A New Species of the Asian Toad Genus Megophrys Sensu Lato (Anura: Megophryidae) from Guizhou Province, China

ORIGINAL Asian Herpetological Research 2020, 11(1): 1–18 ARTICLE DOI: 10.16373/j.cnki.ahr.190041

A New Species of the Asian Toad Genus Megophrys sensu lato (Anura: Megophryidae) from Guizhou Province, China

Jing LIU1, Shize LI1, 2, Gang WEI3, Ning XU3, Yanlin CHENG1, Bin WANG1, 4* and Jun WU2*

1 Department of Resources and Environment, Moutai Institute, Renhuai 564500, China 2 Nanjing Institute of Environmental Sciences, Ministry of Ecology and Environment of China, Nanjing 210042, China 3 Biodiversity Conservation Key Laboratory, Guiyang College, Guiyang 550002, China 4 Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, China

Abstract We describe a new species of the genus 1. Introduction Megophr ys from Guizhou Province, China. Molecular phylogenetic analyses based on mitochondrial DNA The Asian Horned toads of the subfamily Megophryinae and nuclear DNA sequences all strongly supported the (Amphibia: Anura: Megophryidae) is widely distributed in new species as an independent clade nested into the tropical and subtropical regions of Asia from India and Bhutan Megophr ys clade and sister to M. minor. On morphology, to China and south to the Sundas and the Philippines (Fei et the new species is distinguished from its congeners by al., 2012; Frost, 2019). Taxonomic assignments especially generic a combination of the following characters: (1) small arrangements in the group have been controversial (Dubois, body size with SVL < 39.2 mm in male and SVL < 40.4 1986; Dubois a nd Ohler, 1998; La throp, 1997; Tia n a nd Hu, 1983; mm in female; (2) vomerine teeth absent; (3) tongue Fei et al., 2009; Fei et al., 2012). Fei et al. (2016) classified 36 Chinese not notched behind; (4) a small horn-like tubercle at species of the subfamily Megophryinae into six genera, i.e. the edge of each upper eyelid; (5) tympanum distinctly Liuophr ys Fei, Ye and Jiang, 2016, Atympanophr ys Tian and Hu, visible, rounded; (6) two or three metacarpal tubercles 1983 containing three subgenera (Atympanophr ys, Borealophrys in hand; (7) relative finger lengths: I < II < V < III; (8) toes Fei, Ye and Jiang, 2016 and Gigantophr ys Fei, Ye and Jiang, without webbing; (9) heels overlapped when thighs are 2016), Boulenophr ys Fei, Ye and Jiang, 2016, Xenophr ys Günther, positioned at right angles to the body; (10) tibiotarsal 1864 containing two subgenera (Tianophr ys Fei and Ye, 2016 and articulation reaching tympanum to eye when leg Xenophr ys), Ophyrophr yne Boulenger, 1908 and Brachytarsophr ys stretched forward; (11) an internal single subgular vocal Tian and Hu, 1983. Chen et al. (2017) classified the Asian sac in male; (12) in breeding male, the nuptial pads with horned toads into the genera Atympanophr ys, Megophr ys black nuptial spines on the dorsal bases of the first and Kuhl and Van Hasselt, 1822 and Xenophr ys, Ophyrophr yne, second fingers. and Brachytarsophrys. Mahony et al. (2017) classified all members of Megophryinae into a single genus Megophr ys sensu lato including seven subgenera (Megophr ys, Xenophr ys, Keywords Taxonomy, new species, molecular phylogenetic Panophr ys Rao and Yang, 1997, Atympanophr ys, Ophyrophr yne, analysis, morphology, China Pelobatrachus Bedda rd, 1908 “1907” a nd Brachytarsophrys) based on molecular phylogenetics and morphological comparisons. *Corresponding author: Dr. Jun WU, from Nanjing Institute of Megophr ys s. l. currently contains 91 species (Frost, 2019), and Environmental Sciences, Ministry of Ecology and Environment of China, as note, of which, 37 species were described in the last decade Nanjing, China, with his research focusing on consevation management and biodiversity of amphibians; Dr. Bin WANG, from Chengdu Institute (Deuti et al., 2017; Fei et al., 2009; Li et al., 2014; Li et al., 2018a ; of Biology, Chinese Academy of Sciences, Chengdu, China, with his Mahony, 2011; Mahony et al., 2011; Mahony et al., 2013; Mahony research focusing on taxonomy and biodiversity of amphibians. E-mail: [email protected] (Jun WU); [email protected] (Bin WANG) et al., 2017; Mahony et al., 2018; Messenger et al., 2019; Mo et al., Received: 8 August 2019 Accepted: 29 October 2019 2010; Munir et al., 2018; Orlov et al., 2015; Tapley et al., 2017; Asian Herpetological Research 2 Vol. 11

Tapley et al., 2018; Wa ng et al., 2012; Wa ng et al., 2014; Wa ng in a mountain stream where the new taxon was found in the et al., 2017a, b; Wang et al., 2019; Ya ng et al., 2018; Zha ng et al., Kuankuoshui National Nature Reserve. They were identified 2017; Zhao et al., 2014). What’s more, molecular phylogenetic as the new taxon because they were almost identical in studies still surprisingly indicated mass of cryptic species in the morphology and one representative of them was genetically group, for example, 20 cryptic species were suggested by Chen close to the adult specimens of the new taxon (see the results). et al. (2017), and 41 cryptic species were proposed just only in The stages of tadpoles were identified following Gosner (1960). subgenus Megophr ys (Panophr ys) by Liu et al. (2018). Obviously, All specimens were fixed in 10% buffered formalin for one day, detailed investigations need to be conducted for describing the and then later transferred to 70% ethanol. Tissue samples were cryptic species. taken and preserved separately in 95% ethanol prior to fixation. During field surveys in the Kuankuoshui National Nature The specimens were deposited in Chengdu Institute of Biology, Reserve, Suiyang County, Guizhou Province, China and Chinese Academy of Sciences (CIB, CAS). Fanjing Mountain, Jiangkou County, Guizhou Province, China, 2.2. Molecular data and phylogenetic analyses Four adult we collected some Megophr ys s. l. specimens from the montane specimens and one tadpole of the new taxon were included forests. Our molecular phylogenetic analyses and morphological in molecular analyses (for voucher information see Table 1). comparisons indicated it as a new taxon of Megophrys s. l. Total DNA was extracted using a standard phenol-chloroform Herein, we describe it as a new species. extraction protocol (Sambrook et al., 1989). Two fragments of the mitochondrial genes encoding 16S rRNA and cytochrome 2. Materials and Methods oxidase subunit I (COI) were amplified using the primers in Simon et al. (1994) and Che et al. (2012), respectively. They 2.1. Specimen Two adult females and nine adult males of the were amplified under the following conditions: 35 cycles new taxon (for voucher numbers see Table S1) were collected at 95 °C for 4 min, 95 °C for 1 min, 52 °C (for 16S rRNA)/ from the mountain streams in the Kuankuoshui National 46 °C (for COI) for 40 s, and 72 °C for 1 min followed by a 10 Nature Reserve, Suiyang County, Guizhou Province, China and min extension at 72 °C. The nuclear gene fragments encoding Fanjing Mountain, Jiangkou County, Guizhou Province, China brain-derived neurotrophic factor (BDNF) and recombination (Figure 1). Two tadpoles (voucher numbers: CIBKKS20180426001 activating gene 1 (RAG1) were amplified using the primers and and CIBKKS20180426002) of the new taxon were also collected protocols in Vieites et al. (2007) and Shen et al. (2013). All primers

Figure 1 Sampling localities of Megophrys jiangi sp. nov. in this study. The type locality is Kuankuoshui National Nature Reserve, Suiyang County, Guizhou Province, China and another locality is Fanjing Mountain, Jiangkou County, Guizhou Province, China. Jing LIU et al. A New Species of Megophrys

No. 1 3 – – – – – – – – – – – – – BDNF KX812044 KX811986 KX811984 KX812043 KX812045 KX811969 KX811958 KX811967 KX811994 KX811973 KX811961 KX811970 KX811952 KX811963 MN107756 MN107754 MN107755 MN107753 – – – – – – – – – – – – – RAG1 KX812252 KX812242 KX812203 KX812251 KX812253 KX812248 KX812258 KX812223 KX812236 KX812232 KX812226 KX812221 KX812228 KX812219 MN107759 MN107760 MN107758 MN107757 – – – – – – – – COI KX812144 KX812108 KX812094 KX812143 KX812145 KX812125 KX812129 KX812136 KX812112 KX812137 KX812131 KX812117 KX812115 KX812119 MK524139 MK524129 MK524145 MK524142 MN107750 MN107751 MN107752 MN107749 MN107748 GenBank accession number 16S KJ560391 KJ579122 KJ560412 KJ560376 KX811895 KX856404 KX811838 KX811840 KX811894 KX811896 KX811867 KX811881 KX811884 KX811849 KX811888 KX811872 KX811856 KX811852 KX811912 KX811864 MK524108 MK524098 MK524114 MK524111 MH514886 MH514889 MN107745 MN107746 MN107747 MN107744 MN107743 Locality Lao Cai, Sa Pa, Vietnam Lao Cai, Sa Pa, Vietnam Suichuan, Jiangxi, China Wuyishan, Fujian, China Wuyi Shan, Fujian, China Jizu Shan, Yunnan, China Emei Shan, Sichuan, China Dawei Shan, Yunnan, China Wawu Shan, Sichuan, China Fanjingshan, Guizhou, China Fanjingshan, Guizhou, China Jinggang Shan, Jiangxi, China Fanjingshan, Guiz`hou, China Huangcaoling, Yunnan, China Leigong Shan, Guizhou, China Guangwu Shan, Sichuan, China Mt. Yinping, Guangdong, China Mt. Nankun, Guangdong, China Qingcheng Shan, Sichuan, China Qingcheng Shan, Sichuan, China Qingcheng Shan, Sichuan, China Chashan Forest Farm, Jiangxi, China Wugongshan Scenic Area, Jiangxi, China Pu Hu Nature Reserve, Thanh Hoa, Vietnam Nanling Nature Reserve, Guangdong, China Kuankuosui Nature Reserve, Guizhou, China Kuankuosui Nature Reserve, Guizhou, China Kuankuosui Nature Reserve, Guizhou, China Badagongshan Nature Reserve, Hunan, China Heishiding Nature Reserve, Guangdong, China Huanglianshan National Nature Reserve, Yunnan, China KRM18 KIZ07132 KIZ01939 KIZ045469 KIZ048997 KIZ046812 KIZ025765 KIZ011603 KIZ025807 KIZ019441 KIZ021889 KIZ016100 SYS a004498 SYS a001972 SYS a001427 SYS a002272 SYS a002610 SYS a002370 SYS a001959 SYS a001579 VNMN 2018.01 VNMN 2018.02 KIZ-LC0805067 Voucher number CIBFJS20150719009 CIBFJS20150720004 Tissue ID: YPX37545 Tissue ID: YPX37544 Tissue ID: YPX11006 CIBKKS20180723007 CIBKKS20180426001 CIBKKS20180722006 sp. nov. sp. nov. sp. nov. sp. nov. sp. nov. sp. nov. Species Megophrys lini Megophrys cheni Megophrys obesa Megophrys minor Megophrys minor Megophrys minor Megophrys spinata Megophrys ombrophila Megophrys omeimontis Megophrys binlingensis Megophrys kuatunensis Megophrys sangzhiensis Megophrys wugongensis Megophrys wushanensis Megophrys nanlingensis Megophrys daweimontis Megophrys nankunensis Megophrys jinggangensis Megophrys jingdongensis Megophrys fansipanensis Megophrys binchuanensis Megophrys hoanglienensis Megophrys dongguanensis Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys wuliangshanensis Megophrys palpebralespinosa Information of samples used in the molecular analyses in this study. 22 21 23 24 31 25 26 28 30 20 27 29 19 14 15 16 17 18 12 13 9 10 11 7 8 6 3 4 5 2 1 Sample Number Table 1 Asian Herpetological Research 4 Vol. 11 – – – – – – – – – – – – – – – – – BDNF KX811933 KX811935 KX812016 KX811998 KX812017 KX812037 KX812039 KX812026 KX812012 KX811985 KX811983 KX811980 KX811979 MK005314 Continued Table 1 – – – – – – – – – – – – – – RAG1 KY022356 KY022354 KY022355 KX812169 KX812171 KX812191 KX812265 KX812197 KX812279 KX812277 KX812200 KX812184 KX812217 KX812216 KX812213 KX812209 MK005318 – – – – – – – – – – COI KX812052 KX812050 KX812051 KX812054 KX812091 KX812153 KX812082 KX812161 KX812155 KX812156 KX812084 KX812075 KX812150 KX812107 KX812104 KX812093 KX812095 MK524136 MK524130 MK005306 MH647528 GenBank accession number 16S KJ831310 KJ831313 KJ831317 KJ579118 KY022310 KY425379 KY022198 KY022309 KY022311 KX811922 KX811918 KX811919 KX811921 KX811770 KX811908 KX811767 KX811917 KX811913 KX811914 KX894679 KX811765 KX894669 KX811762 KX811897 KX811814 KX811821 KX811813 KX811823 MK524105 MK524099 MK005310 – – Locality Malaysia Hong Kong, China Palawan, Philippines Husa, Yunnan, China Beibeng, Xizang, China Beibeng, Xizang, China Mt. Mufu, Hunan, China Ukhrul dist.,Manipur, IN Zhangmu, Xizang, China Wuyi Shan, Fujian, China Mt. Jiulian, Jiangxi, China Huang Shan, Anhui, China Bintulu, Sarawak, Malaysia Baolong, Chongqing, China Leigong Shan, Guizhou, China O’Reang, Mondolkiri, Cambodia East Siang dist.,Arunachal Pradesh, IN Bidoup Mountain, Lam Dong, Vietnam West Kameng dist., Arunachal Pradesh, IN Xiaoqiaogou Nature Reserve, Yunnan, China Badagongshan Nature Reserve, Hunan, China Heishiding Nature Reserve, Guangdong, China Nui Chua National Park, Ninh Thuan, Vietnam Gunung Mulu National Park, Sarawak, Malaysia Ban Pang Kamphaeng Hin, Chiang Mai, Thailand Gunung Kinabalu National Park, Sabah, Malaysia Pasonanca Natural Park, Zamboanga, Philippines Phong Dien Nature Reserve, Thua Thien Hue, Vietnam Gunung Kinabalu National Park, Kogopan Trail, Malaysia KIZ06621 KU 314303 ZSIA11799 KIZ019419 KIZ024336 KIZ010360 KIZ010978 KIZ048439 KIZ048799 KIZ014278 KIZ022004 KIZ019216 BNHS 6061 ROM 16634 ITBCZ 1108 SYS a001957 SYS a006391 SYS a002107 ZMH A13125 UNIMAS 8148 UNIMAS 8943 FMNH 273694 FMNH 262778 SDBDU2009.75 Voucher number SDBDU2009.133 K5198/ZSI11393 ZMMU ABV-00454 CIBLS20171101001 ZMMU NAP-05015 Tissue ID: YPXJK033 Tissue ID: YPX10987 Species Megophrys gerti Megophrys sanu Megophrys hansi Megophrys acuta Megophrys elfina Megophrys dringi Megophrys zhangi Megophrys nasuta Megophrys periosa Megophrys ligayae Megophrys synoria Megophrys boettgeri Megophrys cf. major Megophrys baluensis Megophrys stejnegeri Megophrys katabhako Megophrys cf. periosa Megophrys kobayashii Megophrys glandulosa Megophrys medogensis Megophrys jiulianensis Megophrys edwardinae Megophrys microstoma Megophrys brachykolos Megophrys leishanensis Megophrys himalayana Megophrys baolongensis Megophrys pachyproctus Megophrys mufumontana Megophrys huangshanensis Megophrys tuberogranulata 48 49 50 51 52 53 54 43 47 55 62 42 44 46 56 59 61 45 57 58 60 40 41 39 37 38 36 35 32 34 Sample Number 33 Jing LIU et al. A New Species of Megophrys

