DOCSLIB.ORG

The Insect Endosymbiont Sodalis Glossinidius Utilizes a Type III Secretion System for Cell Invasion

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Insect Endosymbiont Sodalis Glossinidius Utilizes a Type III Secretion System for Cell Invasion The insect endosymbiont Sodalis glossinidius utilizes a type III secretion system for cell invasion Colin Dale†, Simon A. Young, Daniel T. Haydon, and Susan C. Welburn Sir Alexander Robertson Center for Tropical Veterinary Medicine, Royal Dick School of Veterinary Studies, University of Edinburgh, Easter Bush, Roslin, Midlothian EH25 9RG, Scotland, United Kingdom Edited by Margaret G. Kidwell, University of Arizona, Tucson, AZ, and approved November 16, 2000 (received for review September 20, 2000) Sodalis glossinidius is a maternally transmitted secondary endo- selectively eliminate either Sodalis or Wigglesworthia from tsetse symbiont residing intracellularly in tissues of the tsetse flies, without inducing sterility in the host. Phylogenetic reconstruc- Glossina spp. In this study, we have used Tn5 mutagenesis and a tions based on the 16S rDNA locus reveal that Sodalis is a negative selection procedure to derive a S. glossinidius mutant that member of the family Enterobacteriaceae, which is closely related is incapable of invading insect cells in vitro and is aposymbiotic to other intracellular secondary bacterial endosymbionts found when microinjected into tsetse. This mutant strain harbors Tn5 in other insects such as the flour weevil Sitophilus zeamais and integrated into a chromosomal gene sharing high sequence iden- the aphid Acrythosiphon pisum (11–13). We are particularly tity with a type III secretion system invasion gene (invC) previously interested in Sodalis as a study model because it is known that identified in Salmonella enterica. With the use of degenerate PCR, the association between this bacterium and tsetse has only we have amplified a further six Sodalis inv͞spa genes sharing high recently been established. This association is evident from sequence identity with type III secretion system genes encoded by symbiont–host coevolution studies demonstrating the absence of Salmonella pathogenicity island 1. Phylogenetic reconstructions phylogenetic congruence in the evolution of Sodalis and tsetse based on the inv͞spa genes of Sodalis and other members of the (11). Sodalis provides an excellent model for the study of family Enterobacteriaceae have consistently identified a well- host–symbiont interactions because of the availability of an in supported clade containing Sodalis and the enteric pathogens vitro Sodalis–insect cell coculture system (14). In addition, Shigella and Salmonella. These results suggest that Sodalis may Sodalis is the only maternally transmitted insect endosymbiont to have evolved from an ancestor with a parasitic intracellular life- have been isolated and maintained in pure culture (9). In this style, possibly a latter-day entomopathogen. These observations study, we demonstrate the use of Tn5 transposon mutagenesis as Sodalis lend credence to a hypothesis suggesting that vertically transmit- a tool for generating random mutants. With the use of an in vitro negative selection procedure, we have identified Sodalis ted mutualistic endosymbionts evolve from horizontally transmit- mutants deficient in their ability to attach to and invade insect ted parasites through a parasitism–mutualism continuum. cells both in vitro and in vivo. Characterization of a noninvasive Tn5 Sodalis mutant has revealed that Sodalis relies on compo- lthough parasitism and mutualism may have radically dif- nents of a type III secretion system to facilitate entry into insect Aferent implications for host fitness, endosymbiotic bacteria cells. participating in these relationships are known to share many similarities, including an intracellular habitat (1). The exploita- Materials and Methods tion of an intracellular habitat is thought to have been one of the Bacterial Strains, Cell Lines, and Culture Conditions. Throughout this most important events in bacterial evolution, permitting signif- study, we used S. glossinidius type strain M1, a pure bacterial icant environmental niche expansion and defining the arrival of culture isolated from the hemolymph of laboratory colonized intracellular pathogens and mutualistic endosymbionts (2, 3). tsetse (9). S. glossinidius strain M1 was maintained by coculture Although there is a good understanding of the mechanisms in Aedes albopictus C6͞36 cells (15) at 25°C in liquid Mitsuhashi– contributing to bacterial pathogenesis, very little is known