The Hybrid Origin of Adiantum Meishanianum (Pteridaceae): a Rare and Endemic Species in Taiwan

Home , Adiantum caudatum, Adiantum philippense, Adiantum reniforme, Adiantum tenerum

The Hybrid Origin of Adiantum meishanianum (Pteridaceae): A Rare and Endemic Species in Taiwan Author(s): Wan-Yu Zhang, Li-Yaung Kuo, Fay-Wei Li, Chun-Neng Wang, and Wen-Liang Chiou Source: Systematic Botany, 39(4):1034-1041. 2014. Published By: The American Society of Plant Taxonomists URL: http://www.bioone.org/doi/full/10.1600/036364414X682616

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Systematic Botany (2014), 39(4): pp. 1034–1041 © Copyright 2014 by the American Society of Plant Taxonomists DOI 10.1600/036364414X682616 Date of publication July 9, 2014 The Hybrid Origin of Adiantum meishanianum (Pteridaceae): A Rare and Endemic Species in Taiwan

Wan-Yu Zhang,1,4 Li-Yaung Kuo,1,4 Fay-Wei Li,2 Chun-Neng Wang,1,5 and Wen-Liang Chiou3,5 1Institute of Ecology and Evolutionary Biology, National Taiwan University, Taipei 10617, Taiwan. 2Department of Biology, Duke University, Durham, North Carolina 27708, U. S. A. 3Division of Botanical Garden, Taiwan Forestry Research Institute, Taipei 10066, Taiwan. 4These authors contributed equally. 5Author for correspondence (CNW: [email protected]; WLC: [email protected])

Communicating Editor: Thomas L. P. Couvreur

Abstract—Adiantum meishanianum is an endemic species distributed only in Meishan village, Kaohsiung, Taiwan. Because its sporangia contain only abortive spores, A. meishanianum has been regarded as having a hybrid origin, presumably with A. caudatum, A. malesianum,and A. philippense as the putative parents. The aim of this study is to confirm the hybrid origin and determine the parental lineages of A. meishanianum by examining cytology, reproductive modes, and using molecular phylogenetics. We found that the sequences of two chloroplast regions, rps16-matK intergenic spacer and the matK gene, are identical between A. meishanianum and A. malesianum, suggesting A. malesianum is the maternal parent. The nuclear phylogeny reconstructed based on the low-copy marker, CRY2 first intron, reveals that A. meishanianum has three types of sequences: one type groups with sequences of sexual diploid individuals of A. philippense and the other two group with sequences of the sexual tetraploid A. malesianum, indicating that A. philippense is the paternal species. Our data further imply that the extant A. meishanianum probably originated from a single hybridization event, and its rarity is likely due to the limited distribution of the paternal parent.

Keywords—Adiantum malesianum, Adiantum philippense, CRY2 first intron, cryptic species, hybridization.