No. 1 5 – – – – – – – – – – BDNF KX812046 KX812048 KX811938 KX812030 KX812025 KX812024 KX811943 KX812041 KX811939 KX812006 Continued Table 1 – – – – – – – RAG1 KY022351 KY022352 KX812282 KX812284 KX812269 KX812262 KX812194 KX812195 KX812274 KX812271 KX812268 KX812181 MH405011 – – – – – – – COI KX812164 KX812166 KX812056 KX812159 KX812079 KX812163 KX812080 KX812060 KX812062 KX812057 KX812072 MH406235 MH647536 GenBank accession number 16S KY022306 KY679891 KY022307 KX811930 KX811928 KX811810 KX811925 KX811790 KX811900 KX811807 KX811927 KX811780 KX811902 KX811811 KX811904 KX811797 HQ588950 KM504261 KM504251 MH406775 – Locality Hejiang, Sichuan, China Mengyue, Yunnan, China Nanjiang, Sichuan, China Sukabumi, Java, Indonesia Emei Shan, Sichuan, China Emei Shan, Sichuan, China Wawu Shan, Sichuan, China Dayao Shan, Guangxi, China Wuliang shan, Yunnan, China Huangcaoling, Yunnan, China East Khasi Hills dist., Meghalaya West Garo Hills dist., Meghalaya Aural, Kampong Speu, Cambodia U Bo, Phong Nha-Ke Bang NP, Vietnam Liziping Nature Reserve, Sichuan, China Naling Nature Reserve, Guangdong, China Xiaoqiaogou Nature Reserve, Yunnan, China Nanling National Forest Park, Guangdong, China Khao Nan National Park, Nakhon Si Thammarat, Thailand KIZ025778 KIZ046706 KIZ025467 KIZ021786 KIZ025799 KIZ014512 KIZ048508 KIZ016045 BNHS 6046 SYSa003933 CIB ZYC517 SYS a000589 ZFMK 87596 NCSM 79599 CIB20050081 LSUMZ 81916 Voucher number SDBDU2009.297 MZB:Amp:22233 Tissue ID: YPX37539 Tissue ID: YPX20455 Species Megophrys feae Megophrys popei Megophrys lancip Megophrys aceras Megophrys cf. parva Megophrys montana Megophrys gigantica Megophrys carinense Leptolalax oshanensis Megophrys auralensis Megophrys oreocrypta Megophrys wawuensis Megophrys intermedia Leptobrachium boringii Megophrys maosonensis Megophrys shapingensis Megophrys flavipunctata Megophrys nankiangensis Megophrys chuannanensis Megophrys mangshanensis 82 76 77 78 81 66 75 79 65 67 70 71 72 73 74 68 69 80 63 64 Sample Number Asian Herpetological Research 6 Vol. 11 were presented in Table S2. PCR products were purified with divergence with uncorrected p-distance model was estimated spin columns and then were sequenced with primers same using MEGA 6.06 (Tamura et al., 2011) to determine the genetic used in PCR. Sequencing was conducted using an ABI3730 distance between Megophr ys species, respectively. automated DNA sequencer in Shanghai DNA BioTechnologies 2.3. Morphological comparisons All twelve adult specimens Co., Ltd. (Shanghai, China). All sequences were deposited in and six tadpole specimens of the new taxon collected in this GenBank (for GenBank accession numbers see Table 1). work were measured. The terminology and methods followed For molecular analyses, the available sequence data for all Fei et al. (2009). Measurements were taken with a dial caliper to related species of the genus Megophr ys s. l. were downloaded 0.1 mm. Nineteen morphometric characters of adult specimens from GenBank, primarily from previous studies (Chen et al., were measured: SVL=snout-vent length (distance from the tip 2017; Liu et al., 2018; for GenBank accession numbers see Table of the snout to the posterior edge of the vent), HDL=head length 1). For phylogenetic analyses, corresponding sequences of (distance from the tip of the snout to the articulation of jaw), one Leptolalax oshanensis and one Leptobrachium boringii were HDW=maximum head width (greatest width between the left downloaded (for GenBank accession numbers see Table 1) and and right articulations of jaw), SL=snout length (distance from used as outgroups according to Chen et al. (2017). the tip of the snout to the anterior corner of the eye), ED=eye Sequences were assembled and aligned using the Clustalw diameter (distance from the anterior corner to the posterior module in BioEdit 7.0.9.0 (Hall, 1999) with default settings. corner of the eye), IOD=interorbital distance (minimum Alignments were checked by eye and revised manually if distance between the inner edges of the upper eyelids), necessary. To avoid bias in alignments, GBLOCKS 0.91.b IND=internasal distance (minimum distance between the inner (Castresana, 2000) with default settings was used to extract margins of the external nares), TYD=maximal tympanum regions of defined sequence conservation from the length- diameter, LAL=length of lower arm and hand (distance from variable 16S gene fragments. Non-sequenced fragments were the elbow to the distal end of the Finger IV), LW=lower arm defined as missing loci. width (maximum width of the lower arm), FIL=first finger Phylogenetic trees were reconstructed for the mitochondrial length (distance from base to tip of finger I), FIIL=second finger genes concatenated data and nuclear genes concatenated length (distance from base to tip of finger II); FIIIL=third finger data, respectively. Phylogenetic analyses were conducted length (distance from base to tip of finger III), FIVL=fourth using maximum likelihood (ML) and Bayesian Inference (BI) finger length(distance from base to tip of finger IV), THL=thigh methods, implemented in PhyML 3.0 (Guindon et al., 2010) a nd length (distance from vent to knee), TL=tibia length (distance MrBayes 3.12 (Ronquist and Huelsenbeck, 2003), respectively. from knee to tarsus), TW=maximal tibia width, TFL=length of To avoid under- or over-parameterization (Lemmon and foot and tarsus (distance from the tibiotarsal articulation to the Moriarty, 2004; McGuire et al., 2007), the best partition scheme distal end of the Toe IV), FL=foot length (distance from tarsus and the best evolutionary model for each partition were chosen to the tip of fourth toe). A total of ten morphometric characters for the phylogenetic a nalyses using PAR TITIONFINDER 1.1.1 of tadpoles were measured: TOL=total length, SVL=snout- (Robert et al., 2012). In the analyses, 16S, each codon position of vent length, BH=maximum body height, BW=maximum body the protein-coding genes were defined, and Bayesian Inference width, SL=snout length (distance from the anterior corner of Criteria (BIC) was used. As a result, the analyses selected the best the eye to the tip of the snout), SS=snout to spiraculum (distance partition scheme (i.e. 16S gene/each codon position of COI gene) from spiraculum to the tip of the snout), MW=mouth width and the TrN+I+G model for each partition for mitochondrial (distance between two corners of mouth), IOD=interorbital DNA dataset, and as well, selected the best partition scheme distance (minimum distance between eyes), TAL=tail length (i.e. each codon position of RAG1 and BDNF genes) and the (distance from base of vent to the tip of tail), TH=tail height TrN+I+G as the best model for the second codon position of (maximum height between upper and lower edges of tail). nuclear genes and the GTR+G +I model as the best model for We compared morphological characters of the new taxon the other two codon position of RAG1 and BDNF genes. For with other Megophr ys s. l. species. Comparative data were the ML tree, branch supports were drawn from 10 000 non- obtained from the literature for M. aceras (Boulenger, 1903), parametric bootstrap replicates. In BI analyses, two runs each M. actuta (Li et al., 2014), M. ancrae (Mahony et al., 2013), M. with four Markov chains were run for 60 million generations auralensis (Ohler et al., 2002), M. baluensis (Boulenger, 1899a), with sampling every 1000 generations. The first 25% of M. baolongensis (Ye et al., 2007), M. binchuanensis (Ye and Fei, generations were removed as the “burn-in” stage followed by 1995), M. binlingensis (Fei et al., 2009), M. boettgeri (Boulenger, calculation of Bayesian posterior probabilities and the 50% 1899b), M. brachykolos (Inger and Romer, 1961), M. carinense majority-rule consensus of the post burn-in trees sampled (Boulenger, 1889), M. caudoprocta (Shen, 1994), M. cheni (Wang et at stationarity. Finally, pairwise 16S and COI gene sequence al., 2014), M. chuannanensis (Fei et al., 2001), M. damrei (Mahony, Jing LIU et al. A New Species of Megophrys

No. 1 7

2 011) , M. daweimontis (Rao and Yang, 1997), M. dongguanensis temperature was taken by a digital hygrothermograph. (Wang et al., 2019), M. dringi (Inger et al., 1995), M. edwardinae (Inger, 1989), M. el fina (Poyarkov et al., 2017), M. fansipanensis 3. Results (Taply et al., 2018), M. feae (Boulenger, 1887), M. feii (Yang et al., 2018), M. flavipunctata (Mahony et al., 2018), M. gerti (Ohler, 3.1. Phylogenetic analyses Aligned sequence matrix of 2003), M. gigantica (Liu et al., 1960), M. glandulosa (Fei et al.,1990), 16S+COI and RAG1+BDNF contained 1101 bp and 1614 bp, M. hansi (Ohler, 2003), M. himalayana (Mahony et al., 2018), M. respectively. ML and BI trees of the mitochondrial DNA dataset hoanglienensis (Taply et al., 2018), M. huangshanensis (Fei and Ye, presented almost consistent topology (Figure 2A), and as well, 2005), M. insularis (Wang et al., 2017a), M. intermedia (Smith, 1921), ML and BI trees of the nuclear DNA dataset showed almost M. jingdongensis (Fei and Ye, 1983), M. jinggangensis (Wang et al., identical topology (Figure 2B), though relationships of several 2012), M. jiulianensis (Wang et al., 2019), M. kobayashii (Malkmus lineages were unresolved. All phylogenetic analyses strongly and Matsui, 1997), M. koui (Mahony et al., 2017), M. kuatunensis supported the new taxon as an independent clade nested into (Pope, 1929), M. lancip (Munir et al., 2018), M. latidactyla (Orlov et the Megophr ys s. l. clade and sister to M. minor. al., 2015), M. leishanensis (Li et al., 2018a), M. lekaguli (Stuart et al., Genetic distance on 16S and COI genes with uncorrected 2006), M. liboensis (Zhang et al., 2017), M. ligayae (Taylor, 1920), p-distance model between samples of the new taxon are less M. lini (Wang et al., 2014), M. lishuiensis (Wang et al., 2017b), than 0.2%, much lower than interspecific genetic distances in M. longipes (Boulenger, 1886), M. major (Boulenger, 1908), M. the genus Megophr ys s. l. (Tables S3 and S4). Genetic distance mangshanensis (Fei et al.,1990), M. maosonensis (Bourret, 1937), M. between the new taxon and its closely-related species M. minor medogensis (Fei et al., 1983), M. megacephala (Mahony et al., 2 011) , is 8.3% on COI and 7.3% on 16S, being much higher than that M. microstoma (Boulenger, 1903), M. minor (Stejneger, 1926), M. between many pairs of closely related species in the genus, for montana (Kuhl and Van Hasselt, 1822), M. monticola (Günther, 1864), M. mufumotana (Wang et al., 2019), M. nankiangensis (Hu example, on COI, M. huangshanensis vs. M. boettgeri (1.8%), M. vs. (3.8%), vs. et al.,1966), M. nankunensis (Wang et al., 2019), M. nanlingensis sangzhiensis M. spinata M. spinata M. binlingensis (Wang et al., 2019), M. nasuta (Schlegel, 1958), M. obesa (Li et (7.7%), M. sangzhiensis vs. M. binlingensis (6.8%) and M. wushanensis al., 2014), M. ombrophila (Messenger et al., 2019), M. omeimontis vs. M. tuberogranulata (7.0%); a nd on 16S, M. sangzhiensis vs. M. (Liu, 1950), M. oreocr ypta (Mahony et al., 2018), M. oropedion spinata (1.7%), M. spinata vs. M. binlingensis (1.7%) a nd M. minor vs. (Mahony et al., 2013), M. pachyproctus (Huang and Fei, 1981), M. M. spinata (6.0%). palpebralespinosa (Bourret, 1937), M. parallela (Inger and Iskandar, 3.2. Description of the new species 2005), M. parva (Boulenger, 1893), M. periosa (Mahony et al., 2018), Megophrys jiangi sp. nov. M. popei (Zhao et al., 2014), M. robusta (Mahony et al., 2013), M. Holotype CIBKKS20180722006 (Figure 3), adult male, from rubrimera (Tapley et al., 2017), M. sangzhiensis ( Jiang et al., 2008), Kuankuoshui National Nature Reserve (28°13′14″ N, 107°09′47″ M. serchhipii (Mathew and Sen, 2007), M. shapingensis (Liu, 1950), E, 1521 m a. s. l.), Suiyang County, Guizhou Province, China, M. shuichengensis (Tian and Sun, 2000), M. spinata (Hu et al., collected by Shize LI on 22 July 2018. 1973), M. stejnegeri (Taylor, 1920), M. synoria (Stuart et al., 2006), Paratype three adult males and one adult females from M. takensis (Mahony, 2011), M. tuberogranulata (Mo et al., 2010), M. Kuankuoshui National Nature Reserve, Suiyang County, vegrandis (Mahony et al., 2013), M. wawuensis (Fei et al., 2001), M. Guizhou Province, China, collected by Shize LI and Jing wugongshanensis (Wang et al., 2019), M. wuliangshanensis (Ye and LIU. One female CIBKKS20180723003 collected by Jing Fei, 1995), M. wushanensis (Ye and Fei, 1995), M. zhangi (Ye and LIU on 23 July 2018, three adult males CIBKKS20180723001, Fei, 1992) and M. zunhebotoensis (Mathew and Sen, 2007). CIBKKS20180723002 and CIBKKS20180723007 collected by 2.4. Bioacoustics analyses Ten advertisement calls of one Shize LI on 23 July 2018. Five adult males and one adult female individual (specimen CIBKKS20180722006) of the new taxon from Fanjing Mountain collected by Shize LI. One male: were recorded at ambient air temperature of 19.5 °C and CIB F JS20150718005 collected on 18 Jul y 2015, f i ve males: CIB air humidity of 85% in a mountain stream of Kuankuoshui F JS20150719006, CIB F JS20150719007 and CIB F JS20150719009 National Nature Reserve between 22:00–23:00 on 22 July collected on 19 July 2015, CIB FJS20150720003 and CIB 2018. SONY PCM-D50 digital sound recorder was used to FJS20150720004 collected on 20 July 2015, respectively. record within 20 cm of the calling individuals. The sound files Diagnosis Megophr ys jiangi sp. nov. is assigned to the genus in wave format were resampled at 48 kHz with sampling Megophr ys based on molecular phylogenetic analyses and the depth 24 bits. The sonograms and waveforms were generated following generic diagnostic characters: snout shield-like; snout by WaveSurfer software (Sjöander and Beskow, 2000) from projecting beyond the lower jaw; canthus rostralis distinct; chest which all parameters and characters were measured. Ambient gland small and round, closer to the axilla than to midventral Asian Herpetological Research 8 Vol. 11 . A: ML (Maximum likelihood) tree reconstructed based on the 16S rRNA and COI gene sequences. B: ML (Maximum Megophrys sensu lato Phylogenetic relationships of the genus likelihood) tree reconstructed based on the nuclearbased on reconstructed tree likelihood) DNAandRAG1 sequences of genes. Bayesian BNDF posterior probability/ node. each denoted beside were bootstrap support ML Samples 1–82 refer to Table 1. Figure 2 Jing LIU et al. A New Species of Megophrys

