DOCSLIB.ORG

The Hybrid Origin of Adiantum Meishanianum (Pteridaceae): a Rare and Endemic Species in Taiwan

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Hybrid Origin of Adiantum Meishanianum (Pteridaceae): a Rare and Endemic Species in Taiwan The Hybrid Origin of Adiantum meishanianum (Pteridaceae): A Rare and Endemic Species in Taiwan Author(s): Wan-Yu Zhang, Li-Yaung Kuo, Fay-Wei Li, Chun-Neng Wang, and Wen-Liang Chiou Source: Systematic Botany, 39(4):1034-1041. 2014. Published By: The American Society of Plant Taxonomists URL: http://www.bioone.org/doi/full/10.1600/036364414X682616 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Systematic Botany (2014), 39(4): pp. 1034–1041 © Copyright 2014 by the American Society of Plant Taxonomists DOI 10.1600/036364414X682616 Date of publication July 9, 2014 The Hybrid Origin of Adiantum meishanianum (Pteridaceae): A Rare and Endemic Species in Taiwan Wan-Yu Zhang,1,4 Li-Yaung Kuo,1,4 Fay-Wei Li,2 Chun-Neng Wang,1,5 and Wen-Liang Chiou3,5 1Institute of Ecology and Evolutionary Biology, National Taiwan University, Taipei 10617, Taiwan. 2Department of Biology, Duke University, Durham, North Carolina 27708, U. S. A. 3Division of Botanical Garden, Taiwan Forestry Research Institute, Taipei 10066, Taiwan. 4These authors contributed equally. 5Author for correspondence (CNW: [email protected]; WLC: [email protected]) Communicating Editor: Thomas L. P. Couvreur Abstract—Adiantum meishanianum is an endemic species distributed only in Meishan village, Kaohsiung, Taiwan. Because its sporangia contain only abortive spores, A. meishanianum has been regarded as having a hybrid origin, presumably with A. caudatum, A. malesianum,and A. philippense as the putative parents. The aim of this study is to confirm the hybrid origin and determine the parental lineages of A. meishanianum by examining cytology, reproductive modes, and using molecular phylogenetics. We found that the sequences of two chlo- roplast regions, rps16-matK intergenic spacer and the matK gene, are identical between A. meishanianum and A. malesianum, suggesting A. malesianum is the maternal parent. The nuclear phylogeny reconstructed based on the low-copy marker, CRY2 first intron, reveals that A. meishanianum has three types of sequences: one type groups with sequences of sexual diploid individuals of A. philippense and the other two group with sequences of the sexual tetraploid A. malesianum, indicating that A. philippense is the paternal species. Our data further imply that the extant A. meishanianum probably originated from a single hybridization event, and its rarity is likely due to the limited dis- tribution of the paternal parent. Keywords—Adiantum malesianum, Adiantum philippense, CRY2 first intron, cryptic species, hybridization. Adiantum meishanianum F. S. Hsu ex Y. C. Liu & W. L. regions of selected Adiantum species. Based on the sequences obtained, Chiou (Pteridaceae), a rare species endemic to Taiwan we designed three specific primers: “Adn rps16 fEET”, “Adn matK rRLF”, and “Adn matK fHIS”. The PCR reactions were performed in (Liu et al. 2009), has only been found in Meishan village, 15 mL reaction volumes, including 20 ng genomic DNA, 1 + PCR buffer, Kaohsiung City, Taiwan, with a single population, and is 200 mM dNTP, 15 pmol of each primer, and 0.5 U polymerase (GENET considered as critically endangered (Wang et al. 2012). Hsu BIO ExPrime Taq DNA Polymerase, Korea). The detailed information (1993) first reported that A. meishanianum is a triploid spe- of these primers and PCR conditions can be found in Table 1. Nuclear dataset—Phylogenies based on biparentally inherited DNA cies based on a somatic chromosome count (2n = 90). Lee markers, particularly low-copy nuclear genes, provide an efficient way to et al. (2007) later found that A. meishanianum produces only disentangle the reticulate relationships caused by hybridization and/or aborted spores, which either fail to germinate or develop polyploidization (Ebihara et al. 2005; Adjie et al. 2007; Li et al. 2012; Sessa into abnormal gametophytes, suggesting that this species et al. 2012). Only recently have such molecular markers become readily is a sterile triploid hybrid. The persistence and expansion available to fern biologists (Rothfels et al. 2013). However, the universality of these regions and developed primers for these nuclear genes usually of the population of A. meishanianum seems to rely solely vary among fern lineages (Chen at al. 2012; Rothfels et al. 2013). on vegetative