about Maramorosch (MM) medium (15) supplemented with 20% MICROBIOLOGY interactions between bacterial endosymbionts and their host (vol͞vol) heat-inactivated FCS (ICN). Uninfected insect cell cells. Theoretical studies assume that there may be a tradeoff cultures were passaged every 10 days with a 1:10 split into fresh between the effectiveness of horizontal and vertical modes of medium and were examined by Gimenez staining (16) and light transmission (4, 5). It has been predicted that mutualists evolve microscopy. For cloning, S. glossinidius strain M1 was cultivated on MM agar plates composed of MM medium (without FCS) from parasites through an evolutionary continuum in which ͞ parasite virulence is attenuated and transmission strategy solidified by autoclaving after the addition of 1% (wt vol) switches from horizontal to vertical (6). According to this theory, bacto-agar (Difco). MM agar plates were cultivated under microaerophilic conditions in sealed gas jars flushed with 10 vol we might expect to find that pathogens and mutualistic endo- ͞ symbionts harbor similar virulence determinants and utilize the of 5% O2 95% CO2. same machinery to facilitate invasion and survival in host cells. Transposon Mutagenesis. In the present study, we explore these issues by investigating Electrocompetent S. glossinidius was prepared on ice from 100 ml of a 5-day-old log-phase culture of genes that coordinate insect cell invasion in Sodalis glossinidius, an intracellular secondary endosymbiont of the tsetse fly (Glossi- na spp.). This paper was submitted directly (Track II) to the PNAS office. Three distinct endosymbiotic bacteria have been identified Abbreviation: MM, Mitsuhashi–Maramorosch medium. previously in the tissues of tsetse (7). Whereas one of these Data deposition: The sequences reported in this paper have been deposited in the GenBank bacteria is known to be a parasitic Wolbachia, the remaining two database (accession nos. AF306649 and AF306650). are thought to be mutualists and have been classified as the See commentary on page 1338. primary and secondary endosymbionts of tsetse (named Wiggles- †To whom reprint requests should be addressed. E-mail: [email protected]. worthia glossinidia and S. glossinidius, respectively) (8, 9). Sodalis The publication costs of this article were defrayed in part by page charge payment. This is a bacterium found exclusively in tsetse flies residing both inter- article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. and intracellularly in a number of different host tissues, including §1734 solely to indicate this fact. midgut, fat body, and hemolymph (9, 10). The symbiotic role of Article published online before print: Proc. Natl. Acad. Sci. USA, 10.1073͞pnas.021450998. Sodalis remains unclear, because it has proved difficult to Article and publication date are at www.pnas.org͞cgi͞doi͞10.1073͞pnas.021450998 PNAS ͉ February 13, 2001 ͉ vol. 98 ͉ no. 4 ͉ 1883–1888 Downloaded by guest on September 26, 2021 strain M1 (OD 600 nm ϭ 0.3) by successively pelleting (6,000 ϫ Table 1. PCR primers used in this study g, 10 min, 4°C) and resuspending bacteria in 25 ml, 2 ml, and Primer Sequence (5Ј33Ј) finally 0.2 ml of sterile 10% (vol͞vol) glycerol on ice. For electroporation, 50 ␮l of electrocompetent strain M1 was mixed Tn5F ATGAGCCATATTCAACGGGAAAC on ice in a 0.1-cm-path cuvette with 20 ng of pUTkm1 DNA, and Tn5R CCAGTGTTACAACCAATTAAC a single pulse was applied (1.9 kV, 25 ␮F, 200 ⍀). After pKT231F TGGCTACCCATAAGCCT electroporation, bacteria were transferred to a flask containing pKT231R CTCTTGCGCTGCCTCTCC 5 ml of sterile MM medium and allowed to recover by overnight In1 (invC) GGAAGCGCCGGCCAGGAG incubation at 25°C. To select for bacteria with Tn5 transposi- In2 (spaM) GCGGACACAGCCGTTGCC tions, kanamycin was added to the flask containing recovering In3 (invC) ATGMGNGCNWSNYTNYT cells (final concentration: 20 ␮g͞ml). After a further 3-day In4 (invC) TCACGCATCAAACGCATGC incubation at 25°C, kanamycin-resistant S. glossinidius was mixed In5 (invA) GCXGARGTXGCXGCXMGXTT with a suspension of insect cells (A. albopictus clone C6͞36) in In6 (invA) ARXARXGCXGGDATYTG fresh MM at multiplicity of infection of Ϸ10 to allow invasive In7 (spaP) AAYGCXYTXGGXYTXCARCA bacteria to adhere to and invade insect cells. After 24 h at 25°C, In8 (spaP) AYCATCATCATXCCXARXGC the cell suspension was vortexed gently to release attached In9 (spaQ) ARXGTYTGYTCYTGXARYTG bacterial cells. Insect cells (containing invasive S. glossinidius) In10 (spaP) GCXYTXGGXATGATGATG were pelleted by low-speed centrifugation (1,500 ϫ g, 5 min, In11 (invA) TTYATGGGXWSXTTYTAYAT 25°C). Nonadherent or noninvasive bacteria were collected by In12 (invA) GGCATGGCGTCCAGGGAGAACCGCG aspiration of the supernatant, providing enrichment for bacteria In13 (invA) CACGGTATGGAGCTTTCCGAGGCGC unable to invade insect cells. This enrichment procedure was In14 (invA) TTGGTCTCCTGAATGCCG repeated a further three times under identical conditions to In15 (spaQ) GCGACGCTGGTGGGATTGCTGGTGG ensure selection of nonadherent and noninvasive bacteria. Bac- In16 (spaS) GTXGGYTTYTCXGTYTT teria recovered from the supernatant of the final enrichment In17 (invA) TTYGGXATHCARGARACXAA
