instability of the mRNA.

6.4 The XIAP IRES cannot destabilise fGH mRNA

To test the possibility that IRES activity may promote pRNA instability, a literature

search was performed to find an IRES with associated deletion studies showing a functional

and non-functional IRES. The 1007 nucleotide long X-Linked inhibitor of Apoptosis (XIAp)

5'UTR contains an IRES, and deletion of the polypyrimidine tract, located 35 - 44 nucleotides upstream of the initiation codon, resulted in a complete ablation of IRES activity (Holcik er

al., 1999). To determine the effect of the wild+ype XIAP 5'UTR and the pyrimidine tract

mutant (pBgal/hUTR/CAT and ppgalÆy(-43144AA)/CAT (A kind gifr from Dr. Marrin

Holcik) (Figure 6.104), the S'UTRs were cloned into the dicistronic reporter vector, pRF (Figure 6.3) and the activity of the XIAP 5'UTR and mutant were assayed in my system.

Consistent with Holcik et al (1999), the XIAP 5'UTR initiated translation of the downstream

firefly luciferase reporter, 300 fold in NIH3T3 and 800 fold in HeLa cells compared to the

control vector (Figure 6.10B and C, respectively). The two base pair substitution in the polypyrimidine tract of the XIAP 5'UTR, had a complete loss of firefly expression, in both cell lines, indicating loss of IRES activity. Therefore these results indicate this pyrimidine stretch is important in IRES function. The 5'UTR of XIAP, therefore provided a good model system containing a mutant with a complete loss of IRES function and a wild-type 5,UTR with good IRES activity to assess whether IRES activity regulates mRNA instability.

109 Figure 6.10

IRES actÍvity of the XIAP S'UTR

A. A schematic representation of the XIAP 5'UTR constructs received from Dr. Martin

Holcik. The human XIAP 5'UTR was inserted into the dicistronic plasmid ppgal/CAT (P-

gal is B-galactosidase). The sequence of the polypyrimidine tract is indicated for both

constructs, with the base substitutions underlined. B. XIAP IRES activity in NIH3T3 cells.

NIH3T3 cells were transiently transfected with pRF (control) pRxiapF (wild-type) or

pRxiap(-44,4344)F (mutant). Renilla and firefly luciferase activities were determined 24

hours post-transfection, and IRES activities represented as ratios of firefly to renilla

luciferase. The ratios for each cell line are graphed relative to pRF, which was given a

value of 1. Data presented are the mean (ISEM) of triplicate samples from three

independent experiments. C. XIAP IRES activity in HeLa cells. HeLa cells were transiently

transfected with pRF (control) pRxiapF (wild-type) or pRxiap(-44,43AA)F (mutant).

Renilla and firefly luciferase activities were determined 24 hours post-transfection, and

IRES activities represented as ratios of firefly to renilla luciferase. The ratios for each cell

line are graphed relative to pRF, which was given a value of 1. Data presented are the mean

(tSEM) of triplicate samples from three independent experiments. A

CMV Fgal LR CAT polyA pÊgaUCAT XhoI

hUTR ppgalrhUTR/CAT -1007- -1(AUG)

UGUUCUCUUUUU

p ÊgalÆy (- 44,43 A T -1007 UGAACUCUUUIJU ^)/CA

NIH3T3 B PRF

pRxiapF

pRxiap(-44,4344)F

0 100 200 300 400

Relative Luciferase Activity firefly I Renilla

C HeLa

PRF

pRxiapF

pRxiap(-44,43AA)F

0 500 1000 1500 Relative Luciferase Activity firefly / ReniIIa Chanter 6 T G C rich 5'IITRs containinq IRESs mav be more suscenfi ble to mRNA instabili

To determine whether the XIAP 5'UTR could destabilise the fGH reporter mRNA, the

wild-type and mutant XIAP 5'UTRs were cloned into the pfGH vector (Figure 6.4). NIH3T3

cells expressing pfGH, VEGF S'UTR, XIAP 5'UTR or XIAP(-43,44AA) were subjecred to

serum stimulation, and subsequent degradation of the reporter mRNA was measured. Insertion

of the VEGF 5'UTR into the reporter gene substantially destabilised the fGH reporter mRNA

(Figure 6.11, pfGH and pfvegfGH), as shown previously (Dibbens et aI., 1999). However,

insertion of the XIAP 5'UTR into pfGH had no destabilising effect on the reporter mRNA

(Figure 6.11, pfxiapcH). Additionally, mutation of the pyrimidine tract in the XIAP 5'UTR

had no effect on the fGH reporter mRNA (Figure 6.11, pfxiap(-43,44AA)GH), indicating the

pyrimidine tract is not important in the regulation of XIAP mRNA stability. It remains

possible that the XIAP IRES may function by a different mechanism to the majority of cellular

S'UTRs that contain IRESs because the XIAP 5'UTR is unusual in that it is A + T rich (70 7o),

and IRES function is located within a small stretch of the long 5'UTR. Most cellular IRES discovered, tend to have a high G + C rich content (Table 1.1), and deletion often reveals a distribution of IRES activity throughout the 5'UTR. This difference in IRES function may indicate why the XIAP 5'uTR could not destabilise the fGH reporter mRNA.

6.5 G+ C rich S'UTRs containins IRESs mav also contain mRNA

destabilisation elements

To determine whether IRES activity of G + C rich cellular 5'UTRs can destabilise the fGH reporter mRNA, the HIF-lcr and c-myc 5'UTRs were utilised. The HIF-1o and c-myc

5'UTRs are G + C rich (72 and65 7o, respectively) and contain an IRES (Figure 6.12).To determine the efficiency of IRES function, the HIF-1o and c-myc 5'UTRs were inserted into

110 Figure 6.LL

The XIAP 5'UTR cannot destabilise the fGH reporter

A. Phospholmager analysis of representative RNase protection gels. RNA was isolated at

the indicated times after serum stimulation of NIH3T3 cells stably transfected with variants

of the fGH gene containing the indicated sequences inserted upstream of the growth

hormone coding region. The upper band is the protection product from probe for the growth

hormone region of the fGH reporter; the lower band is the protection product from the

GAPDH internal control. Representative RNase protection gels are shown for each

construct. Also shown are the undigested and digested (in the presence of 10 pg tRNA)

probes for growth hormone and GAPDH. B. Time course of degradation of the fGH

reporters. Each line on the graph is labeled with the sequence name. Data presented is the

mean (tSEM) of duplicate samples from two independent experiments, normalised with

respect to GAPDH. A

.8 -åEg Ë.8 E TEE plasmid ;;EEo Õaìaì pfGH pfveefGH pfxiapGH prgp(-++,+3AALCU È1 +<< Time (hours) o ooo 01.523 4 5 6 0r.52 3 45 6 01.52345 6 0t.523 4s6 r.,*rr*Ë* *Þ Ë<-G.H.

B

100 +-pfGH +- pfxiapGH pfxiap(-43,44A4)cH è0 -+

't É ¡ro + pfvegfGH z 10 ú s

1 0 I 2 34 567 Time (hours) Figure 6.L2

HIF-1o and c-myc IRES activity in NIH3T3 and HeLa cells

A. and B. HeLa cells were transiently transfected with pRF, pRhifF or pRmycF as indicated. Renilla and firefly luciferase activities were determined 24 hours post- transfection and IRES activities represented as ratios of firefly to renilla luciferase. The ratios for each cell line are graphed relative to pRF, which was given a value of 1. Data presented are the mean (tSEM) of triplicate samples from three independent experiments.

Modified from figure 3.17. A

PRF

pRhifF

pRmycF

010203040

Relative luciferase Activity Firefly lRenilla

B

PRF

pRhifF

pRmycF

0 50 100 150 200 Relative luciferase Activity Firefly lRenilla rich to instabilit)¡

post- the pRF dicistronic reporter plasmid, and luciferase activities quantitated 24 hours the firefly transfection. The HIF-lcr and c-myc 5'UTRs could both initiate translation of

in this luciferase cistron to a similar rate, indicating that these IRESs are of a similar strength reporter system in both NIH3T3 and HeLa cells'

are intrinsically To assess whether G + C rich S'UTRs containing IRES elements

the fGH destabilising, the HIF-lcr and the c-myc S'UTRs were inserted into the 5'UTR of reporter gene, yielding pftrifGH and pfmycGH, respectively (Figure 6'5)' Decay of the

was measured after serum stimulation of the c-þs promoter. Both the HIF-Iü reporter 'RNA demonstrating that and c-myc 5'UTRs destabilised the reporter mRNA (Figure 6.134 and B),

the size difference these G + C rich 5'UTRs contain functional destabilising elements. Despite

respectively), the between the VEGF, HIF-lcr and c-myc 5'UTRs (1014, 286,396 nucleotides,

size of the decay of the reporter mRNA was similar with each 5'UTR, indicating the relative

+ C rich 5,UTR is not important in the destabilisation of the fGH mRNA. This suggests that G

5'UTRs containing IRESs may also be susceptible to mRNA instability'

6.6 Summarv and

previous work in our laboratory identified multiple, independently functional

destabilising elements of the VEGF mRNA (Dibbens et al., 1999). These destabilising

least two regions of the elements were located in the 5'uTR, coding region and 3'uTR, and at

mRNA were required to recapitulate the destabilisation of the entire VEGF transcript. been shown to Sequences within the 5'UTR that affect translation initiation have also

translation influence mRNA half-lives, providing a possible link between mRNA stability and

(Oliveira et a\.,1995); (Ross 1995)'

111 Figure 6.L3

The HIF-lcr and c-myc S'UTRs confer instability in NIH3T3 fÏbroblasts

A. Phosphorlmager analysis of representative RNase protection gels. RNA was isolated at the indicated times after serum stimulation of NIH3T3 cells stably transfected with variants

of the fGH gene containing the indicated sequences inserted upstream of the growth

hormone coding region. The upper band is the protection product from probe for the growth

hormone region of the fGH reporter; the lower band is the protection product from the

GAPDH internal control. Representative RNase protection gels are shown for each

construct. B. Time course of degradation of the fGH reporters. Each line on the graph is

labeled with the sequence name. Data presented is the mean (ISEM) of duplicate samples

from two independent experiments, normalised with respect to GAPDH' A

Plasmid pfGH pfvegfGH pfttifGH pfmycGH

Timepoint o t.sz 3 4 s 6 otsz 3 4 s 6 0 t.s2 3 4 s 6 01.52 3 4 5 6

a K***r* K*K <- GAPDH

B

100 r pfGH

ä0

oE pfhifcH Lr I z -r- PfmYcGH ú # pfvegfGH ñ

10

Time (hours) 6 C s instability

The 5'UTR of VEGF has been shown to contain an internal ribosome entry site (Akiri et aI., 1998); (Huez et al., 1998); (Miller et al., 1998); (Stein et al., 1998), and contains an

additional characteristic of an in-frame open-reading frame that can support alternative

translation initiation from upstream CUGs (Meiron et a\.,2001). Because of the possible link

between 6RNA stability and translation, it was possible the presence of the IRESs in the

5'UTR may contain mRNA instability elements. I found by deleting regions of the VEGF

5,UTR and assaying for both mRNA stability and IRES activity in the pfGH and pRF reporter

plasmids, respectively, there was a correlation between IRES activity and mRNA instability.

increase in Several deletions that showed a large decrease in IRES function also showed an

stability of the mRNA, suggesting these regions contain elements that function in both mRNA

stability and IRES function. Notably, IRES activity was more severely affected than stability,

possibly for two reasons. Firstly, the sensitivity of the luciferase reporters is higher than the

fGH reporter system, and secondly, the fos promoter produces a transcriptional pulse for

approximately 30 minutes (Rivera et al., 1990), and may not be able to resolve half-lives

significantly less than I hour (Dibbeîs et a1.,1999)'

VEGF is the first example of an mRNA that contains both an IRES and mRNA

instability elements in the 5'UTR. My expectation was cellular mRNAs containing IRESs may

instability also be subject to mRNA instability, linking IRES-mediated translation with mRNA

as a common mechanism of gene regulation. However, the Xlinked inhibitor of apoptosis

(XIAP) 5'IJTR, although capable of initiating internal ribosome entry in two different reporter

This systems, and in different cell types was unable to destabilise the fGH reporter mRNA'

indicates that not all mRNAs containing IRESs in the 5'UTR contain instability elements.

However, the XIAp IRES is unusual in that it is A + T rich and IRES activity is strongly

regulated by a small polypyrimidine tract (Holcik eî al., 1999)' This is not a common 112 Chaoter 6 Lons G C rich S'IITRs containins IRESs mav be more susceotible to mRNA instability

characteristic of most cellular IRESs, which are generally G + C rich, and the activity of the

IRES is not easily definable, as multiple regions are required in the formation of secondary

structure, constituting the IRES (Le et a\.,1997).

Analysis of the HIF-lcx and c-myc 5'UTRs revealed that they both contain IRESs

(Nanbru etaI., 1997); (Nanbru etaL.,2001); (Stoneley eta\.,1998)(Chapter3)andbothcan

destabilise the fGH mRNA to a similar extent to the VEGF 5'UTR. The finding suggests that

G + C rich 5'UTRs that contain IRES elements may also be subjected to regulation by mRNA

instability. The c-myc mRNA transcript contains instability elements in the 3'UTR and coding

region (Herrick et aI., 1994); (Wisdom et aI., 1991), and I have identified the 5'UTR as

containing an instability element, indicating, like the VEGF mRNA, the c-myc transcript

contains independent instability elements in the 5', coding and 3'UTR.

The HIF-lcx mRNA transcript has been shown to be constitutively expressed in

normoxic and hypoxic conditions (Iyer et aL,1998b), however, it has been postulated it may

be subject to regulation at the mRNA level of gene expression due to the presence of several

AREs in the 3'UTR (Iyer et al.,I998b); (Lagnado et aL, L994); (Wang et al.,I995a).I found

the HIF-1o 5'UTR can destabilise the fGH reporter mRNA, suggesting that the HIF-lcx

mRNA may be subject to regulation by mRNA destabilisation in normal oxygen conditions,

however this is yet to be determined. The significance of this finding indicates that like VEGF,

HIF-14 is subject to tight regulation at multiple levels of gene expression to ensure it is

induced rapidly in response to external stimuli, but can also be rapidly switched off upon removal of the stimulus.