No. 1 9 line; femoral gland on rear of thigh; vertical pupils. eyelid; eye large and convex, eye diameter 43.2% of head length; The new species could be identified from its congeners by pupils vertical; nostril orientated laterally, closer to snout than a combination of the following morphological characters: eye; tympanum distinct, TYP/EYE ratio 0.60 (Figure 3A, B, C); (1) small body size with SVL < 39.2 mm in male and SVL < vomerine ridges and vomerine teeth absent; margin of tongue 40.4 mm in female; (2) vomerine teeth absent; (3) tongue not smooth, not notched behind. notched behind; (4) a small horn-like tubercle at the edge of Forelimbs slender, the length of lower arm and hand 40.8% each upper eyelid; (5) tympanum distinctly visible, rounded; (6) of SVL; fingers slender, relative finger lengths: I < II < V < III; tips two metacarpal tubercles in hand; (7) relative finger lengths: of digits globular, without lateral fringes; subarticular tubercle I < II < V < III; (8) toes with rudimentary webbing at bases; (9) distinct at the base of each finger; three metacarpal tubercles, heels overlapped when thighs are positioned at right angles to inner and outer metacarpal tubercles prominent, the outer one the body; (10) tibiotarsal articulation reaching tympanum to long and thin the inner one and middle one oval-shaped, and eye when leg stretched forward; (11) an internal single subgular the inner one distinctly larger than middle one (Figure 3D, E). vocal sac in male; (12) in breeding season, in male, the black Hindlimbs slender (TL/SVL = 0.49); heels overlapped when nuptial pads without nuptial spines on the dorsal bases of the thighs are positioned at right angles to the body, tibiotarsal first and second fingers. articulation reaching tympanum to eye when leg stretched Description of holotype (Figure 3) SVL 38.2 mm; head width forward; tibia length longer than thigh length; relative toe larger than head length ( HDW/HDL ratio about 1.2); snout lengths: I < II < V < III < IV; tips of toes round, slightly dilated; obtusely pointed, protruding well beyond the margin of the subarticular tubercle absent; toes without webbing; no lower jaw in ventral view; loreal region vertical and concave; lateral fringe; inner metatarsal tubercle oval-shaped; no outer canthus rostralis well-developed; top of head flat on in dorsal metatarsal tubercle (Figure 3F). view; an small horn-like tubercle at the edge of the upper Dorsal skin rough, with numerous granules; several large

Figure 3 The holotype specimen (CIBKKS20180722006) ofMegophrys jiangi sp. nov. A: dorsal view. B: ventral view. C: lateral view. D: dorsal view of hand. E: ventral view of hand. F: ventral view of foot. Asian Herpetological Research 10 Vol. 11 warts scattered on flanks; an small horn-like tubercle at the = 90) and the intervals between notes 0.07–0.23 second (0.14 ± edge of each upper eyelid; tubercles on the dorsum forming an 0.05, n = 80). Amplitude modulation within note was apparent, V-shaped and an inverted V-shaped weak ridge, the V-shaped beginning with moderately high energy pulses, increasing ridges disconnect; two discontinuous dorsolateral parallel ridges slightly to a maximum, and then decreasing towards the end on either side of the V-shaped ridges; an inverted triangular of each note. The average domina nt frequency was 5838.1 ± 111.1 brown speckle between two upper eyelids; the skin of posterior (5662–5995 Hz, n = 10). sides of abdomen and inner side of thigh with orange; several Tadpole description All measurements of tadpoles were tubercles on the flanks and dorsal surface of thighs and tibias presented in Table 3. The following tadpole description was and forming three transverse tubercle rows; supratympanic based on specimen CIBKKS20180426001 at Stage 26 (Figure fold distinct (Figure 3A). 7), the tadpole was confirmed as Megophr ys jiangi sp. nov. Ventral surface smooth; chest gland small and round, closer by molecular analyses. Body slender, body and tail yellow- to the axilla than to midventral line; femoral gland on rear of brown; tail height greater than body height; dorsal fin arising, thigh; posterior end of the body protrudes distinct and appears behind the origin of the tail, height near mid-length, tapering as an arc-shaped swelling, upper the anal region (Figure 3B). gradually to narrow, tip pointed; tail 2.4 times as long as snout- Coloration of holotype in life An inverted triangular brown vent length; tail height 16.9% of tail length; body width longer speckle between the eyes; two V-shaped ridges on the dorsum than body height; tail fins lightly colored; eyes large, lateral, of body, three transverse bands on the dorsal surface of the interorbital distance is 37.4% of snout-vent length; nostril near thigh and shank separately; several dark brown and white eyes; spiracle on the left side of the body and not distinct; oral vertical bars on the lower and upper lip; the venter purple grey, disk terminal, lips expanded and directed upwardly into a some big dark spots on the ventral surface, ventral surface of umbelliform oral disk; transverse width of expanded funnel limbs with some white spots; the posterior of ventral surface of 49.4% of snout-vent length. body, inner of thigh and upper of tibia jacinth; palms and soles Secondary sexual characteristics Adult females with SVL uniform purple grey, tip of digits pink; pectoral and femoral 39.5–40.4 mm, larger than adult males with 34.4–39.2 mm. glands white (Figure 4A–E). Adult males have a single subgular vocal sac. In breeding Preserved holotype coloration Dorsal surface dark brown; male, the nuptial pads on the dorsal bases of the first finger the inverted triangular brown speckle between the eyes, and second fingers with black nuptial spines obvious under inverted triangular between eyes, V-shaped ridges on dorsum microscope (Figure 3 D). and transverse bands on limbs and digits distinct; ventral Morphological comparisons (Table S5) By having small surface greyish white; creamy-white substitutes the pinkish in body size, Megophr ys jiangi sp. nov. differs from M. aceras, metatarsal tubercles; the posterior of ventral surface of body, M. auralensis, M. binlingensis, M. carinense, M. caudoprocta, M. inner of thigh and upper of tibia fade to light red (Figure 3). chuannanensis, M. damrei, M. edwardinae, M. feae, M. flavipunctata, Variation Morphometric variations of the new species were M. gigantica, M. glandulosa, M. himalayana, M. intermedia, M. small in adults (Table 2 and Table S1). In some adult individuals jingdongensis, M. kobayashii, M. lekaguli, M. liboensis, M. ligayae, the marking on back of trunk is irregular like network (Figure M. longipes, M. major, M. mangshanensis, M. maosonensis, M. 5A); in some adult individuals the marking on back of trunk medogensis, M. megacephala, M. omeimontis, M. oreocr ypta, consists by X-shaped ridge (Figure 5B); the marking on back of M. periosa, M. popei, M. sangzhiensis, M. shapingensis, M . trunk consists by X-shaped ridge and the skin rough distinct shuichengensis, M. spinata and M. takensis by having small body by numerous granules(Figure 5C); in some adult individuals size (maximum SVL < 42.3 mm in the new species vs. minimum the whole ventral purplish grey except the posterior belly with SVL > 45 mm in the latter). By lacking vomerine teeth, white blotches(Figure 5D); in some adult individuals the throat Megophr ys jiangi sp. nov. differs from M. aceras, M. ancrae, and anterior belly atropurpureus, and some with spots mixed M. carinense, M. baluensis, M. caudoprocta, M. chuannanensis, M. black spots on the posterior belly (Figure 5E); in some adult damrei, M. daweimontis, M. dongguanensis, M. fansipanensis, M. individuals the ventral surface purple and some with spots flavipunctata, M. glandulosa, M. hoanglienensis, M. himalayana, mixed purple spots on the belly (Figure 5F). M. insularis, M. intermedia, M. jingdongensis, M. jinggangensis, M. Advertisement calls The call description is based on jiulianensis. M. kobayashii, M. lancip, M. latidactyla, M. lekaguli, M. recordings of the holotype CIBKKS20180722006 (Figure liboensis, M. ligayae, M. major, M. mangshanensis, M. maosonensis, 6) from the rock of the streamlet. Each call consists of M. medogensis, M. megacephala, M. montana, M. nasuta, M. 7–11 ( 9 ± 1.5 , n = 10) notes. Call duration was 2.15–4.15 s nankunensis, M. nanlingensis, M. omeimontis, M. oropedion, M. (3.23 ± 0.63, n = 10). Call interval was 0.38–0.53 s (0.45 ± 0.06, n = oreocr ypta, M. palpebralespinosa, M. parallela, M. parva, M. periosa, 9). Each note had a duration of 0.17–0.37 second (0.24 ± 0.05, n M. popei, M. robusta, M. rubrimera, M. sangzhiensis, M. stejnegeri, Jing LIU et al. A New Species of Megophrys

No. 1 11

Figure 4 Views of the holotype (CIBKKS20180722006) of Megophrys jiangi sp. nov. in life. A: dorsolateral view. B: ventral view. C: ventral view of hand. D: dorsal view of hand showing nuptial pads on the first and second fingers (1). E: ventral view of foot.

Table 2 Basic statistics for measurements of the adult specimens of Megophrys jiangi sp. nov. Unit: mm. See abbreviations for the morphological characters in Materials and Methods section.

Male (n = 9) Female (n = 2) Ranging Mean ± SD Ranging SVL 34.4–39.2 36.9±1.80 39.5–40.4 HDL 10.2–11.8 10.9±0.54 10.8–11.4 HDW 11.7–13.0 12.5±0.52 13.5–14.1 SNT 4.0–5.1 4.5±0.43 4.6–5.0 IND 4.2–5.0 4.6±0.25 4.8–5.0 IOD 2.5–3.8 3.0±0.38 3.0–3.2 ED 4.0–4.8 4.5±0.25 4.5–4.7 TYD 2.2–3.0 2.6±0.26 2.6–2.7 LAL 14.7–17.5 16.0±0.86 18.2–18.2 LW 3.0–3.8 3.4±0.29 3.1–3.6 FIL 3.0–4.3 3.6±0.46 3.7–3.8 FIIL 3.2–4.4 3.8±0.45 4.1–4.3 FIIIL 5.0–6.5 5.6±0.46 6.2–6.7 FIVL 3.8–4.8 4.3±0.29 4.6–4.6 THL 15.8–18.6 16.9±0.94 17.3–17.7 TL 17.1–20.2 18.1±0.96 18.4–20.4 TW 4.0–4.7 4.4±0.22 4.8–5.1 TFL 22.9–26.7 25.0±1.31 26.2–27.8 FL 15.9–18.5 17.0±0.84 18.1–18.8 Asian Herpetological Research 12 Vol. 11

Figure 5 Color variation in Megophrys jiangi sp. nov. in life. A: dorsolateral view of the male specimen CIBKKS20180723001. B: dorsolateral view of the male specimen CIBKKS20180723002. C: dorsal view of the male specimen CIBFJS20150719009. D: ventral view of the female specimen CIBFJS20150718005. E: ventral view of the male specimen CIB FJS20150720004. F: ventral view of the female specimen CIB KKS20180723003.

M. takensis, M. zhangi and M. zunhebotoensis (vs. present in the M. jiulianensis. M. jingdongensis, M. kuatunensis, M. liboensis, latter). M. mangshanensis, M. maosonensis, M. medogensis, M. minor, M. By having an small horn-like tubercle at the edge of nankiangensis, M. nanlingensis, M. omeimontis, M. oropedion, M. each upper eyelid, Megophr ys jiangi sp. nov. differs from M. pachyproctus, M. parallela, M. popei, M. robusta, M. sangzhiensis, binchuanensis, M. binlingensis, M. damrei, M. gigantica, M. minor, M. shapingensis, M. shuichengensis, M. spinata, M. vegrandis, M. M. nankiangensis, M. oropedion, M. pachyproctus, M. spinata, M. wawuensis, M. zhangi and M. zunhebotoensis (vs. tongue notched takensis, M. wuliangshanensis, M. wushanensis, M. zhangi and M. behind in the latter). zunhebotoensis (vs. tubercle lacking in the latter). By lacking lateral fringe in toes, Megophr ys jiangi sp. By having an small horn-like tubercle at the edge of each nov. differs from M. actuta, M. auralensis, M. baolongensis, M. upper eyelid, Megophr ys jiangi sp. nov. differs from M. carinense, binchuanensis, M. boettgeri, M. carinense, M. cheni, M. chuannanensis, M. feae, M. gerti, M. hansi, M. intermedia, M. koui, M. latidactyla, M. dringi, M. el fina, M. feae, M. feii, M. flavipunctata, M. M. liboensis, M. microstoma, M. nasuta, M. palpebralespinosa, M. gigantica, M. glandulosa, M. hansi, M. intermedia, M. jingdongensis, popei, M. shuichengensis, M. stejnegeri and M. synoria (vs. having M. jinggangensis, M. kuatunensis, M. latidactyla, M. lini, M. a prominent and elongated tubercle at the edge of each upper major, M. maosonensis, M. nankiangensis, M. omeimontis, M. eyelid in the latter). palpebralespinosa, M. popei, M. rubrimera, M. sangzhiensis, M. By tongue not notched behind, Megophr ys jiangi sp. nov. serchhipii, M. shapingensis, M. shuichengensis, M. spinata, M. differs from M. ancrae, M. baolongensis, M. binlingensis, M. vegrandis, M. zhangi and M. zunhebotoensis (vs. present in the boettgeri, M. carinense, M. cheni, M. chuannanensis, M. damrei, M. latter). dringi, M. fansipanensis, M. feae, M. feii, M. flavipunctata, M. gerti, By toes without webs at bases, Megophr ys jiangi sp. nov. M. glandulosa, M. hoanglienensis, M. huangshanensis, M. insularis, differs from M. brachykolos, M. carinense, M. flavipunctata, Jing LIU et al. A New Species of Megophrys

No. 1 13

Figure 6 Advertisement call of a male Megophrys jiangi sp. nov., CIBKKS20180722006, holotype. A: waveform showing one syllable. B: sonogram showing one syllable. C: waveform showing nine syllables of one strophe. D: sonogram showing nine syllables of one strophe.

Table 3 Measurements of the tadpoles of Megophrys jiangi sp. nov. Unit: mm. See abbreviations for the morphological characters in Materials and Methods section.

Voucher Gosner’s stage TOL SVL IOD BW SS SL MW TL TH CIBKKS20180426001 26 26.0 7.7 2.88 3.8 4.5 2.2 3.8 18.3 3.1 CIBKKS20180426002 26 25.5 8.0 3.0 3.6 4 2.7 4.0 16.7 3.0

M. jingdongensis, M. jinggangensis, M. lini, M. major, M . tympanum in males and to the eye in females). palpebralespinosa, M. popei, M. shuichengensis, M. spinata (vs. at By having an internal single subgular vocal sac in male, least one-fourth webbed in the latter). Megophr ys jiangi sp. nov. differs from M. caudoprocta, M. By heels overlapping when thighs are positioned at right shapingensis and M. shuichengensis (vs. vocal sac absent in the angles to the body, Megophr ys jiangi sp. nov. differs from M. latter). acuta, M. brachykolos, M. dongguanensis, M. nankunensis, M. obesa, By having nuptial pads and nuptial spines on the dorsal base M. ombrophila and M. wugongensis by (vs. heels not meeting of the first and second fingers in breeding male, Megophr ys when thighs are positioned at right angles to the body in the jiangi sp. nov. differs from M. acuta, M. feii, M. shapingensis and latter). M. shuichengensis (vs. nuptial pads and nuptial spines lacking in By tibiotarsal articulation reaching forward to the region the latter). between tympanum and eye when hindlimb is stretched along Based on molecular phylogenetic analyses, Megophr ys jiangi the side of the body, Megophr ys jiangi sp. nov. differs from M. sp. nov. was clustered as a sister taxon to M. minor. The new baolongensis, M. nankiangensis, M. pachyproctus, M. shuichengensis species could be identified from M. minor distinctly by having and M. tuberogranulatus (vs. reaching posterior corner of the eye a small horn-like tubercle at the edge of each upper eyelid (vs. in the latter); differs from M. daweimontis, M. glandulosa, M. lini, absent in the latter), tongue not notched behind (vs. notched in M. major, M. medongensis, M. obesa, M. sangzhiensis (vs. reaching the latter), tibiotarsal articulation reaching the level between the anterior corner of the eye or beyond eye or nostril and tip tympanum to eye when leg stretched forward (vs. tibiotarsal of snout in the latter); differs from M. leishanensis (vs. reaching articulation reaching the level between eye and tip of snout middle part of eye); differs from M. mufumontana (reaching in the latter), having two or three metatarsal tubercles in each Asian Herpetological Research 14 Vol. 11

systematic studies and biodiversity conservation of amphibians in China.