Adiantum meishanianum F. S. Hsu ex Y. C. Liu & W. L. regions of selected Adiantum species. Based on the sequences obtained, Chiou (Pteridaceae), a rare species endemic to Taiwan we designed three specific primers: “Adn rps16 fEET”, “Adn matK rRLF”, and “Adn matK fHIS”. The PCR reactions were performed in (Liu et al. 2009), has only been found in Meishan village, 15 mL reaction volumes, including 20 ng genomic DNA, 1 + PCR buffer, Kaohsiung City, Taiwan, with a single population, and is 200 mM dNTP, 15 pmol of each primer, and 0.5 U polymerase (GENET considered as critically endangered (Wang et al. 2012). Hsu BIO ExPrime Taq DNA Polymerase, Korea). The detailed information (1993) first reported that A. meishanianum is a triploid spe- of these primers and PCR conditions can be found in Table 1. Nuclear dataset—Phylogenies based on biparentally inherited DNA cies based on a somatic chromosome count (2n = 90). Lee markers, particularly low-copy nuclear genes, provide an efficient way to et al. (2007) later found that A. meishanianum produces only disentangle the reticulate relationships caused by hybridization and/or aborted spores, which either fail to germinate or develop polyploidization (Ebihara et al. 2005; Adjie et al. 2007; Li et al. 2012; Sessa into abnormal gametophytes, suggesting that this species et al. 2012). Only recently have such molecular markers become readily is a sterile triploid hybrid. The persistence and expansion available to fern biologists (Rothfels et al. 2013). However, the universality of these regions and developed primers for these nuclear genes usually of the population of A. meishanianum seems to rely solely vary among fern lineages (Chen at al. 2012; Rothfels et al. 2013). on vegetative propagation via adventitious buds borne on As a case study, we developed a novel low-copy nuclear marker: the elongated rachis tips. Among the once-pinnate species of the first intron of the cryptochrome gene (CRY), which encodes a blue Adiantum in Taiwan, A. caudatum L., A. malesianum Ghatak. light photoreceptor. It is an ideal nuclear marker for Adiantum species because the copy number and exon/intron positions are known from and A. philippense L. have been hypothesized as the parental A. capillus-veneris L. (Kanegae and Wada 1998; Imaizumi et al. 2000). candidates due to their morphological similarities, includ- Among the non-coding regions of the five A. capillus-veneris CRY ing the long pinna stalk (3–4 mm), the semi-orbiculate basal genes, the first intron is most stable in its exon/intron boundary. Thus, pinnae, and the adventitious bud on the elongated rachis based on the published A. capillus-veneris CRY1–5 coding sequences, (Hsu 1993; Lee et al. 2007; Liu et al. 2009). we first designed one degenerate primer set to target the first intron (“Adn CRY fPEE” and “Adn CRY rDLL”). By electrophoresis in 1 + TBE This study aims to resolve the hybrid origin of A. meishanianum 0.8% agarose gel, we verified, isolated, and sequenced the PCR prod- by reconstructing the phylogenies based on both chloroplast ucts of 400 bp, which contains only the amplicons from CRY2. After and nuclear DNA sequences of all once-pinnate Adiantum we obtained partial CRY2 first exon and second exon sequences from species in Taiwan. The ploidy and reproductive modes of A. caudatum, A. meishanianum,andA. philippense, a specific primer set to amplify once-pinnate Adiantum CRY2 first intron was designed: the candidate parental species, as determined by the spore “Adn CRY2 fHLN” and “Adn CRY2 rVKQ”. All PCR reactions were number per sporangium and cytological evidence, were fur- carried out as described above. Other details of primer information ther examined to confirm the hybrid relationships. and PCR conditions can be found in Table 1. To distinguish different sequence types after PCR (i.e. alleles or homeologs), single-strand conformation polymorphism (SSCP) was used Materials and Methods when the direct sequencing of amplicons of “Adn CRY2 fHLN + Adn CRY2 rVKQ” failed. The protocol of SSCP electrophoresis followed Chloroplast dataset—We sampled 17 Adiantum species, representing Ebihara et al. (2005). Before SSCP electrophoresis, the PCR products were all major clades in the genus (Lu et al. 2012) and including all of the purified using a Gel/PCR purification kit (Genomics, Taipei, Taiwan) and once-pinnate species in Taiwan (Knapp 2011). DNA was extracted using eluted with ddH2O. After SSCP electrophoresis, all gel slices containing a modified CTAB procedure (Wang et al. 2004). We adopted the strategy the separated single-strand DNA products (i.e. bands) were purified by of Kuo et al. (2011) to design specific primers for the chloroplast DNA the same purification kit, and were re-amplified and sequenced. (cpDNA) regions, matK and rps16-matK intergenic spacer (IGS). First, we Voucher information of the materials used in chloroplast or nuclear applied universal primers (“FERN chlB fYAA”, “FERN rps16 fQCGR”, DNA analyses of this study is summarized in the Appendices. “FERN rps16 fSRQE”, “FERmatK fEDR”, and “FERmatK rAGK”) to Phylogenetic analyses—DNA sequences were aligned using ClustalW generate sequences of matK, rps16 second exon and rps16-matK IGS implemented in BioEdit (Hall 1999) and the alignments were edited

1034 2014] ZHANG ET AL.: HYBRID ORIGIN OF ADIANTUM MEISHANIANUM 1035

Table 1. The sequences and PCR condition of primers used in this study. *Primer for sequencing. #Primer for sequencing Adiantum caudatum rps16-matK IGS.