Load more

Recommended publications
  • An Endosymbiont's Journey Through Metamorphosis of Its Insect Host
    COMMENTARY An endosymbiont’s journey through metamorphosis of its insect host COMMENTARY Martin Kaltenpotha,b,1 Symbiotic microorganisms are essential for the lives of many multicellular eukaryotes (1). In insects, decades of symbiosis and—more recently—microbiome re- search have shown that microbial symbionts can supple- ment limiting nutrients, aid in digestion or detoxification, and defend their host against antagonists, thereby expanding the ecological and evolutionary potential of their hosts (2). In order to ensure that their offspring are endowed with the beneficial symbionts, insects have evolved a range of transmissionroutestopassthesym- bionts vertically from parents to offspring or acquire them horizontally from unrelated host individuals or from the environment (3, 4). However, while, at first glance, the transmission from one host individual to another might seem like the most intricate problem for a symbi- otic partnership, maintaining the symbiosis throughout the host’s development may be no less of a challenge (5). In particular, holometabolous insects like beetles, butterflies and moths, flies, ants, bees, and wasps experience a complete restructuring of the body during metamorphosis from the larva to the adult individual. While gut microbes can be maintained throughout the reorganization of the gut (6), and other extracellular symbionts can persist outside of the host’s body (7), how intracellular mutualists located Fig. 1. (Top) An adult rice weevil (S. oryzae). (Bottom) Schematic representation ’ ’ in special organs (bacteriomes) are maintained and of the symbionts journey during the weevil s metamorphosis and some of the associated gene expression changes in host and symbiont. The gut-associated sometimes even translocated during metamorphosis bacteriome dissociates into individual bacteriocytes (red) in the early pupa, remained poorly understood (but see ref.
    [Show full text]
  • Serial Horizontal Transfer of Vitamin-Biosynthetic Genes Enables the Establishment of New Nutritional Symbionts in Aphids’ Di-Symbiotic Systems
    The ISME Journal (2020) 14:259–273 https://doi.org/10.1038/s41396-019-0533-6 ARTICLE Serial horizontal transfer of vitamin-biosynthetic genes enables the establishment of new nutritional symbionts in aphids’ di-symbiotic systems 1 1 1 2 2 Alejandro Manzano-Marıń ● Armelle Coeur d’acier ● Anne-Laure Clamens ● Céline Orvain ● Corinne Cruaud ● 2 1 Valérie Barbe ● Emmanuelle Jousselin Received: 25 February 2019 / Revised: 24 August 2019 / Accepted: 7 September 2019 / Published online: 17 October 2019 © The Author(s) 2019. This article is published with open access Abstract Many insects depend on obligate mutualistic bacteria to provide essential nutrients lacking from their diet. Most aphids, whose diet consists of phloem, rely on the bacterial endosymbiont Buchnera aphidicola to supply essential amino acids and B vitamins. However, in some aphid species, provision of these nutrients is partitioned between Buchnera and a younger bacterial partner, whose identity varies across aphid lineages. Little is known about the origin and the evolutionary stability of these di-symbiotic systems. It is also unclear whether the novel symbionts merely compensate for losses in Buchnera or 1234567890();,: 1234567890();,: carry new nutritional functions. Using whole-genome endosymbiont sequences of nine Cinara aphids that harbour an Erwinia-related symbiont to complement Buchnera, we show that the Erwinia association arose from a single event of symbiont lifestyle shift, from a free-living to an obligate intracellular one. This event resulted in drastic genome reduction, long-term genome stasis, and co-divergence with aphids. Fluorescence in situ hybridisation reveals that Erwinia inhabits its own bacteriocytes near Buchnera’s. Altogether these results depict a scenario for the establishment of Erwinia as an obligate symbiont that mirrors Buchnera’s.