4. Discussion

In the genus Megophr ys, due to the superficial similarities in morphologies (e.g. drab colorations, complicated markings and even changeable colorations and skin markings of the same individual under various environments), related species is often considered to be difficult to be distinguished from each other especially in field identification, which would cause confusion Figure 7 The tadpole of Megophrys jiangi sp. nov. Dorsal view (A) in taxonomic arrangements (Fei et al., 2009). Megophr ys minor and lateral view (B) of specimen CIBKKS20180426001 in life. was recorded in a wide distributional range in the provinces of Sichuan, Guizhou, Chongqin, Yunnan, Guangxi, Jiangxi in China and north of Vietnam (Fei et al., 2012, 2016). The species hand (vs. absent of metatarsal tubercle in hand in the latter), has been recorded in Kuangkuoshui National Nature Reserve and having an small horn-like tubercle at the edge of each and Fanjing Mountain for many years (Wu et al., 1986; Fei et upper eyelid (vs. lacking in the latter). al., 2012, 2016), but we just found Megophr ys jiangi sp. nov. in Two species of Megophr ys, i.e. M. spinata and M . these two regions though with many surveys in recent years. were recorded to be sympatric with shuichengensis Megophr ys Therefore, we suggested that the populations in these areas jiangi The new species could be identified from sp. nov. ever identified as M. minor were under misidentification and these two species by having small body size (maximum SVL should be Megophr ys jiangi sp. nov. In consideration of much < 42.3 mm in the new species vs. minimum SVL > 45 mm underestimated species diversity in the genus Megophr ys s. l. (Liu in the latter), tongue not notched behind (vs. notched in the et al., 2018), it is expected that there still be cryptic species whose latter), lacking lateral fringe in toes (vs. present in the latter), populations had possibly been identified as M. minor, probably toes without webs at bases (vs. at least one-fourth webbed corresponding to several cryptic species suggested in Chen et al. in the latter), having an internal single subgular vocal sac in (2017) and Liu et al. (2018). This need deep field investigations male (vs. nuptial pads and nuptial spines lacking in male M. and comprehensive comparisons in the related regions. shuichengensis), tibiotarsal articulation reaching forward to the Geographical distances between Kuankuoshui National region between tympanum and eye when hindlimb is stretched Nature Reserve and Fanjing Mountain were about 153 km, along the side of the body (vs. reaching posterior corner of the and the new species is much probably distributed in the eye in M. shuichengensis). region between the two localities. Moreover, in the region Distribution and habitats Megophr ys jiangi sp. nov. is between these two localities, just in these two years, our group known from the type locality, Kuankuoshui National Nature has described three new frog species, i.e. Megophr ys jiangi sp. Reserve (28°06′–28°19′ N, 107°02′–107°14′ E), Suiyang county, nov., Microhyla fanjingshanensis (Li et al., 2019) a nd Odorrana Fanjing Mountain (27°49′–28°01′ N, 108°45′–108°48′ E), Jiangkou kweichowensis (Li et al., 2018b), and this region was also indicated County, Guizhou Province, China at elevations between 1 270– as the overlap region of many related species and/or clades (Li et 1704 m a. s. l. in Kuankuoshui Nature National Reserve and al., 2018b). Hence, more detailed investigations will contribute to Fanjing Mountain, and from Chen et al. (2017), this new species determining the distribution range of the species and exploring is also distributed in Jianba Town, Suiyang County, Guizhou systematic profiles of the related taxa in this region. Province and Qinghua Forest Farm, Chongqing City, China. Both in the Kuankuoshui National Nature Reserve and Acknowledgements We are grateful to editors and Fanjing Mountain , the new species are frequently found in reviewers for their working on the manuscript. Collections bamboo forests nearby the streams (Figure 8 A, B), and five in field were permitted by Administration of Kuankuoshui sympatric amphibian species, i.e. Megophr ys spinata, Odorrana National Nature Reserve (No. KKS20040348). This study margaratae, Rhacophorus omeimontis and Rana zhenhaiensis were was approved by the animal ethical committee of Chengdu found in the two localities. Institute of Biology, Chinese Academy of Sciences, and animal Etymology The specific epithet “jiangi” is in honor of Professor experiments were carried out following the institutional Jian-Ping Jiang from Chengdu Institute of Biology, Chinese guidelines (No. 2017CIBAEC0344). This work was supported Academy of Sciences, in recognition of his contributions to the by Project Supported by the Biodiversity Investigation, Jing LIU et al. A New Species of Megophrys

No. 1 15

Figure 8 Habitats of Megophrys jiangi sp. nov. in the type locality Kuankuoshui National Nature Reserve, Suiyang County, Guizhou Province, China. A: landscape of montane forests in the type locality. B: a mountain stream in the type locality (insert a male of the new species calling on the stone).

Observation and Assessment Program (2019-2023) of Ministry 159–172 + pls. XVI-XIM of Ecology and Environment of China, the Strategic Priority Boulenger G. A. 1903. Report on the batrachians and reptiles. Annandale Research Program of the Chinese Academy of Sciences (Grant N., Robinson H. C., eds. Fasciculi Malayenses. Anthropological and Zoological Results of an Expedition to Perak and the Siamese Malay No. XDPB0202), National Natural Sciences Foundation of States 1901–1903 undertaken by Nelson Annandale and Herbert C. China (NSFC-31960099), Biodiversity Conservation Key London, Longmans, Green & Co.: Robinson under the auspecies of the Laboratory of Guizhou Province Education Department, University of Edinburgh and the University of Liverpool. Volume 2, Guiyang College, The laboratory on biodiversity conservation Zoolog y , Pa rt 1: 131–176 and applied ecology of Guiyang college, Guizhou Provincial Boulenger G. A. 1908. A revision of the oriental pelobatid batrachians Department of Education Youth Science and Technology (genus Megophr ys). Proc Zool Soc Lond, 78 (2): 407–430 Talents Growth Project (Nos. KY[2018]455, KY[2018]468 and Bourret R. 1937. Notes herpétologiques sur l’Indochine française. XIV. Les batraciens de la collection du Laboratoire des Sciences Naturelles KY[2018]469), The Specialty Food Resource Utilization Talent de l’Université. Descriptions de quinze especes ou variétés nouvelles. Base of Moutai University. Annexe au Bulletin Général de l’Instruction Publique Hanoi, 1937: 5–56 Castresana J. 2000. Selection of conserved blocks from multiple alignments References for their use in phylogenetic analysis. Mol Biol Evol, 17: 540–552 Che J., Chen H. M., Yang J. X., Jin J. Q., Jiang K., Yuan Z. Y., Murphy Beddard F. E. 1908 “1907”. Contributions to the knowledge of the anatomy R. W., Zhang Y. P. 2012. Universal COI primers for DNA barcoding of the batrachian family Pelobatidae. Proc Zool Soc Lond, 1907: 871–911 amphibians. Mol Ecol Resour, 12: 247–258 Boulenger G. A. 1886 “1885”. Description of a new frog of the genus Chen J. M., Zhou W. W., Nikolay A., Poyarkov Jr., Stuart B. L., Brown R. Megalophrys. Proc Zool Soc Lond, 1885: 850 M., Lathrop A., Wang Y. Y., Yuan Z. L., Jiang K., Hou M., Chen H. M., Boulenger G. A. 1887. Description of a new frog of the genus Megalophrys. Suwannapoom C., Nguyen S. N., Duong T. V., Papenfuss T. J., Murphy Annali del Museo Civico di Storia Naturale di Genova. Serie 2, 4: R. W., Zhang Y. P., Che J. 2017. A novel multilocus phylogenetic 512–513 estimation reveals unrecognized diversity in Asia toads, genus Boulenger G. A. 1889. Description of a new batrachian of the genus Megophr ys sensu lato (Anura: Megophryidae). Mol Phylogenet Evol, Leptobrachium, obtain by M. L. Fea in the Karens Mountains Burma. 106: 28–43 Ann Mus Civ Stro Nat Genova, 7(2): 748–750 Deuti K., Grosjean S., Nicolas V., Vasudevan K., Ohler A. 2017. Boulenger G. A. 1893. Concluding report on the reptiles andbatrachians Nomenclatural puzzle in early Megophr ys nomina (Anura, obtained in Burma by Signor L. Fea dealing with the collection made Megophryidae) solved with description of two new species from India in Pegu and the Karin Hills in 1887–1888. Annali del Museo Civico di (Darjeeling hills and Sikkim). Alytes, 34: 20–48 Storia Naturale di Genova, Serie 2, 13: 304–347 Dubois A. 1987 “1986”. Miscellanea taxinomica batrachologica (I). Alytes, 5: Boulenger G. A. 1899a. Descriptions of three new reptiles and a new 7–95 batrachian from Mount Kina Balu, North Borneo. Ann Nat Hist, Series Dubois A., Ohler A. 1998. A new species of Leptobrachium (Vibrissaphora) 7, 4: 453 from northern Vietnam, with a review of the taxonomy of the genus Boulenger G. A. 1899b. On a collection of reptiles and batrachians made Leptobrachium (Pelobatidae, Megophryinae). Dumerilia, 4: 1–32 by Mr. J. D. La Touche in N.W. Fokien, China. Proc Zool Soc Lond, Fei L., Hu S. Q., Ye C. Y., Huang. Y. Z. 2009. Fauna Sinica. Amphibia. Asian Herpetological Research 16 Vol. 11

Volume 2. Anura. Chinese Academy of Science. Beijing, China: Science Chinese) Press. (In Chinese) Kuhl H., Van Hasselt J. C. 1822. Uittreksels uit breieven van de Heeren Kuhl Fei L., Ye C. Y., Huang Y. Z. 1983. Two new subspecies of Megophr ys en van Hasselt, aan de Heeren C. J. Temminck, Th. van Swinderen en omeimontis Liu from China (Amphibia, Pelobatidae). Acta Herpetologica W. de Haan. Algemeene Konst-en Letter-Bode, 7: 99–104 Sinica. New Series, Chengdu, 2(2): 49–52 (In Chinese with English Lathrop A. 1997. Taxonomic review of the megophryid frogs (Anura: abstract) Pelobatoidea). Asian Herpetol Res, 7: 68–79 Fei L., Ye C. Y., Huang Y. Z. 1990. Key to Chinese Amphibians. Chongqing, Lemmon A. R., Moriarty E. C. 2004. The importance of proper model China: Publishing House for Scientific and Technological (In Chinese) assumption in Bayesian phylogenetics. Syst Biol, 53: 265–277 Fei L., Ye C. Y., Huang Y. Z. 2001. Colour Handbook Amph. Sichuan, Li Y. L., Jin M. J., Zhao J., Liu Z. Y., Wang Y. Y., Pang H. 2014. Description Beijing: Science Press (In Chinese) of two new species of the genus Megophr ys (Amphibia: Anura: Fei L. Ye C. Y. 2005. Two new species of Megophryidae from China. In: Megophryidae) from Heishiding Natural Resreve, Fengkai, Guangdong, Fei et al. (Ed.), The Key and Illustration of Chinese. Chongqing, China: China, based on molecular and morphological data. Zootaxa, 3795(4): Sichuan Publishing House of Science and Technology (In Chinese) 449–471 Fei L., Hu S. Q., Ye C. Y., Huang. Y. Z. 2009. Fauna Sinica. Amphibia. Li S. Z., Xu N., Liu J., Jiang J. P., Wei G., Wang B. 2018a. A New Species Volume 2. Anura. Chinese Academy of Science. Beijing, China: Science of the Asian Toad Genus Megophrys sensu lato (Amphibia: Anura: Press (In Chinese) Megophryidae) from Guizhou Province, China. Asian Herpetol Res, Fei L., Ye C. Y., Jiang J. P. 2012. Colored atlas of Chinese Amphibians and 9(4): 224–239 their distributions. Chengdu, China: Sichuan Publishing House of Li S. Z., Xu N., Lv J. C., Jiang J. P., Wei G., Wang B. 2018b. A new species Science and Technology (In Chinese) of the odorous frog genus Odorrana (Amphibia, Anura, Ranidae) from Fei L., Ye C. Y., Jiang J. P. 2016. Genus Liuophr ys Fei, Ye and Jiang, new southwestern China. PeerJ, 6: e5695 genus; Subgenus Atympanophr ys (Borealophrys) Fei, Ye and Jiang, new Li S. Z., Zhang M. H., Xu N., Lv J. C., Jiang J. P., Liu J., Wei G., Wang subgenus; Subgenus Atympanophr ys (Gigantophr ys) Fei, Ye and Jiang, B. 2019. A new species of the genus Microhyla (Amphibia: Anura: new subgenus; Genus Boulenophr ys Fei, Ye and Jiang, 2016, new genus; Microhylidae) from Guizhou Province, China. Zootaxa, 4624 (4): 551– Subgenus Xenophr ys (Tianophr ys) Fei, Ye and Jiang, new subgenus. In 575 Fei L, Ye C. Y. 2016 Amphibians of China. Volume (I). Beijing, China: Liu C. Z. 1950. Amphibians of Western China. Fieldiana, America Zool Science Press。 Mem, Chicago, 2: 1–400 Frost D. R. 2019. Amphibian Species of the World Version 6.0, an Oline Liu C. Z., Hu S. Q., Yang H. H. 1960. Amphibian of Yunnan collected in Reference: Names assigned to genus Megophr ys. American Museum 1958. Acta Zool Sinca, 12(2): 149–174 (In Chinese with English abstract) of Natural History, New York, USA. Available from: http:// Liu Z. Y., Zhu T. Q., Zeng Z. C., Lyu Z. T., Wang J., Messenger K., research.amnh.org/vz/herpetology/amphibia/Amphibia/Anura/ Greenberg A. J., Gou Z. X., Yang Z. H., Shi S. H., Wang Y. Y. 2018. Megophryidae/Megophrys (accessed 20 June 2019). Prevalence of cryptic species in morphologically uniform taxa–Fast Günther A. C. L. G. 1864. The Reptiles of British India. London: Ray Society speciation and evolutionary radiation in Asian frogs. Mol Phylogenet by R. Hardwicke. Evol, 127: 723–731 Guindon S, Dufayard J. F., Lefort V., Anisimova M., Hordijk W., Gascuel O. Mahony S. 2011. Two new species of Megophr ys Kuhl & van Hasselt 2010. New algorithms and methods to estimate maximum-likelihood (Amphibia: Megophryidae), from western Thailand and southern phylogenies: assessing the performance of PhyML 3.0. Syst Biol, 59(3): Cambodia. Zootaxa, 2734: 23–39 307–321 Mahony S., Sengupta S., Kamei R. G., Biju S. D. 2011. A new low altitude Hall T. A. 1999. BIOEDIT: a user-friendly biological sequence alignment species of Megophr ys Kuhl and van Hasselt (Amphibia: Megophryidae), editor and analysis program for Windows 95/98/NT. Nucleic Acids from Assam, Northeast India. Zootaxa, 3059: 36–46 Symp Ser, 41: 95–98 Mahony S., Teeling E. C., Biju S. D. 2013. Three new species of horned frogs, Hu S. X., Zhao E. M., Liu C. Z. 1966. A herpetological survey of the Tsinling Megophr ys (Amphibia: Megophryidae), from northeast India, with a and Ta-pa shan region. Acta Zool Sinica, 18(1): 57–89 (In Chinese) resolution to the identity of Megophrys boettgeri populations reported Hu S. X., Zhao E. M., Liu C. Z. 1973. A survey of amphibians and reptiles from the region. Zootaxa, 3722(2): 143–169 in Kweichow province, including a herpetofauna analysis. Acta Zool Mahony S., Nicole M. F., Biju S.D., Teeling E. C. 2017. Evolutionary history Sinica, 19(2): 149–171 (In Chinese) of the Asian Horned Frogs (Megophryinae): integrative approaches to Huang Y. Z., Fei L. 1981. Two new species of amphibians from Xizang. timetree dating in the absence of a fossil record. Mol Biol Evol, 34(3): Acta Zootaxonomica Sin, 6: 211–215 744–771 Inger R. F. 1989. Four new species of frogs from Borneo. Malayan Nat J, Mahony S., Kamei R. G., Teeling E.C., Biju S. D. 2018. Cryptic diversity Kuala Lumpur, 42: 229–243 within the Megophr ys major species group (Amphibia: Megophryidae) Inger R. F., Romer J. D. 1961. A new pelobatid frog of the genus Megophr ys of the Asian Horned Frogs: Phylogenetic perspectives and a taxonomic from Hong Kong. Fieldia na Zool, 39(46): 533–538 revision of South Asian taxa, with descriptions of four new species. Inger R. F., Stuebing R. B., Lian T. F. 1995. New species and new records of Zootaxa, 4523: 1–96 Anura ns f rom Boreno. R a f f Bull Zool, 43(1): 115–131 Malkmus R., Matsui M. 1997. Megophr ys kobayashii, ein neuer pelobatider Inger R. F., Iskandar D. T. 2005. A collection of amphibians from west Frosch vom Mount Kinabalu. Sauria. Berlin, 19: 31–37 Sumatra, with description of a new species of Megophr ys (Amphibia: Mathew R., Sen N. 2007. Description of two new species of Megophr ys Anura). Ra ffles B Zool, 133–142 (Amphibia: Anura: Megophryidae) from North-east India. Cobra, 1: Jiang J. P, Ye C. Y., Fei L. 2008. A New Horn Toad Megophrys sangzhiensis 18–28 from Hunan, China (Amphibia, Anura). Zool Res 29(2): 219–222 (In McGuire J. A., Witt C. C., Altshule D. L., Remsen J. V. 2007. Phylogenetic Jing LIU et al. A New Species of Megophrys