propagation via adventitious buds borne on As a case study, we developed a novel low-copy nuclear marker: the elongated rachis tips. Among the once-pinnate species of the first intron of the cryptochrome gene (CRY), which encodes a blue Adiantum in Taiwan, A. caudatum L., A. malesianum Ghatak. light photoreceptor. It is an ideal nuclear marker for Adiantum species because the copy number and exon/intron positions are known from and A. philippense L. have been hypothesized as the parental A. capillus-veneris L. (Kanegae and Wada 1998; Imaizumi et al. 2000). candidates due to their morphological similarities, includ- Among the non-coding regions of the five A. capillus-veneris CRY ing the long pinna stalk (3–4 mm), the semi-orbiculate basal genes, the first intron is most stable in its exon/intron boundary. Thus, pinnae, and the adventitious bud on the elongated rachis based on the published A. capillus-veneris CRY1–5 coding sequences, (Hsu 1993; Lee et al. 2007; Liu et al. 2009). we first designed one degenerate primer set to target the first intron (“Adn CRY fPEE” and “Adn CRY rDLL”). By electrophoresis in 1 + TBE This study aims to resolve the hybrid origin of A. meishanianum 0.8% agarose gel, we verified, isolated, and sequenced the PCR prod- by reconstructing the phylogenies based on both chloroplast ucts of 400 bp, which contains only the amplicons from CRY2. After and nuclear DNA sequences of all once-pinnate Adiantum we obtained partial CRY2 first exon and second exon sequences from species in Taiwan. The ploidy and reproductive modes of A. caudatum, A. meishanianum,andA. philippense, a specific primer set to amplify once-pinnate Adiantum CRY2 first intron was designed: the candidate parental species, as determined by the spore “Adn CRY2 fHLN” and “Adn CRY2 rVKQ”. All PCR reactions were number per sporangium and cytological evidence, were fur- carried out as described above. Other details of primer information ther examined to confirm the hybrid relationships. and PCR conditions can be found in Table 1. To distinguish different sequence types after PCR (i.e. alleles or homeologs), single-strand conformation polymorphism (SSCP) was used Materials and Methods when the direct sequencing of amplicons of “Adn CRY2 fHLN + Adn CRY2 rVKQ” failed. The protocol of SSCP electrophoresis followed Chloroplast dataset—We sampled 17 Adiantum species, representing Ebihara et al. (2005). Before SSCP electrophoresis, the PCR products were all major clades in the genus (Lu et al. 2012) and including all of the purified using a Gel/PCR purification kit (Genomics, Taipei, Taiwan) and once-pinnate species in Taiwan (Knapp 2011). DNA was extracted using eluted with ddH2O. After SSCP electrophoresis, all gel slices containing a modified CTAB procedure (Wang et al. 2004). We adopted the strategy the separated single-strand DNA products (i.e. bands) were purified by of Kuo et al. (2011) to design specific primers for the chloroplast DNA the same purification kit, and were re-amplified and sequenced. (cpDNA) regions, matK and rps16-matK intergenic spacer (IGS). First, we Voucher information of the materials used in chloroplast or nuclear applied universal primers (“FERN chlB fYAA”, “FERN rps16 fQCGR”, DNA analyses of this study is summarized in the Appendices. “FERN rps16 fSRQE”, “FERmatK fEDR”, and “FERmatK rAGK”) to Phylogenetic analyses—DNA sequences were aligned using ClustalW generate sequences of matK, rps16 second exon and rps16-matK IGS implemented in BioEdit (Hall 1999) and the alignments were edited 1034 2014] ZHANG ET AL.: HYBRID ORIGIN OF ADIANTUM MEISHANIANUM 1035 Table 1. The sequences and PCR condition of primers used in this study. *Primer for sequencing. #Primer for sequencing Adiantum caudatum rps16-matK IGS. PCR Tm / Primer names Primer sequence 50-30 Target region Target taxon extension time Reference Adn CRY fPEE* CCWGADGARGARGGNCARTT CRY1–5 intron1 Adiantum 49C / 90s this study Adn CRY rDLL* TTYAATGSMGAYYTBCTGTATGAGCC CRY -5 intron1 Adiantum 49C / 90s this study Adn CRY2 fHLN* CACCTCAATGAATCTCTCACAA CRY2 intron1 once-pinnate 65C / 30s this study Adiantum Adn CRY2 rVKQ* GCCTGRGAGAGCCCCTGTTTCAC CRY2 intron1 once-pinnate 65C / 30s this study Adiantum FERN ch1B fYAA# GATGTRAYGTATGCRGCYAAAGA rps16-matK IGS for all ferns 55C / 90s Kuo et al. 2011 FERN rpsl6 fQCGR CRMTRTGGTAGRAAGCAAC rps16-matK IGS for all ferns 55C / 90s Kuo et al. 2011 FERN
Load more

Recommended publications
  • "National List of Vascular Plant Species That Occur in Wetlands: 1996 National Summary."