PCR Tm / Primer names Primer sequence 50-30 Target region Target taxon extension time Reference Adn CRY fPEE* CCWGADGARGARGGNCARTT CRY1–5 intron1 Adiantum 49C / 90s this study Adn CRY rDLL* TTYAATGSMGAYYTBCTGTATGAGCC CRY -5 intron1 Adiantum 49C / 90s this study Adn CRY2 fHLN* CACCTCAATGAATCTCTCACAA CRY2 intron1 once-pinnate 65C / 30s this study Adiantum Adn CRY2 rVKQ* GCCTGRGAGAGCCCCTGTTTCAC CRY2 intron1 once-pinnate 65C / 30s this study Adiantum FERN ch1B fYAA# GATGTRAYGTATGCRGCYAAAGA rps16-matK IGS for all ferns 55C / 90s Kuo et al. 2011 FERN rpsl6 fQCGR CRMTRTGGTAGRAAGCAAC rps16-matK IGS for all ferns 55C / 90s Kuo et al. 2011 FERN rpsl6 fSRQE* CCCGRMRAGAAGGGARAG rps16-matK IGS for all ferns 55C / 90s Kuo et al. 2011 Adn rps16 fEET* GAGGAAACYCAGCTAGATMTTT rps16-matK IGS Adiantum 49C / 90s this study Adn rps16 rRLF* ACATCTYTAATTTGTCGTCGAAAYAATCG rps16-matK IGS Adiantum 49C / 90s this study and matK FERmatK fEDR* ATTCATTCRATRTTTTTATTTHTGGARGAYAGATT matK for all ferns 53C / 60s Kuo et al. 2011 FERmatK rAGK CGTRTTGTACTYYTRTGTTTRCVAGC matK for all ferns 53C / 60s Kuo et al. 2011 Adn matK fIHS* ATTCATTCRATATTTYYATTTYTGGAAGATAGATT matK Adiantum 53C / 60s this study manually. To infer the appropriate nucleotide substitution model for The nuclear DNA (nrDNA) matrix of CRY2 first intron the following phylogenetic analyses, jModelTest (Posada 2008) was contained a total of 471 characters, 157 of them were vari- employed, and the model was selected based on Akaike information criterion (Akaike 1974). Garli 2.0 (Zwickl 2006) was used to reconstruct able. The log-likelihood score was -16,723.999137 for the the maximum likelihood (ML) phylogeny. The proportion of invari- most likely ML tree. Among three sequence types of ant sites and state frequencies were estimated by the program. The A. meishanianum, two of them were identical to those of “genthreshfortopoterm” option was set to 20,000. To calculate ML A. malesianum, and the other identical to those of the sexual bootstrap support (MLBS) values, 500 replicates were run under the A. philippense same criteria. Bayesian phylogenetic inference was performed by diploid (Fig. 2). MrBayes v.3.1.2 (Huelsenbeck and Ronquist 2001; Ronquist and Cytotype and reproductive mode—By somatic chromo- Huelsenbeck 2003). Two simultaneous runs were carried out with four some counting, one A. caudatum, one A. philippense, and 6 chains (10 generations each), in which each chain was sampled every one A. meishanianum were shown with 2n = 90 (or ca. 90) 1,000 generations. The first 25% of the sample was discarded as burn-in, (Table 2; Fig. 3). As a result, they were all designated as and the rest were used to calculate the 50% majority-rule consensus tree. Ploidy and reproductive mode inference—Ploidy analyses were con- triploids since the known chromosome basic number is 29 ducted on A. caudatum, A. malesianum, A. meishanianum, and A. philippense, or 30 in Adiantum (Lo¨ve et al. 1977; Tryon et al. 1990). and were carried out by either somatic chromosome squashing or Using these individuals as the standards, the ploidy of flow cytometry. other living collections was examined by flow cytometry Root tip squashes were used to count somatic chromosomes. Root tips were collected between 6–8 AM and pretreated with 70 ppm (Fig. 3D). For A. malesianum and A. meishanianum, only cycloheximide and 250 ppm 8-hydroxyquinoline (1:1) at 18–20Cfor sexual tetraploids and sterile triploids were found, respec- 8 h. They were fixed sequentially in 100% acetic acid and absolute tively (Table 2). In A. caudatum, sexual diploids and apo- ethanol (1:3) overnight and preserved in 70% ethanol at 4 C. Then they mictic triploids were found (Table 2). In A. philippense, were macerated in 1 N HCl at 60C for 10 s, and digested with 4% pectinase (SIGMA, St. Louis, Missouri) for 1–2 h. Finally, mitotic sexual diploids, apomictic diploids, and apomictic triploids chromosomes were stained by modified carbol fuchsin stain and exam- were found (Table 2). ined under a microscope (Sharma 1982; Huang et al. 2006). By using the individuals with known somatic chromosome number as the standards, flow cytometry analyses were applied to confirm the Discussion ploidy of other living collections. The pretreatment of materials for flow cytometry analyses followed Ebihara et al. (2005), and the BD Hybrid origin of A. meishanianum—The monophyly of FACSCan system (BD Biosciences, Franklin Lake, New Jersey) was used. A. meishanianum + A. malesianum in the cpDNA phylogeny Reproductive mode was assessed by counting spore number per indicates that these two species share the same maternal sporangium. In Adiantum, 64 and 32 spores per sporangium suggest progenitor (Fig. 1), assuming that the chloroplast is mater- sexual and apomictic individuals, respectively (Ko 2011). In this study, five sporangia per individual were selected to examine their spore nally inherited as in many ferns (Gastony and Yatskievich numbers per sporangium. 1992; Vogel et al. 1998; Adjie et al. 2007). The phylogeny reconstructed using low-copy nuclear marker reveals that Results A. meishanianum contains identical sequence types of CRY2 first intron with A. malesianum and with the sexual diploid Phylogenetic analyses—The cpDNA alignment matrix of A. philippense (Fig. 1; Table 2). Taken together, triploid rps16-matK IGS + matK contained a total of 2,364 characters A. meishanianum is likely the hybrid of A. malesianum (as with 1,404 variable sites. The log-likelihood score for the maternal progenitor providing diploid egg) and A. philippense most likely ML tree was -1709.230276 (Fig. 1). In the cpDNA (as paternal progenitor providing haploid sperm). phylogeny, all the once-pinnate Adiantum species formed Lee et al. (2007) proposed that the A. caudatum complex in a highly supported monophyletic group (Fig. 1). Within this Taiwan, which includes A. caudatum and A. malesianum, and clade, the monophyly of A. malesianum and A. meishanianum A. philippense are the parental candidates of A. meishanianum. received MLBS of 100. All the matK + rps16-matK IGS Adiantum caudatum should be excluded from the ances- sequences of A. meishanianum were identical with those of tors of A. meishanianum because these two species are not A. malesianum, except for the A. malesianum sample Ma2 col- closely related in the cpDNA and nrDNA phylogenies lected from Nantou County. (Figs. 1, 2). However, there are several additional species 1036 SYSTEMATIC BOTANY [Volume 39

Fig. 1. The ML phylogeny based on rps16-matK + matK of 17 Adiantum species and Cheilanthes lindheimeri. ML bootstrap support (MLBS) values and posterior probabilities of Bayesian phylogenetic inference (PP) are indicated on each branch, as MLBS/PP. The plus (+) sign represents MLBS = 100 or PP = 1.00. The thickened branch indicates MLBS ≧70 and PP ≧0.95. The gray arrow indicates the lineage with A. meishanianum. 2014] ZHANG ET AL.: HYBRID ORIGIN OF ADIANTUM MEISHANIANUM 1037