    [Show full text]
  • DNA Transduction in Sodalis Species: Implications for the Genetic
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.408930; this version posted December 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 DNA transduction in Sodalis species: implications for the genetic 2 modification of uncultured endosymbionts of insects 3 4 5 Chelsea M. Keller1, Christopher G. Kendra1, Roberto E. Bruna1, David Craft1, Mauricio 6 H. Pontes1,2* 7 8 9 1Department of Pathology and Laboratory Medicine, 2Department of Microbiology and 10 Immunology, Pennsylvania State University College of Medicine, Hershey, PA 17033, 11 USA. 12 13 *Corresponding author: 14 Mauricio H. Pontes 15 Penn State College of Medicine 16 Departments of Pathology, and 17 Microbiology and Immunology 18 500 University Drive, C6818A 19 Hershey, PA 17033 20 [email protected] 21 717-531-0003 ext. 320524 22 23 Running title: Bacteriophage P1-mediated transduction in Sodalis 24 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.408930; this version posted December 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 25 Abstract 26 Bacteriophages (phages) are ubiquitous in nature. These viruses play a number of 27 central roles in microbial ecology and evolution by, for instance, promoting horizontal 28 gene transfer (HGT) among bacterial species.
    [Show full text]
  • Serratia Symbiotica and Aphids 1 2 Julie Perreaua,B, Devki J. Patela
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.279018; this version posted September 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Vertical transmission at the pathogen-symbiont interface: Serratia symbiotica and aphids 2 3 Julie Perreaua,b, Devki J. Patela, Hanna Andersona, Gerald P. Maedaa, Katherine M. Elstonb, 4 Jeffrey E. Barrickb, Nancy A. Morana 5 6 a Department of Integrative Biology, University of Texas at Austin, Austin, TX 78712 7 b Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712 8 9 Running title: Serratia symbiotica at the pathogen-symbiont interface 10 11 # Address correspondence to Julie Perreau, [email protected] 12 13 14 Word count 15 Abstract: 236 16 Text (excluding the references, table footnotes, and figure legends): 5,098 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.279018; this version posted September 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 17 Abstract 18 Many insects possess beneficial bacterial symbionts that occupy specialiZed host cells and are 19 maternally transmitted. As a consequence of their host-restricted lifestyle, these symbionts often 20 possess reduced genomes and cannot be cultured outside hosts, limiting their study.
    [Show full text]
  • International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/Ijsem.0.001485
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/ijsem.0.001485 Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Mobolaji Adeolu,† Seema Alnajar,† Sohail Naushad and Radhey S. Gupta Correspondence Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Radhey S. Gupta L8N 3Z5, Canada [email protected] Understanding of the phylogeny and interrelationships of the genera within the order ‘Enterobacteriales’ has proven difficult using the 16S rRNA gene and other single-gene or limited multi-gene approaches. In this work, we have completed comprehensive comparative genomic analyses of the members of the order ‘Enterobacteriales’ which includes phylogenetic reconstructions based on 1548 core proteins, 53 ribosomal proteins and four multilocus sequence analysis proteins, as well as examining the overall genome similarity amongst the members of this order. The results of these analyses all support the existence of seven distinct monophyletic groups of genera within the order ‘Enterobacteriales’. In parallel, our analyses of protein sequences from the ‘Enterobacteriales’ genomes have identified numerous molecular characteristics in the forms of conserved signature insertions/deletions, which are specifically shared by the members of the identified clades and independently support their monophyly and distinctness. Many of these groupings, either in part or in whole, have been recognized in previous evolutionary studies, but have not been consistently resolved as monophyletic entities in 16S rRNA gene trees. The work presented here represents the first comprehensive, genome- scale taxonomic analysis of the entirety of the order ‘Enterobacteriales’.
