The Journal of Neuroscience, August 1, 1999, 19(15):6360–6371
 Identification of Amino Acid Residues within GABAA Receptor Subunits that Mediate Both Homomeric and Heteromeric Receptor Expression
Pamela M. Taylor,1 Philip Thomas,2 George H. Gorrie,1 Christopher N. Connolly,1 Trevor G. Smart,2 and Stephen J. Moss1 1The Medical Research Council Laboratory for Molecular Cell Biology and Department of Pharmacology, University College London, London WC1E 6BT, United Kingdom, and 2Department of Pharmacology, The School of Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, United Kingdom
GABAA receptors are believed to be heteropentamers that can homo-oligomerize. The effect of this putative “assembly signal” be constructed from six subunit classes: ␣(1–6), (1–4), ␥(1–3), on the production of heteromeric receptors composed of ␣ ␦, ⑀, and . Given that individual neurons often express multiple and ␥ subunits was also analyzed. This signal was not critical receptor subunits, it is important to understand how these for the formation of receptors composed of either ␣12or␣13 receptors assemble. To determine which domains of receptor subunits, suggesting that mutation of these residues did not subunits control assembly, we have exploited the differing ca- disrupt subunit folding. However, this signal was important in pabilities of the 2 and 3 subunits to form functional cell the formation of ␥2 receptors. These residues did not seem to surface homomeric receptors. Using a chimeric approach, we affect the initial association of 2 and ␥2 subunits but appeared have identified four amino acids in the N-terminal domain of the to be important for the subsequent production of functional 3 subunit that mediate functional cell surface expression of receptors. Our studies identify, for the first time, key residues this subunit compared with 2, which is retained within the within the N-terminal domains of receptor  subunits that me- endoplasmic reticulum. Substitution of these four amino ac- diate the selective assembly of GABAA receptors. ids—glycine 171, lysine 173, glutamate 179, and arginine 180— Key words: GABA receptor; homomeric; heteromeric; as- into the 2 subunit was sufficient to enable the 2 subunit to sembly; benzodiazepine; cell surface
␣  ␣  ␥ GABAA receptors are the major sites of fast synaptic inhibition in receptors composed of either 1 2or 1 2 2 subunits (Connolly the brain. Molecular cloning has revealed a multiplicity of et al., 1996a,b). The ␣1␥2 and 2␥2 combinations and homomeric
GABAA receptor subunits that can be divided by sequence ho- subunits are retained within the ER (Connolly et al., 1996 a,b; mology into six subunit classes: ␣(1–6), (1–3), ␥(1–4), ␦, ⑀, and Gorrie et al., 1997). ER-retained unassembled subunits are rap- . Alternative splicing further increases the repertoire of idly degraded (Gorrie et al., 1997). Recent studies focusing on the  ␣  GABAA receptors (Macdonald and Olsen, 1994; Rabow et al., 3 subunit have shown that in contrast to homomeric 1, 2, or 1995; Davies et al., 1997; Hedblom and Kirkness, 1997). Local- ␥2L subunits, this protein has the capacity to access the cell ization experiments have revealed a large spatial and temporal surface on homomeric expression as determined by immunoflu- variation in subunit expression, with many individual neurons orescence (Connolly et al., 1996b). In addition, homomeric 3 expressing multiple subunits (Laurie et al., 1992; Macdonald and subunits produce spontaneously gated ion channels on expression Olsen, 1994; Rabow et al., 1995). Clearly, to understand the in either Xenopus oocytes or mammalian cells (Connolly et al., diversity of GABAA receptors expressed in neuronal membranes 1996b; Wooltorton et al., 1997). it is important to gain some insights into how these receptor Using subunit chimeras, we have exploited the differences in subunits are assembled into functional hetero-oligomers. cell surface expression between the 2 and 3 subunits to identify To address this question, the assembly of recombinant recep- key residues that are important in controlling receptor assembly. tors has been analyzed, focusing on receptors composed of ␣1, This approach has identified four amino acids in the N-terminal 2, and ␥2 subunits, because this combination is believed to domain of the 3 subunit that mediate subunit homo- account for up to 50% of all benzodiazepine-sensitive receptors oligomerization and cell surface expression. These residues also in the adult brain (Laurie et al., 1992; Benke et al., 1994; Mac- selectively affected assembly with the ␥2 subunit but not the ␣1 donald and Olsen, 1994; Rabow et al., 1995). Collectively, it is subunit. Together, these observations demonstrate that defined apparent that GABAA receptors are assembled in the endoplas- signals in the N-terminal domains of GABAA receptor subunits mic reticulum (ER), where access to the cell surface is limited to mediate selective subunit oligomerization and play a critical role in controlling receptor assembly. Received Dec. 23, 1998; revised May 17, 1999; accepted May 17, 1999. MATERIALS AND METHODS This work was supported by the Medical Research Council (United Kingdom) and the Wellcome Trust. Cell culture and transfection. Human embryonic kidney 293 (A293) cells Correspondence should be addressed to Dr. S. J. Moss, The Medical Research and African green monkey kidney (COS) cells were maintained in Council Laboratory for Molecular Cell Biology, University College London, Gower DMEM (Life Technologies, Gaithersburg, MD) supplemented with 10% Street, London WC1E 6BT, United Kingdom. fetal bovine serum, 100 U/ml streptomycin (Sigma, St. Louis, MO), and Copyright © 1999 Society for Neuroscience 0270-6474/99/196360-12$05.00/0 100 U/ml penicillin (Sigma). Cells were electroporated (400 V, infinite • Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly J. Neurosci., August 1, 1999, 19(15):6360–6371 6361 resistance, 125 F; Bio-Rad Gene Electroporator II) with 10 gofDNA Western blotting was performed as described previously (Connolly et al., using equimolar ratios of expression constructs. For electrophysiology, 1996a) using an enhanced chemiluminescent substrate (Pierce Supersig- the reporter plasmid for the S65T mutant jellyfish green fluorescent nal substrate). The signals were quantitated using a Bio-Rad protein (Heim et al., 1995) was added to the transfection mixture. phosphorimager. Transfected cells were maintained in culture for up to 70 hr before use. Immunoprecipitation. Cells were L-methionine-starved for 30 min be- 35 DNA construction. The murine GABAA receptor cDNAs encoding the fore labeling with [ S]methionine (ICN/Flow) at 200 Ci/ml. Immu- ␣1, ␥2L, and ␥2S (Whiting et al., 1990; Kofuji et al., 1991) subunits with noprecipitation using FLAG or 9E10 antibodies was performed as de- the 9E10 epitope (between amino acids 4 and 5) and the 2 subunit scribed previously. cDNA with the FLAG epitope (between amino acids 4 and 5) in the Electrophysiological analysis. Whole-cell recordings from transfected cytomegalovirus-based pGW1 expression vector have been described A293 cells were performed as described previously (Wooltorton et al., previously (Connolly et al., 1996a). The 3 subunit cDNA in pGW1 was 1997) up to 70 hr after transfection. Drugs were rapidly applied via a tagged with the FLAG epitope using the oligonucleotide CATGTTCC modified U-tube. The expression of functional cell-surface homomeric  2ϩ CGGGGTCCTTGTCATCGTCGTCCTTGTAGTCGTTTACGCTCTG subunit receptors was assessed by their sensitivity to Zn (10 M), by site-directed mutagenesis as described previously (Kunkel, 1985). picrotoxin (10 M), and pentabarbitone (1 mM). For ␣ and ␥ hetero- To generate the 23 chimera, a PstI/AvrII fragment encoding the C mers, GABA sensitivity was assessed. Control untransfected cells did not terminal of the 3 subunit was ligated into the (FLAG)2, pGW1 AvrII/ elicit membrane currents or change membrane conductances when ex- PstI vector using standard recombinant methods. To generate the 32 posed to these ligands. chimera, a PstI/HindIII fragment encoding the C terminal of 2 was (FLAG) ligated into the 3 pGW1 HindIII/PstI vector. An XhoI site was RESULTS introduced into both the 2 and 32 pGW1 constructs at a position   corresponding to residue 154 of the mature proteins by site-directed GABAA receptor 2 and 3 subunits differ in their mutagenesis using the oligonucleotides GCCATAGCTTTCAATCTC ability to access the cell surface GAGTGTACAGTTTTGTTC (2) and GCCATAGCTTTCAATCTC  To examine the mechanisms underlying the assembly of GABAA GAGAGTGCAGTTTTGCTC ( 3) (Kunkel, 1985). A SacII/XhoI frag-  ment encoding residues 1–153 of the 3 subunit was ligated into the receptors, receptor subunits modified with reporter epitopes (FLAG)2 pGW1 XhoI/SacII vector, and a XhoI/PstI fragment encoding were expressed in A293 cells. Addition of reporter epitopes residues 153–224 of the 3 subunit was ligated into the (FLAG)2 pGW1 between residues 4 and 5 of selected GABAA receptor subunits XhoI/PstI vector to produce more refined chimeras. Further mutants has been shown to be functionally silent (Connolly et al., were generated by site-directed mutagenesis using the oligonucleotides GGAGCTCGATCTTTGTCACGCCAGT and AGTGACAGCATT 1996a,b). Receptor expression was analyzed by immunofluores- GTCATCGCCACGCC for the (FLAG)3 (DNTK) construct and GAAG cence with or without membrane permeabilization. Homomeric CTCAATCCTTTCCACTCCTGTGA and CCTGTGACTGCCTT expression of (FLAG)2 in A293 cells did not produce surface (FLAG) (GKER) GTC ACCGCCGCGCCAG for the 2 construct. staining (Fig. 1). The staining pattern in permeabilized cells Immunocytochemistry. Transfected cells plated on poly-L-lysine (10 showed that this subunit is retained within the ER on homomeric g/ml)-coated coverslips were fixed in 3% paraformaldehyde (in PBS) 15–18 hr after transfection, and immunofluorescence was performed as expression (Connolly et al., 1996a,b; Gorrie et al., 1997). In (FLAG) described previously (Connolly et al., 1996a). When cells were perme- contrast, homomeric expression of 3 produced robust abilized, 0.05% vol/vol, NP40 was added to all solutions after fixation. surface expression in unpermeabilized cells (Fig. 1), as demon- The primary antibodies were applied for 1 hr at the following concen- strated previously in Madin–Darby canine kidney (MDCK) cells trations: anti-FLAG M2 mouse monoclonal antibody (IBI Ltd.), 9 g/ (Connolly et al., 1996b). Similar differences in surface expression ml; 9E10 supernatant (Evan et al., 1985) diluted 1:2. Secondary antibod-   ies, either fluoroscein-conjugated anti-mouse IgG (Pierce, Rockford, IL) of 2 and 3 were observed in both COS and baby hamster or Alexa 488-conjugated anti-mouse IgG (Molecular Probes, Eugene, kidney cells, suggesting that this phenomena is not likely to be OR) at 1 g/ml were applied for 45 min. Fluorescence images were host cell specific (data not shown). analyzed by confocal microscopy (MRC 1000, Bio-Rad, Hercules, CA). Quantitation of cell surface fluorescence by flow cytometrical sorting Specific residues within the N-terminal domain of analysis. After transfection (15–18 hr), cells were blown gently into GABA receptor  subunits control cell ϩ ϩ A Ca2 /Mg2 -free PBS. Subsequent washes and antibody dilutions were surface expression performed in HBSS (Life Technologies) containing 2.5 mg/ml BSA and To determine the molecular basis of the differential ability of 2.5 mM EDTA at 4°C. Cells were incubated with primary antibody,  purified 9E10, at 3 g/ml or anti-FLAG antibody at 4 g/ml, for 45 min, homomeric subunits to access the cell surface, chimeras be- washed three times, and