A number of genes in plants, Escherichia coli, Saccharomyces cerevisiae, and animals

show regulation of mRNA via elements in their 5'UTRs. These include, nitrate reductase

113 Chanfer6 Tnnolll- rich S'UTRs confainins TRF.Ss rnav he lrìrìre srì le. to mRN A instabili

(Cannons et aI., 2002), chloroplast genes rbcl- and atpB (Anthonisen et al., 200I),

Saccharomyces cerevisiae AP-l like transcription factor Yap2 (Vilela et al., 1999), a pre-

spore-specific mRNA AC9I4 (Chiaberge et aL,1998) and E. coli omp{ transcript (Arnold er

a1.,1998). Because this type of gene regulation is present in bacteria, yeast, and plant, it is not

surprising that it is now being recognised in mammalian cells, with this study identifying the

HIF-1o and c-myc 5'UTRs as containing destabilising elements. Whether the genes listed

above also contain IRESs in their 5'UTRs remains to be determined, but the majority have

relatively long and G + C rich S'UTRs, making them good candidates.

Data presented in this chapter suggests that cellular mRNAs containing IRES elements

may contain mRNA instability elements, which may provide unique therapeutic strategies in

controlling these genes, when they are inappropriately expressed. This is the first example of

mRNAs containing an IRES and instability elements in their 5'IJTRs, and provides a potential

link between mRNA instability and translation and further indicates the complex regulation of genes containing long 5'UTRs.

114 Chapter 7

Final Discussion ahçnter"l Final Di scì I ssr rìn

7.1 Final Discussion

The main aim of work presented in this thesis was to examine the function of the

5'UTR present in the hypoxia-inducible factor-lcr mRNA, which had similarities with other

S'UTRs containing IRESs. The majority of eukaryotic mRNAs have S'UTRs of 20 - 100

nucleotides, and shortening to less than 72 nucleotides impairs the efficiency of translation

from the first AUG codon (Kozak 1987); (Kozak 1991). Increasing rhe length of the 5'UTR

can increase the efficiency of translation, however many mRNAs with unusually long 5'UTRs

are poorly translated due to the presence of upstream AUGs, CUGs, upstream open reading

frames and / or secondary structure (Kozak 1987); (Kozak l99I). It has been recently

discovered that a number of mRNAs with long 5'UTRs contain internal ribosome entry sites

(Hellen et a\.,200I); (Vagner et aL.,2001). Work presented in this thesis demonstrated that the

5'UTR of HIF-1cr contained an internal ribosome entry site, and it is utilised under conditions

that may be inhibitory to cap-dependent translation.

The HIF-14 IRES adds to the list of internal ribosome entry sites discovered in cellular

mRNAs. The question remains however, how many cellular mRNAs contain an IRES in their

5' UTR? Interestingly, not all long G + C rich 5'UTRs contain IRESs, as our laboratory has

shown that the 5'UTR of the early-growth response-l (EGR-l) mRNA (which is 280

nucleotides long and G + C nch Q7 Vo)), poorly initiates translation of a downstream reporter

gene in a dicistronic assay (R. Grepin and G. Goodall, unpublished observation). All genes containing IRESs reported to date, are required to be translated under conditions that may not be favourable for maximal rates of cap-dependent translation. Several IRESs that have been shown to be required during a cellular stress condition, and are likely to impact on global translation rates includes: c-myc and X-linked inhibitor of apoptosis during apoptosis (Holcìk

115 Final

et a1.,2000); (Stoneley et a1.,2000a); cat-l during amino acid deprivation (Fernandez et al.,

in 2001); ODC and p58 during cell-cycle (Cornelis et a\.,2000); (Pyronnet et a\.,2000), Rbm3

(Stein hypothermic conditions (Chappell et a1.,2001); and VEGF and HIF-lcr under hypoxia

et al., 1998Xthis studY).

I have shown data indicating that exposure of cells to low oxygen fot 24 hours

suppresses cellular translation rates by 50 7o altough the mechanism by which hypoxia

status of suppresses translation is poorly understood. It is postulated that the phosphorylation

initiation factors, like eIF4E and eIF2 are central to the regulation of global translation rates,

and it is likely that these two factors are tightly controlled, particularly under stress conditions,

like hypoxia (Gingras et al., lggg) (Sachs et aL, 1997). Several other initiation factors that

may be involved in regulating global translation rates are eIF4B, oIF4G and eIF3, and are

further implicated in the suppression of translation in response to stress, such as hypoxia,

however no detailed analysis of their regulation has been shown (Gray & Hentze, 1998)

(Marcotrigiano et at.,1999) (Morley et al., 1997)'

4E- One study has shown the availability of eIF4E is reduced due to its association with

Bpl in hypoxic conditions, however it is thought that other mechanisms contribute to the

responsible suppression of protein synthesis (Tinton et aI.,1999). Since oIF4E is only partially

for the suppression of translation under hypoxia, it is reasonable to suspect that the

phosphorylation status of eIF2 is affected, although this has yet to be shown. In normal

cellular conditions, eIF2 binds GTP and the initiator tRNA and delivers this complex to the

small ribosomal subunit (pain, 1996). Phosphorylation of eIF2 results in an inhibition of GTP

cycling, resulting in a suppression of translation (Gray et al., 1993)' This mechanism of

translation inhibition is utilised under conditions such as heme deficiency, uncharged tRNAs

116 Chapter 7 Final Discussion

or double-stranded RNA (Clemens et aL, 1997); (Hershey et al., 1996), and may also play a pivotal role in the regulation of translation under hypoxia.

Although its regulation is not well understood, eIF4G is also a good candidate for global regulation of translation, particularly under stress conditions as it has been suggested to be limiting in cells (like eIF4E), and it appears to be tightly regulated in cells, with its level of synthesis and turnover controlled (Gan et aI., 1996); (Gan et al., 1998); (Johannes et al.,

1998); (Morley et al., 1997).It appears that proteins known as eIF4G decoys (referred to as

NATI, DAP-5 or p97), may regulate the level of eIF4G in the cell (Morley et a1.,1997). These eIF4G decoy proteins appear to act through their affinity for eIF3 and eIF4A, and thus can suppress both cap-dependent and lRES-mediated translation (Hentze L997); (Imataka et al.,

1991). This mechanism of translational down-regulation may explain, in part, the decrease in reporter gene expression from both the cap-driven and IRES-driven reporters of the dicistronic mRNA under conditions of serum deprivation.

The analysis of IRES activity from HIF-10( 5'UTR deletions indicated multiple regions were required for maximal activity of the IRES. This is in concordance with many other cellular IRESs reported including VEGF (Huez et al., 1998), c-myc (Stoneley et al., 1998), and FMRl (Chiang et al.,2O0I). Two other classes of IRES elements have been implicated in cellular 5'IJTRs, namely an 18S rRNA complementarity region and a polypyrimidine tract, which is central to the activity of the IRES (Chappell et a1.,2000a); (Holcik et al., 1999).

Surprisingly, the HIF-1cr 5'UTR contains both types of these elements, with data indicating that the 18S rRNA complementarity region was not essential for IRES function, and the polypyrimidine tract, in contrast to the role of most IRESs (particularly the viral IRESs) seemed to have a repressing function in HIF-14 IRES activity. It seems likely that a trans-

117 Chanter 7 Discussion

acting binding protein is involved in the regulation of HIF-lcr IRES activity via the

polypyrimidine tract, however this has yet to be elucidated. Several trans-acting factors have

been shown to bind to pyrimidine residues in the S'UTRs of both cellular and viral IRESs, and

play a role in the regulation of the IRES (Gosert et a\.,2000); (Hellen & Sarnow, 2001). These

factors do not appear to play a role in promoting translation initiation, but rather bind to attain,

or maintain a conformation, allowing the recruitment of the initiation factors (Hellen et al.,

200L). The notion that trans-acting factors regulate the efficiency of IRES activity is

supported by observations indicating IRES expression is increased in rabbit reticulocyte

lysates upon the addition of HeLa extract, and the differing efficiencies of IRESs in different

cell types (Borman et al., 1991). These trans-acttng factors include, polypyrimidine tract

binding protein (PTB), La autoantigen and poly (rC) binding protein (PCBP) (Mitchell et al.,

2001); (Holcik & Korneluk, 2001). PTB has been reported to repress IRES function of the Bip

IRES (Kim et al., 2000), with all other trans-acting factors shown to be involved in the

activation of IRES activity (reviewed in (Hellen et aL.,2001))

The finding that the polypyrimidine tract in the HIF-1c 5'UTR may act as a repressing

site potentiates this as a site for therapeutic intervention. Since there are benefits for the

expression and inhibition of HIF-lcx, protein levels in ischemic tissue and tumours,

respectively, regulation of the IRES may be a possible site of controlling expression.

However, due to the increasing numbers in cellular mRNAs containing IRESs, a general activation or suppression of IRESs is not likely to be beneficial, particularly when one considers the diversity of genes encoding mRNAs that contain an IRES. The most attractive and specific mechanism of regulating IRESs may be to target the trans-acting factors that bind to the IRES, and in the case of HIF-lct, it may be possible to target the potential binding

118 ahanf e.r 7 Final Discus qt ôn

protein to the polypyrimidine tract and control the amount of HIF-lcr protein that is synthesised.

Data presented in chapter 5 indicated that the HIF-1crIRES had increased expression in response to activation of the PI3K signaling pathway by heregulin. HIF-1crIRES expression was concomitant with an increase in cap-dependent reporter levels, that was shown to be due to a translational affect, as mRNA levels were constant. The PI3K signaling pathway has been implicated in the regulation of translation initiation, via signaling through mTOR and phosphorylation of 4E-BP, releasing eIF4E and up-regulating translation (Gingras et aL,

1999b); (Hara et al., 1991); (Peterson et al., 1999). The mechanism by which activation of translation initiation factors could specifically activate the HIF-1cxIRES is unknown, since the majority of these factors would also increase cap-dependent translation. Since there is a dual increase in expression of both reporters of the dicistronic mRNA, its seems possible that activation of the PI3K signaling pathway does not specifically increase expression of the HIF-

1a IRES, but rather an up-regulation of factors involved in global translation.

The finding that overexpression of Akt (a downstream target of PI3K) had no affect on

HIF-1cx IRES function, but resulted in an increase in expression of the cap-dependent reporter, suggests that other signaling pathways may be involved in the activation of the IRES.

Downstream targets of PI3K, other than Akt and mTOR are relatively unknown, however there is some evidence for the activation of the mitogen activated protein kinase (MAPK) members by PI3K (Graness et aI., 1998). Interestingly, activation of the epidermal growth factor receptor in MCFT cells leads to the phosphorylation of Akt and ERK1/2 (Weng et al.,

2OO2). Therefore, heregulin activation of MCFT cells may also result in the phosphorylation of

ERK|/2, providing an alternative mechanism of translational up-regulation, as activation of

119 Chaoter 7 Final Discussion

the MAPK pathway has been shown to phosphorylate eIF4E, and increase translation rates

(Fukunaga et al., 1997); (Waskiewicz et aI., L997). Specific inhibition of PI3K blocked this activation of both cap-dependent and IRES-mediated reporters, indicating that PI3K does play a role in HIF-1o IRES mediated translation. This suggests that HIF-lct IRES-mediated translation is increased via activation of PI3K, through a pathway that is independent of Akt, but may involve activation of the ERK/MAPK signal transduction pathway. This could be determined by the use of chemical inhibitors that are specific for the ERK/MAPK signaling pathway to determine whether this has an effect on HIF-lcr IRES function.

This is only the second demonstration of a cellular IRES that is regulated by a signaling pathway, the tìrst being the up-regulation of c-myc IRES activity in response to activation of the MAPK pathway (Stoneley et a1.,2000a). This result is consistent with the finding of increased expression of the dicistronic mRNA reporters containing the HIF-la 5'UTR

(pRhifF) upon heregulin stimulation, showing a concomitant increase in expression of both the cap-dependent driven reporter and the IRES driven reporter. The specificity of up-regulation of cellular IRES activity in response to these signaling pathways remains to be determined, but may involve a factor involved in both cap-dependent and lRES-mediated translation since there was an increase in expression of both reporters from the dicistronic mRNA.

In this thesis I have demonstrated an interesting correlation between IRES activity, and mRNA instability (Chapter 6). This observation was based on instability data from regions of the VEGF 5'UTR (Dr. Justin Dibbens, unpublished), that correlated with IRES deletion data.

However, this characteristic is not present in all cellular IRESs, as the XIAP 5'UTR could not destabilise the fGH reporter mRNA.

120 Chanter 7 Final Discussi

The finding that the HIF-lcx and c-myc 5'UTRs could destabilise the fGH reporter

mRNA indicates that this mode of regulation is not restricted to the VEGF mRNA. The

mechanism of how these cellular IRESs can promote mRNA destabilisation is not understood,

however it appears that sequence may be important. It has been shown that the VEGF 5,UTR

can bind PTB and this binding is independent of IRES activity, suggesting that it may have

another role (Huez et al., 1998). PTB has been implicated to play a role in mRNA stability

(kwin et al., l99l); (Tillmar et al., 2002), which may provide a mechanism for its binding to

the 5'UTR in VEGF mRNA. Analysis of the 5'UTR sequences of HIF-1o, c-myc and XIAp

yielded the presence of 1 (11 nucleotides in length), 4 (8,7,11, and 7 nucleotides in length)

and 2 (8 and 11 nucleotides in length) pyrimidine stretches, respectively. The pyrimidine

stretch in the XIAP 5'UTR has been shown to bind La autoantigen (Holcik et a1.,2000),

which indicates PTB may play a role in the instability of these mRNAs, assuming that it can

bind to these pyrimidine rich regions of the HIF-1o and c-myc 5'UTRs. This notion links the

mechanism of mRNA instability and lRES-mediated translation as PTB has been shown to

play a role in both cellular functions (hwin et al., I99l); (Kaminski & Jackson, l99g); (I{tm et

aI., 2000); (Mitchell et al., 2001). This unidentified protein may yield some interesting

findings, and may be the missing link between IRES function and mRNA instability.

In this thesis I have shown that the HIF-1o 5'UTR contains an IRES, and this provides

an alternative mechanism of translation under hypoxia. I also raise the possibility that

signaling through the PI3K signaling pathway may activate the HIF-1cr IRES and provides a

novel mechanism of gene expression. I show for the first time that the HIF-lcr IRES contains mRNA instability determinants, and further indicate that IRES activity from G + C rich

5'UTRs may promote mRNA destabilisation. Overall, this thesis has contributed to the

121 Chaoter 7 Final Discussion

understanding of the function of the HIF-lcx 5'UTR, and that multiple modes of regulation exist.

122 Chapter I

References Chanter 8 References

Reference List

1. Acland, P., Dixon, M., Peters, G., and Dickson, C. (1990) Subcellular fate of the int-2 oncoprotein is determined by choice of initiation codon. Nature 343,662-665.

2. Adam, S. 4., Nakagawa, T., Swanson, M. S., Woodruff, T. K., and Dreyfuss, G. (1986) mRNA polyadenylate-binding protein: gene isolation and sequencing and identification of a ribonucleoprotein consensus sequence. Mol Cell8io16,2932-2943.