    [Show full text]
  • From Insect Symbionts to Inhabitants of Decomposing Deadwood
    fmicb-12-668644 June 8, 2021 Time: 16:13 # 1 ORIGINAL RESEARCH published: 11 June 2021 doi: 10.3389/fmicb.2021.668644 Ecological Divergence Within the Enterobacterial Genus Sodalis: From Insect Symbionts to Inhabitants of Decomposing Deadwood Vojtechˇ Tláskal1*, Victor Satler Pylro1,2, Lucia Žifcákovᡠ1 and Petr Baldrian1 1 Laboratory of Environmental Microbiology, Institute of Microbiology of the Czech Academy of Sciences, Praha, Czechia, 2 Microbial Ecology and Bioinformatics Laboratory, Department of Biology, Federal University of Lavras (UFLA), Lavras, Brazil The bacterial genus Sodalis is represented by insect endosymbionts as well as free- living species. While the former have been studied frequently, the distribution of the latter is not yet clear. Here, we present a description of a free-living strain, Sodalis ligni sp. nov., originating from decomposing deadwood. The favored occurrence of Edited by: S. ligni in deadwood is confirmed by both 16S rRNA gene distribution and metagenome Paolina Garbeva, data. Pangenome analysis of available Sodalis genomes shows at least three groups Netherlands Institute of Ecology within the Sodalis genus: deadwood-associated strains, tsetse fly endosymbionts and (NIOO-KNAW), Netherlands endosymbionts of other insects. This differentiation is consistent in terms of the gene Reviewed by: Eva Novakova, frequency level, genome similarity and carbohydrate-active enzyme composition of the University of South Bohemia in Ceskéˇ genomes. Deadwood-associated strains contain genes for active decomposition of Budejovice,ˇ Czechia Rosario Gil, biopolymers of plant and fungal origin and can utilize more diverse carbon sources than University of Valencia, Spain their symbiotic relatives. Deadwood-associated strains, but not other Sodalis strains, *Correspondence: have the genetic potential to fix N2, and the corresponding genes are expressed in Vojtechˇ Tláskal deadwood.
    [Show full text]
  • Melophagus Ovinus (Hippoboscidae)
    Comparative analysis of symbiotic communities in Hippoboscidae Eva Nováková , Filip Husník , Václav Hypša Faculty of Science, University of South Bohemia, and Institute of Parasitology , Biology Centre, ASCR, v.v.i., Branisovka 31, 37005 Ceske Budejovice, Czech Republic Background: Methods: The family Hippoboscidae (louse flies, keds): Genome sequences and comparisons: blood-sucking ectoparasites related to tse-tse flies gDNA isolated from symbiotic organs (bacterioms), Illumina data generated similar biological characteristics: Data assembly using Velvet and CLC adenotrophic vivipary, milk glands Gene prediction and annotation done in IMG ER pipeline (JGI) and /or RAST Comparative analyses carried out using RAST, KEGG, SEED two hosts selected for a functional comparison: Melophagus ovinus (sheep ked) Lipoptena cervi (deer ked) Localization: LEM, TEM, FISH on parafin embeded tissue samples Host: Melophagus ovinus (Hippoboscidae ) Host: Lipoptena cervi (Hippoboscidae ) Table 1. Host associated organisms and their draft genomes Chromosome size Number of Total number of G+C Coding Chromosome Number of Total number of G+C Coding Associated organism (Mb) scaffolds */ contigs # genes content density Associated organism size (Mb) scaffolds */ contigs # genes content density Arsenophonus melophagi 1.15 40 # 765 32% 61% Arsenophonus lipopteni 0.83 6# 633 25% 76% Sodalis melophagi 4.5 230* Bartonella melophagi 1.5 25 # Wolbachia low coverage Trypanosoma melophagium low coverage Results: Major differences were found between the two studied systems. While Melophagus ovinus hosts a complex symbiotic community of four bacterial species, Lipoptena cervi only harbors Arsenophonus bacterium (Table 1). In both hosts, Arsenophonus represents an obligate nutritional symbiont , capable of synthesizing all of the B vitamins (except for thiamine for which it carries a specific ABC transporter) .