then incubated with Alexa 488-conjugated tween (FLAG)2 and (FLAG)3 were produced. These constructs anti-mouse IgG at 1 g/ml for a further 30 min, before they were washed were produced at amino acid glutamine 224 within transmem- 2ϩ 2ϩ twice and resuspended in Mg /Ca -free PBS. Cell fluorescence was brane domain 1 (TM1), which is identical in all  subunits measured using a Becton Dickinson FACS Calibur machine (Becton Dickinson, Mountain View, CA), and the percentage of transfected cells (Yemer et al., 1989; Macdonald and Olsen, 1994; Rabow et al., that were more fluorescent than mock-transfected cells was determined 1995). Two chimeras were constructed in which the N-terminal by calculating the number of cells above the boundary of fluorescence of and C-terminal portions of the (FLAG)3 and (FLAG)2 subunits mock-transfected cells on a fluorescence histogram. A statistical analysis were exchanged. These chimeras, (FLAG)2/3 and (FLAG)3/2, of the apparent differences in cell-surface expression of different subunits were expressed in A293 cells, and subunit localization was ana- or subunit combinations was performed using the Student’s t test. (FLAG)  Sucrose density gradient fractionation. Receptor subunits were sub- lyzed by immunofluorescence. The 3/ 2 chimera, con- jected to sucrose density gradient fractionation on 5–20% linear sucrose taining the N terminus of 3, was capable of robust cell surface density gradients in lysis buffer (Gorrie et al., 1997). Before loading, expression as defined by staining in unpermeabilized cells, com- ϫ solubilized cell extracts were clarified by centrifugation (100,000 g for parable to that seen with (FLAG)3 (Fig. 1D). In contrast, the 10 min). Gradients were calibrated by loading parallel gradients with (FLAG)2/3 chimera containing the N terminus of 2 was not marker proteins (1 mg/ml) of known sedimentation coefficients: BSA, 4.3S; aldolase, 7.4S; catalase, 11.2S. Gradients were centrifuged in a able to access the cell surface (Fig. 1C). However, this protein Beckman SW55Ti rotor at 40,000 rpm for 14 hr at 4°C. The gradients could be seen in permeabilized cells where it appeared to be were fractionated into fourteen 350 l fractions, and receptor subunit retained in the ER, like (FLAG)2 (Connolly et al., 1996a). From sedimentation was analyzed by Western blotting. Alternatively, the this approach, it is clear that the N-terminal domain of (FLAG)3 (9E10)2 subunit was immunoprecipitated from each fraction as described previously (Gorrie et al., 1997). is important for determining cell surface expression. (FLAG) Western blotting. Receptor subunits were detected in gradient fractions To identify the regions of 3 responsible for mediating using either anti-FLAG antibody or purified 9E10 antibody at 10 g/ml. homomeric cell surface expression more precisely, further chi- • 6362 J. Neurosci., August 1, 1999, 19(15):6360–6371 Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly
Figure 1. Surface expression of homomeric (FLAG) subunits in A293 cells. Expression was determined by immunofluorescence using anti- FLAG M2 mouse monoclonal antibody and fluorescein-conjugated secondary antibodies with (ϩ) or without (Ϫ) permeabilization 15–18 hr after transfection. Images were collected by confocal microscopy. The structure of each con- struct is indicated above the image, with the 2 sequence in white and 3ingray. The four transmembrane domains in the C-terminal half of the subunits are represented by boxes. A, (FLAG)2(ϩ); B, (FLAG)3(Ϫ); C, (FLAG)23 (ϩ); D, (FLAG)32(Ϫ). Scale bar, 10 m. meras were produced. An alignment of the 3 and 2 subunit N-terminal domains is shown in Figure 2. There are 20 amino acid residues within the N terminus that differ between the 2 and 3 subunits. These differences are clustered in two distinct por- tions of the N-terminal domain (Fig. 2). Exchange of amino acids between isoleucine 154 and glutamine 224 from the (FLAG)3to the (FLAG)2 subunit resulted in cell surface expression (Fig. 3B). In contrast, substitution of residues 1–153 from (FLAG)3 into (FLAG)2 resulted in intracellular retention (Fig. 3A). These studies clearly identify a role for amino acids between residues 154 and 224 within the 3 subunit in mediating cell surface homomeric expression. Using systematic site-directed mutagene- sis, four amino acids were identified—G 171,K173,E179, and R 180 (single letter amino acid code)—within the (FLAG)3 subunit that were critical in conferring cell surface expression on (FLAG)2 (Fig. 3D). The individual mutation of D(171)G, N(173)K, T(179)K, or K(180)R in 2 did not promote cell surface homo- meric expression (data not shown). As a control, the correspond- Figure 2. Sequence alignment of the N-terminal domains of the 2 and (FLAG) 171 173 179 180 3 subunits. Amino acids that differ between the 2 and 3 subunits are ing residues from 2, D N T K , were used to   (FLAG) (FLAG) (DNTK) indicated (*). The joins between the two subunits in the 2 3 chimeras replace GKER in 3. Mutant 3 was unable are shown by arrows. The four residues that affect cell surface expression to access the cell surface and appeared to be ER-retained like are in bold. The presumed Cys–Cys loop is indicated. The boxed region (FLAG)2 (Fig. 3C). indicates the first presumed transmembrane domain. • Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly J. Neurosci., August 1, 1999, 19(15):6360–6371 6363
Figure 3. Surface expression of ho- momeric (FLAG)23 chimeras in A293 cells. Expression was deter- mined by immunofluorescence using anti-FLAG M2 mouse monoclonal an- tibody and fluorescein-conjugated sec- ondary antibodies with (ϩ) or without (Ϫ) permeabilization 15–18 hr after transfection, and images were col- lected by confocal microscopy. A, (FLAG)322(ϩ); B, (FLAG) 232 (Ϫ); C, (FLAG)3 (DNTK) (ϩ); D, (FLAG)2 (GKER) (Ϫ). Scale bar, 10 m.