3. Akiri, G., Nahari, D., Finkelstein, Y., Le, S. Y., Elroy-Stein, O., and Levi, B. Z. (lg9ï) Regulation of vascular endothelial growth factor (VEGF) expression is mediated by internal initiation of translation and alternative initiation of transcription. Oncogene 17, 227-236.

4. Allalunis-Turner, M. J., Franko, A. J., and Parliament, M. B. (1999) Modulation of oxygen consumption rate and vascular endothelial growth factor mRNA expression in human malignant glioma cells by hypoxia. Br.J Cancer 80, 104-109.

5. Alon, T., Hemo, I., Itin, 4., Pe'er, J., Stone, J., and Keshet, E. (1995) Vascular endothelial growth factor acts as a survival factor for newly formed retinal vessels and has implications for retinopathy of prematunty. Nat Med. l, 1024-1,028.

6. Alvarez-Tejado, M., Alfranca, 4., Aragones, J., Yara, A., Landazuri, M. O., and del Peso, L (2002) Lack of evidence for the involvement of the phosphatidylinositol 3- kinase / Akt pathway in the activation of hypoxia-inducible factors by low oxygen

tension. J Biol Chem 277, 13508-13517 .

7. Amellem, O. and Pettersen, E. O. (1991) Cell inactivation and cell cycle inhibition as induced by extreme hypoxia: the possible role of cell cycle arrest as a protection against hypoxia-induced lethal damage. CeIl Prolif 24,121-I4L

8. Annunen, P., Autio-Harmainen, H., and Kivirikko, K. I. (1998) The novel type II prolyl 4-hydroxylase is the main enzyme form in chondrocytes and capillary endothelial cells, whereas the type I enzyme predominates in most cells. J Biol Chem 273,5989-5992.

9. Anthonisen, I.L., Salvador, M. L., and Klein, U. (2001) Specific sequence elements in the 5' untranslated regions of rbcl- and atpB gene mRNAs stabilize transcripts in the chloroplast of Chlamydomonas reinhardtii. RNA. 7, 1024-1033.

10. Arany, 2., Huang, L. 8., Eckner, R., Bhattacharya, S., Jiang, C., Goldberg, M. 4., Bunn, H. F., and Livingston, D. M. (1996) An essential role for p300/CBP in the cellular response to hypoxia . Proc Natl Acad Sci U S A 93, 12969-12973.

123 Chaoter 8 References

11. Arnaud,E,., Touriol, C., Boutonnet, C., Gensac, M. C., Vagner, S', Prats, H., and Prats, is cap A. C. Gggg) A new 34-kilodalton isoform of human fibroblast growth factor 2 dependently synthesized by using a non-AUG start codon and behaves as a survival factor. Mol CeIl BioI19,505-514.

12. Amold, T. E., Yu, J., and Belasco, J. G. (1998) mRNA stabilization by the ompA 5' untranslated region: two protective elements hinder distinct pathways for mRNA degradation. RNA. 4, 319-330.

13. Arsham, A. M., Plas, D. R., Thompson, c. 8., and simon, M. c. (2002) phosphatidylinositol 3-kinase / Akt signaling is neither required for hypoxic stabilization of HIF-1 alpha nor sufficient for HIF-1-dependent target gene transcription. J BioI Chem 277 , 15162-15110.

14. Attal, J., Theron, M. C., Puissant, C., and Houdebine, L. M. (1999) Effect of intercistronic length on internal ribosome entry site (IRES) efficiency in bicistronic mRNA. Gene Expr. 8, 299-309'

15. Bachurski, C. J., Theodorakis, N.G., Coulson, R. M., and Cleveland, D. W' (1994) An amino-terminal tetrapeptide specifies cotranslational degradation of beta-tubulin but not alpha-tubulin mRNAs. MoI CeIl Biol'l'4,4016-4086'

16. Bagheri-Yarmand, R., Vadlamudi, R. K., Wang, R. A., Mendelsohn, J., and Kumar, R' (20-00) Vascular endothelial growth factor up-regulation via p2l-acfivated kinase-l signaling regulates heregulin-betal-mediated angiogenesis. J Biol Chem 275, 3945L- 39451.

l7. Barthel, 4., Okino, S. T., Liao, J., Nakatani, K., Li, J., and Whitlock, J. P' (1999) Regulation of GLUT1 gene transcription by the serine/threonine kinase Aktl. J Biol Chem 274,20281-20286'

18. Battey, J., Moulding, C., Taub, R., Murphy, W., Stewart, T., Potter, H., Lenoir, G., and Ledei, p. (1983) The human c-myc oncogene: structural consequences of translocation into the IgH locus in Burkitt lymphoma. Ce\|34,779-781 '

ß. Beck, I., Weinmann, R., and Caro, J. (1993) Charactenzation of hypoxia-responsive enhancer in the human erythropoietin gene shows presence of hypoxia-inducible 120- Kd nuclear DNA-binding protein in erythropoietin-producing and nonproducing cells' Blood 82,704-7|L.

20. Belsham, G. J. (1992) Dual initiation sites of protein synthesis on foot-and-mouth disease virus RNA are selected following internal entry and scanning of ribosomes in vitro. EMBO J 11,1105-1110.

21. Benjamin, L. E. and Keshet, E. (1991) Conditional switching of vascular endothelial growth factor (VEGF) expression in tumors: induction of endothelial cell shedding and iegression of hemangioblastoma-like vessels by VEGF withdrawal. Proc Natl Acad Sci u s A94,8761-8766. 124 Chanter 8 References

22. Bentley, D. L. and Groudine, M. (1986) Novel promoter upstream of the human c-myc gene and regulation of c-myc expression in B-cell lymphomas. MoI CeII BioI 6,348I- 3489.

23. Beretta, L., Gingras, A. c., svitkin, Y. v., Hall, M. N., and sonenberg, N. (1996) Rapamycin blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation of translation. EMBO J 15,658-664.

24. Beretta, L., Svitkin, Y. V., and Sonenberg, N. (1996) Rapamycin stimulates viral protein synthesis and augments the shutoff of host protein synthesis upon picornavirus infection. J Virol. 70, 8993-8996.

25. Bergeron, M., Ferriero, D. M., Vreman, H. J., Stevenson, D. K., and Sharp, F. R. (1997) Hypoxia-ischemia, but not hypoxia alone, induces the expression of heme oxygenase-l (HSP32) in newborn rat brain. J Cereb.Blood FIow Metab 17,647-658.

26. Bernstein, J., Sella, O., Le, S. Y., and Elroy-Stein, o. (rgg7) pDGF2/c-sis mRNA leader contains a differentiation-linked internal ribosomal entry site (D-IRES). J BioI Chem 272,9356-9362.

27. Bhattacharya, S. (1998) Mechanisms of signal transduction in the stress response of hepatocytes. Int.Rev.Cytol. 184, 109-156.

28. Blagosklonny, M. V. (2001) Do VHL and HIF-1 mirror p53 and Mdm-2? Degradarion- transactivation loops of oncoproteins and tumor suppressors. Oncogene 20,395-398.

29. Blancher, c., Moore, J.w., Robertson, N., and Harris, A. L. (2001) Effects of ras and von Hippel-Lindau (VÉil-) gene mutations on hypoxia-inducible factor (HIF)-lalpha, HlF-2alpha, and vascular endothelial growth factor expression and their regulation by the phosphatidylinositol 3-kinase/Akt signaling pathway. Cancer Res.61,7349-7355. 'w., 30. Blancher, c., Moore, J. Talks, K. L., Houlbrook, s., and Harris, A. L. (2000) Relationship of hypoxia-inducible factor (HIF)-lalpha and HlF-2alpha expression to vascular endothelial growth factor induction and hypoxia survival in human breast cancercell lines. Cancer R¿s. 60,7106-7I13.

3I. Boal, T. R., Chiorini, J. 4., Cohen, R. 8., Miyamoto, S., Frederickson,.R. M., Sonenberg, N., and Safer, B. (1993) Regulation of eukaryotic translation initiation factor expression during T-cell activation. Biochim.Biophys Acta 1176,257 -264.

32. Boehm, T., Folkman, J., Browder, T., and o'Reilly, M. s. (L997) Antiangiogenic therapy of experimental cancer does not induce acquired drug resistance. Nature 390, 404-401.

33. Borman, A. M., Bailly, J. L., Girard, M., and Kean, K. M. (1995) Picornavirus internal ribosome entry segments: comparison of translation efficiency and the requirements for optimal internal initiation of translation in vitro. Nucleic Acids Res 23,3656-3663.

125 Chapter 8 References

34. Borman, A. M. andJackson, R. J. (L992) Initiation of translation of human rhinovirus RNA: mapping the internal ribosome entry site. Virology L88, 685-696.

35. Borman, A. M., Le Mercier, P., Girard, M., and Kean, K. M. (1997) Comparison of picornaviral IRES-driven internal initiation of translation in cultured cells of different origins. Nucleic Acids Res. 25, 925-932.

36. Brogna, S. and Ashburner, M. (1997) The Adh-related gene of Drosophila melanogaster is éxpressed as a functional dicistronic messenger RNA: multigenic transcription in higher organisms. EMBO J 16,2023-2031.

37. Bruick, R. K. (2000) Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia . Proc.Natl'Acad.Sci.U.S.A 97, 9082-9087 . 38. Bruick, R. K. and McKnight, S. L. (2001) A conserved family of prolyl-4- hydroxylases that modify IIß ' Science 294, L337 -1340.

39. Bu, G., Maksymovitch, E. 4., and Schwartz, A. L' (1993) Receptor-mediated endocytosis of tissue-type plasminogen activator by low density lipoprotein receptor- related protein on human hepatoma cells.,I Biol Chem268,13002-13009.

40. Buck, c. 8., shen, X., Egan, M. 4., Pierson, T. c., walker, c. M., and Siliciano, R. F. (2001) The human immunodeficiency virus type L gag gene encodes an internal ribosome entry site. J Virol.75, 181-191

4L Bushell, M., McKendrick, L., Janicke, R. IJ., Clemens, M' J', and Morley, S. J. (1999) Caspase-3 is necessary and sufficient for cleavage of protein synthesis eukaryotic initiation factor 4G during apoptosis. FEBS Lett. 451,332-336'

42. Byers, P. H. (2002) Killing the messenger: New insights into nonsense-mediated mRNA decay. J Clin Invest 109,3-6.

43. Canaani, D., Revel, M., and Groner, Y. (I976) Translational discrimination of 'capped' and 'non-capped' mRNAs: inhibition of a series of chemical analogs of mTGpppX. FEBS Lett.64,326-33I.

44. Cannons, A. C. and Cannon,J. (2002) The stability of the Chlorella nitrate reductase 6RNA is determined by the secondary structure of the 5'UTR: implications for posttranscriptional regulation of nitrate reductase. Planta 214, 488-491.

45. Cantley, L. C. and Neel, B. G. (1999) New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc NatI Acad Sci U S A96' 4240-4245'

126 Chapter 8 References

46. Carmeliet, P., Dor, Y., Herbert, J.M., Fukumura, D., Brusselmans, K., Dewerchin, M., Neeman, M., Bono, F., Abramovitch, R., Maxwell, P., Koch, C. J., Ratcliffe, P., Moons, L., Jain, R. K., Collen, D., Keshert, E., and Keshet, E. (1998) Role of HIF- lalpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature 394,485-490.

47. Carmeliet, P., Ferreirâ, V., Breier, G., Pollefeyt, S., Kieckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal, K., Eberhardt, C., Declercq, C., Pawling, J., Moons, L., Collen, D., Risau, 'W., and Nagy, A. (1996) Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380, 435- 439.

48. Carter, M. S. and Sarnow, P. (2000) Distinct mRNAs that encode La autoantigen are differentially expressed and contain internal ribosome entry sites. J Biol Chem 275, 2830r-28307.

49. Chappell, S. 4., Edelman, G. M., and Mauro, V. P. (2000) A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity. Proc NatI Acad Sci U S A97, 1536-154r.

50. Chappell, S. 4., LeQuesne, J. P., Paulin, F. E., deSchoolmeester, M. L., Stoneley, M., Soutar, R. L., Ralston, S. H., Helfrich, M. H., and Willis, A. E. (2000) A mutation in the c-myc-IRES leads to enhanced internal ribosome entry in multiple myeloma: a novel mechanism of oncogene de-regulation. Oncogene L9,4437-4440.

51. Chappell, S. A., Owens, G. C., and Mauro, V. P. (2001) A 5' Leader of Rbm3, a Cold Stress-induced mRNA, Mediates Internal Initiation of Translation with Increased Efficiency under Conditions of Mild Hypothermia. J Biol Chem276,36917-36922.

52. Chen, C. Y., Gherzi, R., Anderson, J. S., Gaietta, G., Jurchott, K., Royer, H. D., Mann, M., and Karin, M. (2000) Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation. Genes Dev.14,I236-L248.

53. Chiaberge, S., Cassarino, E., and Mangiarotti, G. (1998) The phosphorylation of protein 56 modulates the interaction of the 40S ribosomal subunit with the 5' untranslated region of a dictyostelium pre-spore-specific mRNA and controls its stability. J Biol Chem 273, 27010-2707 5.

54. Chiang, P. W., Carpenter, L.8., and Hagerman, P. J. (2001) The S'-untranslated region of the fmrl message facilitates translation by internal ribosome entry. J Biol Chem 276,31916-3792t.

55. Chiarotto, J. A. and Hill, R. P. (1999) A quantitative analysis of the reduction in oxygen levels required to induce up-regulation of vascular endothelial growth factor (VEGF) mRNA in cervical cancer cell lines. Br.J Cancer 80, 1518-1524.

127 Chapter 8 References

56. Cho, S., Choi, Y. J., Kim, J. M., Jeong, S. T., Kim, J. H., Kim, S. H., and Ryu, S. E. (2001) Binding and regulation of HIF-lalpha by a subunit of the proteasome complex, PSMA7. FEBS Lett. 498, 62-66.

57. Chung, S., Jiang, L., Cheng, S., and Furneaux, H. (1996) Purification and properties of HuD, a neuronal RNA-binding proteins. J BioI Chem27l,Il5l8-1I524.

58. Clemens, M. J., Bushell, M., and Morley, S. J. (1998) Degradation of eukaryotic polypeptide chain initiation factor (eIF) aG in response to induction of apoptosis in human lymphoma cell lines. Oncogene 17,292I-293L

59. Clemens, M. J. and Elia, A. (1997) The double-stranded RNA-dependent protein kinase PKR: structure and function. J.Interferon Cytokine Res. 17,503-524.

60. Coldwell, M. J., deSchoolmeester, M. L., Fraser, G. A, Pickering, B. M., Packham, G., and Willis, A. E. (2001) The p36 isoform of BAG-1 is translated by internal ribosome entry following heat shock. Oncogene 20,4095-4100.