    Intro 1996 National List of Vascular Plant Species That Occur in Wetlands The Fish and Wildlife Service has prepared a National List of Vascular Plant Species That Occur in Wetlands: 1996 National Summary (1996 National List). The 1996 National List is a draft revision of the National List of Plant Species That Occur in Wetlands: 1988 National Summary (Reed 1988) (1988 National List). The 1996 National List is provided to encourage additional public review and comments on the draft regional wetland indicator assignments. The 1996 National List reflects a significant amount of new information that has become available since 1988 on the wetland affinity of vascular plants. This new information has resulted from the extensive use of the 1988 National List in the field by individuals involved in wetland and other resource inventories, wetland identification and delineation, and wetland research. Interim Regional Interagency Review Panel (Regional Panel) changes in indicator status as well as additions and deletions to the 1988 National List were documented in Regional supplements. The National List was originally developed as an appendix to the Classification of Wetlands and Deepwater Habitats of the United States (Cowardin et al.1979) to aid in the consistent application of this classification system for wetlands in the field.. The 1996 National List also was developed to aid in determining the presence of hydrophytic vegetation in the Clean Water Act Section 404 wetland regulatory program and in the implementation of the swampbuster provisions of the Food Security Act. While not required by law or regulation, the Fish and Wildlife Service is making the 1996 National List available for review and comment.
    [Show full text]
  • National List of Vascular Plant Species That Occur in Wetlands 1996
    National List of Vascular Plant Species that Occur in Wetlands: 1996 National Summary Indicator by Region and Subregion Scientific Name/ North North Central South Inter- National Subregion Northeast Southeast Central Plains Plains Plains Southwest mountain Northwest California Alaska Caribbean Hawaii Indicator Range Abies amabilis (Dougl. ex Loud.) Dougl. ex Forbes FACU FACU UPL UPL,FACU Abies balsamea (L.) P. Mill. FAC FACW FAC,FACW Abies concolor (Gord. & Glend.) Lindl. ex Hildebr. NI NI NI NI NI UPL UPL Abies fraseri (Pursh) Poir. FACU FACU FACU Abies grandis (Dougl. ex D. Don) Lindl. FACU-* NI FACU-* Abies lasiocarpa (Hook.) Nutt. NI NI FACU+ FACU- FACU FAC UPL UPL,FAC Abies magnifica A. Murr. NI UPL NI FACU UPL,FACU Abildgaardia ovata (Burm. f.) Kral FACW+ FAC+ FAC+,FACW+ Abutilon theophrasti Medik. UPL FACU- FACU- UPL UPL UPL UPL UPL NI NI UPL,FACU- Acacia choriophylla Benth. FAC* FAC* Acacia farnesiana (L.) Willd. FACU NI NI* NI NI FACU Acacia greggii Gray UPL UPL FACU FACU UPL,FACU Acacia macracantha Humb. & Bonpl. ex Willd. NI FAC FAC Acacia minuta ssp. minuta (M.E. Jones) Beauchamp FACU FACU Acaena exigua Gray OBL OBL Acalypha bisetosa Bertol. ex Spreng. FACW FACW Acalypha virginica L. FACU- FACU- FAC- FACU- FACU- FACU* FACU-,FAC- Acalypha virginica var. rhomboidea (Raf.) Cooperrider FACU- FAC- FACU FACU- FACU- FACU* FACU-,FAC- Acanthocereus tetragonus (L.) Humm. FAC* NI NI FAC* Acanthomintha ilicifolia (Gray) Gray FAC* FAC* Acanthus ebracteatus Vahl OBL OBL Acer circinatum Pursh FAC- FAC NI FAC-,FAC Acer glabrum Torr. FAC FAC FAC FACU FACU* FAC FACU FACU*,FAC Acer grandidentatum Nutt.