Fig. 2. The ML phylogeny based on CRY2 first intron of only once-pinnate Adiantum species in Taiwan. ML bootstrap support (MLBS) values and posterior probabilities of Bayesian phylogenetic inference (PP) are indicated on each branch, as MLBS/ PP. The plus (+) sign represents MLBS = 100 or PP = 1.00. The thickened branch indicates MLBS ≧70 and PP ≧0.95. The gray arrows indicate the lineages with A. meishanianum. in the A. caudatum complex that occur outside of Taiwan. A. meishanianum, is morphologically indistinguishable with Some of them are morphologically similar but cytologi- the conspecific apomictic triploid (Table 3), which belongs cally appear as different species, including A. incisum to subsp. philippense (Verma and Fraser-Jenkins 2008). How- Forssk., A. indicum Ghatak [or A. recurvatum (D. Don) ever, genetically, they diverge greatly, as revealed by the Fraser-Jenk.], and A. Adiantum zollingeri Mett. ex Kuhn cpDNA and nrDNA phylogenies (Figs. 1, 2). Although (Manton et al. 1967, 1970; Sinha and Manton 1970; diploids of subsp. philippense were also reported outside of Fraser-Jenkins 2008). Further phylogenetic investigation Taiwan, all of them are known as apomictic, (i.e. producing including these species is necessary to clarify their status 32-spored sporangia; Cheng and Zhang 2010), including the and relationships. individual from Thailand sampled here. Interestingly, in As suggested by the SSCP banding pattern, the CRY2 first our cpDNA and nrDNA phylogenies, the apomictic diploid intron sequence and its composition seem consistent across from Thailand (sample P18) grouped with apomictic trip- the sampled individuals (data not shown). Thus, the ploidy, loids instead of with other sexual diploids (Figs. 1, 2). In cpDNA, and nrDNA sequences are completely identical addition, based on our flow cytometry results, this apomictic across all the A. meishanianum individuals we sampled. diploid contains a larger nuclear genome size compared to These data do not provide any evidence supporting the the sexual ones (data not shown). These data suggest the multiple origins of A. meishanianum. Instead, a single hybrid possibility of one or more cryptic species under A. philippense, origin followed by subsequent population expansion via and that the sexual diploid members of A. philippense in vegetative propagation (i.e. adventitious buds at the rachis Taiwan are different from their apomictic counterparts. To tip) is a more likely scenario. further clarify the species boundaries, studies including Cryptic species Under A. philippense—The sexual diploid another sexual diploid subspecies, subsp. teestae S. C. A. philippense in Taiwan (Fig. 4B), the paternal parent of Verma & Fraser-Jenkins, are needed. 1038 SYSTEMATIC BOTANY [Volume 39

Table 2. The information of Adiantum materials examined with ploidy level, reproductive mode, and molecular phylogeny. All the vouchers are kept in TAIF. KBCC = Dr. Cecilia Koo Botanic Conservation Center. aThe ploidy confirmed by flow cytometry analyses.