    [Show full text]
  • Paratransgenesis As a Tool to Block Trypanosome Transmission by Tsetse
    Paratransgenesis as a tool to block trypanosome transmission by tsetse. Jan Van Den Abbeele THIRD FAO/IAEA INTERNATIONAL CONFERENCE ON AREA-WIDE MANAGEMENT OF INSECT PESTS: INTEGRATING THE STERILE INSECT AND RELATED NUCLEAR AND OTHER TECHNIQUES VIENNA, 22 - 26 MAY 2017 DEPARTMENT BIOMEDICAL SCIENCES Outline of the presentation Background on tsetse-transmitted trypanosomiases and its control Potential role of paratransgenic refractory tsetse flies within SIT programs Paratransgenesis in tsetse fly: proof-of-concept; current bottlenecks DEPARTMENT BIOMEDICAL SCIENCES Tsetse-transmitted African trypanosomiasis HAT; sleeping sickness T.brucei gambiense; T.brucei Parasitic disease(s) caused by Tsetse fly (Glossina sp.) rhodesiense Trypanosoma sp. (protozoa, kinetoplastidae) in different host species (man, bovine, goat,…). Distribution: sub-Saharan Africa Trypanosoma sp. TYPEAAT NAME; nagana DEPARTMENT IN WINDOW T.congolense; T.vivax; T.brucei brucei DEPARTMENT BIOMEDICAL SCIENCES Tsetse-transmitted African trypanosomiasis HAT (in 2015) AAT DRC: 2.351 new cases Remains one of the biggest infectious (>85% ); disease constraints to productive livestock rearing in sub-Saharan Africa: CAR: 146; cattle breeding (increase of 100 cases in mortality and morbidity) surrounding countries reduction of meat / milk remote, rural areas AAT production: lower income, > 60 million people are reduction of nutritional proteins still at risk losses in animal traction WHO: elimination by 2025? power: reduction of the yields e.g. TRYP-ELIM program in DRC and the surface area that can (ITM, PNLTHA, LSTM – B&M be cultivated; restricted land funding) usage DEPARTMENT BIOMEDICAL SCIENCES Tsetse-transmitted African trypanosomiasis: control HAT: AAT: Active case detection Diagnosis by the local vet/farmer,… Treatment: two main drugs: Accurate and rapid diagnosis; stage isometamidum chloride, diminazene determination aceturate; homidium; important issues: Treatment: limited amount of drugs quality of the drugs on the local market; available; drug resistance? drug resistance.
    [Show full text]
  • Evolutionary Replacement of a Reduced Genome Symbiont
    The ISME Journal (2014) 8, 1237–1246 & 2014 International Society for Microbial Ecology All rights reserved 1751-7362/14 www.nature.com/ismej ORIGINAL ARTICLE Swapping symbionts in spittlebugs: evolutionary replacement of a reduced genome symbiont Ryuichi Koga1,2 and Nancy A Moran1,3 1Microbial Diversity Institute, Yale University, West Haven, CT, USA; 2Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki, Japan and 3Department of Integrative Biology, University of Texas at Austin, Austin, TX, USA Bacterial symbionts that undergo long-term maternal transmission experience elevated fixation of deleterious mutations, resulting in massive loss of genes and changes in gene sequences that appear to limit efficiency of gene products. Potentially, this dwindling of symbiont functionality impacts hosts that depend on these bacteria for nutrition. One evolutionary escape route is the acquisition of a novel symbiont with a robust genome and metabolic capabilities. Such an acquisition has occurred in an ancestor of Philaenus spumarius, the meadow spittlebug (Insecta: Cercopoidea), which has replaced its ancient association with the tiny genome symbiont Zinderia insecticola (Betaproteobacteria) with an association with a symbiont related to Sodalis glossinidius (Gammaproteobacteria). Spittlebugs feed exclusively on xylem sap, a diet that is low both in essential amino acids and in sugar or other substrates for energy production. The new symbiont genome has undergone proliferation of mobile elements resulting in many gene inactivations; nonetheless, it has selectively maintained genes replacing functions of its predecessor for amino- acid biosynthesis. Whereas ancient symbiont partners typically retain perfectly complementary sets of amino-acid biosynthetic pathways, the novel symbiont introduces some redundancy as it retains some pathways also present in the partner symbionts (Sulcia muelleri).