No. 1 17

systematics and biogeography of hummingbirds: Bayesian and Stejneger L. 1926. Two new tailless amphibians from western China. Proc maximum likelihood analyses of partitioned data and selection of an Biol Soc Wash, 39: 53–54 appropriate partitioning strategy. Syst Biol, 56: 837–856 Stuart B. L., Chuaynkern Y., Chan-ard T., Inger R. F. 2006. Three new Messenger K. R., Dahn H. A., Liang Y. R., Xie P., Wang Y., Lu C. H. 2019. A species of frogs and a new tadpole from eastern Thailand. Fieldiana new species of the genus Megophr ys Gunther, 1864 (Amphibia: Anura: Z o o l , 111: 1–19 Megophryidae) from Mount Wuyi, China. Zootaxa, 4554 (2): 561–583 Tamura K, Stecher G, Peterson D, Fiipski A, Kumar S. 2011. MEGA6: Mo M. Y., Shen Y. H., Li H. H., Wu M. S. 2010. A new species of Megophr ys molecular evolutionary genetics analysis using evolutionary distance. (Amphibia: Anura: Megophryidae) from the northwestern Hunan Mol Biol Evol, 28: 2725–2729 Province, China. Curr Zool, 56(4): 432–436 Tapley B., Cutajar T., Mahony S., Nguyen C. T., Dau V. Q., Nguyen T. Munir M., Hamidy A., Farajallah A., Smith E. N. 2018. A new Megophr ys T., Luong H. V., Rowley J. J. L. 2017. The Vietnamese population of Kuhl and Van Hasselt (Amphibia: Megophryidae) from southwestern Megophrys kuatunensis (Amphibia: Megophryidae) represents a new Sumatra, Indonesia. Zootaxa, 4442: 389–412 species of Asian horned frog from Vietnam and southern China. Ohler A., Swan S. R., Daltry J. C. 2002. A recent survey of the amphibian Zootaxa, 4344(3): 465–492 fauna of the Cardamom Mountains, Southwest Cambodia with Tapley B., Cutajar T. P., Mahony S., Nguyen C. T., Dau V. Q., Luong A. M., descriptions of three new species. Raffles B Zool, 50(2): 465–481 Le D. T., Nguyen T. T., Nguyen T. Q., Portway C., Luong H. V., Rowley Ohler A. 2003. Revision of the genus Ophr yophr yne Boulenger, 1903 J. J. L. 2018. Two new and potentially highly threatened Megophrys (Megophryidae) with description of two new species. Alytes, 23–44 Horned frogs (Amphibia: Megophryidae) from Indochina’s highest Orlov N. L., Pyarkov Jr N. A., Nguyen T. T. 2015. Taxonomic notes on mountains. Zootaxa, 4508: 301–333 Megophr ys frogs (Megophryidae, Anura) of Vietnam, with description Taylor E. H. 1920. Philippine Amphibia. Philipp J Sci, 16: 213–359 of a new species. Russian Herpetol, 22: 206–218 Tian Y. Z., Gu M. M., Sun A. Q. 2000. A new species of Megophr ys in Pope C. H. 1929. Four new frogs from Fukien Province, China. Amer Mus China (Amphibia: Pelobatidae). Acta Zootaxonomica Sin, 25: 462–466 Nov , 352: 1–5 (In Chinese) Poyarkov N. A., Duong Jr., T. V., Orlov N. L., Gogoleva S. I., Vassilieva Tian W. S., Hu Q. X. 1983. Taxonomic study on genus Megophr ys, with A. B., Nguyen L. T., Nguyen V. D. H., Nguyen S. N., Che J., Mahony descriptions of two genera. Acta Herpetol Sinica, 2: 41–48 (In Chinese). S. 2017. Molecular, morphological and acoustic assessment of the Vieites D. R., Min M. S., Wake, D. B. 2007. Rapid diversification and genus Ophr yophr yne (Anura, Megophryidae) from Langbian Plateau, dispersal during periods of global warming by plethodontid southern Vietnam, with description of a new species. ZooKeys, 672: salamanders. Proc Natl Acad Sci USA, 104: 19903–19907 49–120 Wang J., Liu Z. Y., Lyu Z. T., Wang Y. Y. 2017a. A new species of the genus Rao D. Q., Yang D. T. 1997. The karyotypes of Megophryinae (Pelobatidae) Megophr ys (Amphibia: Anura: Megophryidae) from an offshore island with a discussion on their classification and phylogenetic relationships. in Guangdong Province, southeastern China. Zootaxa, 4324(3): 541–556 Asian Herpetol Res, 7: 93–102 Wang Y. E., Liu B.Q., Jiang K., Jin,W., Xu J. N., Wu C. H. 2017b. A new Robert L., Brett C., Simon Y. W. H., Stephane G. 2012. PartitionFinder: species of the Horn Toad of the genus Xenophr ys from Zhejiang, China Combined Selection of Partitioning Schemes and Substitution Models (Amphibia: Megophryidae). Chin J Zool, 52: 19–29 (In Chinese) for Phylogenetic Analyses. Mol Phylogenet Evol, 29(6): 1695–1701 Wang Y. Y., Zhang T. D., Zhao J., Sung Y. H., Yang J. H., Pang H., Zhang Ronquist F. R., Huelsenbeck J. P. 2003. MrBayes3: Bayesian phylogenetic Z. 2012. Description of a new species of the genus Megophr ys Guenther, inference under mixed models. Bioinformatics, 19(12): 1572–1574 1864 (Amphibia: Anura: Megophryidae) from Mount Jinggang, China, Sambrook J., Fritsch E. F., Maniatis T. 1989. Molecular Cloning: A based on molecular and morphological data. Zootaxa, 3546: 53–67 Laboratory Manual. New York, America: Cold Spring Harbor Wang Y. Y., Zhao J., Yang J. H., Zhou Z. M., Chen G. L., Liu Y. 2014. Laboratory Press Morphology, molecular genetics, and bioacoustics support two new Schlegel H. 1858. Handleiding tot de Beoefening der Dierkunde. Volume 2. sympatric Megophr ys (Amphibia: Anura Megophryidae) species in Breda: Koninklijke Militaire Akademie Southeast China. Plos ONE, 9: e93075 Shen M. M., Liang D., Feng Y. J., Chen M. Y., Zhang P. 2013. A versatile and Wang J., Lyu Z. T., Liu Z. Y., Liao C. K., Zeng Z. C., Li Y. L., Wang Y. Y. highly efficient toolkit including 102 nuclear markers for Vertebrate 2019. Description of six new species of the subgenus Panophr ys within phylogenomics, tested by resolving the higher level relationships of the the genus Megophr ys (Anura, Megophryidae) from southeastern China Caudata. Mol Biol Evol, 30(10): 2235–2248 based on molecular and morphological data. ZooKeys, 851: 113–164 Shen Y. H. 1994. A new pelobatid toad of the genus Megophr ys from China Wu L., Dong Q., Xu R. H. 1986. Amphibians of Guizhou province. Guiyang, (Anura: Pelobatidae). Collection of Articles for the 60th Anniversary of China: Guizhou People Press (In Chinese) the Foundation of the Zoological Society of China, Nanking: Zool Soc, Yang J. H., Wang J., Wang Y. Y. 2018. A new species of the genus 603–606 (In Chinese) Megophr ys (Anura: Megophryidae) from Yunnan Province, China. Simon C., Frati F., Beckenbach A., Crespi B., Liu H. Flook P. 1994. Evolution, Zootaxa, 4413: 325–338 weighting and phylogenetic utility of mitochondrial gene sequences Ye C. Y., Fei L. 1992. A new Pelobatid toda of the genus Megophr ys from and a compilation of conserved polymerase chain reaction primers. Xizang, China. Acta Herpetol Sinica, 1–2: 50–52 (In Chinese) Ann Entomol SOC Amer, 87: 651–701 Ye C. Y., Fei L. 1995. Taxonomic studies on the small type Megophr ys Sjöander K., Beskow J. 2000. Wavesurfer (Anura: Pelobatidae). Collection in China including descriptions of the new species (subspecies) of Articles for the International Conference on Spoken Language (Pelobatidae: genus Megophr ys). Acta Herpetol Sinica, 4–5: 72–81 (In Processing, Beijing, China, 464–467 Chinese) Smith M.A. 1921. New or little-known reptiles and batrachians from Ye C. Y., Fei L., Xie F. 2007. A new species of Megophryidae Megophr ys southern Annam (Indo-China). Proc Zool Soc London, 423–440 baolongensis from China (Amphibia, Anura). Acta Herpetol Sinica, 11: Asian Herpetological Research 18 Vol. 11

38–41 Zhao J., Yang J. H., Chen G. L., Chen C. Q., Wang Y. Y. 2014. Description Zhang Y., Li G., Xiao N., Li J., Pan T., Wang H., Zhang B., Zhou J. 2017. A of a new species of the genus Brachytarsophrys Tian and Hu, 1983 new species of the genus Xenophr ys (Amphibia: Anura: Megophryicae) (Amphibia: Anura: Megophryidae) from Southern China based on from Libo County, Guizhou, China. Asian Herpetol Res, 8: 75–85 molecular and morphological data. Asian Herpetol Res, 5(3): 150–160

Handling Editor: Heling Zhao

How to cite this article: Liu J., Li S. Z., Wei G., Xu N., Cheng Y. L., Wang B., Wu J. A New Species of the Asian Toad Genus Megophrys sensu lato (Anura: Megophryidae) from Guizhou Province, China. Asian Herpetol Res, 2020, 11(1): 1–18. DOI: 10.16373/j.cnki.ahr.190041 Appendix

Table S1 Measurements of the adult specimens of Megophrys jiangi sp. nov. Unit: mm. See abbreviations for the morphological characters in Materials and Methods section.

Voucher Sex SVL HDL HDW SNT IND IOD ED TYD LAL LW FIL FIIL FIIIL FIVL THL TL TW TFL FL CIBFJS20150718005 female 39.5 10.8 14.1 5 5 3.2 4.5 2.6 18.2 3.6 3.8 4.3 6.2 4.6 17.3 18.4 5.1 26.2 18.1 CIBFJS20150719006 male 36.1 11.1 12.9 5 4.7 3.1 4.5 2.7 15.4 3.6 3.5 3.7 5.6 4.8 15.9 17.7 4.4 25.1 17.5 CIBFJS20150719007 male 34.8 10.2 11.7 4.3 4.5 2.9 4 2.3 15.1 3.1 3.1 3.2 5.3 3.8 16.6 17.1 4.3 23 16.2 CIBFJS20150719009 male 34.4 10.3 12 4.3 4.4 3 4.6 2.5 16.7 3 3 3.3 5.6 4.4 16.3 17.2 4 22.9 15.9 CIBFJS20150720003 male 38 10.4 13 4 4.2 2.5 4.3 2.2 16.3 3.6 3.6 3.7 5.9 3.9 16.7 17.6 4.4 24.7 16.1 CIBFJS20150720004 male 38.3 11.8 12.1 4.6 5 3.3 4.6 2.6 16.4 3.1 4.3 4.4 5 4.3 17 18.4 4.4 26.3 17.6 CIBKKS20180723003 female 40.4 11.4 13.5 4.6 4.8 3 4.7 2.7 18.2 3.1 3.7 4.1 6.7 4.6 17.7 20.4 4.8 27.8 18.8 CIBKKS20180722006 male 38.2 11.1 12.9 5.1 4.9 3.8 4.8 2.9 15.6 3.8 4 4.2 5.8 4.4 17.9 18.7 4.4 25.3 16.5 CIBKKS20180723001 male 38.1 10.6 13 4.1 4.6 2.7 4.6 2.8 17.5 3.6 4.2 4.2 6.5 4.4 18.6 20.2 4.7 26.7 18.5 CIBKKS20180723002 male 35.2 11.3 12.4 4.3 4.4 3 4.2 2.8 16 3.4 3.5 4.2 5.1 4.3 15.8 17.6 4.7 25.8 17.3 CIBKKS20180723007 male 39.2 11.2 13 5.1 4.7 3 4.6 3 14.7 3.6 3.4 3.5 5.4 4.3 17.6 18.1 4.5 24.9 17

Table S2 Primers used in this study.

Locus Primer name Sequence (5′–3′) Source P7 CGCCTGTTTACCAAAAACAT 16S rRNA Simon et al., 1994 P8 CCGGTCTGAACTCAGATCACGT Chmf4 TYTCWACWAAYCAYAAAGAYATCGG COI Che et al., 2012 Chmr4 ACYTCRGGRTGRCCRAARAATCA Rag1_1F GCMTTGCTSCCRGGGTATCA RAG1 Shen et al., 2013 Rag1_2R TCAATGGACGGAAGGGTTTCAATAA BDNF-F ACCATCCTTTTCCTKACTATGG BDNF Vieites et al., 2007 BDNF-R CTATCTTCCCCTTTTAATGGTC Table S3 Uncorrected p-distance between Megophrys sensu lato species based on COI gene sequences.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

Megophrys jiangi 1 sp. nov. 2 Megophrys minor 0.083

3 Megophrys spinata 0.141 0.136

Megophrys 4 0.129 0.130 0.038 sangzhiensis Megophrys 5 0.121 0.120 0.077 0.068 binlingensis Megophrys 6 0.125 0.116 0.093 0.086 0.070 binchuanensis Megophrys 7 0.132 0.116 0.113 0.111 0.096 0.102 palpebralespinosa Megophrys 8 0.151 0.122 0.116 0.116 0.101 0.095 0.109 jingdongensis Megophrys 9 0.146 0.111 0.118 0.109 0.088 0.096 0.120 0.099 daweimontis Megophrys 10 0.145 0.114 0.107 0.100 0.093 0.080 0.116 0.097 0.102 wuliangshanensis Megophrys 11 0.138 0.120 0.109 0.100 0.082 0.088 0.123 0.122 0.111 0.105 omeimontis Megophrys 12 0.173 0.159 0.177 0.170 0.154 0.154 0.179 0.155 0.182 0.157 0.164 nankunensis Megophrys 13 0.168 0.152 0.163 0.159 0.141 0.150 0.152 0.147 0.171 0.150 0.170 0.071 dongguanensis Megophrys 14 0.150 0.136 0.141 0.145 0.136 0.143 0.163 0.139 0.148 0.134 0.155 0.100 0.111 wugongensis