Sample Living Collections Taxa No. Locality Ploidy Reproduction Voucher in KBCC Adiantum caudatum L. C1 Dakeng, Taichung City, Taiwan 3Xa Apomixis 20081109–21MO - C2 Qingshuiyan, Changhua County, Taiwan 3Xa Apomixis 20100502–034MO - C3 Zengwen Reservoir, Chiayi County, Taiwan 3Xa Apomixis Liu6808-e K017626 C4 Mt. Dagang, Kaohsiung City, Taiwan 3Xa Apomixis 20081125–16bMO - C5 Liangshan, Pingtung County, Taiwan 2Xa Sexual - K013900 C6 Mt. Laofo, Pingtung County, Taiwan 3Xa Apomixis - K017393 C7 Jinfeng, Taitung City, Taiwan 3Xa Apomixis ZWY310 - C8 Gushan, Kaohsiung City, Taiwan 3X (2n = ca. 90) Apomixis Kuo3924 K022992 Adiantum malesianum Ghatak Ma1 Mt. Shitou, Miaoli County, Taiwan 4Xa Sexual Kuo3933 K019612 Ma2 Zhongliao, Nantou County, Taiwan 4Xa Sexual 20080907–05MO - Ma3 Guanyin waterfall, Chiayi County, Taiwan 4Xa Sexual Kuo3932 K013775 Ma4 Longci, Tainan County, Taiwan 4Xa Sexual 20070903–113MO - Ma5 Meishankou, Kaohsiung City, Taiwan 4Xa Sexual Kuo3934 K022539 Ma6 Jiayi, Pingtung County, Taiwan 4Xa Sexual 20070730-MO - Ma7 Dali, Haulian County, Taiwan 4Xa Sexual Liu9530 - Adiantum meishanianum Me1 Meishankou, Kaohsiung City, Taiwan 3Xa Sterile Liu5002 - F. S. Hsu ex Y. C. Liu & Me2 Meishankou, Kaohsiung City, Taiwan 3X (2n = ca. 90) Sterile Kuo3917-M02 - W. L. Chiou Me3 Meishankou, Kaohsiung City, Taiwan 3Xa Sterile Kuo3917-M03 - Me4 Meishankou, Kaohsiung City, Taiwan 3Xa Sterile Kuo3917-M05 - Me5 Meishankou, Kaohsiung City, Taiwan 3Xa Sterile Kuo3917-M07 - Me6 Meishankou, Kaohsiung City, Taiwan 3Xa Sterile Kuo3917-M08 - Adiantum philippense L. P1 Fuxing, Taoyuan County, Taiwan 3Xa Apomixis - - P2 Jianshih, Hsinchu County, Taiwan 3Xa Apomixis - K022991 P3 Chunyang, Nantou County, Taiwan 3Xa Apomixis - - P4 Caohu, Taichung City, Taiwan 3Xa Apomixis - K022990 P5 Wanda Reservoir, Nantou County, Taiwan 3X (2n = 90) Apomixis - K022545 P6 Mt. Duli, Chiayi County, Taiwan 3Xa Apomixis - K022993 P7 Zengwen Reservoir, Chiayi County, Taiwan 3Xa Apomixis - K022542 P8 Zengwen Reservoir, Chiayi County, Taiwan 3Xa Apomixis Liu6810 - P9 Nanhua Reservoir, Tainan County, Taiwan 3Xa Apomixis Kuo3935 K022543 P10 Nanhua Reservoir, Tainan County, Taiwan 3Xa Apomixis - K022544 P11 Shanping, Kaohsiung City, Taiwan 3Xa Apomixis - K022546 P12 Neishi, Pingtung County, Taiwan 3Xa Apomixis MO2390 - P13 Shanping, Kaohsiung City, Taiwan 2Xa Sexual Kuo3936 K018606 P14 Meishankou, Kaohsiung City, Taiwan 2Xa Sexual MO Awan-1 - P15 Meishankou, Kaohsiung City, Taiwan 2Xa Sexual - K022540 P16 Mt. Kuolen, Cambodia - - MO1635 K018416 P17 Cat Tien, Vietnam - - Wade1406 - P18 Kan-chanaburi, Thailand 2Xa Apomixis Kuo3937 K019788 P19 Hainan County, China - - Kuo1679 K032799 Adiantum caudatum L. C1 Dakeng, Taichung City, Taiwan 3Xa Apomixis 20081109–21MO - C2 Qingshuiyan, Changhua County, Taiwan 3Xa Apomixis 20100502–034MO -

Table 3. The morphological comparison of the Adiantum taxa examined in this study.

Species A. caudatum A. caudatum A. malesianum A. meishanianum A. philippense A. philippense Ploidy (2n) 2X3X4X3X2X3X Reproductive mode sexual apomixis sexual sterile sexual apomixis Number of pinnae 20–30 20–40 20–30 10–20 5–20 5–15 Shape of basal pinna flabellate flabellate semi-orbiculate semi-orbiculate flabellate flabellate Shrink basal pinnae no yes no no no no Length of pinnae stalk (mm) 0.5–1 0.5–1 1–3 3–5 5–15 3–25 Rachis adxial densely hairy densely hairy densely hairy glabrous glabrous glabrous Rachis abxial densely hairy sparsely hairy densely hairy sparsely hairy glabrous glabrous Lamina adxial glabrous or sparsely hairy densely hairy glabrous glabrous glabrous sparsely hairy Lamina abxial glabrous or sparsely or densely hairy glabrous glabrous glabrous sparsely hairy densely hairy False indusium meddle densely hairy densely hairy glabrous or glabrous glabrous glabrous sparsely hairy False indusium margin sparsely hairy densely hairy densely hairy glabrous glabrous glabrous Sterile pinna dissection deep shallow - middle shallow shallow-middle deep deep Fertile pinna dissection deep shallow - middle shallow shallow-middle deep shallow 2014] ZHANG ET AL.: HYBRID ORIGIN OF ADIANTUM MEISHANIANUM 1039

Fig. 3. Somatic chromosome photograph of Adiantum caudatum (A, 2n = ca. 90), A. philippense (B, 2n = 90), and A. meishanianum (C, 2n = ca. 90). Flow cytometry results (D) of sexual diploid A. philippense, A. meishanianum,andA. malesianum.