In addition to immunofluorescence studies, flow cytometrical be variable but not significantly different from the (FLAG)3 sorting (FACS) was used to determine the levels of cell surface subunit ( p Ͼ 0.05) (Fig. 4B). Similarly, the number of expression of homomeric  subunits. Live A293 cells were labeled (FLAG)3 (DNTK)-transfected cells in which the FLAG epitope by immunofluorescence using FLAG antibody followed by an was detected on the cell surface was not significantly different Alexa 488-conjugated secondary antibody and analyzed by FACS. from that for (FLAG)2-transfected cells ( p Ͼ 0.05) (Fig. 4B) and Figure 4A shows typical results for mock-transfected A293 cells is significantly less than for (FLAG)3-transfected cells ( p Ͼ 0.05). or cells expressing (FLAG)2or(FLAG)3. Expression of (FLAG)3 To determine whether the differing wild-type and mutant sub- on the cell surface results in a clear shift of the histogram peak to units were expressed at similar levels, cells expressing FLAG- higher fluorescence intensity. This shift in fluorescence was ex- tagged versions of these constructs were metabolically labeled pressed as a percentage of cells expressing the FLAG epitope on with [ 35S]methionine. Receptor  subunits were then immuno- the cell surface. Typically 30% of (FLAG)3-transfected cells precipitated and separated by SDS-PAGE (Fig. 4C). (FLAG)3 expressed the FLAG epitope. This value reflects transfection migrated with a molecular mass of between 57 and 59 kDa, and efficiency; therefore, when different subunits were compared, cell (FLAG)2 migrated as bands of 54 and 50 kDa, as determined surface expression was calculated as a percentage of the cell previously (Connolly et al., 1996a; McDonald et al., 1998). This surface expression seen for (FLAG)3 in each experiment, which approach determined that 2, 2 (GKER), 3, and 3 (DNTK) were was normalized to 100%. Despite the fact that (FLAG)2 cannot all expressed to similar levels (Fig. 4C). be detected on the cell surface by immunofluorescence micros- copy, very low levels (ϳ2%) of (FLAG)2 could sometimes be Functional properties of  subunit chimeras detected by FACS analysis. This is likely to represent cells that The ability of different  subunits to form functional homo- have become permeabilized during the staining procedure. The oligomeric receptors was also measured. Whole-cell currents gen- values obtained for (FLAG)2 were not significantly different from erated in response to the application of various ligands from mock-transfected cells ( p Ͼ 0.05) (Fig. 4B). The levels of cell transfected A293 cells were recorded at a holding potential of surface expression for the (FLAG)2 (GKER) mutant were found to Ϫ40 mV. A293 cells expressing 2 show no response to the • 6364 J. Neurosci., August 1, 1999, 19(15):6360–6371 Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly
ϩ application of GABA, pentobarbital, Zn 2 , or picrotoxin (Fig. 5A). In contrast, cells expressing 3 subunits are insensitive to the application of up to 1 mM GABA but display large inward cur- rents with associated rebound currents in response to pentobar- bital (Fig. 5B) (Wooltorton et al., 1997). The characteristic spon- taneous gating of homo-oligomeric 3 receptors can be demonstrated by the generation of outward currents in response 2ϩ to the GABAA receptor inhibitors Zn and picrotoxin (Fig. 5B). This is because the pipette electrolyte and external Krebs’ com-
position caused ECl to approximate 0 mV. Thus, the spontaneous gating of 3 homomers was manifest by a persistent inward current at the Ϫ40 mV holding potential. In agreement with the immunofluorescence studies, recordings made from cells express- ing either the 32or232 chimeras resulted in functional cell surface receptors because 1 mM pentobarbital activated inward currents. These chimeras also exhibited spontaneous gating as the 2ϩ addition of 10 M Zn or 10 M picrotoxin elicited outward membrane currents (Fig. 5C,D). In contrast, 23or323 ϩ2 chimeras exhibited no sensitivity to pentobarbital (1 mM), Zn (10 M), or picrotoxin (10 M)(n ϭ 3; data not shown). Whole-cell recordings were also made from cells expressing  subunit point mutants. Cells transfected with 3 (DNTK) are in- ϩ sensitive to the application of GABA, pentobarbital, Zn 2 , and picrotoxin (Fig. 5E), confirming that 3 (DNTK) does not assemble into functional homomeric receptors. However, A293 cells ex- (GKER) pressing 2 exhibited a weak response to 1 mM pentobar- bital (Fig. 5F), indicating that the four substitutions enable the 2 subunit to form functional homo-oligomeric receptors. In con- trast, cells expressing 2 (GKER) do not clearly display outward ϩ currents in response to Zn 2 or picrotoxin, suggesting that these Ϫ subunits do not appear to form spontaneously open Cl channels. Therefore, the data derived from the immunofluoresence, FACS, and electrophysiological studies clearly identify four N-terminal amino acid residues, GKER, within (FLAG)3 that are necessary for homomeric cell surface expression and are also sufficient to confer homomeric cell surface expression on the (FLAG)2 subunit after mutation. Given that similar surface levels of 2 (GKER) and 3 are seen (Fig. 4), the differences in the physiological properties of these homomeric receptors are of interest. These observations suggest that although the residues G 171,K173,E179, and R 180 are sufficient to mediate cell surface expression, other distinct residues are responsible for the unique pharmacological and physiological properties of 3 homomers. Sucrose density gradient fractionation of receptor  subunits The ER retention of (FLAG)2 and the cell surface expression of (FLAG)3 may reflect differences between the abilities of these
4
surface fluorescence for mock-transfected cells (top panel) and cells transfected with either (FLAG)3(middle panel)or(FLAG)2(bottom panel) cDNAs. B, Relative levels of (FLAG) subunit cell surface expres- sion. The number of cells expressing the flag epitope on the cell surface was expressed as a percentage of the number of (FLAG)3-transfected cells expressing the flag epitope on the cell surface (mock, n ϭ 5; (FLAG)3, n ϭ 9; (FLAG)2, n ϭ 4; (FLAG)2 (GKER), n ϭ 6; (FLAG)3 (DNTK), n ϭ 5). C, Expression levels of (FLAG)2(lane 2), (FLAG)2 (GKER) (lane 3), (FLAG)3 Figure 4. Quantitation of  subunit cell surface expression in A293 cells (lane 4), (FLAG)3 (DNTK) (lane 5), or control untransfected COS cells by FACS analysis. Cell surface  subunits were labeled by immunofluo- (lane 1) were assessed in COS cells labeled for 2 hr with 100 Ci/ml rescence on nonpermeabilized cells using anti-FLAG M2 mouse mono- [ 35S]methionine. Expressing cells were then lysed, and receptor subunits clonal antibody and an anti-mouse Alexa 488-conjugated secondary anti- were immunoprecipitated with FLAG antibody, resolved by SDS-PAGE, body. The cells were then subjected to flow cytometry analysis. A, and visualized by autoradiography. The migration of molecular mass Histograms showing the distribution of cells with different levels of cell standards is indicated on the left. • Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly J. Neurosci., August 1, 1999, 19(15):6360–6371 6365