15 M.nanlingensis 0.152 0.132 0.157 0.146 0.134 0.145 0.159 0.137 0.154 0.141 0.159 0.102 0.107 0.084

Megophrys 16 0.150 0.136 0.157 0.152 0.143 0.145 0.166 0.135 0.150 0.145 0.145 0.114 0.111 0.105 0.089 jinggangensis Megophrys 17 0.134 0.113 0.138 0.129 0.111 0.116 0.132 0.111 0.121 0.111 0.129 0.107 0.113 0.088 0.089 0.086 wushanensis Megophrys 18 0.146 0.120 0.155 0.150 0.127 0.136 0.150 0.143 0.145 0.139 0.139 0.114 0.123 0.121 0.113 0.125 0.063 baolongensis Megophrys 19 0.143 0.129 0.143 0.134 0.114 0.136 0.152 0.126 0.143 0.127 0.129 0.130 0.134 0.105 0.107 0.120 0.070 0.089 tuberogranulata Megophrys 20 0.138 0.129 0.157 0.139 0.125 0.138 0.145 0.139 0.148 0.132 0.127 0.134 0.134 0.118 0.111 0.113 0.070 0.093 0.095 leishanensis Megophrys 21 0.145 0.127 0.161 0.150 0.136 0.143 0.154 0.145 0.146 0.129 0.150 0.134 0.138 0.116 0.121 0.120 0.080 0.098 0.104 0.105 jiulianensis Megophrys 22 0.145 0.123 0.150 0.130 0.121 0.129 0.154 0.135 0.138 0.127 0.152 0.127 0.116 0.111 0.096 0.105 0.089 0.113 0.098 0.102 0.093 huangshanensis

23 Megophrys boettgeri 0.146 0.121 0.157 0.134 0.125 0.129 0.150 0.135 0.138 0.125 0.152 0.132 0.120 0.116 0.104 0.107 0.088 0.111 0.100 0.104 0.089 0.018

Megophrys 24 0.161 0.120 0.163 0.154 0.134 0.143 0.145 0.145 0.138 0.130 0.152 0.134 0.123 0.118 0.111 0.113 0.100 0.104 0.111 0.113 0.114 0.098 0.091 mufumontana Megophrys 25 0.146 0.132 0.164 0.168 0.146 0.159 0.161 0.151 0.159 0.157 0.182 0.136 0.132 0.118 0.123 0.134 0.132 0.148 0.129 0.150 0.146 0.136 0.138 0.130 brachykolos

26 Megophrys gerti 0.189 0.180 0.182 0.184 0.186 0.186 0.193 0.177 0.198 0.193 0.195 0.205 0.213 0.204 0.198 0.198 0.184 0.189 0.195 0.188 0.193 0.182 0.188 0.195 0.214

27 Megophrys hansi 0.193 0.182 0.196 0.188 0.188 0.196 0.196 0.176 0.191 0.202 0.204 0.198 0.189 0.188 0.196 0.184 0.170 0.195 0.186 0.180 0.191 0.180 0.179 0.182 0.195 0.175

Megophrys 28 0.155 0.164 0.191 0.179 0.168 0.171 0.180 0.172 0.180 0.177 0.186 0.193 0.193 0.184 0.191 0.198 0.182 0.179 0.188 0.179 0.189 0.182 0.191 0.175 0.182 0.189 0.143 microstoma Megophrys 29 0.157 0.150 0.179 0.184 0.161 0.163 0.166 0.145 0.180 0.157 0.161 0.161 0.170 0.155 0.161 0.163 0.146 0.161 0.154 0.155 0.168 0.166 0.170 0.168 0.163 0.205 0.200 0.163 pachyproctus

30 Megophrys stejnegeri 0.186 0.189 0.196 0.195 0.191 0.198 0.225 0.193 0.193 0.198 0.191 0.196 0.205 0.189 0.184 0.188 0.179 0.207 0.193 0.189 0.191 0.196 0.193 0.195 0.207 0.209 0.200 0.207 0.200

31 Megophrys ligayae 0.182 0.193 0.209 0.204 0.193 0.195 0.216 0.198 0.198 0.195 0.198 0.211 0.220 0.207 0.216 0.209 0.198 0.209 0.205 0.195 0.196 0.195 0.193 0.200 0.214 0.220 0.191 0.193 0.213 0.170 Continued Table S3

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

32 Megophrys nasuta 0.189 0.205 0.204 0.202 0.193 0.186 0.213 0.198 0.195 0.196 0.196 0.227 0.229 0.216 0.207 0.193 0.202 0.213 0.214 0.198 0.205 0.220 0.218 0.205 0.223 0.218 0.207 0.180 0.191 0.171 0.180

Megophrys 33 0.173 0.193 0.202 0.191 0.193 0.180 0.202 0.193 0.193 0.182 0.200 0.207 0.207 0.195 0.205 0.200 0.196 0.196 0.196 0.205 0.196 0.200 0.191 0.196 0.191 0.221 0.198 0.200 0.198 0.164 0.152 0.177 edwardinae

34 Megophrys periosa 0.168 0.170 0.179 0.168 0.164 0.168 0.182 0.172 0.168 0.166 0.164 0.170 0.173 0.166 0.180 0.173 0.171 0.175 0.159 0.141 0.157 0.168 0.170 0.170 0.182 0.202 0.198 0.161 0.173 0.209 0.204 0.209 0.218

35 Megophrys zhangi 0.171 0.171 0.184 0.180 0.164 0.168 0.182 0.172 0.177 0.177 0.159 0.180 0.186 0.177 0.188 0.179 0.177 0.163 0.157 0.155 0.166 0.173 0.171 0.171 0.188 0.214 0.207 0.159 0.173 0.196 0.200 0.189 0.200 0.088

Megophrys 36 0.175 0.155 0.171 0.175 0.157 0.163 0.175 0.160 0.155 0.157 0.173 0.186 0.184 0.177 0.166 0.182 0.180 0.173 0.159 0.168 0.171 0.163 0.168 0.154 0.182 0.193 0.214 0.171 0.171 0.195 0.229 0.202 0.214 0.096 0.096 glandulosa Megophrys 37 0.162 0.152 0.177 0.177 0.177 0.164 0.171 0.160 0.159 0.161 0.177 0.184 0.181 0.171 0.168 0.184 0.175 0.177 0.162 0.161 0.170 0.168 0.166 0.164 0.177 0.200 0.200 0.166 0.164 0.213 0.215 0.186 0.206 0.101 0.108 0.094 medogensis

38 Megophrys cf. major 0.198 0.175 0.214 0.202 0.177 0.180 0.189 0.155 0.171 0.177 0.175 0.180 0.193 0.195 0.189 0.193 0.182 0.175 0.163 0.170 0.186 0.186 0.188 0.170 0.179 0.220 0.211 0.170 0.173 0.214 0.223 0.198 0.227 0.113 0.118 0.113 0.114

Megophrys 39 0.171 0.170 0.179 0.175 0.155 0.163 0.184 0.158 0.157 0.157 0.173 0.195 0.191 0.171 0.175 0.179 0.168 0.177 0.163 0.150 0.180 0.168 0.173 0.166 0.179 0.182 0.177 0.145 0.171 0.196 0.193 0.186 0.213 0.095 0.107 0.102 0.110 0.109 flavipunctata Megophrys 40 0.164 0.152 0.180 0.180 0.179 0.161 0.173 0.168 0.173 0.164 0.164 0.171 0.170 0.170 0.166 0.171 0.168 0.180 0.168 0.155 0.188 0.175 0.173 0.157 0.186 0.200 0.198 0.161 0.155 0.196 0.211 0.184 0.198 0.111 0.113 0.116 0.105 0.120 0.104 maosonensis Megophrys 41 0.170 0.161 0.182 0.179 0.170 0.166 0.184 0.162 0.166 0.168 0.157 0.180 0.179 0.184 0.168 0.179 0.171 0.175 0.161 0.168 0.188 0.179 0.175 0.170 0.193 0.207 0.211 0.177 0.163 0.200 0.213 0.188 0.205 0.098 0.107 0.111 0.096 0.114 0.098 0.043 mangshanensis

42 Megophrys cf. parva 0.179 0.170 0.193 0.182 0.170 0.170 0.177 0.158 0.155 0.179 0.170 0.173 0.177 0.161 0.171 0.182 0.164 0.182 0.171 0.168 0.180 0.179 0.171 0.168 0.180 0.200 0.189 0.163 0.170 0.200 0.198 0.196 0.220 0.136 0.143 0.130 0.132 0.141 0.121 0.127 0.123

Megophrys 43 0.144 0.139 0.186 0.178 0.157 0.168 0.164 0.158 0.171 0.168 0.164 0.171 0.173 0.155 0.171 0.157 0.144 0.155 0.148 0.150 0.162 0.166 0.160 0.150 0.184 0.178 0.184 0.159 0.175 0.191 0.193 0.182 0.198 0.148 0.139 0.164 0.151 0.164 0.142 0.132 0.144 0.150 shapingensis

44 Megophrys gigantica 0.171 0.161 0.186 0.182 0.152 0.168 0.171 0.153 0.175 0.175 0.170 0.173 0.171 0.168 0.177 0.166 0.157 0.179 0.163 0.177 0.164 0.179 0.173 0.168 0.195 0.184 0.182 0.173 0.188 0.207 0.196 0.195 0.202 0.159 0.171 0.175 0.162 0.170 0.152 0.150 0.152 0.154 0.067

Megophrys 45 0.152 0.148 0.180 0.175 0.161 0.159 0.168 0.153 0.179 0.163 0.159 0.171 0.173 0.163 0.164 0.150 0.139 0.159 0.150 0.152 0.161 0.170 0.164 0.159 0.171 0.188 0.166 0.155 0.159 0.195 0.191 0.186 0.182 0.146 0.146 0.171 0.150 0.159 0.141 0.139 0.143 0.132 0.074 0.091 wawuensis

46 Megophrys carinense 0.177 0.184 0.198 0.198 0.193 0.202 0.205 0.197 0.202 0.200 0.195 0.184 0.179 0.182 0.189 0.186 0.184 0.198 0.200 0.182 0.173 0.196 0.196 0.189 0.179 0.211 0.200 0.173 0.188 0.184 0.207 0.202 0.195 0.171 0.168 0.188 0.173 0.180 0.171 0.182 0.184 0.182 0.175 0.175 0.155

47 Megophrys feae 0.193 0.184 0.191 0.189 0.189 0.195 0.207 0.189 0.186 0.198 0.195 0.175 0.175 0.180 0.177 0.177 0.171 0.195 0.184 0.189 0.171 0.177 0.175 0.179 0.193 0.214 0.202 0.193 0.186 0.179 0.205 0.193 0.196 0.173 0.168 0.168 0.153 0.180 0.170 0.173 0.180 0.179 0.166 0.164 0.154 0.091

48 Megophrys montana 0.213 0.211 0.214 0.205 0.200 0.225 0.207 0.202 0.204 0.223 0.211 0.221 0.214 0.220 0.221 0.220 0.225 0.227 0.216 0.220 0.216 0.220 0.218 0.214 0.209 0.221 0.213 0.209 0.218 0.202 0.213 0.229 0.198 0.198 0.205 0.205 0.208 0.204 0.193 0.211 0.205 0.188 0.216 0.207 0.211 0.188 0.202

49 Megophrys aceras 0.194 0.173 0.211 0.209 0.195 0.184 0.207 0.183 0.195 0.188 0.184 0.175 0.186 0.177 0.156 0.180 0.173 0.177 0.177 0.177 0.190 0.190 0.190 0.175 0.199 0.188 0.179 0.169 0.162 0.175 0.211 0.182 0.188 0.197 0.201 0.197 0.186 0.197 0.192 0.179 0.179 0.179 0.169 0.175 0.164 0.180 0.186 0.207 Table S4 Uncorrected p-distance between Megophrys sensu lato species based on 16S gene sequences.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72

Megophrys jiangi 1 sp. nov.

2 Megophrys minor 0.073

3 Megophrys spinata 0.105 0.060

Megophrys 4 0.109 0.068 0.017 sangzhiensis Megophrys 5 0.096 0.058 0.011 0.017 binlingensis Megophrys 6 0.094 0.058 0.033 0.037 0.025 binchuanensis Megophrys 7 0.105 0.062 0.045 0.055 0.041 0.037 palpebralespinosa Megophrys 8 0.098 0.062 0.033 0.039 0.025 0.031 0.045 jingdongensis Megophrys 9 0.092 0.054 0.031 0.033 0.027 0.029 0.041 0.025 daweimontis Megophrys 10 0.091 0.055 0.039 0.045 0.035 0.033 0.047 0.029 0.027 wuliangshanensis Megophrys 11 0.096 0.054 0.025 0.035 0.021 0.025 0.037 0.021 0.023 0.029 omeimontis Megophrys 12 0.094 0.058 0.041 0.043 0.041 0.047 0.062 0.041 0.048 0.047 0.031 fansipanensis Megophrys 13 0.087 0.054 0.031 0.037 0.027 0.033 0.051 0.041 0.037 0.045 0.025 0.025 hoanglienensis Megophrys 14 0.094 0.070 0.053 0.055 0.049 0.055 0.062 0.053 0.045 0.051 0.043 0.054 0.051 nankunensis Megophrys 15 0.100 0.068 0.056 0.058 0.053 0.055 0.070 0.064 0.047 0.060 0.049 0.060 0.051 0.025 dongguanensis

16 Megophrys cheni 0.113 0.074 0.052 0.052 0.049 0.049 0.068 0.051 0.046 0.054 0.043 0.057 0.052 0.023 0.033

Megophrys 17 0.096 0.077 0.064 0.066 0.064 0.062 0.070 0.064 0.055 0.060 0.053 0.058 0.058 0.047 0.049 0.038 ombrophila

18 Megophrys obesa 0.135 0.097 0.078 0.081 0.081 0.081 0.099 0.071 0.060 0.068 0.063 0.078 0.078 0.048 0.051 0.031 0.039

Megophrys 19 0.092 0.056 0.041 0.047 0.045 0.047 0.066 0.045 0.041 0.049 0.041 0.043 0.041 0.043 0.045 0.033 0.051 0.057 wugongensis

20 Megophrys lini 0.096 0.066 0.047 0.058 0.054 0.051 0.051 0.051 0.045 0.056 0.043 0.056 0.056 0.043 0.043 0.038 0.056 0.051 0.047

Megophrys 21 0.101 0.066 0.053 0.060 0.055 0.062 0.066 0.066 0.058 0.066 0.051 0.060 0.058 0.053 0.053 0.049 0.066 0.068 0.049 0.039 nanlingensis Megophrys 22 0.125 0.073 0.065 0.065 0.057 0.057 0.076 0.065 0.054 0.054 0.051 0.060 0.054 0.035 0.035 0.028 0.057 0.045 0.057 0.041 0.059 kuatunensis Megophrys 23 0.072 0.052 0.047 0.054 0.043 0.045 0.055 0.051 0.043 0.049 0.039 0.054 0.039 0.045 0.051 0.038 0.049 0.063 0.039 0.039 0.047 0.051 jinggangensis Megophrys 24 0.090 0.065 0.045 0.047 0.039 0.041 0.051 0.045 0.037 0.041 0.033 0.039 0.037 0.037 0.041 0.038 0.045 0.060 0.041 0.048 0.056 0.041 0.035 wushanensis Megophrys 25 0.085 0.064 0.043 0.045 0.037 0.045 0.051 0.043 0.041 0.045 0.041 0.041 0.039 0.031 0.041 0.033 0.051 0.068 0.043 0.049 0.058 0.041 0.039 0.021 baolongensis Megophrys 26 0.085 0.052 0.033 0.035 0.027 0.035 0.047 0.033 0.033 0.035 0.033 0.039 0.033 0.031 0.039 0.023 0.043 0.051 0.033 0.039 0.047 0.030 0.027 0.015 0.015 tuberogranulata Megophrys 27 0.077 0.056 0.037 0.043 0.035 0.037 0.045 0.039 0.037 0.039 0.033 0.039 0.037 0.039 0.047 0.033 0.043 0.057 0.037 0.039 0.047 0.041 0.031 0.023 0.023 0.015 leishanensis Megophrys 28 0.092 0.064 0.045 0.051 0.043 0.051 0.064 0.053 0.049 0.047 0.041 0.039 0.033 0.043 0.047 0.044 0.056 0.069 0.035 0.048 0.056 0.046 0.039 0.031 0.029 0.023 0.023 jiulianensis Megophrys 29 0.090 0.054 0.039 0.049 0.041 0.045 0.053 0.047 0.037 0.045 0.039 0.048 0.041 0.043 0.047 0.038 0.049 0.054 0.039 0.039 0.052 0.041 0.035 0.031 0.031 0.019 0.019 0.027 huangshanensis