In conclusion, our study resolved the hybrid origin of for their comments on this manuscript. This research was supported Adiantum meishanianum through the analyses of ploidy, by National Science Council (Grant no. 100-2621-B-002-003) and by Taiwan Forestry Research Institute (Grant no. 101AS-13.5.2-FI-G4). sequences of chloroplast and nuclear DNA, and reproductive modes. We show that A. meishanianum (Fig. 4A) is the sterile triploid hybrid between sexual diploid A. philippense Literature Cited (as the paternal parent; Fig. 4B) and sexual tetraploid Adjie, B., S. Masuyama, H. Ishikawa, and Y. Watano. 2007. Indepen- A. malesianum (as the maternal parent; Fig. 4C). The extant dent origins of tetraploid cryptic species in the fern Ceratopteris population of A. meishanianum probably originated from thalictroides. Journal of Plant Research 120: 129–138. a single hybridization event. The rarity and endemism of Akaike, H. 1974. A new look at the statistical model identification. IEEE A. meishanianum are likely due to the limited distribution Transactions on Automatic Control 19: 716–723. of the sexual diploid populations of A. philippense, which Chen, C. W., L. Y. Kuo, C. N. Wang, and W. L. Chiou. 2012. Development of a PCR primer set for intron 1 of the low-copy gene LEAFY in probably represent a cryptic species under subsp. philippense Davalliaceae. American Journal of Botany 99: e223–e225. and have only been recorded from Meishan village and Cheng, X. and S. Z. Zhang. 2010. Index to chromosome numbers of Shanping in Southern Taiwan. Chinese Pteridophyta (1969–2009). Journal of Fairylake Botanical Garden 9: 1–58. Ebihara, A., H. Ishikawa, S. Matsumoto, S. J. Lin, K. Iwatsuki, M. Taxonomic Treatment Takamiya, Y. Watano, and M. Ito. 2005. Nuclear DNA, chloroplast DNA, and ploidy analysis clarified biological complexity of the Adiantum +meishanianum F. S. Hsu ex Y. C. Liu & W. L. Vandenboschia radicans complex (Hymenophyliaceae) in Japan and Chiou (pro sp.) Description: A hybrid species between adjacent areas. American Journal of Botany 92: 1535–1547. Frasser-Jenkins, C. R. 2008. Taxonomic revision of three hundred Indian Adiantum malesianum Ghatak (as the maternal parent) subcontinental pteridophytes with a revised census-list: a new picture and sexual diploid Adiantum philippense L. (as the of fern-taxonomy and nomenclature in the Indian subcontinent. Dehra paternal parent). Dun, India: Bishen Singh Mahendra Pal Singh. Gastony, G. J. and G. Yatskievich. 1992. Maternal inheritance of the Acknowledgments. We thank Chun-Ming Chen (Dr. Cecilia Koo chloroplast and mitochondrial genomes in cheilanthoid ferns. Botanic Conservation Center, KBCC) for help in maintaining and pro- American Journal of Botany 79: 716–722. viding living materials. We also thank Yao-Mou Huang, Yea-Chen Liu, Hall, T. A. 1999. BioEdit: A user-friendly biological sequence alignment and Cheng-Wei Chen for help collecting materials, Wei-Hsiu Wu and editor and analysis program for Windows 95/98/NT. Nucleic Acids Pi-Fong Lu for providing the photos, and three anonymous reviewers Symposium Series 41: 95–98. 1040 SYSTEMATIC BOTANY [Volume 39

Fig. 4. Habitats and living forms of Adiantum meishanianum (A, photo provided by Wei-Hsiu Wu), sexual diploid A. philippense (B, photo provided by Wei-Hsiu Wu), and A. malesianum (C, photo provided by Pi-Fong Lu).

Hsu, F. S. 1993. Chromosome studies on the Adiantaceae in Taiwan.Mas- Liu, Y. C., Y. M. Huang, and W. L. Chiou. 2009. Validation of the ter’s Thesis, Taichung, Taiwan: National Chung Hsing University. name Adiantum meishanianum (Pteridaceae), a species endemic to [In Chinese]. Taiwan. Novon 19: 59–61. Huang,Y.M.,H.M.Chou,T.H.Hsieh,J.C.Wang,andW.L. Lo¨ve, A., D. Lo¨ve, and R. E. G. Pichi Sermolli. 1977. Cytotaxonomical atlas Chiou. 2006. Cryptic characteristics distinguish diploid and trip- of the Pteridophyta. Vaduz, Germany: J. Cramer. loid varieties of Pteris fauriei (Pteridaceae). Canadian Journal of Lu, J. M., J. Wen, S. Lutz, and Y. P. Wang. 2012. Phylogenetic relation- Botany 84: 261–268. ships of Chinese Adiantum based on five plastid markers. Journal of Huelsenbeck, J. P. and F. Ronquist. 2001. MrBayes: Bayesian inference Plant Research 125: 237–249. of phylogenetic trees. Bioinformatics 17: 754–755. Manton, I., J. Ghatak, and B. M. B. Sinha. 1967. Cytotaxonomic studies Imaizumi, T., T. Kanegae, and M. Wada. 2000. Cryptochrome nucleo- in the Adiantum caudatum complex of Africa and Asia. I. Parent- cytoplasmic distribution and gene expression are regulated by age of A. indicum Ghatak. Botanical Journal of the Linnean Society light quality in the fern Adiantum capillus-veneris. The Plant Cell 60: 223–235. 12: 81–96. Manton, I., B. M. B. Sinha, and G. Vida. 1970. Cytotaxonomic studies in Kanegae, T. and M. Wada. 1998. Isolation and characterization of the Adiantum caudatum complex of Africa and Asia. II. Autoploidy homologues of plant blue-light photoreceptor (cryptochrome) and alloploidy in African representatives of A. incisum. Botanical genes from the fern Adiantum capillus-veneris. Molecular & General Journal of the Linnean Society 63: 1–21. Genetics 259: 345–353. Posada, D. 2008. jModelTest: Phylogenetic model averaging. Molecular Knapp, R. 2011. Ferns and fern allies of Taiwan. Taipei, Taiwan: KBCC Biology and Evolution 25: 1253–1256. press and Yuan-Liou publishing. Ronquist, F. and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylo- Ko, C. W. 2011. Effect of irradiance, temperature, and spore sowing genetic inference under mixed models. Bioinformatics 19: 1572–1574. density on propagation and growth in Adiantum species native to Rothfels, C. J., A. Larsson, F. W. Li, E. M. Sigel, L. Huiet, D. O. Burge, Taiwan. M. S. thesis, Taipei, Taiwan: National Taiwan University. M. Ruhsam, S. W. Graham, D. Stevenson, G. K. S. Wong, P. Korall, [In Chinese.]. and K. M. Pryer. 2013. Transcriptome-mining for single-copy Kuo, L. Y., F. W. Li, W. L. Chiou, and C. N. Wang. 2011. First insights nuclear markers in ferns. PLoS ONE 8: e76957. into fern matK phylogeny. Molecular Phylogenetics and Evolution 59: Sessa, E. B., E. A. Zimmer, and T. J. Givnish. 2012. Unraveling reticulate 556–566. evolution in North American Dryopteris (Dryopteridaceae). BMC Lee, P. H., Y. M. Huang, Y. C. Liu, and W. L. Chiou. 2007. The origin of Evolutionary Biology 12: 104. Adiantum meishanianum. Nantou, Taiwan: Yushan National Park Sharma, H. C. 1982. A technique for somatic counts from root tips of cereal Headquaters Construction and Planning administration, ministry of seedlings raised by embryo culture. Current Science 51: 143–144. the interior research project report. [In Chinese.]. Sinha, B. M. B. and I. Manton. 1970. Cytotaxonomic studies in the Li, F. W., K. M. Pryer, and M. D. Windham. 2012. Gaga, a new genus Adiantum caudatum complex of Africa and Asia. III. Segmental allo- segregated from Cheilanthes (Pteridaceae). Systematic Botany 37: polyploid origin of A. malesianum Ghatak. Botanical Journal of the 845–860. Linnean Society 63: 247–264. 2014] ZHANG ET AL.: HYBRID ORIGIN OF ADIANTUM MEISHANIANUM 1041