61. Coldwell, M. J., Mitchell, S. 4., Stoneley, M., MacFarlane, M., and Willis, A. E. (2000) Inititiation of Apaf-1 translation by internal ribosome entry. Oncogene 19, 899- 905.

62. Cormier-Regard, S., Nguyen, S. V., and Claycomb, W. C. (1998) Adrenomedullin gene expression is developmentally regulated and induced by hypoxia in rat ventricular cardiac myocytes. J Biol Chem 273, 17787 -17792.

63. Cornelis, S., Bruynooghe, Y., Denecker, G., Van Huffel, S., Tinton, S., and Beyaert, R. (2000) Identification and charactenzation of a novel cell cycle-regulated internal ribosome entry site. Mol Cell 5,597-605.

64. Damert, A., Machein, M., Breier, G., Fujita, M. Q., Hanahan, D., Risau, W., and Plate, K. H. (1997) Up-regulation of vascular endothelial growth factor expression in a rat glioma is conferred by two distinct hypoxia-driven mechanisms. Cancer Res 57, 3860- 3864.

65. Dames, S. 4., Martinez-Yamout, M., De Guzman, R. N., Dyson, H. J., and Wright, P. E. (2002) From the Cover: Structural basis for Hif-lalpha /CBP recognition in the cellular hypoxic response. Proc Natl Acad Sci U S A 99, 527I-5276.

66. De Benedetti, A. and Rhoads, R. E. (1990) Overexpression of eukaryotic protein synthesis initiation factor 4E in HeLa cells results in aberrant growth and morphology. Proc NatI Acad Sci U S A 87, 8212-8216.

67. de Melo Neto, O. P., Standart, N., and Martins de Sa, C. (1995) Autoregulation of poly(A)-binding protein synthesis in vitro. Nucleic Acids Res 23,2198-2205.

128 Chaoter 8

68. Dever, T. E., Wei, C. L., Benkowski, L. 4., Browning, K., Merrick, W. C., and Hershey, J. W. (1994) Determination of the amino acid sequence of rabbit, human, and wheat germ protein synthesis factor eIF-4C by cloning and chemical sequencing. "I Biol Chem 269, 32L2-32I8.

69. Dholakia, J. N., Xtt, 2., Hille, M. 8., and Wahba, A. J. (1990) Purification and characterisation of sea urchin initiation factor 2.The requirement of guanine nucleotide exchange factor for the release of eukaryotic polypeptide chain intiation factor 2-bound GDP. J Biol Chem265,I93l9-I9323'

70. Dibbens, J. 4., Miller, D. L., Damert, 4., Risau, W., Vadas, M. 4., and Goodall, G. J. (1999) Hypoxic regulation of vascular endothelial growth factor mRNA stability requires the cooperation of multiple RNA elements. MoI Biol Cell10,901-9I9.

iL. Duncan, R. F. and Hershey, J. W. (1937) Initiation factor protein modifications and inhibition of protein synthesis. MoI CeII Biol T , 1293-1295-

j2. p;bert, B. L. and Bunn, H. F. (1998) Regulation of transcription by hypoxia requires a multiprotein complex that includes hypoxia-inducible factor l, an adjacent transcription factor, and p300/CREB binding protein. Mol Cell BioI 18,4089-4096.

73. Eckhart, A. D., Yang, N., Xin, X., and Faber, J. E. (1997) Characterization of the alphalB-adrenergic receptor gene promoter region and hypoxia regulatory elements in vascular smooth muscle. Proc NatI Acad Sci U S A94,9487-9492.

14. Elson, D. 4., Ryan, H. E,., Snow, J. W., Johnson, R., and Arbeit, J. M. (2000) Coordinate up-regulation of hypoxia inducible factor (HlF)-lalpha and HIF-1 tatget genes during multi-stage epidermal carcinogenesis and wound healing. Cancer Res. 60, 6189-6195.

75. Ema, M., Taya, S., Yokotani, N', Sogawa, K., Matsuda, Y., and Fujii-Kuriyama, Y' (lgg7) A novel bHLH-PAS factor with close sequence similarity to hypoxia- inducible factor lalpha regulates the VEGF expression and is potentially involved in lung and vascular development. Proc Natl Acad Sci U S A94,4213-4218.

16. Epstein, A. C., Gleadle, J.M., McNeill, L. 4., Hewitson, K. S., O'Rourke, J., Mole, D. R., Mukherji, M., Metzen, E., Wilson, M' I., Dhanda, A., Tian, Y. M., Masson, N', Hamilton, D. L., Jaakkola, P., Barstead, R., Hodgkin, J., Maxwell, P. H., Pugh, C.'W., Schofield, C. J., and Ratcliffe, P. J. (2001) C. elegans EGL-9 and Mammalian Homologs Define a Family of Dioxygenases that Regulate HIF by Prolyl Hydroxylation. CeII 107, 43-54'

77. Evans, D. R., Rasmussen, C., Hanic-Joyce, P. J., Johnston, G. C., Singer, R. A.' and Barnes, C. A. (1995) Mutational analysis of the Prtl protein subunit of yeast translation initiation factor 3. Mol Cell BioI15,4525-4535.

129 Chanfer 8 Referenc es

78. Fadden, P., Haystead, T. 4., and Lawrence, J. C., Jr. (1997) Identification of phosphorylation sites in the translational regulator, PHAS-I, that are controlled by insulin and rapamycin in rat adipocytes. J Biol Chem272,I024O-I0247.

79. Fang, J., Yan, L., Shing, Y., and Moses, M. A. (2001) HlF-lalpha-mediated up- regulation of vascular endothelial growth factor, independent of basic fibroblast growth factor, is important in the switch to the angiogenic phenotype during early tumorigenesis. Cancer Res. 61, 573I-5735.

80. Fatyol, K. and Szalay, A. A. (2001) The pl4ARo tu-or suppressor protein facilitates nucleolar sequestration of hypoxia-inducible factor-lcx (HIF-1a) and inhibits HIF-I

mediated transcriptio n. J B iol Chem 27 6, 2842L -28429 .

81. Feigenblum, D. and Schneider, R. J. (1996) Cap-binding protein (eukaryotic initiation factor 4E) and 4E- inactivating protein BP-l independently regulate cap-dependent translation. Mol Cell Biol 16, 5450-5451.

82. Feldser, D., Agani, F., Iyer, N. V., Pak, 8., Ferreira, G., and Semenza, G. L. (1999) Reciprocal positive regulation of hypoxia-inducible factor lalpha and insulin-like growth factor 2. Cancer Res. 59,3915-3918. 'W. 83. Fernandez, J., Yaman, I., Mishra, R., Merrick, C., Snider, M. D., Lamers, W. H., and Hatzglou, M. (2001) Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability. J Biol Chem 276, 12285- t229L

84. Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L., O'Shea, K. S., Powell- Braxton, L., Hillan, K. J., and Moore, M. W. (1996) Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380,439-442.

85. Fidler, I. J. and Ellis, L. M. (1994) The implications of angiogenesis for the biology and therapy of cancer metastasis. Ce\|79,185-188.

86. Flamme, I., Frohlich, T., von Reutern, M., Kappel, 4., Damert, 4., and Risau, W. (1997) HRF, a putative basic helix-loop-helix-PAS-domain transcription factor is closely related to hypoxia-inducible factor-1 alpha and developmentally expressed in blood vessels. Mech.Dev. 63, 51-60.

81 . Folkman, J. (L994) Angiogenesis and breast cancer. J CIin Oncol. 12, 44I-443

88. Folkman, J. (1995) Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat.Med. 1,21-3L.

89. Folkman, J. and Shing, Y. (1992) Angiogenesis. J Biol Chem 267 , IO93I-10934

90. Forsythe, J. 4., Jiang, B. H., Iyer, N. V., Agani, F., Leung, S. \ry., Koos, R. D., and Semenza, G. L. (1996) Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor L Mol Cell Biol16,4604-4613.

130 Chanter 8

91. Fukunaga, F. and Hunter, T. (1997) MnKl, a new map kinase-activated protein kinase, isolted by novel expression screening method for identifying protein kinase substrates. EMBO J 16,l92r-r933.

92. Futterer, J., Kiss-Laszlo,2., and Hohn, T. (1993) Nonlinear ribosome migration on cauliflower mosaic virus 35s RNA. Ce\|73,789-802. 'W., 93. Gan, LaCelle, M., and Rhoads, R. E. (1998) Functional charactenzation of the internal ribosome entry site of eIF4G mRNA. J BioI Chem 273, 5006-5012.

94. Gan, W. and Rhoads, R. E. (1996) Internal initiation of translation directed by the 5'- untranslated region of the mRNA for eIF4G, a factor involved in the picomavirus- induced switch from cap-dependent to internal initiation. J BioI Chem 271,623-626.

95. Gerards,'W. L., de Jong, W. W., Boelens, W., and Bloemendal, H. (1998) Structure and assembly of the 20S proteasome. Cell Mol Lifu Sci 54,253-262'

96. Gerber, H. P., Condorelli, F., Park, J., and Ferrara, N. (1997) Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Flt-l, but not Flk-l/KDR, is up-regulated by hypoxia. J Biol Chem272,23659-23667.

97. Gerber, H. P., McMurtrey, 4., Kowalski, J., Yan, M., Keyt, B' 4., Dixit, V., and Ferrara, N. (1993) Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flk-l/KDR activation. J BioI Chem273,30336-30343.

98. Giaccia, A. J. and Kastan, M. B. (1998) The complexity of p53 modulation: emerging patterns from divergent signal s. G ene s D ev. 12, 297 3 -2983.

99. Gingras, A. C., Gygi, S. P., Raught, B., Polakiewicz, R. D., Abraham, R. T., Hoekstra, M. F., Aebersold, R., and Sonenberg, N. (1999) Regulation of 4E-BP1 phosphorylation: a novel two-step mechanism. Genes Dev. 13,1422-1437.

100. Gingras, A. C., Kennedy, S. G., O'Leary, M. 4., Sonenberg, N., and Hay, N. (1998) 4E-8P1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt (PKB) signaling pathway. Genes Dev. 122,502-513.

101. Gingras, A. C., Raught, 8., and Sonenberg, N. (1999) eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68,913-963.

lO2. Gnarra, J. R., Tory, K., Weng, Y., Schmidt, L., Wei, M. H., Li, H', Latif, F., Liu, S., Chen, F., Duh, F. M., and . (1994) Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet.7, 85-90.

103. Goldberg, M. A. and Schneider, T. J. (1994) Similarities between the oxygen-sensing mechanisms regulating the expression of vascular endothelial growth factor and erythropoietin. J Biol Chem 269, 4355-4359 '

131 Chanter I References

IO4. Goldstrohm, A. C., Greenleaf, A. L., and Garcia-Blanco, M. A. (2001) Co- transcriptional splicing of the pre-messenger RNAs: considerations for the mechanism

of alternative splicing. Gene 277,3L-47 . 'Wenger, 105. Gorlach, 4., Camenisch, G., Kvietikova, I., Vogt, L., R. H., and Gassmann, M. (2000) Efficient translation of mouse hypoxia-inducible factor-lalpha under normoxic and hypoxic condition s. B i o chim. B i o phy s. Acta 1493, I25 - 13 4.

106. Gosert, R., Chang, K. H., Rijnbrand, R., Yi, M., Sangar, D. V., and Lemon, S. M. (2000) Transient expression of cellular polypyrimidine tract binding protein stimulates cap-independent translation directed by both picornaviral and flaviviral internal ribosome entry sites in vivo. MoI Cell 8io120,1583-1595.

107. Gradi, 4., Svitkin, Y. v., Imataka, H., and sonenberg, N. (1998) Proteolysis of human eukaryotic translation initiation factor eIF4GII, but not eIF4GI, coincides with the shutoff of host protein synthesis after poliovirus infection. Proc NatI Acad Sci U S A 95,11089-1t094.

108. Gradin, K., McGuire, J., Wenger, R.H., Kvietikova, I., Whitelaw, M. L., Toftgard, R., Tora, L., Gassmann, M., and Poellinger, L. (L996) Functional interference between hypoxia and dioxin signal transduction pathways: competition for recruitment of the Arnt transcription factor. MoLCelI Biol. 1.6,522I-523I.

109. Graeber, T. G., Osmanian, C., Jacks, T., Housman, D. E., Koch, C. J., Lowe, S. W., and Giaccia, A. J. (1996) Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumours. Nature 379, 88-91.

110. Graness, 4., Adomeit, 4., Heinze, R., lVetzker, R., and Liebmann, C. (1998) A novel mitogenic signaling pathway of bradykinin in the human colon carcinoma cell line SW-480 involves sequential activation of a Gq/11 protein, phosphatidylinositol 3- kinase beta, and protein kinase Cepsilon. J BioI Chem273,32016-32022. 'W. 111. Gray, N. K. and Hentze, M. (1994) Iron regulatory protein prevents binding of the 43S translation pre-initiation complex to ferritin and eALAS mRNAs. EMBO J 13, 3882-3891.

ll2. Gray, N. K. and Wickens, M. (1998) Control of translation initiation in animals. Annu Rev CeIl Dev.BioI 14, 399-458.

113. Gu, J., Milligan, J., and Huang, L. E. (2001) Molecular mechanism of hypoxia- inducible factor lalpha-p3OO interaction. A leucine-rich interface regulated by a single cysteine. J BioI Chem 276, 3550-3554.

lI4. Gu, W. and Hecht, N. R. (1996) Translation of a testis-specific CulZn superoxide dismutase (SOD-l) mRNA is regulated by a 65-kilodalton protein which binds to its 5' untranslated region. Mol CeIl Biol 16, 4535-4543.

132 Chaoter 8 References

115. Gu, Y. Z.,Moran, S. M., Hogenesch, J. 8., Wartman, L., and Bradfield, C. A. (1998) Molecular characterization and chromosomal localization of a third alpha-class hypoxia inducible factor subunit, HIF3alpha . Gene Expn 7 ,205-213 '

116. Guthridge, M.4., Stomski, F. C., Barry, E. F., Winnall, W., Woodcock, J. M., McClure, B. J., Dottore, M., Bemdt, M. C., and Lopez, A. F. (2000) Site-specific serine phosphorylation of the IL-3 receptor is required for hemopoietic cell survival. MoI CeIl6,99-108.

ILi. Haddad, J. J. and Land, S. C. (2001) A non-hypoxic, ROS-sensitive pathway mediates TNF-alpha-dependent regulation of HIF- 1 al pha. FEB S Lett. 505, 269 -27 4.

118. Haghighat, 4., Mader, S., Pause, 4., and Sonenberg, N. (1995) Repression of cap- dependent translation by 4E-binding protein 1: competition with p220 for binding to eukaryotic initiation factor-4E. EMBO J L4,570I-5709.