30 Megophrys boettgeri 0.081 0.047 0.039 0.045 0.037 0.041 0.053 0.043 0.035 0.041 0.035 0.043 0.037 0.039 0.043 0.033 0.047 0.051 0.037 0.035 0.047 0.035 0.027 0.027 0.027 0.015 0.015 0.023 0.008

Megophrys 31 0.083 0.058 0.049 0.053 0.043 0.047 0.062 0.049 0.045 0.047 0.041 0.047 0.041 0.045 0.054 0.046 0.058 0.078 0.051 0.052 0.058 0.046 0.039 0.033 0.033 0.025 0.029 0.033 0.031 0.025 mufumontana

32 Megophrys acuta 0.139 0.104 0.097 0.100 0.094 0.087 0.093 0.097 0.081 0.103 0.094 0.107 0.085 0.097 0.087 0.085 0.106 0.094 0.097 0.075 0.088 0.087 0.075 0.088 0.078 0.075 0.075 0.088 0.075 0.075 0.093

Megophrys 33 0.107 0.075 0.073 0.079 0.070 0.060 0.070 0.070 0.068 0.068 0.060 0.062 0.064 0.058 0.062 0.062 0.066 0.078 0.066 0.039 0.060 0.057 0.054 0.054 0.053 0.049 0.052 0.054 0.056 0.052 0.062 0.081 brachykolos

34 Megophrys gerti 0.147 0.133 0.130 0.130 0.128 0.123 0.119 0.128 0.121 0.126 0.112 0.116 0.112 0.128 0.123 0.137 0.128 0.146 0.116 0.130 0.121 0.149 0.119 0.122 0.125 0.121 0.121 0.123 0.124 0.121 0.121 0.170 0.123

35 Megophrys elfina 0.143 0.121 0.123 0.119 0.112 0.114 0.112 0.105 0.110 0.114 0.108 0.114 0.114 0.121 0.117 0.131 0.119 0.135 0.116 0.126 0.123 0.140 0.117 0.110 0.114 0.105 0.114 0.121 0.121 0.114 0.114 0.167 0.117 0.035

36 Megophrys synoria 0.190 0.171 0.161 0.152 0.146 0.143 0.146 0.140 0.152 0.142 0.137 0.158 0.155 0.164 0.158 0.157 0.158 0.160 0.154 0.167 0.167 0.160 0.152 0.153 0.158 0.149 0.167 0.167 0.165 0.161 0.158 0.179 0.174 0.101 0.092

37 Megophrys hansi 0.135 0.126 0.116 0.109 0.114 0.109 0.120 0.107 0.112 0.116 0.105 0.102 0.107 0.125 0.127 0.130 0.122 0.141 0.113 0.120 0.141 0.139 0.123 0.114 0.109 0.107 0.113 0.123 0.120 0.116 0.118 0.158 0.122 0.096 0.090 0.111

Megophrys 38 0.144 0.116 0.113 0.113 0.109 0.120 0.107 0.113 0.111 0.113 0.107 0.111 0.115 0.122 0.127 0.121 0.125 0.134 0.120 0.116 0.118 0.130 0.111 0.116 0.113 0.106 0.113 0.120 0.113 0.109 0.111 0.172 0.120 0.103 0.096 0.134 0.063 microstoma Megophrys 39 0.148 0.110 0.096 0.101 0.096 0.098 0.098 0.101 0.098 0.101 0.094 0.108 0.101 0.112 0.110 0.128 0.107 0.150 0.089 0.107 0.108 0.140 0.099 0.097 0.099 0.090 0.103 0.096 0.101 0.099 0.094 0.175 0.126 0.152 0.150 0.162 0.144 0.144 pachyproctus

40 Megophrys baluensis 0.171 0.157 0.132 0.142 0.129 0.136 0.136 0.134 0.139 0.129 0.137 0.150 0.139 0.147 0.147 0.159 0.165 0.188 0.147 0.137 0.139 0.159 0.142 0.135 0.137 0.132 0.142 0.132 0.142 0.142 0.137 0.174 0.142 0.175 0.173 0.204 0.185 0.156 0.150 Continued Table S4

41 Megophrys stejnegeri 0.159 0.154 0.130 0.137 0.135 0.137 0.137 0.130 0.125 0.123 0.132 0.140 0.142 0.154 0.152 0.153 0.149 0.174 0.142 0.137 0.140 0.159 0.142 0.145 0.150 0.140 0.145 0.145 0.147 0.147 0.145 0.191 0.145 0.164 0.157 0.206 0.168 0.151 0.166 0.083

42 Megophrys ligayae 0.162 0.147 0.129 0.141 0.129 0.139 0.141 0.132 0.136 0.139 0.132 0.137 0.137 0.156 0.158 0.184 0.166 0.198 0.141 0.149 0.146 0.187 0.147 0.140 0.142 0.135 0.142 0.139 0.142 0.142 0.139 0.209 0.146 0.157 0.147 0.187 0.154 0.132 0.131 0.072 0.105

Megophrys 43 0.164 0.136 0.131 0.136 0.131 0.136 0.119 0.128 0.119 0.138 0.121 0.141 0.129 0.129 0.133 0.138 0.141 0.153 0.139 0.119 0.129 0.135 0.127 0.129 0.129 0.127 0.136 0.134 0.134 0.129 0.129 0.153 0.131 0.147 0.143 0.181 0.170 0.141 0.150 0.077 0.096 0.089 kobayashii

44 Megophrys nasuta 0.174 0.147 0.147 0.166 0.152 0.159 0.130 0.149 0.147 0.154 0.147 0.164 0.164 0.159 0.149 0.185 0.159 0.203 0.154 0.140 0.147 0.185 0.149 0.155 0.155 0.152 0.149 0.152 0.152 0.152 0.157 0.191 0.151 0.173 0.158 0.212 0.189 0.159 0.153 0.083 0.093 0.095 0.078

Megophrys 45 0.180 0.147 0.132 0.144 0.134 0.139 0.144 0.134 0.139 0.141 0.132 0.142 0.137 0.144 0.156 0.188 0.171 0.210 0.144 0.142 0.144 0.177 0.147 0.135 0.140 0.133 0.137 0.130 0.137 0.137 0.128 0.210 0.151 0.180 0.173 0.214 0.172 0.156 0.122 0.081 0.103 0.071 0.093 0.097 edwardinae

46 Megophrys dringi 0.137 0.117 0.107 0.124 0.112 0.116 0.112 0.105 0.107 0.116 0.095 0.103 0.112 0.124 0.119 0.134 0.119 0.128 0.117 0.103 0.117 0.127 0.117 0.103 0.108 0.105 0.108 0.115 0.103 0.103 0.103 0.159 0.110 0.158 0.149 0.167 0.153 0.145 0.128 0.123 0.134 0.117 0.119 0.132 0.120

Megophrys cf. 47 0.156 0.118 0.112 0.127 0.117 0.120 0.127 0.117 0.110 0.118 0.113 0.125 0.118 0.123 0.130 0.132 0.128 0.144 0.105 0.113 0.110 0.123 0.120 0.116 0.110 0.105 0.110 0.115 0.110 0.108 0.116 0.168 0.128 0.188 0.174 0.192 0.175 0.169 0.144 0.160 0.179 0.168 0.142 0.147 0.155 0.111 periosa

48 Megophrys periosa 0.151 0.108 0.103 0.118 0.108 0.110 0.125 0.107 0.105 0.108 0.103 0.116 0.108 0.120 0.120 0.121 0.118 0.131 0.103 0.103 0.098 0.112 0.111 0.106 0.106 0.096 0.101 0.111 0.101 0.098 0.108 0.158 0.123 0.185 0.171 0.192 0.167 0.161 0.150 0.163 0.171 0.171 0.145 0.155 0.163 0.111 0.019

Megophrys 49 0.136 0.096 0.098 0.113 0.103 0.103 0.105 0.110 0.093 0.101 0.096 0.111 0.096 0.101 0.103 0.109 0.101 0.118 0.096 0.091 0.089 0.095 0.094 0.094 0.091 0.086 0.096 0.098 0.089 0.086 0.096 0.144 0.106 0.177 0.166 0.189 0.167 0.153 0.137 0.163 0.166 0.171 0.132 0.150 0.165 0.101 0.028 0.021 himalayana

50 Megophrys sanu 0.193 0.154 0.117 0.130 0.124 0.133 0.133 0.140 0.123 0.130 0.120 0.148 0.127 0.134 0.144 0.131 0.140 0.131 0.134 0.130 0.124 0.114 0.124 0.118 0.115 0.111 0.114 0.131 0.124 0.121 0.128 0.154 0.150 0.209 0.198 0.201 0.200 0.170 0.166 0.169 0.195 0.175 0.166 0.176 0.179 0.121 0.060 0.057 0.042

51 Megophrys zhangi 0.139 0.113 0.091 0.104 0.095 0.100 0.099 0.104 0.093 0.098 0.091 0.109 0.096 0.100 0.106 0.118 0.109 0.131 0.100 0.098 0.093 0.103 0.093 0.089 0.087 0.085 0.087 0.098 0.093 0.091 0.096 0.154 0.111 0.163 0.156 0.186 0.160 0.143 0.128 0.146 0.161 0.137 0.146 0.137 0.144 0.100 0.048 0.046 0.037 0.000

Megophrys 52 0.177 0.163 0.136 0.149 0.136 0.152 0.149 0.149 0.126 0.136 0.136 0.164 0.146 0.157 0.160 0.153 0.157 0.147 0.153 0.150 0.143 0.136 0.143 0.144 0.137 0.133 0.136 0.147 0.140 0.136 0.140 0.171 0.164 0.208 0.201 0.212 0.203 0.174 0.183 0.182 0.176 0.196 0.166 0.173 0.193 0.128 0.074 0.074 0.065 0.048 0.048 katabhako Megophrys 53 0.143 0.113 0.093 0.106 0.102 0.101 0.106 0.104 0.097 0.102 0.097 0.113 0.102 0.115 0.111 0.123 0.111 0.140 0.102 0.100 0.100 0.117 0.097 0.102 0.102 0.093 0.093 0.104 0.093 0.093 0.104 0.158 0.124 0.166 0.171 0.199 0.167 0.152 0.132 0.166 0.163 0.163 0.151 0.149 0.160 0.116 0.050 0.039 0.041 0.053 0.041 0.062 glandulosa Megophrys 54 0.141 0.111 0.099 0.111 0.097 0.102 0.115 0.104 0.099 0.102 0.093 0.109 0.102 0.106 0.106 0.115 0.106 0.134 0.093 0.098 0.091 0.106 0.095 0.091 0.098 0.089 0.093 0.102 0.093 0.091 0.100 0.175 0.111 0.168 0.161 0.202 0.165 0.152 0.130 0.148 0.152 0.156 0.143 0.137 0.151 0.112 0.052 0.041 0.045 0.060 0.045 0.077 0.047 medogensis

55 Megophrys cf. major 0.134 0.123 0.104 0.113 0.104 0.109 0.106 0.100 0.100 0.100 0.106 0.109 0.096 0.106 0.115 0.130 0.118 0.148 0.102 0.109 0.107 0.121 0.100 0.098 0.093 0.089 0.104 0.102 0.100 0.100 0.100 0.168 0.118 0.164 0.159 0.189 0.150 0.138 0.126 0.141 0.152 0.146 0.161 0.152 0.146 0.114 0.054 0.059 0.050 0.072 0.054 0.081 0.052 0.056

Megophrys 56 0.167 0.130 0.117 0.132 0.122 0.122 0.127 0.122 0.115 0.117 0.120 0.138 0.125 0.132 0.137 0.144 0.135 0.161 0.125 0.118 0.118 0.129 0.113 0.123 0.120 0.115 0.120 0.128 0.118 0.115 0.125 0.168 0.135 0.208 0.205 0.214 0.200 0.172 0.160 0.163 0.188 0.190 0.161 0.169 0.184 0.123 0.054 0.056 0.045 0.068 0.057 0.086 0.054 0.059 0.057 flavipunctata Megophrys 57 0.149 0.130 0.103 0.112 0.107 0.116 0.121 0.103 0.100 0.100 0.107 0.110 0.110 0.114 0.128 0.147 0.121 0.157 0.108 0.121 0.119 0.134 0.114 0.103 0.103 0.101 0.110 0.107 0.107 0.105 0.112 0.177 0.128 0.170 0.170 0.174 0.149 0.146 0.147 0.154 0.155 0.152 0.173 0.165 0.152 0.120 0.055 0.064 0.057 0.072 0.054 0.084 0.062 0.069 0.043 0.066 maosonensis Megophrys 58 0.147 0.128 0.096 0.107 0.100 0.114 0.123 0.103 0.107 0.107 0.109 0.114 0.107 0.119 0.128 0.140 0.126 0.156 0.105 0.119 0.112 0.128 0.112 0.105 0.105 0.098 0.103 0.105 0.105 0.103 0.105 0.170 0.125 0.172 0.170 0.184 0.147 0.142 0.145 0.147 0.160 0.149 0.173 0.160 0.149 0.120 0.062 0.066 0.066 0.075 0.056 0.081 0.062 0.069 0.048 0.062 0.019 mangshanensis Megophrys 59 0.157 0.134 0.118 0.118 0.118 0.116 0.123 0.128 0.103 0.121 0.121 0.139 0.129 0.126 0.121 0.127 0.118 0.151 0.121 0.116 0.121 0.115 0.113 0.114 0.106 0.106 0.113 0.124 0.111 0.106 0.114 0.161 0.142 0.181 0.173 0.201 0.169 0.160 0.150 0.170 0.161 0.194 0.144 0.162 0.186 0.126 0.077 0.080 0.066 0.096 0.080 0.109 0.077 0.087 0.082 0.080 0.085 0.093 oreocrypta Megophrys 60 0.148 0.115 0.102 0.108 0.097 0.106 0.115 0.106 0.104 0.102 0.099 0.115 0.104 0.120 0.117 0.133 0.122 0.158 0.109 0.109 0.122 0.124 0.109 0.107 0.104 0.098 0.109 0.113 0.111 0.104 0.102 0.189 0.122 0.168 0.151 0.189 0.150 0.128 0.125 0.146 0.152 0.146 0.141 0.147 0.151 0.107 0.084 0.089 0.082 0.102 0.074 0.105 0.087 0.094 0.087 0.106 0.094 0.088 0.092 auralensis

61 Megophrys cf. parva 0.149 0.112 0.101 0.103 0.098 0.100 0.109 0.105 0.096 0.105 0.098 0.103 0.108 0.116 0.114 0.131 0.112 0.150 0.110 0.108 0.103 0.125 0.105 0.101 0.103 0.101 0.103 0.117 0.112 0.107 0.105 0.186 0.126 0.165 0.153 0.194 0.159 0.137 0.124 0.141 0.142 0.136 0.122 0.125 0.129 0.110 0.075 0.078 0.075 0.088 0.069 0.110 0.072 0.070 0.083 0.092 0.095 0.089 0.080 0.056

Megophrys 62 0.101 0.085 0.074 0.078 0.068 0.070 0.066 0.072 0.066 0.074 0.064 0.074 0.074 0.083 0.092 0.095 0.092 0.125 0.078 0.074 0.081 0.104 0.070 0.075 0.074 0.070 0.081 0.087 0.081 0.076 0.075 0.122 0.092 0.121 0.119 0.153 0.125 0.122 0.099 0.123 0.117 0.124 0.112 0.131 0.122 0.082 0.114 0.106 0.092 0.121 0.091 0.134 0.102 0.091 0.094 0.118 0.112 0.114 0.109 0.096 0.088 shapingensis

63 Megophrys gigantica 0.113 0.095 0.081 0.083 0.075 0.079 0.077 0.077 0.072 0.085 0.070 0.079 0.081 0.090 0.099 0.104 0.094 0.136 0.083 0.085 0.088 0.113 0.081 0.081 0.081 0.077 0.088 0.094 0.088 0.083 0.081 0.139 0.099 0.129 0.127 0.163 0.128 0.128 0.102 0.129 0.127 0.125 0.110 0.132 0.123 0.076 0.107 0.107 0.092 0.119 0.090 0.135 0.101 0.088 0.088 0.119 0.106 0.108 0.112 0.096 0.082 0.012