Tryon,R.M.,A.F.Tryon,andK.U.Kramer.1990.Pteridaceae. KJ605575, KJ605524; Kaohsiung, Kuo3917-M03 (TAIF), KJ605576, KJ605525; Pp. 230–255 in The families and genera of vascular plants, Kaohsiung, Kuo3917-M05 (TAIF), KJ605577, KJ605526; Kaohsiung, eds.K.Kubitzki,Berlin,Germany:Springer-Verlag. Kuo3917-M07 (TAIF), KJ605578, KJ605527; Kaohsiung, Kuo3917-M08 Verma, S. C. and C. R. Fraser-Jenkins. 2008. Adiantum philippense L., the (TAIF), KJ605579, KJ605528. Adiantum pedatum L. JAPAN. Aomori, correct name for A. lunulatum Burm. f., and its subspecies. Pp. 65–92 Kuo1224 (TAIF), KJ605580, KJ605529. Adiantum peruvianum Klotzsch. in Perspectives in Pteridophytes, eds. S. C. Verma, S. P. Khullar, and cultivated, Kuo3931 (TAIF) & K026690 (KBCC), KJ605581, KJ605530. H. K. Cheema. Dehra Dun, India: Bishen Singh Mahendra Pal Singh. Adiantum philippense L. VIETNAM. Cat Tien, Wade1406 (TAIF), Vogel, J. C., S. J. Russell, F. J. Rumsey, J. A. Barrett, and M. Gibby. 1998. KJ605582, KJ605531; TAIWAN. Chiayi, K022991 (KBCC), KJ605583, Evidence for maternal transmission of chloroplast DNA in the KJ605532; Chiayi, K022542 (KBCC), KJ605584, KJ605533; Chiayi, genus Asplenium (Aspleniaceae, Pteridophyta). Botanica Acta 111: Liu6810 (TAIF), KJ605585, KJ605534; CHINA. Hainan, Kuo1679 (TAIF) & 247–249. K013279 (KBCC), KJ605586, KJ605535; TAIWAN. Hsinchu, K022993 Wang, C. N., M. Moller, and Q. C. B. Cronk. 2004. Phylogenetic posi- (KBCC), KJ605587, KJ605536; THAILAND. Kan-chanaburi, Kuo3937 tion of Titanotrichum oldhamii (Gesneriaceae) inferred from four dif- (TAIF) & K019788 (KBCC), KJ605588, KJ605537; TAIWAN. Kaohsiung, ferent gene regions. Systematic Botany 29: 407–418. K022546 (KBCC), KJ605589, KJ605538; Kaohsiung, Kuo3936 (TAIF) & Wang, J. C., W. L. Chiou, and H. M. Chang. 2012. A preliminary red list K018606 (KBCC), KJ605590, KJ605539; Kaohsiung, MO Awan-1 (TAIF), of Taiwanese vascular plants. Natou, Taiwan: Endemic Species KJ605591, KJ605540; Kaohsiung, K022540 (KBCC), KJ605592, KJ605541; Research Institute & Taiwan Society of Plant Systematics. CAMBODIA. Mt. Kuolen, MO1635 (TAIF) & K018416 (KBCC), KJ605593, Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis KJ605542; TAIWAN. Nantou, -, KJ605594, KJ605543; Nantou, K022545 of large biological sequence datasets under the maximum likelihood criterion. (KBCC), KJ605595, KJ605544; Pingtung, MO2390 (TAIF), KJ605596, Ph. D. dissertation. Austin: The University of Texas. KJ605545; Taichung, K022990 (KBCC), KJ605597, KJ605546; Tainan, Kuo3935 (TAIF) & K022543 (KBCC), KJ605598, KJ605547; Tainan, K022544 Appendix 1. The materials used in cpDNA phylogeny. Informa- (KBCC), KJ605599, KJ605548; Taoyuan, -, KJ605600, KJ605549. Adiantum tion is presented as taxon name followed by locality, collection number raddianum C. Presl. cultivated, Kuo3923 (TAIF) & K013914 (KBCC), (its herbarium and/or Dr. Cecilia Koo Botanic Conservation Center), KJ605601, KJ605550. Adiantum reniforme