119. Hata, K., Yonezawa, K., Kozlowski, M.T., Sugimoto, T., Andrabi, K., Weng, Q.P., Kasuga, M., Nishimoto, I., and Avruch, J. (1991) Regulation of eIF-4E BPl phosphorylation by mTOR. J Biol Chem272,26457-26463.

120. Hellen, C. U., Pestova, T. V., and Wimmer, E. (1994) Effect of mutations downstream of the internal ribosome entry site on initiation of poliovirus protein synthesis. J Virol. 68,6312-6322.

l2l. Hellen, C. U. and Sarnow, P. (2001) Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev. 15, I593-I6L2.

L22. Helmlinger, G., Yuan, F., Dellian, M., and Jain, R. K. (1997) Interstitial pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a lack of correlation. Nat Med. 3,177-182'

I23. Henis-Korenblit, S., Strumpf, N. L., Goldstaub, D., and Kimchi, A. (2000) A novel form of DAP5 protein accumulates in apoptotic cells as a result of caspase cleaage and internal ribosome entry site-mediated translation . MoI Cell 8io120,496-506.

124. Henriksson, M. and Luscher, B. (1996) Proteins of the myc network: essential regulators of cell growth and differentiation. Adv Cancer Res.68, 109-182.

125. Hentze,M. V/. (L991) oIF4G: a multipurpose ribosome adapter? Science 275, 500-501.

126. Hentze, M. W. and Kuhn, L. C. (1996) Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc NatI Acad Sci U SA 93, 8175-8182.

IZ7. Hentze, M. W. and Kulozik, A. E. (1999) A perfect message: RNA surveillance and nonsense-mediated decay. Cell 96, 307-310.

133 Chapter 8 References

128. Herrick, D. J. and Ross, L (1994) The half-life of c-myc mRNA in growing and serum- stimulated cells; influence of the coding and 3' untranslated regions and role of

ribosome transloc atio n. M oI C ell B i oI 14, 27 19 -2128.

I29. Hershey, J. W. (1991) Translational control in mammalian cells. Annu Rev Biochem 60,7t7-755.

130. Hershey, J. W., Mathews, M. 8., and Sonenberg, N. (1996) Translational control.

131. Hiremath, L. S., Webb, N. R., and Rhoads, R. E. (1985) Immunological detection of the messenger RNA cap-binding protein. J Biol Chem260,7843-1849.

I32. Hoffman, E. C., Reyes, H., Chu, F.F., Sander, F., Conley, L. H., Brooks, B. 4., and Hankinson, O. (1991) Cloning of a factor required for activity of the Ah (dioxin) receptor. Science 252, 954-958.

I33. Hogenesch, J.8., Chan, W.K., Jackiw, V. H., Brown, R.C., Gu, Y. Z.,Pray-Gtant, M., Perdew, G. H., and Bradfield, C. A. (1,997) Charactenzation of a subset of the basic-helix-loop-helix-PAS superfamily that interacts with components of the dioxin signaling pathway. J BioI Chem272,858I-8593.

134. Holcik, M. and Korneluk, R. G. (2000) Functional charactenzation of the X-linked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La

autoantigen in XIAP translation . MoI.CeII Biol. 20, 4648-4657 .

135. Holcik, M., Lefebvre, C., Yeh, C., Chow, T., and Korneluk, R. G. (1999) A new internal-ribosome-entry-site motif potentiates XIAP-mediated cytoprotection. Nat.Cell Biol.l,190-192.

136. Holland, E. C., Hively, W. P., DePinho, R. 4., and Varmus, H. E. (1998) A constitutively active epidermal growth factor receptor cooperates with disruption of G1 cell-cycle arrest pathways to induce glioma-like lesions in mice. Genes Dev. 12,3615- 3685.

137. Honda, R., Tanaka, H., and Yasuda, H. (1997) Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett. 420,25-27.

138. Hori, 4., Sasada, R., Matsutani, E., Naito, K., Sakura, Y., Fujita, T., and Kozai, Y. (1991) Suppression of solid tumor growth by immunoneutralizing monoclonal antibody against human basic fibroblast growth factor. Cancer R¿s. 51, 6180-6184.

L39. Hu, J., Discher, D. J., Bishopric, N. H., and Webster, K. A. (1998) Hypoxia regulates expression of the endothelin-l gene through a proximal hypoxia-inducible factor-l binding site on the antisense strand. Biochem Bíophys.Res.Commun.245 ,894-899.

134 Chanter I References

I4O. Hu, M. C., Tranque, P., Edelman, G. M., and Mauro, V. P. (1999) rRNA- complementanty in the 5' untranslated region of mRNA specifying the Gtx homeodomain protein: evidence that base-pairing to 18S rRNA affects translational efficiency. Proc NatI Acad Sci U S A96,1339-1344.

I4l. IJu, 2., Zhang, 2., Doo, E., Coux, O., Goldberg, A. L., and Liang, T. J. (1999) Hepatitis B virus X protein is both a substrate and a potential inhibitor of the proteasome complex. J Virol. 73, 723I-7240.

142. Huang, L. E., Arany, 2., Livingston, D. M., and Bunn, H. F. (1996) Activation of hypoxia-inducible transcription factor depends primarily upon redox-sensitive stabilization of its alpha subunit. J Biol Chem271,32253-32259.

143. Huang, L. E., Gu, J., Schau, M., and Bunn, H. F. (1998) Regulation of hypoxia- inducible factor lalpha is mediated by an 02- dependent degradation domain via the ubiquitin-proteasome pathway. Proc NatI Acad Sci U ,S A 95, 7987 -7992.

L44. Hudder, A. and Werner, R. (2000) Analysis of a Charcot-Marie-Tooth disease mutation reveals an essential internal ribosome entry site element in the connexin-32 gene.,I Biol Chem 27 5, 34586-34591.

I45. Hudson, C. C., Liu, M., Chiang, G. G., Otterness, D. M., Loomis, D. C., Kaper, F., Giaccia, A. J., and Abraham, R. T. (2002) Regulation of hypoxia-inducible factor 1cr expression and function by the mammalian target of rapamycin. Mol CelI BioI 22, 7004-1014.

146. Huez,I., Creancier, L., Audigier, S., Gensac, M. C., Prats, A. C., and Prats, H. (1998) Two independent internal ribosome entry sites are involved in translation initiation of vascular endothelial growth factor mRNA. MoI Cell Biol L8,6I78-6L90.

147. Ikeda, 8., Achen, M. G., Breier, G., and Risau, W. (1995) Hypoxia-induced transcriptional activation and increased mRNA stability of vascular endothelial growth factor in C6 glioma cells. "I BioI Chem270,1976l-19766. 148. Ikuta, T., Eguchi, H., Tachibana, T., Yonedâ, Y., and Kawajiri, K. (1998) Nuclear localization and export signals of the human aryl hydrocarbon receptor. J Biol Chem 273,2895-2904.

I49. Imataka, H., Gradi, 4., and Sonenberg, N. (1998) A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation . EMBO J L7, 7 480-7 489.

150. Imataka, H., Oslen, H. S., and Sonenberg, N. (1997) A new translational regulator with homology to eukaryotic translation initiation factor 4G. EMBO J 16, 8I7 -825.

151. Irwin, N., Baekelandt, V., Goritchenko, L., and Benowitz, L. L (1991) Identification of two proteins that bind to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA. Nucleic Acids Res 25,I28L-I288.

135 Chanter 8 References

I52. Ishii, N., Maier, D., Merlo, A., Tada, M., Sawamura, Y., Diserens, A. C., and Van Meir, E. G. (1999) Frequent co-alterations of TP53, p16ICDKN2A, p14ARF, PTEN tumor suppressor genes in human glioma cell lines. Brain Pathol.9,469-419.

153. Ivan, M., Kondo, K., Yang, H., Kim,'W., Valiando, J., Ohh, M., Salic, 4., Asara, J. M., Lane, W. S., and Kaelin, W. G., Jr. (2001) HlFalpha targeted for VHl-mediated destruction by proline hydroxylation: implications for 02 sensing. Science 292, 464- 468.

I54. Iwai, K., Yamanaka, K., Kamuta,T., Minato, N., Conaway, R.C., Conaway, J. W., Klausner, R. D., and Pause, A. (1999) Identification of the von Hippel-lindau tumor- suppressor protein as part of an active E3 ubiquitin ligase complex. Proc Natl Acad Sci u s A96, 12436-1244r.

155. Iyer, N. V., Kotch, L. E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H., Gassmann, M., Gearhaft, J. D., Lawler, A. M., Yu, A. Y., and Semenza, G. L. (1998) Cellular and developmental control of 02 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev. 12, 149-162.

156. Iyer, N. V., Leung, S. W., and Semenza, G. L. (1998) The human hypoxia-inducible factor lalpha gene: HIF1A structure and evolutionary conservation. Genomics 52 , 159-165.

I57. Izquierdo, J. M. and Cuezva, J. M. (2000) Internal-ribosome-entry-site functional activity of the 3'-untranslated region of the mRNA for the beta subunit of the mitochondrial H+-ATP synthase . Biochem J. 346, 849-855. 'Wilson, 158. Jaakkola, P., Mole, D. R., Tian, Y. M., M. I., Gielbert, J., Gaskell, S. J., Kriegsheim, Av, Hebestreit, H. F., Mukherji, M., Schofield, C. J., Maxwell, P. H., 'W., Pugh, C. and Ratcliffe, P. J. (2001) Targeting of HlF-alpha to the von Hippel- Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292, 468-472.

159. Jackson, R. J. and Standart, N. (1990) Do the poly(A) tail and 3' untranslated region control mRNA translation? CelI 62, 15-24.

160. Jang, S. K., Krausslich, H. G., Nicklin, M. J., Duke, G. M., Palmenberg, A. C., and Wimmer, E. (19SS) A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J Virol. 62, 2636-2643.

161. Jekunen, A. P. and Kairemo, K. J. (1997) Inhibition of malignant angiogenesis. Cancer Treat. Rev. 23, 263 -286.

162. Jiang, B. H., Agani, F., Passaniti, A., and Semenza, G. L. (1991) V-SRC induces expression of hypoxia-inducible factor 1 (HIF-1) and transcription of genes encoding vascular endothelial growth factor and enolase 1: involvement of HIF-I in tumor progression . Cancer Res. 57, 5328-5335.

136 Chaoter 8 References

163. Jiang, B. H., Jiang, G., Zheng, I. 2., Lu, 2., Hunter, T., and Vogt, P. K. (2001) Phosphatidylinositol 3-kinase signaling controls levels of hypoxia-inducible factor 1. CeIl Growth Drffer. 12,363-369.

164. Jiang, B. H., Rue, E., Wang, G. L., Roe, R., and Semenza, G. L. (1996) Dimerization, DNA binding, and transactivation properties of hypoxia-inducible factor l. J BioI Chem 271., 1777I-1777 8.

165. Jiang, B. H., Semenza, G. L., Bauer, C., and Marti, H. H. (1996) Hypoxia-inducible factor-l levels vary exponentially over a physiological relevant range of Oz tension. Am.J. Physiol 27 l, C 1 172-C I 1 80.

166. Jiang, B. H., Zheng, J.2., Aok{ M., and Vogt, P. K. (2000) Phosphatidylinositol 3- kinase signaling mediates angiogenesis and expression of vascular endothelial growth factor in endothelial cells. Proc Natl Acad Sci U S A97,1149-1153.

161. Jiang, B. H., Zheng, J.2., Leung, S. W., Roe, R., and Semenza, G. L. (1997) Transactivation and inhibitory domains of hypoxia-inducible factor lalpha. Modulation of transcriptional activity by oxygen tension. J Biol Chem 272, 19253- 19260.

168. Jin, K. L., Mao, X. O., and Greenberg, D. A. (2000) Vascular endothelial growth

factor: direct neuroprotective effect in in vitro ischemia. Proc Natl Acad Sci U S A 97 , t0242-t0247.

169. Johannes, G. and Sarnow, P. (1998) Cap-independent polysomal association of natural mRNAs encoding c-myc, BiP, and eIF4G conferred by internal ribosome entry sites. RNA. 4,1500-1513.

L70. Joshi, 8., Yan, R., and Rhoads, R. E. (1994) In vitro synthesis of human protein synthesis initiation factor 4 gamma and its localization on 43 and 48 S initiation complexes . J BioI Chem 269, 2048-2055.

ITL Kaelin, W. G., Jr. and Maher, E. R. (1998) The VHL tumour-suppressor gene paradigm. Trends Genet. 1,4, 423-426.

Il2. Kallio, P. J., Okamoto, K., O'Briefl, S., Carrero, P., Makino, Y., Tanaka, H., and Poellinger, L. (1998) Signal transduction in hypoxic cells: inducible nuclear translocation and recruitment of the CBP/p300 coactivator by the hypoxia-inducible factor-l alpha. EMBO J 17, 657 3-6586.

I73. Kallio, P. J., Pongratz,I., Gradin, K., McGuire, J., and Poellinger, L. (L997) Activation of hypoxia-inducible factor lalpha: posttranscriptional regulation and conformational change by recruitment of the Arnt transcription factor. Proc NatI Acad Sci U S A 94, 5667-5672.

137 Chanter 8 References

I14. Kallio, P. J., Wilson, 'W. J., O'Brien, S., Makino, Y., and Poellinger, L. (1999) Regulation of the hypoxia-inducible transcription factor La by the ubiquitin- proteasome pathway. J BioI Chem 274,6519-6525.

I75. Kaminski, 4., Belsham, G. J., and Jackson, R. J. (L994) Translation of encephalomyocarditis virus RNA: parameters influencing the selection of the internal iniriarion sife. EMB0 J 13,1613-1681. I76. Kaminski, 4., Howell, M. T., and Jackson, R, J. (1990) Initiation of encephalomyocarditis virus RNA translation: the authentic initiation site is not selected by a scanning mechanism. EMBO J 9,3753-3759.

177. Kaminski, A. and Jackson, R. J. (1998) The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute. RNA. 4,626-638. 'W., 178. Kappel, 4., Ronicko, V.,Damert, 4., Flamme, I., Risau, and Breier, G. (1999) Identification of vascular endothelial growth factor (VEGF) receptor-2 (Flk-l) promoter/enhancer sequences sufficient for angioblast and endothelial cell-specific transcription in transgenic mice. Blood 93, 4284-4292.

I19. Kempe, 8., Muhs, 8., and Schafer, M. (1993) Gene regulation in Drosophila spermatogenesis: analysis of protein binding at the translational control element TCE. Dev Genet 14,449-459.

I79. Kevil, C. G., De Benedetti, 4., Payne, D. K., Coe, L. L., Laroux, F. S., and Alexander, J. S. (1996) Translational regulation of vascular permeability factor by eukaryotic initiation factor 4E: implications for tumor angiogenesis. Int.J Cancer 65,785-790.