Figure 5. Functional analysis of  subunit homomers. Whole-cell currents were recorded from transfected A293 cells after the application of 1 mM GABA, 1 mM pentobar- 2ϩ bital (PB), 10 M Zn ,or10M picrotoxin (PTX) from A27.1p93 cells expressing A, 2; B, 3; C, 32; D, 232; E, 3 (DNTK); and F, 2 (GKER) constructs. Calibration bar: A–D, 200 pA; E, F, 100 pA. All of the cells were voltage- clamped at Ϫ40 mV, and each trace is representative of observations made from four to five determinations. two proteins to homo-oligomerize, because oligomerization is a mately 5S (Fig. 6A,B) like (FLAG)2 (Fig. 6A,C) (Gorrie et al., prerequisite for ER exit (Hammond and Helenius, 1995). To 1997). In contrast, (FLAG)2 (GKER), which like (FLAG)3 can analyze the oligomerization of receptor  subunits, detergent- access the cell surface, had a sedimentation coefficient of 9S (Fig. solubilized cell extracts were fractionated on 5–20% linear su- 6A,C). Given that the (FLAG)2, (FLAG)2 (GKER), (FLAG)3, and crose density gradients. For these studies, expression in COS cells (FLAG)3 (DNTK) proteins are all expressed to similar overall was used because they gave higher expression levels than A293 levels (Fig. 4C), these observations strongly suggest that the cells, facilitating biochemical analysis. Gradient fractions were amino acids GKER in (FLAG)3 mediate cell surface expression subjected to Western blotting or immunoprecipitation with 9E10 by facilitating subunit homo-oligomerization. antibody. The behavior of the 3 (DNTK), 2 (GKER), 2, and 3 subunits was identical in both COS and A293 cells (Fig. 1–3) with The amino acids responsible for mediating 3 subunit regard to cell surface expression (data not shown). homo-oligomerization mediate cell surface expression The (FLAG)3 subunit exhibited a sedimentation coefficient of with the ␥2 subunit but not the ␣1 subunit 9S as determined by reference to standards (Fig. 6A,B). The To determine whether the amino acids that control 3 subunit sedimentation coefficient of (FLAG)3 is distinct from (FLAG)2, homo-oligomerization influence hetero-oligomerization, various which exhibits a 5S coefficient (Fig. 6A–C) (Gorrie et al., 1997). In (FLAG)2 and (FLAG)3 constructs were coexpressed with contrast, 2 exhibits a coefficient of 9S when coexpressed with the (9E10)␥2L or (9E10)␣1 subunits. Both (9E10)␣1 and (9E10)␥2L are ␣1orthe␣1 and ␥2 subunits to form functional cell surface ER-retained on homomeric expression (Connolly et al., 1996a,b), receptors (Gorrie et al., 1997; Tretter et al., 1997). The distinct so expression was monitored by detecting the 9E10 reporter sedimentation coefficients of (FLAG)2 and (FLAG)3, combined epitope at the cell surface. Coexpression of (9E10)␣1 with either with differential ER retention, suggested that these subunits differ the (FLAG)2 (GKER) or (FLAG)3 (DNTK) constructs resulted in in their abilities to homo-oligomerize. This issue was explored robust expression of both reporter epitopes on the cell surface further by determining the sedimentation coefficients of (Fig. 7). Likewise, both 2 (GKER) and 3 (DNTK) were able to (FLAG)2 (GKER) and (FLAG)3 (DNTK), which differ in their ability assemble with the ␣1 and ␥2 subunits to produce functional to access the cell surface (Figs. 3, 4). (FLAG)3 (DTNK), which is ␣1␥2 receptors (data not shown). Because both the 2 and 3 ER-retained, exhibited a sedimentation coefficient of approxi- subunits can produce functional receptors on coexpression with • 6366 J. Neurosci., August 1, 1999, 19(15):6360–6371 Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly
Figure 6. Differential sedimentation of (FLAG) subunits on sucrose density gradients. COS cells transfected with (FLAG)3, (FLAG)3 (DNTK),or(FLAG)2 (GKER) were sub- jected to sucrose density gradient fractionation 16 hr after transfection. Gradient fractions were separated by SDS- PAGE; the (FLAG) subunits were detected by Western blotting using anti-FLAG M2 monoclonal antibody (A), and the signals were quantified using a Bio-Rad phoshorim- ager (B, Ⅺ, (FLAG)3, F, (FLAG)3 (DNTK); C, E, (FLAG)2, ࡗ, (FLAG)2 (GKER)). The data for (FLAG)2 are taken from Gorrie et al. (1997) and represent immunoprecipitation of this protein from expressing cells after metabolic labeling with [ 35S]methionine. The level of 2 in each fraction was quantified using a Bio-Rad phosphorimager. Sedimentation coefficients of receptor subunits were determined by refer- ence to the standards BSA (4.3S), aldolase (7.4S), and catalase (11.2S).
␣1 and ␥2 subunits, this result is not unexpected (Macdonald and To determine whether the amino acids that mediate homomeric Olsen, 1994; Rabow et al., 1995). However, coassembly with the expression of 3 influence heteromeric expression, selected  ␣1 subunit indicates that the four mutations do not disturb the subunit mutants were coexpressed with (9E10)␥2L. In contrast to folding of  subunit polypeptides. the lack of surface expression of wild-type (FLAG)2 with Coexpression of (FLAG)2 with (9E10)␥2L resulted in ER reten- (9E10)␥2L, coexpression of (FLAG)2 (GKER) with (9E10)␥2L pro- tion of both subunits, in agreement with earlier observations duced robust cell surface expression of both subunits (Fig. 8C). (Connolly et al., 1996a,b) (Fig. 8A). However, coexpression of When (9E10)␥2L was expressed with (FLAG)3 (DNTK), cell surface (FLAG)3 and (9E10)␥2L resulted in robust cell surface expression expression of both subunits was also observed, although at re- of (9E10)␥2L (Fig. 8B). These results suggest clear differences in duced levels compared with cells coexpressing (FLAG)3 and the ability of (FLAG)2 and (FLAG)3 to assemble with (9E10)␥2L. (9E10)␥2L (Fig. 8D). Identical assembly behavior was seen with • Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly J. Neurosci., August 1, 1999, 19(15):6360–6371 6367
Figure 7. Surface expression of hetero- meric (FLAG)(9E10)␣1 receptors in A293 cells. Expression was deter- mined by immunofluorescence on nonpermeabilized cells 15–18 hr after transfection using anti-FLAG M2 mouse monoclonal antibody to detect (FLAG) subunits (left panel) and 9E10 antibody to detect (9E10)␣1(right panel) followed by Alexa 488- conjugated secondary antibodies. Im- ages were collected by confocal mi- croscopy. A, (FLAG)3 (DNTK)(9E10)␣1; B, (FLAG)2 (GKER) (9E10)␣1. Scale bar, 10 m.