L. cultivated, Kuo3925 (TAIF) & rps16-matK IGS, and matK GenBank accession. K012975 (KBCC), KJ605602, KJ605551. Adiantum soboliferum Wall. TAIWAN. Tainan, Kuo3926 (TAIF) & K017623 (KBCC), KJ605603, Adiantum capillus-junonis Rupr. TAIWAN. Nantou, K012967 (KBCC), KJ605552. Adiantum tenerum Sw. cultivated, Kuo3930 (TAIF) & KJ605554, KJ605503. Adiantum capillus-veneris L. -, -, AY178864, K013712 (KBCC), KJ605604, KJ605553. Cheilanthes lindheimeri Hook. AY178864. Adiantum caudatum L. TAIWAN. Changhua, 20100502-034MO -, -, HM778032, HM778032. (TAIF), KJ605555, KJ605504; Chiayi, Liu6808-e (TAIF) & K017626 (KBCC), KJ605556, KJ605505; Kaohsiung, 20081125-16MO (TAIF), Appendix 2. The materials used in nrDNA phylogeny. Information KJ605557, KJ605506; Pingtung, K013900 (KBCC), KJ605558, KJ605507; is presented as taxon name followed by the locality, collection number Pingtung, K017393 (KBCC), KJ605559, KJ605508; Taichung, 20081109- (its herbarium and/or Dr. Cecilia Koo Botanic Conservation Center), 21MO (TAIF), KJ605560, KJ605509; Taitung, ZWY310 (TAIF), KJ605561, and CRY2 1st intron GenBank accession. The sequences obtained from KJ605510. Adiantum edentulum Christ. TAIWAN. Taitung, Kuo430 SSCP separation are noted with “*”. (TAIF), KJ605562, KJ605511. Adiantum edgeworthii Hook. CHINA. Yunnan, K015018 (KBCC), KJ605563, KJ605512. Adiantum flabellulatum Adiantum capillus-junonis Rupr. TAIWAN. Nantou, K012967 (KBCC), L. TAIWAN. Ilan, K013833 (KBCC), KJ605564, KJ605513. Adiantum KJ605605. Adiantum caudatum L. TAIWAN. Pingtung, K013900 (KBCC), hispidulum Sw. TAIWAN. Chiayi, Kuo3921 (TAIF) & K017619 (KBCC), KJ605606; Taitung, ZWY310 (TAIF), *KJ605607-08. Adiantum edgeworthii KJ605565, KJ605514. Adiantum macrophyllum Sw. cultivated, Kuo3922 Hook. CHINA. Yunnan, K015018 (KBCC), KJ605609. Adiantum malesianum (TAIF) & K023105 (KBCC), KJ605566, KJ605515. Adiantum malesianum J. Ghatak. TAIWAN. Chiayi, K013775 (KBCC), *KJ605610-11. Adiantum J. Ghatak. TAIWAN. Chiayi, Kuo3932 (TAIF) & K013775 (KBCC), KJ605567, meishanianum F.S.HsuexY.C.Liu&W.L.Chiou.TAIWAN. KJ605516; Haulian, Liu9530 (TAIF), KJ605568, KJ605517; Kaohsiung, Kaohsiung, Liu5002 (TAIF), *KJ605612-14. Adiantum philippense L. Kuo3934 (TAIF) & K022539 (KBCC), KJ605569, KJ605518; Miaoli, Kuo3933 THAILAND. Kan-chanaburi, Kuo3937 (TAIF) & K019788 (KBCC), (TAIF) & K019612 (KBCC), KJ605570, KJ605519; Nantou, 20080907-05MO KJ605615; TAIWAN. Kaohsiung, K022540 (KBCC), KJ605616; Nantou, -, (TAIF), KJ605571, KJ605520; Pingtung, 20070730-MO (TAIF), KJ605572, *KJ605617-19; Taichung, K022990 (KBCC), *KJ605620-22; Tainan, Kuo3935 KJ605521; Tainan, 20070903-113MO (TAIF), KJ605573, KJ605522. Adiantum (TAIF) & K022543 (KBCC), *KJ605623-24; Chiayi, K022993 (KBCC), meishanianum F. S. Hsu ex Y. C. Liu & W. L. Chiou. TAIWAN. Kaohsiung, *KJ605625-27. Adiantum soboliferum Wall. TAIWAN. Tainan, Kuo3926 Liu5002 (TAIF), KJ605574, KJ605523; Kaohsiung, Kuo3917-M02 (TAIF), (TAIF) & K017623 (KBCC), KJ605628.