180. Kietzmann, T., Roth, IJ., and Jungermann, K. (1999) Induction of the plasminogen activator inhibitor-1 gene expression by mild hypoxia via a hypoxia response element binding the hypoxia-inducible factor- 1 in rat hepatocytes. Blood 94, 4177 -4185.

181. Kim, J. G., Armstrong, R. C., Berndt, J. 4., Kim, N. W'., and Hudson, L. D. (1998) A secreted DNA-binding protein that is translated through an internal ribosome entry site (IRES) and distributed in a discrete pattern in the central nervous system. Mol Cell Neurosci 12,lI9-I40.

I82. Kim, K. J., Li, 8., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and Ferrara, N. (1993) Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 362,84I-844.

183. Kim, Y. K., Hahm, 8., and Jang, S. K. (2000) Polypyrimidine tract binding protein inhibits translation of bip mRNA. J Mol BioI304, ll9-133.

138 Chapter 8 References

I84. Kolupaeva, V. G., Hellen, C. U., and Shatsky, I. N. (1996) Structural analysis of the interaction of the pyrimidine tract-binding protein with the internal ribosomal entry site of encephalomyocarditis virus and foot-and-mouth disease virus RNAs. RNA. 2, II99- 12t2.

185. Kotch, L. E., Iyer, N. V., Laughner, E., and Semenza, G. L. (1999) Defective vascularization of HIF-lalpha-null embryos is not associated with VEGF deficiency but with mesenchymal cell death. Dev.Biol209,254-267.

186. Kozak, M. (1983) Translation of insulin-related polypeptides from messenger RNAs with tandemly reiterated copies of the ribosome binding site. CeII 34,971-978.

I87. Kozak, M. (1984) Selection of initiation sites by eukaryotic ribosomes: effect of inserting AUG triplets upstream from the coding sequence for prepoinsulin. Nucleic Acids Res 12, 3873-3893.

188. Kozak, M. (1987) An analysis of S'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15, 8125-8148.

189. Kozak, M. (1989) Circumstances and Mechanisms of inhibition of translation by secondary structure in eucaryotic mRNAs . Mol CeIl Biol9, 5134-5142.

190. Kozak, M. (2001) New ways of initiating translation in eukaryotes? MoI CeII BioI2l , t899-r907.

191. Kozak, M. (1984) Point mutations close to the AUG initiator codon affect the efficiency of translation of rat prepoinsulin in vivo. Nature 308,24I-246.

I92. Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. C eII 44, 283 -292.

193. Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem266,19867-19870.

I94. Kraggerud, S. M., Sandvik, J. 4., and Pettersen, E. O. (1995) Regulation of protein synthesis in human cells exposed to extreme hypoxia. Anticancer Res.15, 683-686.

195. Kung, A. L., Wang, S., Klco, J. M., Kaelin, W. G., and Livingston, D. M. (2000) Suppression of tumor growth through disruption of hypoxia-inducible transcription. Nat Med.6,1335-1340.

196. Ladoux, A. and Frelin, C. (1997) Cardiac expressions of HIF-1 alpha and HLFÆPAS, two basic loop helixÆAS domain transcription factors involved in adaptative responses to hypoxic stresses. B iochem Biophy s. Res. C ommun. 240, 5 52-5 56.

139 Chaoter 8

I97. Lagnado, C. 4., Brown, C. Y., and Goodall, G. J. (1994) AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U/AXU/1x). Mol Cell Biol 14, 1984- 7995.

198. Lamphear, B. J., Kirchweger, R., Skern, T., and Rhoads, R. E. (1995) Mapping of functional domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral proteases. Implications for cap-dependent and cap-independent translational initiation . J B iol Chem 27 0, 2197 5 -21983.

I99. Lander, E. S. (2001) Initial sequencing and analysis of the . Nature 409, 860-921.

2OO. Lando, D., Peet, D. J., Whelan, D. 4., Gorman, J. J., and'Whitelaw, M. L. (2002) Asparagine hydroxylation of the HIF transactivation domain a hypoxic switch. Science 295,858-861.

201. Laroia, G., Cuesta, R., Brewer, G., and Schneider, R. (1999) Control of mRNA decay by the heat-shock-ubiquitin-proteasome system. S ci enc e 284, 499 -502.

202. Laughner, E., Taghavi, P., Chiles, K., Mahon, P' C., and Semenza, G. L. (2001) HER2 (neu) signaling increases the rate of hypoxia-inducible factor lalpha (HlF-lalpha) synthesis: novel mechanism for HlF-l-mediated vascular endothelial growth factor expression . Mol Cell BioI 21,3995-4004.

203. Lauring, A. S. and Overbaugh, J. (2000) Evidence that an IRES within the Notch2 coding region can direct expression of a nuclear form of the protein. MoI Cell 6,939- 945.

204. Lazaris-Karatzas, 4., Montine, K. S., and Sonenberg, N. (1990) Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap. Nature 345,544-547.

205. Le, S. Y. and }y'raizel, J. V., Jr. (1997) A common RNA structural motif involved in the internal initiation of translation of cellular mRNAs . Nucleic Acids Res 25,362-369.

206. Lee, P. J., Jiang, B. H., Chin, B. Y., Iyer, N. V', Alam, J., Semenza, G. L., and Choi, A. M. (1997) Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase- 1 gene in response to hypoxia . J BioI Chem 272, 537 5-53 8 1 .

201. Lefebvre, C., Van Steenbrugge, M., Roberfroid, M., and Buc-Calderon, P' M' (1993) Adenine nucleotides and inhibition of protein synthesis in isolated hepatocytes incubatted under different pO2 levels. Arch Biochem Biophys 304,322-33I.

208. Levine, T. D., Gao, F., King, P. H., Andrew, L. E., and Keene, J. D. (1993) Hel-Nl: an autoimmune RNA binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs. MoI CeII BioI t3,3494-3504'

Le Quesne, J. P., stoneley, M.;, Fraser, G. A. and willis, A. E. (2001) Derivation of a 14O structural model for the c-myc IRES I Mol. Biol.310, I n-126. Chaoter 8 References

209. Levy, A. P., Levy, N. S., and Goldberg, M.A. (1996) Post-transcriptional regulation of vascular endothelial growth factor by hypoxia. J Biol Chem 27L,2146-2753.

210. Levy, A. P., Levy, N. S., Wenger, S., and Goldberg, M. A. (1995) Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J Biol Chem 270, t3333-L3340.

2lI. Li, H., Ko, H. P., and Whitlock, J. P. (1996) Induction of phosphoglycerate kinase 1 gene expression by hypoxia. Roles of Arnt and HIF1alpha. ,I BioI Chem 27'1,,21262- 21267.

2I2. Li, S. and Wilkinson, M. F. (2002) Nonsense surveillance in lymphocytes? Immunity 8, r35-t4L.

2I3. Lin, T. 4., Kong, X., Haystead, T. 4., Pause, 4., Belsham, G. J., Sonenberg, N., and Lawrence, J. C., Jr. (1994) PHAS-I as a link between mitogen-activated protein kinase and translation initi ati on. S c ienc e 266, 653 -65 6.

214. Lisztwan, J., Imbert, G., Wirbelauer, C., Gstaiger, M., and Krek, W. (1999) The von Hippel-Lindau tumor suppressor protein is a component of an E3 ubiquitin-protein ligase activity. Genes Dev. L3, L822-1833.

2I5. Liu, X. H., Kirschenbaum, A., Yao, S., Stearns, M.E., Holland, J. F., Claffey, K. P., and Levine, A. C. (1999) Up-regulation of vascular endothelial growth factor by cobalt-chloride-stimulated hypoxia is mediated by persistent induction of cyclooxygenase-Z in a metastatic human prostate cancer cell line. Clin.Exp.Metastasis 17,681-694.

216. Liu, Y., Christou, H., Morita, T., Laughner, E., Semenza, G. L., and Kourembanas, S. (1998) Carbon monoxide and nitric oxide suppress the hypoxic induction of vascular endothelial growth factor gene via the 5'enhancer. J BioI Chem273, L5251-15262.

2I7. Lohrum, M. 4., Ashcroft, M., Kubbutat, M. H., and Vousden, K. H. (2000) Contribution of two independent MDM2-binding domains in p14(ARF) to p53 stabilization. Curr. B iol 10, 539 -542.

2I8. Luo, G., Gu, Y. Z.,Jain, S., Chan, W. K., Carr, K. M', Hogenesch, J. B', and Bradfield, C. A. (1991) Molecular characterization of the murine Hif-1 alpha locus. Gene Expr. 6, 287-299.

2L9. Ma, W. J., Cheng, S., Campbell, C., Wright, 4., and Furneaux, H. (1996) Cloning and charactenzation of HuR, a ubiquitously expressed Elav-like protein. J Biol Chem 27I, 8144-8151.

220. Ma, W. J., Chung, S., and Furneaux, H. (199'7) The Elavlike proteins bind to AU-rich elements and to the poly(A) tail of mRNA. Nucleic Acids Res 25,3564-3569.

Macejak, D. G. and Sarnow, P. (1991). Intemal initiation of translation mediated by the

141 5'leader of a cellular mRNA. Nature 353' 90-94. Chaoter 8 References

22I. Mader, S., Lee, H., Pause, 4., and Sonenberg, N. (1995) The translation initiation factor eIF4E binds to a common motif shared by the translation factor eIF-4 gamma and the translational repressors 4E-binding proteins. MoI Cell Biol15,4990-4991.

222. Maher, E. R. and Kaelin, W. G., Jr. (1997) von Hippel-Lindau disease. Medicine (B altimore ) 7 6, 38I-391.

223. Mahon, P. C., Flirota, K., and Semenza, G. L. (2001) FIH-I: a novel protein that interacts with HlF-lalpha and VHL to mediate repression of HIF-I transcriptional activity. Genes Dev. 15, 267 5-2686.

224. Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. 4., and Simon, M. C. (1997) Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature 386,403-407.

225. Mao, X., Green, J. M., Safer, 8., Lindstefl, T., Frederickson, R. M., Miyamoto, S., Sonenberg, N., and Thompson, C. B. (1992) Regulation of translation initiation factor gene expression during human T cell activation. J BioI Chem 267 ,20444-20450.

226. Marcotrigiano, J., Gingras, A. C., Sonenberg, N., and Burley, S. K. (1999) Cap- dependent translation initiation in eukaryotes is regulated by a molecular mimic of oIF4G. Mol CeII 3, 107 -7 16.

221. Maser, R. S., Zinkel, R., andPetrini, J. H. (2001) An alternative mode of translation permits production of a variant NBS1 protein from the common Nijmegen breakage syndrome allele. Nat Genet. 27, 417 -421.

228. Maxwell, P. H., Dachs, G. U., Gleadle, J. M., Nicholls, L. G., Harris, A. L., Stratford, I. J., Hankinson, O., Pugh, C. W., and Ratcliffe, P. J. (1991) Hypoxia-inducible factor- 1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proc Natl Acad Sci U S A94,8104-8109.

229. Maxwell, P. H., Wiesener, M. S., Chang, G. W., Clifford, S' C., Vaux, E. C., Cockman, M. E., Wykoff, C. C., Pugh, C. W., Maher, E. R., and Ratcliffe, P' J' (1999) The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen- dependent proteolysis . Nature 399, 211-27 5.

230. Mazure, N. M., Chen, E. Y., Yeh, P., Laderoute, K. R., and Giaccia, A. J. (1996) Oncogenic transformation and hypoxia synergistically act to modulate vascular endothelial growth factor expression. Cancer R¿s. 56, 3436-3440.

231. Meiron, M., Anunu, R., Scheinman, E. J., Hashmeuli, S., and Levi, B. Z. (2001) New isoforms of VEGF are translated from alternative intiation CUG codons located in its 5'IJTR. Biochem Biophys Res Commun 282,1053-1060.

142 Chaoter 8 Reference s

232. Michel, Y. M., Borman, A. M., Paulous, S., and Kean, K. M. (2001) Eukaryotic initiation factor 4G-poly(A) binding protein interaction is required for poly(A) tail- mediated stimulation of picornavirus internal ribosome entry segment-driven translation but not for X-mediated stimulation of hepatitis C virus translation. Mol CelI Biol2l,4097-4109.

233. Miller, D. L., Dibbens, J. 4., Damert,4., Risau, W., Vadas, M. 4., and Goodall, G. J' (1998) The vascular endothelial growth factor mRNA contains an intemal ribosome entry site. FEBS Lett. 434,411-420.

234. Minet, E., Arnould, T., Michel, G., Roland, I., Mottet, D', Raes, M., Remacle, J., and Michiels, C. (2000) ERK activation upon hypoxia: involvement in HIF-I activation. FEBS Lett, 468,53-58.

235. Mitchell, S. 4., Bfown, E. C., Coldwell, M. J., Jackson, R. J., and Willis, A. E. (2001) Protein factor requirements of the Apaf-l internal ribosome entry segment: roles of polypyrimidine tract binding protein and upstream of N-ras. MoI CeII BioI 21,3364- 3374.

236. Moallem, E., Kilav, R., Silver, J., and Naveh-Many, T. (1998) RNA-protein binding and post-transcriptional regulation of parathyroid hormone gene expression by calcium and phosphate. J BioI Chem273,5259-

237. Morales, J., Russell, J. E., and Liebhaber, S. A. (1997) Destabilization of human alpha- globin mRNA by translation anti-termination is controlled during erythroid differentiarion and is paralleled by phased shortening of the poly(A) tall. J Biol Chem 272,6607-6613.

238. Morley, S. J., Curtis, P. S., and Pain, V. M. (1991) eIF4G: translation's mystery factor begins to yield its secrets. RNA. 3, 1085-1104.

239. Mukhopadhyay, C. K., Mazumder, 8., and Fox, P. L. (2000) Role of hypoxia-inducible factor-1 in transcriptional activation of ceruloplasmin by iron deficiency. J BioI Chem 275,21048-21054.

240. Myer, V. E., Fan, X. C., and Steitz, J. A. (1997) Identification of HuR as a protein implicated in AUUUA-mediated mRNA decay. EMBO J 16,2130-2139.

24L Nanbru, C., Lafon, I., Audigier, S., Gensac, M. C., Vagner, S., Huez, G., and Prats, A. C. (1997) Alternative translation of the proto-oncogene c-myc by an internal ribosome entry site. J Biol Chem272,3206I-32066.

242. Nanbru, C., Prats, A. C., Droogmans, L., Defrance, P., Huez, G., and Kruys, V' (2001) Translation of the human c-myc P0 tricistronic mRNA involves two independent internal ribosome entry sites. Oncogene 20,4210-4280.

143 Chaoter 8 References

243. O'Rourke, J. F., Tian, Y. M., Ratcliffe, P. J., and Pugh, C. W. (1999) Oxygen-regulated and transactivating domains in endothelial PAS protein 1: comparison with hypoxia- inducible factor- I alpha. J BioI Chem 27 4, 2060 -207 l.