2ϩ both the ␥2L and ␥2S splice variants. These observations indicate the application of 10 M Zn or picrotoxin, indicating that some that the amino acid residues that mediate 3 subunit homo- of the 3 (DNTK)␥2S receptors gate spontaneously (Fig. 9D). It is oligomerization and cell surface expression also mediate hetero- unlikely that mixed populations of 3 (DNTK) homomers and oligomeric interactions between 3 and ␥2 subunits. 3␥2S receptors are expressed, because the former fail to form Cell surface ␥2 receptors also form functional functional cell surface receptors. These electrophysiological ob- ion channels servations correlate well with the immunofluorescence data, which suggested that 3 (DNTK) formed cell surface receptors To investigate the abilities of the  subunits to form hetero- when coexpressed with ␥2, but with a reduced efficiency com- oligomeric receptors when coexpressed with the ␥2S subunit, pared with wild-type 3 subunits. Identical behavior was seen in whole-cell currents generated in response to the application of these experiments with either splice variant of the ␥2 subunit various ligands in transfected A293 cells were recorded. Cells (data not shown). coexpressing 2 and ␥2S subunits were insensitive to GABA, ϩ pentobarbital, Zn 2 , and picrotoxin (Fig. 9A), as described pre- Quantitation of ␥2 cell surface expression  viously (Connolly et al., 1996a). In contrast, cells coexpressing 3 To confirm that the reduction in whole-cell currents produced on ␥ and 2S exhibited both GABA- and pentobarbital-gated mem- expression of 3 (DNTK) and ␥2 subunits compared with 3 and ␥2 brane currents (Fig. 9B). The pharmacology of these channels was subunits was caused by a reduction in cell surface expression,  distinct from that of 3 homomers, which are insensitive to coexpressing cells were subjected to flow cytometry to quantify GABA (Connolly et al., 1996a; Wooltorton et al., 1997). Appli- ␥ ϩ heteromeric 2 receptor cell surface expression. This was 2 (9E10) cation of the GABAA receptor inhibitors Zn (10 M) and achieved by monitoring the level of surface ␥2L using 9E10  ␥ picrotoxin (10 M) to cells expressing 3 and 2S resulted in the antibody. In cells coexpressing 2 and (9E10)␥2L, the level of cell  ␥ generation of outward currents (Fig. 9B), indicating that 3 2S surface expression was low and similar to that observed for channels show a degree of spontaneous activity or that the cells untransfected cells (Fig. 10). For cells coexpressing 3 and   ␥ express a mixed population of 3 homomers and 3 2S (9E10)␥2L, (9E10)␥2L could be detected on the surface of ϳ15% of receptors. cells, and this was used to normalize the cell surface expression of ␥  (GKER) Cells coexpressing 2S with 2 exhibit currents similar constructs in each experiment (Fig. 10). In (9E10)␥2L3 (DNTK)-  ␥ to those generated by cells expressing 3 2S receptors. Applica- transfected cells, (9E10)␥2L surface fluorescence was significantly tion of GABA or pentobarbital generated inward currents; in decreased ( p Ͻ 0.05) (Fig. 10) compared with (9E10)␥2L3- 2ϩ contrast, both Zn and picrotoxin blocked spontaneously open expressing cells (Fig. 10) but was significantly greater than for channels resulting in the generation of outward currents (Fig. both (9E10)␥2L2 and mock-transfected cells ( p Ͻ 0.05) (Fig. 10). 9C). Interestingly, cells coexpressing the 3 (DNTK) mutant with ␥2S also displayed inward currents in response to GABA or Interaction of the ␥2S subunit with  subunits pentobarbital, but these currents were much smaller than those To determine whether changes in subunit oligomerization are observed for 3␥2S or 2 (GKER)␥2S receptors (Fig. 9D). This responsible for the reduced cell surface expression of 3 (DNTK)/ was a consistent feature that was independent of the transfection ␥2S constructs compared with 3/␥2S or 2 (GKER)/␥2S, subunit efficiency. Small outward currents were induced in response to oligomerization was analyzed by immunoprecipitation. For these • 6368 J. Neurosci., August 1, 1999, 19(15):6360–6371 Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly
Figure 8. Surface expression of heteromeric (FLAG)(9E10)␥2L receptors in A293 cells. Expression was determined by immunofluorescence on nonpermeabilized cells 15–18 hr after transfection using anti-FLAG M2 mouse monoclonal antibody to detect (FLAG) subunits (left panel) and 9E10 antibody to detect (9E10)␥2L (right panel) followed by Alexa 488-conjugated secondary antibodies. Images were collected by confocal microscopy. Transfection and staining were performed simultaneously for each subunit combination, and the pictures were all taken using the same confocal microscope settings. A, (FLAG)2 ϩ (9E10)␥2L; B, (FLAG)3 ϩ (9E10)␥2L; C, (FLAG)2 (GKER) ϩ (9E10)␥2L; D, (FLAG)3 (DNTK) ϩ (9E10)␥2L. Scale bar, 10 m. experiments, a (9E10)␥2S construct was expressed with each of the diffuse band of between 45 and 49 kDa. Association between the  subunit constructs used in this study (Fig. 11). The migration of ␥2 and  subunits was examined by immunoprecipitation using homomeric 2, 3, and ␥2S subunits is also shown for clarity in 9E10 antibody. Coimmunoprecipitation of 3 (57 and 59 kDa) Figure 11. The 2 and 3 subunits migrated as bands of 50–54 and 3 (DNTK) (57 and 59 kDa) with (9E10)␥2S was clearly ob- and 57–59 kDa, respectively, whereas (9E10)␥2S migrated as a served because these proteins have distinct migrations on SDS- • Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly J. Neurosci., August 1, 1999, 19(15):6360–6371 6369
Figure 9. Functional analysis of ␥2S hetero-oligomers. Whole-cell currents were recorded in response to 1 mM 2ϩ GABA, 1 mM pentobarbital (PB), 10 M Zn ,or10M picrotoxin (PTX) from A293 cells expressing A, 2␥2S; B, 3␥2S; C, 2 (GKER)␥2S; and D, 3 (DNTK)␥2S. Cells were voltage-clamped at Ϫ40 mV holding potential, and each trace is representative of four to five determinations.