Megophrys 64 0.112 0.094 0.080 0.085 0.078 0.078 0.072 0.082 0.076 0.085 0.074 0.081 0.083 0.092 0.100 0.107 0.096 0.139 0.087 0.078 0.085 0.115 0.079 0.083 0.083 0.079 0.089 0.096 0.090 0.085 0.083 0.135 0.096 0.133 0.131 0.168 0.130 0.129 0.102 0.125 0.128 0.126 0.112 0.133 0.127 0.082 0.114 0.111 0.096 0.125 0.094 0.141 0.107 0.096 0.094 0.121 0.112 0.114 0.116 0.100 0.088 0.013 0.008 nankiangensis Megophrys 65 0.108 0.089 0.080 0.085 0.074 0.076 0.074 0.078 0.072 0.080 0.070 0.078 0.081 0.089 0.098 0.104 0.094 0.135 0.085 0.081 0.083 0.113 0.076 0.081 0.081 0.077 0.087 0.094 0.087 0.083 0.081 0.132 0.094 0.130 0.128 0.165 0.130 0.129 0.104 0.126 0.129 0.126 0.114 0.133 0.127 0.080 0.111 0.109 0.094 0.122 0.092 0.138 0.105 0.092 0.092 0.118 0.110 0.112 0.114 0.098 0.086 0.010 0.006 0.004 wawuensis

66 Megophrys carinense 0.125 0.094 0.093 0.093 0.089 0.091 0.089 0.076 0.082 0.097 0.076 0.089 0.093 0.098 0.102 0.112 0.102 0.138 0.091 0.096 0.098 0.121 0.094 0.092 0.096 0.087 0.098 0.107 0.100 0.096 0.087 0.158 0.102 0.132 0.121 0.146 0.130 0.143 0.112 0.139 0.135 0.123 0.117 0.133 0.128 0.091 0.113 0.113 0.103 0.137 0.102 0.153 0.102 0.100 0.113 0.133 0.114 0.119 0.136 0.111 0.094 0.064 0.062 0.070 0.066

67 Megophrys popei 0.168 0.121 0.121 0.118 0.115 0.115 0.118 0.100 0.109 0.129 0.100 0.115 0.121 0.130 0.130 0.115 0.133 0.141 0.121 0.124 0.127 0.121 0.124 0.122 0.127 0.115 0.130 0.143 0.134 0.127 0.109 0.162 0.133 0.162 0.150 0.147 0.151 0.167 0.134 0.147 0.140 0.149 0.120 0.150 0.156 0.098 0.127 0.127 0.118 0.134 0.121 0.150 0.127 0.124 0.139 0.148 0.137 0.140 0.148 0.129 0.119 0.082 0.079 0.090 0.085 0.010

68 Megophrys feae 0.121 0.096 0.102 0.097 0.097 0.095 0.097 0.080 0.082 0.097 0.082 0.091 0.098 0.104 0.109 0.118 0.109 0.134 0.095 0.093 0.094 0.127 0.096 0.100 0.109 0.098 0.109 0.116 0.107 0.102 0.091 0.168 0.102 0.135 0.130 0.152 0.134 0.138 0.112 0.142 0.130 0.130 0.123 0.152 0.135 0.093 0.120 0.118 0.106 0.154 0.116 0.160 0.115 0.109 0.116 0.133 0.121 0.125 0.141 0.124 0.105 0.057 0.056 0.064 0.060 0.031 0.041

Megophrys 69 0.146 0.112 0.124 0.121 0.118 0.112 0.127 0.118 0.112 0.135 0.106 0.118 0.118 0.136 0.142 0.112 0.136 0.144 0.112 0.121 0.118 0.124 0.113 0.134 0.142 0.121 0.136 0.143 0.134 0.127 0.118 0.172 0.136 0.162 0.159 0.157 0.151 0.154 0.137 0.159 0.155 0.142 0.135 0.169 0.156 0.116 0.133 0.136 0.127 0.157 0.142 0.167 0.138 0.136 0.145 0.161 0.159 0.156 0.154 0.150 0.125 0.073 0.071 0.081 0.076 0.049 0.049 0.036 chuannanensis Megophrys 70 0.114 0.098 0.102 0.111 0.098 0.100 0.100 0.091 0.085 0.093 0.085 0.100 0.102 0.100 0.116 0.127 0.115 0.137 0.096 0.102 0.102 0.130 0.091 0.096 0.102 0.096 0.104 0.105 0.100 0.096 0.094 0.161 0.109 0.135 0.126 0.146 0.134 0.133 0.118 0.144 0.144 0.141 0.133 0.155 0.132 0.100 0.125 0.133 0.113 0.147 0.111 0.146 0.126 0.111 0.115 0.138 0.109 0.116 0.144 0.131 0.116 0.064 0.064 0.070 0.066 0.068 0.090 0.066 0.084 intermedia

71 Megophrys lancip 0.187 0.153 0.143 0.155 0.148 0.140 0.129 0.145 0.146 0.135 0.148 0.151 0.153 0.166 0.168 0.182 0.179 0.215 0.141 0.145 0.161 0.188 0.153 0.156 0.163 0.151 0.151 0.151 0.151 0.153 0.154 0.237 0.163 0.180 0.177 0.197 0.190 0.176 0.157 0.182 0.166 0.178 0.172 0.172 0.183 0.161 0.173 0.176 0.171 0.212 0.158 0.227 0.160 0.165 0.161 0.181 0.164 0.164 0.180 0.140 0.162 0.156 0.165 0.163 0.163 0.156 0.178 0.158 0.188 0.150

72 Megophrys montana 0.144 0.130 0.112 0.123 0.116 0.128 0.119 0.116 0.112 0.121 0.116 0.133 0.126 0.135 0.130 0.165 0.151 0.188 0.119 0.130 0.135 0.172 0.124 0.135 0.124 0.126 0.126 0.133 0.126 0.123 0.124 0.192 0.149 0.157 0.158 0.178 0.157 0.166 0.129 0.187 0.178 0.172 0.158 0.163 0.183 0.148 0.150 0.163 0.153 0.191 0.135 0.184 0.137 0.144 0.139 0.163 0.150 0.146 0.157 0.135 0.133 0.123 0.129 0.135 0.132 0.132 0.165 0.132 0.175 0.127 0.142

73 Megophrys aceras 0.160 0.152 0.137 0.142 0.132 0.139 0.149 0.137 0.132 0.140 0.132 0.140 0.135 0.140 0.150 0.169 0.150 0.204 0.133 0.133 0.152 0.179 0.126 0.129 0.140 0.131 0.138 0.140 0.143 0.138 0.135 0.203 0.157 0.192 0.185 0.197 0.184 0.181 0.148 0.157 0.155 0.160 0.157 0.155 0.136 0.145 0.150 0.153 0.142 0.170 0.130 0.173 0.137 0.133 0.121 0.158 0.133 0.129 0.156 0.114 0.101 0.106 0.109 0.115 0.110 0.119 0.144 0.133 0.156 0.130 0.169 0.150 Table S5 Diagnostic characters separating Megophrys jiangi sp. nov. from other 91 species of the Megophrys sensu lato. SVL "Toes. at least Horn-like one-fourth tubercle at edge of "Tongue. notched webbed (+++), at Lateral fringes upper eyelidlong. Vomerine teeth. (++), feebly most one-fourth on toes. wide No. Species point (+++); present (+), or notched webbed (++), with Male Female (++), narrow (+), slightly large (++), absent (–) (+), or not rudimentary lacking (–) small (+), absent notched (–)" webbing (+), or or indistinct (–) without webbing (–)"

Megophrys 1 27.1–33.0 (10) 28.1–33.6 (4) ++ – – + + aceras

2 Megophrys acuta 27.1–33.0 28.1–33.6 ++ – – + +

Megophrys 3 39.1–45.0 48.9 + + + or – + + or ++ ancrae Megophrys 4 76.7 / + – – + + auralensis Megophrys 5 41–45 54–70 + + / + + baluensis Megophrys 6 42.0–45.0 (5) / + – + – – baolongensis Megophrys 7 32.0–36.0 (4) 40.2–42.5 (2) – – + or – ++ + binchuanensis Megophrys 8 45.1–51.0 (3) / – – + / + binlingensis Megophrys 9 34.5–37.8 (20) 39.7–46.8 (10) + – + ++ + boettgeri Megophrys 10 33.7–39.3 (5) 33.9–45.9 (2) + – – – + brachykolos Megophrys 11 92–123 137 ++ + ++ carinense Megophrys 12 81.3 (1) / ++ + – / + caudoprocta

13 Megophrys cheni 26.2–29.5 31.8–34.1 + – ++ ++ +

Megophrys 14 91–109 / ++ + / ++ + chuannanensis Megophrys 15 57.1 69.1 – + ++ – + damrei Megophrys 16 34.0–37.0 (18) 40.0–46.0 (3) + + / – – daweimontis Megophrys 17 30.2–39.3 (9) / + + – – + dongguanensis Megophrys 18 26.2–29.5 (15) 31.8–34.1 (3) + – ++ ++ + dringi Megophrys 19 39–42 69–82 + – / / / edwardinae

20 Megophrys elfina 26.9–33.9 (29) 35.1–36.5 (6) + – – + +

Megophrys 21 30.9–44.3 (13) 41.7–42.5 (2) + + + – – fansipanensis

22 Megophrys feae 78–102 91–1114 ++ + / – +

23 Megophrys feii 24.3–25.1 (4) 28.2–28.9 (2) + – + ++ +

Megophrys 24 56.9–68.4 (4) 68.0–74.6 (3) + + ++ + + flavipunctata Continued Table S5 SVL "Toes. at least Horn-like one-fourth tubercle at "Tongue. notched webbed (+++), at edge of upper Lateral fringes Vomerine teeth. (++), feebly most one-fourth eyelidlong. point on toes. wide No. Species present (+), or notched webbed (++), with Male Female (+++); slightly (++), narrow (+), absent (–) (+), or not rudimentary large (++), small lacking (–) notched (–)" webbing (+), or (+), absent or without webbing indistinct (–) (–)"

25 Megophrys gerti 32–34.8 (2) 41.4–45.8 (2) ++ – / / –

Megophrys 26 80.5–107.0 110.4–115.4 – – ++ ++ + gigantica Megophrys 27 76.0–81.0 77.0–100.0 + + + ++ + glandulosa

28 Megophrys hansi 35.3–43 (8) 53.5 ++ – – / –

Megophrys 29 68.0–73.5 (7) 83.9 + + / – ++ himalayana Megophrys 30 37.4–47.6 (11) 59.6 + + + – – hoanglienensis Megophrys 31 36.0–41.6 (4) 44.2 + – + – – huangshanensis Megophrys 32 36.8–41.2 (5) 47.1 + + + – + insularis Megophrys 33 / / ++ + / ++ / intermedia Megophrys 34 53.0–56.5 (3) 63.5 + + + ++ +++ jingdongensis Megophrys 35 35.1–36.7 (2) 38.4–41.6 (3) ++ + – + + jinggangensis Megophrys 36 30.4–33.9 (9) 34.1–37.5 (2) + + + – + jiulianensis Megophrys 37 99 109 / + / / / kobayashii

38 Megophrys koui / / ++ / / – –

Megophrys 39 26.2–29.6 (13) 37.4 + – + + – kuatunensis

40 Megophrys lancip 37.9–47.7 (2) 38.7–82.5 (4) ++ + – / +

Megophrys 41 38.9 (1) / ++ + – ++ + latidactyla Megophrys 42 30.4–38.7 (10) 42.3 (2) + – – – + leishanensis Megophrys 43 55.6–66.6 71.8–94.0 + + – – + lekaguli Megophrys 44 34.7–67.7 (5) 60.8–70.6 (8) +++ + + ++ + liboensis Megophrys 45 60 90 + + / / / ligayae

46 Megophrys lini 34.1–39.7 (20) 37.0–39.9 (4) + – – ++ +

Megophrys 47 30.7–34.7 (13) 36.9–40.4 (3) + – – – – lishuiensis Megophrys 48 47.0 65.0 + + + / + longipes Continued Table S5

SVL "Toes. at least Horn-like one-fourth tubercle at webbed (+++), at "Tongue. notched edge of upper Lateral fringes most one-fourth Vomerine teeth. (++), feebly eyelidlong. point on toes. wide webbed (++), No. Species present (+), or notched Male Female (+++); slightly (++), narrow (+), with absent (–) (+), or not large (++), small lacking (–) rudimentary notched (–)" (+), absent or webbing (+), or indistinct (–) without webbing (–)"

49 Megophrys major 34.5–41.2 (4) / – – + – +

Megophrys 50 62.5 73 + + + – – mangshanensis Megophrys 51 / / / + + + / maosonensis Megophrys 52 57.2–68.0 / + + + – + or – medogensis Megophrys 53 45.9–53.4 64.4 – + – – + megacephala Megophrys 54 28–36 47–49 ++ – / – – microstoma

55 Megophrys minor 32.2–40.5 42.0–48.2 + – + – +

56 Megophrys montana 38.1–53.9 45.7–99.5 ++ + / / /

Megophrys 57 / 40.5 / / / / / monticola Megophrys 58 30.1–30.8 (2) 36.3 (2) + – – + + mufumontana Megophrys 59 / 44.0–52.9 – – + + + nankiangensis Megophrys 60 29.9–34.9 (11) 39.4–41.9 (2) + + – – + nankunensis Megophrys 61 30.5–37.3 (10) / + + + + + nanlingensis

62 Megophrys nasuta 69.3–97.5 45.9–134.6 ++ + / / /

63 Megophrys obesa 35.6 (1) 37.5–41.2 (6) + – – – +

Megophrys 64 27.4–34.5 (5) 32.8–35.0 (4) + – – – – ombrophila Megophrys 65 56.0–59.5 (10) 68.0–72.5 (3) + + + + + omeimontis Megophrys 66 / 94.9 + + / – ++ oreocrypta Megophrys 67 32.8–39.2 44.1–48.7 – + + – – oropedion Megophrys 68 35.3–36.2 35.8 – + + – – pachyproctus Megophrys 69 36.2–38.0 (2) / ++ + – ++ +++ palpebralespinosa

70 Megophrys parallela 37.7–46.3 (6) 35.5–58.3 (2) + + – /

71 Megophrys parva 37.0–44.0 45.0–54.0 + + – – + or –

72 Megophrys periosa 71.3–93.8 (12) 112 (1) + + / – + Continued Table S5

73 Megophrys popei 70.7–83.5 (13) 86.2 ++ + ++ + +++

74 Megophrys robusta / 114.0 / + + / +

Megophrys 75 26.7–30.5 (8) / + + + + – rubrimera Megophrys 76 54.7 (1) / + + + + + sangzhiensis Megophrys 77 37.1 / / + / / + serchhipii Megophrys 78 66.0–84.0 77.0–104.0 – – + ++ +++ shapingensis Megophrys 79 102.0–118.3 (7) 99.8–115.6 (6) ++ – + ++ +++ shuichengensis

80 Megophrys spinata 47.2–54.4 (18) 54.0–55.0 (2) – – + ++ +++

Megophrys 81 / / ++ + / / / stejnegeri

82 Megophrys synoria / / ++ / / / /

83 Megophrys takensis 47.3–53.0 72.9 – + – – +

Megophrys 84 33.2–39.6 (9) 50.5 + or – – – – + tuberogranulata Megophrys 85 27.5–30.6 / + – + + + vegrandis Megophrys 86 34.4–42.8 47.0–49.8 – – + – + wawuensis Megophrys 87 31.0–34.1 (4) 38.5–42.8 (9) + – – – + wugongensis Megophrys 88 27.3–31.6 (10) 41.0–41.5 (2) – – + or – – – wuliangshanensis Megophrys – (in female), 89 30.4–35.5 (10) 38.4 – – – + wushanensis ++ (in male)

90 Megophrys zhangi 32.5–37.2 / – + + + –

Megophrys 91 30.0 39.0 / + / / / zunhebotoensis