244. Ohh, M., Park, C.'W., Ivan, M., Hoffman, M. 4., Kim, T. Y., Huang, L. E., Pavletich, N., Chau, V., and Kaelin, W. G. (2000) Ubiquitination of hypoxia-inducible factor requires direct binding to the beta-domain of the von Hippel-Lindau protein. Nat.CeIl BioI2,423-427 .

245. Ohlmann, T. and Jackson, R. J. (1999) The properties of chimeric picornavirus IRESes show that discrimination between internal translation initiation sites is influenced by the identity of the IRES and not just the context of the AUG codon. RNA. 5, 164-778.

246. Ohlmann, T., Rau, M., Pain, V. M., and Morley, S. J. (1996) The C{erminal domain of eukaryotic protein synthesis initiation factor (eIF) 4G is sufficient to support cap- independent translation in the absence of eIF4E. EMBO J 15, L31I-L382.

247. Okada, F., Rak, J. W., Croix, B. S., Lieubeau, 8., Kaya, M., Roncad, L., Shirasawa, S', Sasazuki, T., and Kerbel, R. S. (1998) Impact of oncogenes in tumor angiogenesis: mutant K-ras up-regulation of vascular endothelial growth factor/vascular permeability factor is necessary, but not sufficient for tumorigenicity of human colorectal carcinoma cells. Proc NatI Acad Sci U S A 95, 3609-3614.

248. Okino, S. T., Chichester, C. H., and Whitlock, J. P., Jr. (1998) Hypoxia-inducible mammalian gene expression analyzed in vivo at a TATA-driven promoter and at an initi ator-driven promo ter. J B i ol Chem 27 3, 23831 -23 843 .

249. Oldfield, S., Jones, B. L., Tanton, D., and Proud, C. G. (1994) Use of monoclonal antibodies to study the structure and function of eukaryotic protein synthesis initiation factor eIF-2B. Eur.J Biochem 22L, 399-4L0.

250. Oliveira, C. C. and McCarthy, J. E. (1995) The relationship between eukaryotic translation and mRNA stability. A short upstream open reading frame strongly inhibits translational initiation and greatly accelerates mRNA degradation in the yeast S ac charomy c e s c erevisiae. J Biol Chem 27 0, 8936-89 43.

25L. Ostareck, D. H., Ostareck-Lederer, 4., Wilm, M., Thiele, B. J., Mann, M., and Hentze, M. W. (1991) mRNA silencing in erythroid differentiation: hnRNP K and hnRNP El regulate l5-lipoxygenase translation from the 3' end. Ce\|89,591-606.

252. Oumard, 4., Hennecke, M., Hauser, H., and Nourbakhsh, M. (2000) Translation of NRF mRNA is mediated by highly efficient intemal ribosome entry. MoI Cell Biol20, 2155-2159.

253. Pages, G., Berra, E., Milanini, J., Levy, A. P., and Pouyssegur, J. (2000) Stress- activated protein kinases (JNK and p38ÆIOG) are essential for vascular endothelial growth factor mRNA stability. J Biol Chem275,26484-26491.

144 Chanter 8

254. Pain, V. M. (1996) Initiation of protein synthesis in eukaryotic cells. Eur.J Biochem 236,741-77r.

255. Palmer, L. A., Semenza, G. L., Stoler, M. H., and Johns, R. A. (1998) Hypoxia induces type II NOS gene expression in pulmonary artery endothelial cells via HIF-I' Am.J Phy siol 27 4, L2I2-L2I9.

256. Paulin, F. E., West, M. J., Sullivan, N. F., whitney, R. L., Lyne, L., and Willis, A. E. (1996) Aberrant translational control of the c-myc gene in multiple myeloma. Oncogene 13,505-513.

257. Pause, 4., Belsham, G. J., Gingras, A. C., Donze, O., Lin, T. 4., Lawrence, J. C., Jr., and Sonenberg, N. (1994) Insulin-dependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function. Nature 371,162-761.

258. Pegram, M. D., Pauletti, G., and Slamon, D. J. (1998) F{ER-2/neu as a predictive marker of response to breast cancer therapy. Breast Cancer Res Treat 52,65-17 '

259. Pelletier, J. and Sonenberg, N. (1988) Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334,320-325.

260. Pestova, T. V., Hellen, C. U., and Shatsky, I.N. (1996) Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol Cell Biol16, 6859-6869.

261. Pestova, T. V., Hellen, C. U., and Wimmer, E. (1994) A conserved AUG triplet in the 5'nontranslated region of poliovirus can function as an initiation codon in vitro and in viv o. Virolo gy 204, 1 29 -31 .

262. Pestova, T. V., Kolupaeva, V. G., Lomakin, I. 8., Pilipenko, E. V., Shatsky, I. N', Agol, V. L, and Hellen, C. U. (2001) Molecular mechanisms of translation initiation in eukaryotes . Proc Natl Acad Sci U S A 98, 7029-7036.

263. Pestova, T. V., Shatsky, I. N., Fletcher, S. P., Jackson, R. J., and Hellen, C' U. (1998) A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation .odon during internal translation initiation of hepatitis C and classical swine fever virus RNAs. Genes Dev.12,61-83.

264. Pestova, T. V., Shatsky, I. N., and Hellen, C. U. (1996) Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes. MoI Cell Biol L6,6870-6818.

265. Peterson, R. T., Desai, B. N., Hardwick, J. S., and Schreiber, S. L. (1999) Protein phosphatas e 2A interacts with the 70-kDa 56 kinase and is activated by inhibition of FKBPl2-rapamycin associated protein. Proc Natl Acad Sci U S A96,4438-4442.

145 Chanter 8 References

266. Pilipenko, E. V., Gmyl, A. P., Maslova, S. V., Belov, G. 4., Sinyakov, A. N., Huang, M., Brown, T. D., and Agol, V. I. (1994) Starting window, a distinct element in the cap-independent internal initiation of translation on picomaviral RNA. J MoI Biol24l, 398-414.

267. Pilipenko, E. V., Pestova, T. V., Kolupaeva, V. G., Khitrina, E. V., Poperechnaya, A' N., Agol, V. L, and Hellen, C, U. (2000) A cell cycle-dependent protein serves as a template-specific translation initiation factor. Gene s D ev. 14, 2028-2045 . 'Weich, 268. Plate, K. H., Breier, G., H. 4., and Risau, W. (1992) Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo. Nature 359,845-848.

269. Pollard, J. W., Galpine, A. R., and Clemens, M. J. (1989) A novel role for aminoacyl- tRNA synthetases in the regulation of polypeptide chain initiation. Eur.J Biochem 182, r-9.

210. Ponting, C. P., Blake, D. J., Davies, K. E., Kendrick-Jones, J., and Winder, S. J. (1996) ZZ and TAZ: new putative zinc fingers in dystrophin and other proteins. Trends Biochem Sci 21,11-13.

21I. Poulin, F., Gingras, A. C., Olsen, H., Chevalier, S., and Sonenberg, N. (1998) 4E-8P3, a new member of the eukaryotic initiation factor 4E-binding protein family. J Biol

Chem 273, 14002-14001 .

272. Pozner, 4., Goldenberg, D., Negreanu, V., Le, S. Y., Elroy-Stein, O., Levanon, D., and Groner, Y. (2000) Transcription-coupled translation control of AMLI/RUNXI is mediated by cap- and internal ribosome entry site-dependent mechanisms. Mol Cell BioI 20,2297 -2307 .

273. Pugh, C. W., O'Rourke, J. F., Nagao, M., Gleadle, J. M., and Ratcliffe, P. J. (1997) Activation of hypoxia-inducible factor-1; definition of regulatory domains within the alpha subunit. J Biol Chem272,II205-Il2l4.

214. Pyronnet, S., Pradayrol, L., and Sonenberg, N. (2000) A cell cycle-dependent internal ribosome entry site. Mol Cell 5,607-616. 'W., 275. Ratcliffe, P. J., Pugh, C. and Maxwell, P. H. (2000) Targeting tumors through the HIF system. Nat Med. 6,1315-1316.

216. Raught, 8., Gingras, A. C., and Sonenberg, N. (2001) The target of rapamycin (TOR) proteins. Proc NatI Acad Sci U S A 98, 7037 -7044.

277. Ravi, R., Mookerjee, B., Bhujwalla, Z. M., Sutter, C. H', Artemov, D., Zeng, Q., Dillehay, L. E., Madan, 4., Semenza, G. L., and Bedi, A. (2000) Regulation of tumor angiogenesis by p53-induced degradation of hypoxia-inducible factor lalpha. Genes Dev.14,34-44.

146 Chapter 8

218. Reynolds, J. E., Kaminski,4., Kettinen, H. J., Grace, K., Clarke, B. E., Carroll, A. R., Rowlands, D. J., and Jackson, R. J. (1995) Unique features of internal initiation of hepatits C virus RNA translation. EMBO J 14,6010-6020.

2jg. Rivera, V. M., Sheng, M., and Greenberg, M. E. (1990) The inner core of the serum response element mediates both the rapid induction and subsequent repression of c-fos transcription following serum stimulation. Genes Dev. 4,255-268.

280. Rolfs, 4., Kvietikova, I., Gassmann, M., and Wenger, R. H. (L997) Oxygen-regulated transferrin expression is mediated by hypoxia-inducible factor-l . J BioI Chem 272, 20055-20062

281. Ross, J. (1995) mRNA stability in mammalian cells. Microbiol.Rev. 59,423-450.

282. Ryan, H. E., Lo, J., and Johnson, R. S. (1993) HIF-I alpha is required for solid tumor formation and embryonic vasculaization. EMBO J 17,3005-3015.

283. Ryan, H.E., Poloni, M., McNulty,'W., ElsOn, D., GaSSmAnn, M., Arbeit, J. M., and Johnson, R. S. (2000) Hypoxia-inducible factor-lalpha is a positive factor in solid tumor growth. Cancer R¿s. 60, 4010-4015.

284. Saaristo, 4., Karpanen, T., and Alitalo, K. (2000) Mechanisms of angiogenesis and their use in the inhibition of tumor growth and metastasis. Oncogene L9,6122-6129'

285. Sachs, A., Bond, M. W., and Kornberg, R. D. (1986) A single gene from yeast for both nuclear and cytoplasmic polyadenylate-binding proteins: domain structure and expression . CeIl 45, 827 -835.

286. Sachs, A. 8., Sarnow, P., and Hentze, M. W. (L997) Starting at the beginning, middle, and end: translation initiation in eukaryotes. CeIl89, 831-838.

297. Salceda, S., and Caro, J. (1997) Hypoxia-inducible factor lalpha (HlF-lalpha) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes. J Biol. Chem 272,22642- 22647.

288. Sang, N., Fang, J., Srinivas, V., Leshchinsky, I., and Caro, J. (2002) Carboxyl-terminal transactivation activity of hypoxia-inducible factor 1 alpha is governed by a von Hippel-Lindau protein-independent, hydroxylation-regulated association with p300/CBP. Mol CeII BioI 22, 2984-2992.

Z8g. Savant-Bhonsale, S. and Cleveland, D. W. (1992) Evidence for instability of mRNAs containing AUUUA motifs mediated through translation-dependent assembly of a > 20S degradation complex. Gene s Dev. 6, 1927 -1939'

2gO. Schafer, M., Kuhn, L. C., Bosse, F., and Schafer, U. (1990) A conserved element in the leader mediates post-meiotic translation as well as cytoplasmic polyadenylation of a Drosophila spermatocyte mRNA' EMBO J 9,4519-4525.

147 Chaoter 8 References

291. Scheid, 4., Wenger, R. H., Schaffer, L., Camenisch, I., Distler, O., Ferenc, 4., Cristina, H., Ryan, H.E., Johnson, R. S., Wagner, K.F., Stauffer, U. G., Bauer, C', Gassmann, M., and Meuli, M. (2002) Physiologically low oxygen concentrations in fetal skin regulate hypoxia-inducible factor I and transforming growth factor-beta3. FASEB J 16, 4lt-413.

292. Schiavi, 4., Huddef, 4., and Werner, R. (1999) Connexin43 mRNA contains a functional internal ribosome entry site. FEBS Lett. 464,118-122.

293. Schiavi, S. C., Wellington, C. L., Shyu, A. B., Chen, C. Y., Greenberg, M. E., and Belasco, J. G. (1994) Multiple elements in the c-fos protein coding region facilitate deadenylation and decay by a mechanism coupled to translation. ./ Biol Chem 269, 344r-3448.

294. Schmaltz, C., Hardenbergh, P. H., Wells, 4., and Fisher, D. E. (1998) Regulation of proliferation-survival decisions during tumor cell hypoxia. Mol Cell Biol 18,2845- 2854.

295. Sehgal, 4., Briggs, J., Rinehart-Kim, J., Bassoo, J., and Bos, T. J. (2000) The chicken c-Jun 5' untranslated region directs translation by internal initiation. Oncogene 19, 2836-2845.

296. Sela-Browr, 4., Silver, J., Brewer, G., and Naveh-Many, T. (2000) Identification of AUF1 as a parathyroid hormone mRNA 3'-untranslated region binding protein that determines parathyroid hormone mRNA stability. J Biol Chem275,7424-7429.

297. Semenza, G. L. (2000) Expression of hypoxia-inducible factor 1: mechanisms and consequenc es. Biochem Pharmacol. 59, 4l -53.

298. Semenza, G. L. (2000) HIF-1 and human disease: one highly involved factor. Genes Dev. 14,1983-1991.

2gg. Semenza, G. L., Jiang, B. H., Leung, S. W., Passantino, R., Concordet, J. P., Maire, P., and Giallongo, A. (1996) Hypoxia response elements in the adolase A, enolase 1 and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia- inducible factor I. J BioI Chem271,32529-32537.

300. Semenza, G. L., Nejfelt, M. K., Chi, S. M., and Antonarakis, S. E. (1991) Hypoxia- inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene. Proc Natl Acad Sci U S A 88, 5680-5684'

301. Shen, C. J. and Weber, J. D. (2000) The ARF/p53 pathway. Curr.Opin.Genet.Dev. L0, 94-99.

302. Shima, D. T., Kuroki, M., Deutsch, IJ., Ng, Y. S', Adamis, A. P', and D'Amore, P. A' (1996) The mouse gene for vascular endothelial growth factor. Genomic sttucture, definition of the transcriptional unit, and characterization of transcriptional and posttranscriptional regulatory sequences. J Biol Chem 27'1,, 387 7 -3 8 83.

148 Chanter 8 References

303. Short, S., Tian, D., Short, M. L., and Jungmann, R. A. (2000) Structural determinants for post-transcriptional stabilization of lactate dehydrogenase A mRNA by protein kinase C signal pathway. J BioI Chem275,12963-12969.