    [Show full text]
  • Comparative Genomic Analysis of the Supernumerary Fagellar Systems Among the Enterobacterales
    Flagella by numbers: comparative genomic analysis of the supernumerary agellar systems among the Enterobacterales Pieter De Maayer ( [email protected] ) School of Molecular and Cell Biology, University of the Witwatersrand https://orcid.org/0000-0001- 8550-642X Talia Pillay University of the Witwatersrand Teresa A Coutinho University of Pretoria Research article Keywords: Enterobacterales, supernumerary agella, ag, evolution, motility Posted Date: August 21st, 2020 DOI: https://doi.org/10.21203/rs.3.rs-25380/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on September 29th, 2020. See the published version at https://doi.org/10.1186/s12864-020-07085-w. Page 1/24 Abstract Background: Flagellar motility is an ecient means of movement that allows bacteria to successfully colonize and compete with other microorganisms within their respective environments. The production and functioning of agella is highly energy intensive and therefore agellar motility is a tightly regulated process. Despite this, some bacteria have been observed to possess multiple agellar systems which allow distinct forms of motility. Results: Comparative genomic analyses showed that, in addition to the previously identied primary peritrichous (ag-1) and secondary, lateral (ag-2) agellar loci, three novel types of agellar loci, varying in both gene content and gene order, are encoded on the genomes of members of the order Enterobacterales. The ag-3 and ag-4 loci encode predicted peritrichous agellar systems while the ag- 5 locus encodes a polar agellum. In total, 798/4,028 (~20%) of the studied taxa incorporate dual agellar systems, while nineteen taxa incorporate three distinct agellar loci.
    [Show full text]
  • DNA Transduction in Sodalis Species: Implications for the Genetic
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.408930; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 DNA transduction in Sodalis species: implications for the genetic 2 modification of uncultured endosymbionts of insects 3 4 5 Chelsea M. Keller, Christopher G. Kendra, Roberto E. Bruna, David Craft, Mauricio H. 6 Pontes* 7 8 9 Department of Pathology and Laboratory Medicine, Department of Microbiology and 10 Immunology, Pennsylvania State University College of Medicine, Hershey, PA 17033, 11 USA. 12 13 *Corresponding author: 14 Mauricio H. Pontes 15 Penn State College of Medicine 16 Departments of Pathology, and 17 Microbiology and Immunology 18 500 University Drive, C6818A 19 Hershey, PA 17033 20 [email protected] 21 717-531-0003 ext. 320524 22 23 Running title: Bacteriophage P1-mediated transduction in Sodalis 24 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.408930; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 25 Abstract 26 Bacteriophages (phages) are ubiquitous in nature. These viruses play a number of 27 central roles in microbial ecology and evolution by, for instance, promoting horizontal 28 gene transfer (HGT) among bacterial species.
    [Show full text]
  • Repeated Replacement of an Intrabacterial Symbiont in the Tripartite Nested Mealybug Symbiosis
    Repeated replacement of an intrabacterial symbiont in the tripartite nested mealybug symbiosis Filip Husnika,b,c,1 and John P. McCutcheona,d,1 aDivision of Biological Sciences, University of Montana, Missoula, MT 59812; bInstitute of Parasitology, Biology Centre of the Czech Academy of Sciences, Ceske Budejovice 37005, Czech Republic; cFaculty of Science, University of South Bohemia, Ceske Budejovice 37005, Czech Republic; and dCanadian Institute for Advanced Research, Program in Integrated Microbial Biodiversity, Toronto, ON, Canada M5G 1Z8 Edited by Jeffrey D. Palmer, Indiana University, Bloomington, IN, and approved July 19, 2016 (received for review March 8, 2016) Stable endosymbiosis of a bacterium into a host cell promotes dicted to encode proteins and RNAs with decreased structural cellular and genomic complexity. The mealybug Planococcus citri has stability (26, 27). In symbioses where the endosymbiont is re- two bacterial endosymbionts with an unusual nested arrangement: quired for normal host function, such as in the bacterial endo- the γ-proteobacterium Moranella endobia lives in the cytoplasm of symbionts of sap-feeding insects, this degenerative process can the β-proteobacterium Tremblaya princeps. These two bacteria, trap the host in a symbiotic “rabbit hole,” where it depends com- along with genes horizontally transferred from other bacteria to pletely on a symbiont which is slowly degenerating (28). the P. citri genome, encode gene sets that form an interdependent Unimpeded, the natural outcome of this degenerative process metabolic patchwork. Here, we test the stability of this three-way would seem to be extinction of the entire symbiosis. However, symbiosis by sequencing host and symbiont genomes for five di- extinction, if it does happen, is difficult to observe, and surely is verse mealybug species and find marked fluidity over evolutionary not the only solution to dependency on a degenerating symbiont.
    [Show full text]