PAGE (Fig. 11). Because the close migration of 2 and ␥2S, coimmunoprecipitation was more difficult to detect; however, the higher molecular mass species of 2 and 2 (GKER) (54 kDa) (Fig. 11) coprecipitated with (9E10)␥2S. These results suggested that the reduced efficiency of surface expression of 3 (DNTK)␥2S and the failure of 2␥2S to access the cell surface is not attributable to an inability to oligomerize, in agreement with earlier observations (Connolly et al., 1996a). Instead, the efficiency of assembly is likely to be affected at a later stage, possibly with the 2␥2 and 3 (DNTK)␥2 combinations forming dimeric or trimeric com- plexes, which are processed inefficiently into functional receptors. Alternatively, these residues may affect the transport or targeting of assembled /␥ oligomers to the cell surface. DISCUSSION
To identify amino acid residues that control GABAA receptor assembly, we have used a chimeric approach to analyze the selective cell surface expression of the 3 subunit compared with the 2 subunit. This resulted in the identification of four amino acids—G171, K173, E179, and R180—within the N-terminal  domain of 3 that are capable of conferring homomeric cell (9E10)␥   Figure 10. Relative levels of 2L subunit cell surface expression surface expression on 2. The sedimentation of subunit con- when expressed with different  subunits. Cell surface ␥2L subunits were structs was compared by sucrose density gradient centrifugation. labeled by immunofluorescence on nonpermeabilized cells using 9E10 2 migrated as a 5S complex; in contrast, 3 migrated as a 9S antibody and an Alexa-488 conjugated anti-mouse secondary antibody. complex. Interconversion of the sedimentation coefficients of 2 The number of cells expressing the 9E10 epitope on the cell surface was  measured by FACS analysis and expressed as a percentage of the number and 3 could be achieved by replacing the amino acids GKER in (9E10)␥    of 2L 3 transfected cells expressing the 9E10 epitope on the cell 3 with DNTK from 2 and vice versa. Together, these observa- surface (n ϭ 3 for each subunit combination). tions suggest that these amino acids identified in our study me- diate 3 subunit oligomerization. However, whether residues • 6370 J. Neurosci., August 1, 1999, 19(15):6360–6371 Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly
of G171, K173, E179, and R180, key residues in 3 subunit homo-oligomerization, into the 2 was sufficient to allow assem- bly with the ␥2 subunit. However, substitution of these residues for the corresponding amino acids from 2, DNTK, reduced the efficiency of, but did not completely prevent, assembly with the ␥2 subunit. Immunoprecipitation of ␥2 from COS cell lysates results in the coimmunoprecipitation of coexpressed 2, 3, 2 (GKER), or 3 (DNTK), suggesting that the initial steps of ␥ oligomeriza- tion are unaffected by these amino acids. However, the produc- tion of a 9S complex that presumably represents functional re- ceptors (Gorrie et al., 1997; Tretter et al., 1997) appeared to be drastically reduced for the 3 (DNTK) construct compared with   (GKER) Figure 11. Coimmunoprecipitation of  subunits with the (9E10)␥2S sub- either wild-type 3or 2 constructs. Together, these ob- unit. COS cells or cells expressing 3(lane 1), 2(lane 2), (9E10)␥2S (lane servations suggest that the GKER residues within the 3 subunit 3), flag-tagged (FLAG)2 ϩ (9E10)␥2S (lane 4), (FLAG)3 ϩ (9E10)␥2S (lane are not essential for the initial steps in ␥ subunit oligomerization (FLAG) (GKER) ϩ (9E10)␥ (FLAG) (DNTK) ϩ (9E10)␥ 5), 2 2S (lane 6), 3 2S but play a critical role in facilitating the production of functional (lane 7), or control cells were [ 35S]methionine-labeled and immunopre- cipitated using 9E10 antibody coupled to protein A-Sepharose. Immune tetrameric or pentameric subunit assemblies. complexes were separated by SDS-PAGE using 8% gels. The migration of The role of the residues identified in our study in the produc- 3, 2, and ␥2S is indicated as is the migration of molecular mass tion of receptors composed of ␣␥ subunits that are believed to standards. account for most GABAA receptor subtypes in the brain remains to be determined (Macdonald and Olsen, 1994; Rabow et al., G171, K173, E179, and R180 all contribute equally to this process 1995). Although the production of receptors composed of ␣12␥3 remains to be established. and ␣12␥3 was unaffected by the amino acids mediating 3 The functional properties of the different  homomers were subunit homo-oligomerization, they may play a role in the assem- also examined. In agreement with earlier observations, 2 was bly of receptors containing other ␣ subunit variants. Alterna- unable to form functional channels. However, 3 produced tively, they may also be of importance in the production of ϩ pentobarbital-activated, Zn 2-sensitive responses (Connolly et heteromeric receptors where the ␥ subunit is substituted for al., 1996b). In agreement with its failure to homo-oligomerize and either the ␦ or ⑀ subunits (MacDonald and Olsen, 1994; Rabow et its resultant ER retention, expression of 3 (DNTK) did not pro- al., 1995; Davies et al., 1997). duce functional receptors. In contrast, pentobarbital-activated The four residues that control the interactions of the 3 subunit responses could be recorded from 2 (GKER)-expressing cells. during assembly are not located in a region of the polypeptide These pentobarbital-evoked responses were much smaller than sequence that is homologous to the assembly domains that have those recorded from 3-expressing cells and unlike 3 homomers been identified for nicotinic ACh receptor subunits or glycine were not spontaneously gated (Wooltorton et al., 1997). Given receptor subunits (Gu et al., 1991; Chavez et al., 1992; Kuhse et that surface levels of 2 (GKER) were similar to those of 3, these al., 1993; Kreienkamp et al., 1995). However, an asparagine observations suggest that the residues GKER are sufficient to residue in the N terminus of the 1 subunit that mediates cell mediate 3 subunit homo-oligomerization, but other distinct surface homomeric expression is located in a region homologous N-terminal amino acid residues within this subunit are important to the 3 assembly signal defined here (Hackam et al., 1997). for channel gating. Presumably this assembly signal within the 3 subunit will inter- The contribution of the amino acids within 3 controlling act in concert with other as yet undefined assembly signals to homo-oligomerization in mediating heteromeric receptor assem- ensure