304. Shoshani, T., Faerman, A., Mett, L, Zelin, E., Tenne, T., Gorodifl, S., Moshel, Y., Elbaz, S., Budanov, A., Chajut, 4., Kalinsk, H., Kamer, I., Rozen, 4., Mor, O., Keshet, E., Leshkowitz, D., Einat, P., Skaliter, R., and Feinstein, E. (2002) Identification of a novel hypoxia-inducible factor 1-responsive gene, RTP801, involved in apoptosi s. Mol CeIl 8io1 22, 2283-2293'

305. Shweiki, D., Itin, 4., Soffer, D., and Keshet, E. (1992) Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 359, 843-8454

306. Shweiki, D., Neeman, M., Itin, A., and Keshet, E. (1995) Induction of vascular endothelial growth factor expression by hypoxia and by glucose deficiency in multicell spheroids: implications for tumor angiogenesis. Proc NatI Acad Sci U S A 92, 768-772.

307. Sowter, H. M., Ratcliffe, P. J., Watson, P., Greenberg, A. H., and Harris, A. L' (2001) HIF-l-dependent regulation of hypoxic induction of the cell death factors BNIP3 and NIX in human tumors. Cancer Res. 61,6669-6673.

308. Staton, J. M., Thomson, A. M., and Iæedman, P. J. (2000) Hormonal regulation of 6RNA stability and RNA-protein interactions in the pituitary. J Mol Endocrinol25, t7-34.

309. Stebbins, C. E., Kaelin, W. G., Jr., and Pavletich, N. P. (1999) Structure of the VHL- ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 284,455-46I.

310. Stein, I., Itin, 4., Einat, P., Skalitef, R., Grossman, 2., and Keshet, E. (1998) Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia. MoI Cell BioI 18,3lI2-3I19.

3ll. Stein, I., Neeman, M., Shweiki, D., Itin, 4., and Keshet, E. (1995) Stabilization of vascular endothelial growth factor mRNA by hypoxia and hypoglycemia and coregulation with other ischemia-induced genes. MoI Cell BioI15,5363-5368. 'Wengef, 3I2. Stiehl, D. P., Jelkmann, W., R. H., and Hellwig-Burgel, T. (2002) Normoxic induction of the hypoxia-inducible factor lalpha by insulin and interleukin-lbeta involves the phosphatidylinositol pathway. FEBS Lett. 512, L51-162.

313. Stoneley, M., Chappell, S. A., Jopling, C.L., Dickens, M., MacFarlane, M., and Willis, A. E. (2000) c-Myc protein synthesis is initiated from the internal ribosome entry segment during apoptosis. Mol Cell BioI20,1162-1169-

149 Chanter 8 s

3I4. Stoneley, M., Paulin, F. 8., Le Quesne, J.P., Chappell, S, 4., and Willis' A. E. (1998) C-Myc 5' untranslated region contains an internal ribosome entry segment. Oncogene 1.6,423-428.

315. Stoneley, M., Subkhankulova, T., Le Quesne, J. P., Coldwell, M. J., Jopling, C. L., Belsham, G. J., and Willis, A. E. (2000) Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment. Nucleic Acids Res 28,687-694.

316. Strahl, B. D. and Allis, C. D. (2000) The language of covalent histone modifications. Nature 403,4I-45.

3ll. Sutter, C. H., Laughner, E., and Semenza, G. L. (2000) Hypoxia-inducible factor lalpha protein expression is controlled by oxygen-regulated ubiquitination that is disrupted by deletions and missense mutations. Proc NatI Acad Sci U S A97,4'748- 4753.

318. Tacchini, L., Bianchi, L., Bernelli-Zazzera,4., and Cairo, G. (1999) Transferrin receptor induction by hypoxia. HlF-l-mediated transcriptional activation and cell- specific post-transcriptional regulation. J Biol Chem 27 4, 24L42-24I46.

3lg. Tarun, S. Z. and Sachs, A. (1996) Association of the yeast poly(A) tail binding protein with translation initiation factor eIF-4G. EMBO J 15,7168-7I77.

320. Tazuke, S. I., Mazure, N. M., Sugawara,J., Carland, G', Faessen, G. H., Suen, L. F., kwin, J. C., Powell, D. R., Giaccia, A. J', and Giudice, L. C. (1998) Hypoxia stimulates insulin-like growth factor binding protein 1 (IGFBP-I) gene expression in HepG2 cells: a possible model for IGFBP-I expression in fetal hypoxia. Proc Natl Acad Sci U.SA 95, 10188-10193'

321. Tian, H., McKnight, S. L., and Russell, D. W. (1997) Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes Dev. 11,12-82.

322. Tillmar, L. and Welsh, N. (2002) Hypoxia may increase rat insulin mRNA levels by promoting binding of the polypyrimidine tract-binding protein (PTB) to the pyrimidine-rich insulin mRNA 3'-untransl ated re gion. M ol M e d 8, 263 -27 2.

323. Tinton, S. A. and Buc-Calderon, P. M. (1999) Hypoxia increases the association of 4E- binding protein 1 with the initiation factor 4E in isolated rat hepatocytes. FEBS Lett. 446,55-59.

324. Trawick, J. D., Wang, S. L., Bell, D., and Davis, R. A. (1997) Transcriptional induction of cholesterol 7-alpha-hydroxylase by dexamethasone in L35 hepatoma cells requires sulfhydryl reducing agents. J BioI Chem272,3099-3102.

150 Chanter 8 References

325. Treins, C., Giorgetti-Peraldi, S., Murdaca, J., Semenza, G. L., and Van Obberghen, E. (2002) Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3- kinase I target of rapamycin-dependent signaling pathway. J BioI Chem 277,21915- 2798t.

326. Vagner, S., Galy, 8., and Pyronnet, S. (2001) Irresistible IRES. Attracting the translation machinery to internal ribosome entry sites. EMBO Rep. 2,893-898.

327. Vagner, S., Gensac, M. C., Maret, A., Bayard, F., Amalric, F., Prats, H., and Prats, A. C. (1995) Alternative translation of human fibroblast growth factor 2 mRNA occurs by internal entry of ribosomes. Mol CelI BioI L5,35-44.

328. Vagner, S., Touriol, C., Galy, B., Audigier, S., Gensac, M. C., Amalric, F., Bayard, F', Prats, H., and Prats, A. C. (1996) Translation of CUG- but not AUG-initiated forms of human fibroblast growth factor 2 is activated in transformed and stressed cells. J CeIl BioI135, 139I-1402.

329. Van Holde, K. E. (1998) Chromatin. 111-148

330. Vaupel, P., Kallinowski, F., and Okunieff, P. (1989) Blood flow, oxygen and nutrient supply, and metabolic microenvironment of human tumors: a review. Cancer Res. 49, 6449-6465.

33L. Venter, J. C. (2001) The sequence of the human genome. Science 29L, t304-I351.

332. Vilela, C., Ramirez, C. Y.,Linz,B., Rodrigues-Pousada, C., and McCarthy, J' E' (1999) Post-termination ribosome interactions with the 5'UTR modulate yeast mRNA stability. EMBo J L8,3139-3152.

333. Wang, G. L., Jiang, B. H., Rue, E. 4., and Semenza, G. L. (1995) Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular 02 tension. Proc NatI Acad Sci U S A92,5510-5514.

334. Wang, G. L., Jiang, B. H., and Semenza, G. L. (1995) Effect of protein kinase and phosphatase inhibitors on expression of hypoxia-inducible factor 1. Biochem Biophy s. Re s. C ommun. 216, 669 -67 5.

335. Wang, G. L. and Semenza, G. L. (1993) Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia . J BioI Chem 268,21513-215L8.

336. Wang, G. L. and Semenza, G. L. (1993) General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc Natl Acad Sci U S A 90, 4304- 4308.

337. Waskiewicz, A.J., Flynn, 4., Proud, C. G., and Cooper, J. A. (1991) Mitogen- activated protein kinases activate the serine-threonine kinases MnKl and MnK2. EMBO J'1.6, 1909-1920.

151 Chaoter 8 References

338. Watada, H., Mirmira, R. G., Leung, J., and German, M. S. (2000) Transcriptional and translational regulation of beta-cell differentiation factor Nkx6.1. J Biol Chem 275, 34224-34230.

339. Weng, L.P., Brown, J. L., Baker, K. M., Ostrowski, M. C., and Eng, C' (2002) PTEN blocks insulin-mediated ETS-2 phosphorylation through MAP kinase, independently of the phosphoinositide 3 -kinase pathway. Hum. M ol. G enet ll, 1687 -1696'

340. Wenger, R. H., Rolfs, 4., Marti, H. H., Guenet, J. L., and Gassmann, M' (1996) Nucleotide sequence, chromosomal assignment and mRNA expression of mouse hypoxia-inducible factor- 1 alpha. B io chem Biophy s. Re s. C ommun. 223, 5 4-59 .

34I. Wenger, R. H., Rolfs, 4., Spielmann, P., Zimmermanfl, D. R., and Gassmann, M. (1993) Mouse hypoxia-inducible factor-lalpha is encoded by two different mRNA isoforms: expression from a tissue-specific and a housekeeping-type promoter. Blood 91,3471-3480.

342. West, M. J., Sullivan, N. F., and Willis, A. E. (1995) Translational upregulation of the c-myc oncogene in Bloom's syndrome cell lines. Oncogene ll,2515-2524'

343. Wiener, C. M., Booth, G., and Semenza, G. L. (1996) In vivo expression of mRNAs encoding hypoxia-inducible factor l. Biochem Biophys.Res.Commun.225,485-488.

344. Wiesener, M. S., Turley, H., Allen, W. 8., V/illam, C., Eckardt, K. U., Talks, K.L., Wood, S. M., Gatter, K. C., Harris, A. L., Pugh, C. W., Ratcliffe, P. J., and Maxwell, P. H. (1998) Induction of endothelial PAS domain protein-1 by hypoxia: charcctenzation and comparison with hypoxia-inducible factor-lalpha. Blood 92, 2260-2268.

345. Wisdom, R. and I-ee, W. (1991) The protein coding region of c-myc mRNA contains a sequence that specifies rapid mRNA turnover and induction by protein synthesis inhibitors. Genes Dev. 5, 232-243.

346. Wolffe, A. P., IJrnov, F. D., and Guschin, D. (2000) Co-repressor complexes and remodelling chromatin for repression. B i o chem. S o c.Trans 28, 37 9 -386.

347. Wood, S. M., Wiesener, M. S., Yeates, K. M., Okada, N., Pugh, C. W., Maxwell, P' H., and Ratcliffe, P. J. (1998) Selection and analysis of a mutant cell line defective in the hypoxia-inducible factor-1 alpha-subunit (HIF-lalpha). Characterization of hif-lalpha- dependent and -independent hypoxia-inducible gene expression. J BioI Chem 273, 8360-8368. 'W., 348. Wood, S. M., Gleadle, J. M., Pugh, C. Hankinson, O., and Ratcliffe, P. J. (1996) The role of the aryl hydrocarbon receptor nuclear translocator (ARNT) in hypoxic induction of gene expression. Studies in ARNT-deficient cells. "/ Biol Chem 27L, t5tr7-15123.

152 Chanfer 8

349. Wykoff, C. C., Beasley, N. J., Watson, P. H., Turner, K. J., Pastorek, J., Sibtain, 4., Wilson, G.D., Turley, H., Talks, K. L., Maxwell, P. H., Pugh, C. W., Ratcliffe, P' J', and Harris, A. L. (2000) Hypoxia-inducible expression of tumor-associated carbonic anhydrases . Cancer Res. 60, 7 07 5-7 083.

350. Yang, J. Q., Bauer, S. R., Mushinski, J. F., and Marcu, K. B. (1985) translocations clustered 5' of the murine c-myc gene qualitatively affect promoter usage: implications for the site of normal c-myc regulation. EMBO J 4,1441-1447.

351. Yang, Q. and Sarnow, P. (1997) Location of the internal ribosome entry site in the 5' non-coding region of the immunoglobulin heavy-chain binding protein (BiP) mRNA: evidence for specific RNA-protein interactions. Nucleic Acids Res 25,2800-2807.

352. Ye, X., Fong, P., Iizuka, N., Choate, D., and Cavener, D. R. (1997) Ultrabithorax and Antennapedia 5' untranslated regions promote developmentally regulated internal translation initiation. Mol Cell BioI 17,I714-1121.

353. Yen, L., You, A-E., Moustafa, A., Batist, G', Hynes, N. E., Mader, S., Meloche, S., and Alaoui-Jamali, M. A. (2000) Heregulin selectively upregulates vascular endothelial growth factor secretion in cancer cells and stimulates angiogenesis. Onco gene 19, 3460-3469.

354. Yeuh, A. and Schneider, R. J. (1996) Selective translation initiation by ribosome jumping in adenovirus-infected and heat-shocked cells. Genes Dev. 10,1557-1567.

355. Yeuh, A. and Schneider, R. J. (2000) Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complimentariry to 18S rRNA. Genes Dev. L4,414- 42r.

356. Yu, A. Y., Frid, M. G., Shimoda, L. 4., Wiener, C.M', Stenmark, K., and Semenza, G. L. (1993) Temporal, spatial, and oxygen-regulated expression of hypoxia-inducible factor-l in the llur;,g. Am.J Physiol275,L8I8-L826.

357. Yu, F., White, S.8., Zhao, Q., and Lee, F. S. (2001) HlF-lalpha binding to vHL is regulated by stimulus-sensitive proline hydroxylation. Proc Natl Acad Sci U S A 98, 9630-9635.

358. Zagzag,D.,Zhong, H., Scalzitti, J. M., Laughner, E., Simons, J'W., and Semenza,G. L. (2000) Expression of hypoxia-inducible factor lalpha in brain tumors: association with angiogenesis, invasion, and progression' Cancer 88,2606-2618.

359. Zhong, H., Chiles, K., Feldsef, D., Laughner, E., Hanrahan, C., Georgescu, M.M., Simons, J. W., and Semenza, G. L. (2000) Modulation of hypoxia-inducible factor lalpha expression by the epidermal growth factor/phosphatidylinositol 3- kinaseÆTEN/AKT/FRAP pathway in human prostate cancer cells: implications for tumor angiogenesis and therapeutics. Cancer R¿s' 60, I54l-L545.

153 Chanter 8 References

360. Zhou, W. and Carpenter, G. (2000) Heregulin-dependent trafficking and cleavage of ErbB-4. J Biol Chem 27 5, 34737 -347 43.

36I. Zundel, 'W., Schindler, C., Haas-Kogan, D., Koong, 4., Kaper, F., Chen, E., Gottschalk, A. R., Ryan, H. E., Johnson, R. S., Jefferson, A. 8., Stokoe, D., and Giaccia, A. J. (2000) Loss of PTEN facilitates HlF-l-mediated gene expression. Genes Dev.14,39l-396.

154