the fidelity of GABAA receptor assembly. bly was analyzed. Coexpression of ␣ and  subunits in heterolo- In conclusion, the results of this study provide the first direct gous systems results in the production of GABA-gated channels evidence of defined signals in the N-terminal domain of GABAA (Macdonald and Olsen, 1994; Rabow et al., 1995). That the receptor subunits that are important in mediating subunit selec- substitution of residues GKER and DNTK between 2 and 3 tive receptor assembly. does not affect assembly with ␣1 is not unexpected but is of significance. This result suggests that the amino acids identified in REFERENCES our study are likely to constitute an assembly signal that mediates subunit oligomerization rather than having effects on gross sub- Angelotti TP, Macdonald RL (1993) Assembly of GABAA receptor sub- ␣  ␣  ␥ unit folding. units: 1 1 and 1 1 2S subunits produce unique ion channels with dissimilar single-channel properties. J Neurosci 13:1429–1440. The production of functional receptors composed of  and ␥  ␥ Benke D, Fritschy JM, Trzeciak A, Bannwarth W, Mohler H (1994) subunits is less consistent. The formation of both 2 2 (Draguhn Distribution, prevalence, and drug binding profile of gamma- et al., 1990; Sigel et al., 1990) and 3␥2 receptors (Zezula et al., aminobutyric acid type A receptor subtypes differing in the beta- 1996) has been reported. Other studies have reported that coex- subunit variant. J Biol Chem 269:27100–27107. pression of 1 and ␥2S (Angelotti et al., 1993) or 2 and ␥2L Chavez RA, Maloof J, Beeson D, Newsom-Davis J, Hall ZW (1992) Subunit folding and alpha delta heterodimer formation in the assembly (Connolly et al., 1996a) does not result in the formation of of the nicotinic acetylcholine receptor. Comparison of the mouse and functional receptors. The observation that 2 and ␥2donot human alpha subunits. J Biol Chem 267:23028–23034. coassemble into cell surface receptors is consistent with earlier Connolly CN, Krishek BJ, McDonald BJ, Smart TG, Moss SJ (1996a) results (Connolly et al., 1996a,b). However, 3 was able to assem- Assembly and cell surface expression of heteromeric and homomeric ␥ gamma-aminobutyric acid type A receptors. J Biol Chem 271:89–96. ble with 2 to form functional GABA-gated cell surface recep- Connolly CN, Wooltorton JRA, Smart TG, Moss SJ (1996b) Subcellular tors. These results indicate clear differences in the abilities of the localization of ␥-aminobutyric acid type A receptors is determined by 2 and 3 subunits to assemble with the ␥2 subunit. Substitution receptor  subunits. Proc Natl Acad Sci USA 93:9899–9904. • Taylor et al. Homomeric and Heteromeric GABAA Receptor Assembly J. Neurosci., August 1, 1999, 19(15):6360–6371 6371
Davies PA, Hanna MC, Hales TG, Kirkness EF (1997) Insensitivity to glycine receptor: identification of amino acid sequence motifs govern- anaesthetic agents conferred by a class of GABA(A) receptor subunit. ing subunit stoichiometry. Neuron 1993 6:1049–1056. Nature 385:820–823. Kunkel TA (1985) Rapid and efficient site-specific mutagenesis without Draguhn A, Verdorn TA, Ewert M, Seeburg PH, Sakmann B (1990) phenotypic selection. Proc Natl Acad Sci USA 82:488–492. Functional and molecular distinction between recombinant rat GABAA Laurie DJ, Wisden W, Seeberg PH (1992) The distribution of 13 ϩ receptor subtypes by Zn2 . Neuron 5:781–788. GABAA receptor subunit mRNAs in the rat brain II. Olfactory bulb Evan GI, Lewis G, Ramsey G, Bishop JM (1985) Isolation of monoclo- and cerebellum. J Neurosci 12:4151–4172. nal antibodies specific for human c-myc proto oncogene product. Mol Macdonald RL, Olsen RW (1994) GABAA receptor channels. Annu Rev Cell Biol 5:3610–3616. Neurosci 17:569–602. Gorrie GH, Vallis Y, Stephenson A, Whitfield J, Browning B, Smart TG, McDonald BJ, Amato A, Connolly CN, Benke D, Moss SJ, Smart TG ␣  Moss SJ (1997) Assembly of GABAA receptors composed of 1 and (1998) Adjacent phosphorylation sites on GABAA receptor subunits 2 subunits in both cultured neurons and fibroblasts. J Neurosci determine regulation by cAMP-dependent protein kinase. Nature Neu- 17:6587–6596. rosci 1:23–28. Gu Y, Camacho P, Gardner P, Hall ZW (1991) Identification of two Rabow LE, Russek SJ, Farb DH (1995) From ion currents to genomic amino acid residues in the epsilon subunit that promote mammalian analysis: recent advances in GABAA receptor research. Synapse muscle acetylcholine receptor assembly in COS cells. Neuron 1991 21:189–274. 6:879–887. Sigel E, Baur R, Trube G, Mohler H, Malherbe P (1990) The effect of Hackam AS, Wang TL, Guggino WB, Cutting GR (1997) The subunit composition of rat brain GABAA receptors on channel func- N-terminal domain of human GABA receptor 1 subunits contains tion. Neuron 5:703–711. signals for homooligomeric and heterooligomeric interaction. J Biol Tretter V, Ehya N, Fuchs K, Sieghart W (1997) Stoichiometry of a Chem 272:13750–13757. recombinant GABAA receptor subtype. J Neurosci 17:2728–2737. Hammond C, Helenius A (1995) Quality control in the secretory path- Whiting P, McKernan RM, Iversen LL (1990) Another mechanism for way. Curr Opin Cell Biol 7:670–529. creating diversity in gamma-aminobutyrate type A receptors: RNA Hedblom E, Kirkness EF (1997) A novel class of GABAA receptor splicing directs expression of two forms of gamma 2 phosphorylation subunit in tissues of the reproductive system. J Biol Chem site. Proc Natl Acad Sci USA 87:9966–9970. 272:15346–15350. Wooltorton JA, McDonald BJ, Moss SJ, Smart TG (1997) Identification ϩ Heim R, Cubitt AB, Tsien RY (1995) Improved green fluorescent pro- ofaZn 2 binding site on the murine GABAA receptor complex: teins. Nature 373:663–664. dependence on the second transmembrane domain of  subunits. Kofuji P, Wang JB, Moss SJ, Huganir RL, Burt DR (1991) Generation J Physiol (Lond) 505.3:633–640. of two forms of the gamma-aminobutyric acid A receptor gamma Yemer S, Schofield PR, Draguhn A, Werner P, Kohler M, Seeberg PH  2-subunit in mice by alternative splicing. J Neurochem 56:713–715. (1989) GABAA receptor subunit heterogeneity: functional expres- Kreienkamp HJ, Maeda RK, Sine SM, Taylor P (1995) Intersubunit sion of cloned cDNAs. EMBO J 8:1665–1670. contacts governing assembly of the mammalian nicotinic acetylcholine Zezula J, Slany A, Sieghart W (1996) Interaction of allosteric ligands receptor. Neuron 14:635–644. with GABAg1 receptors containing one, two or three different subunits. Kuhse J, Laube B, Magalei D, Betz H (1993) Assembly of the inhibitory Eur J Pharmacol 301:207–214.