    [Show full text]
  • Assessment of Diversity of Pteridophytes Along Some Hill Roads in a Biodiversity Hot Spot Region of India – a Case Study of Mizoram
    ISSN: 2350-0328 International Journal of AdvancedResearch in Science, Engineering and Technology Vol. 5, Issue 9 , September 2018 Assessment of Diversity of Pteridophytes along Some Hill Roads in a Biodiversity Hot Spot Region of India – A Case Study of Mizoram Samar. Kr.Banerjee,MousumiBanerjee , Anjani.Kr. Srivastava Department of Botany, Ranchi University, Ranchi and Principal Consultant (Environment) STUP India1 Department of Botany,Faculty of Post Graduate Studies, Scottish Church College, Kolkata 2 Department of Botany, Ranchi University, Ranchi 3 ABSTRACT: Mizoram state of India isone of the biodiversity hotspots of the world, the Eastern Himalayan biodiversity hotspot of South Asia. Panoramic view of its roadside flora reveals that it is replete with rich diversity of Pteridophytes.This is due to unique location of Mizoram, its topography with hills and valleys, and also its geology which provide immense ranges of microclimatic conditions which facilitates its growth. These pteridophytes are one of the source of carbon sink along the road. Some work related to pteridophytes have been reported by some researchers in some protected areas like sanctuaries and some forests in Mizoram. Till date no work has been reported on the diversity, ecology and IUCN red list status of pteridophytes growing along the Hill Roads in Mizoram. The paper enlists he current diversity, habitat and ecology of such pteridophytes. Effort has been made to ascertain their status in the IUCN red list and in Catalogue of Life (COL).The study is likely to help in further capacity augmentation/widening of these roads without harming the current diversity of the pteridophytes growing there .The study also provides a protocol to be followedfor monitoring and management of biodiversity along other roads of this hotspot.
    [Show full text]
  • Morphological and Anatomical Adaptations to Dry, Shady Environments in Adiantum Reniforme Var
    Morphological and anatomical adaptations to dry, shady environments in Adiantum reniforme var. sinense (Pteridaceae) Di Wu1, Linbao Li1, Xiaobo Ma1, Guiyun Huang1 and Chaodong Yang2 1 Rare Plants Research Institute of Yangtze River, Three Gorges Corporation, Yichang, China 2 Engineering Research Center of Ecology and Agriculture Use of Wetland, Ministry of Education, Yangtze University, Jingzhou, China ABSTRACT The natural distribution of the rare perennial fern Adiantum reniforme var. sinense (Pteridaceae), which is endemic to shady cliff environments, is limited to small areas of Wanzhou County, Chongqing, China. In this study, we used brightfield and epifluorescence microscopy to investigate the anatomical structures and histochemical features that may allow this species to thrive in shady, dry cliff environments. The A. reniforme var. sinense sporophyte had a primary structure and a dictyostele. The plants of this species had an endodermis, sclerenchyma layers and hypodermal sterome, reflecting an adaption to dry cliff environments. Blades had a thin cuticle and isolateral mesophyll, suggesting a tolerance of shady environments. These characteristics are similar to many sciophyte ferns such as Lygodium japonicum and Pteris multifida. Thus, the morphological and anatomical characteristics of A. reniforme var. sinense identified in this study are consistent with adaptations to shady, dry cliff environments. Subjects Conservation Biology, Plant Science Keywords Endodermis, Dictyostele, Sclerenchyma layer, Suberin lamellae, Thin cuticle Submitted 14 April 2020 Accepted 24 August 2020 INTRODUCTION Published 30 September 2020 Adiantum reniforme var. sinense (Pteridaceae, subfamily Vittarioideae) is a rare Corresponding authors Guiyun Huang, cliff-dwelling perennial pteridophyte, with a natural distribution limited to small areas of [email protected] Wanzhou County, Chongqing, China.
    [Show full text]
  • 11-122. 2000 11
    FERN GAZ. 16(1, 2)11-122. 2000 11 CHECKLIST OF THE PTERIDOPHYTES OF TRINIDAD & TOBAGO Y. S. BAKSH-COMEAU The National Herbarium of Trinidad and Tobago. Department of Life Sciences, The University of the West Indies, St. Augustine, Trinidad, West Indies Key words: checklist, Trinidad and Tobago pteridophytes, types, habitat, distribution. ABSTRACT Three hundred and two species and eight varieties or subspecies in 27 families and 77 genera of ferns and fern allies are listed. Four new combinations and states are made, and one synonym lectotypified. A serious attempt has been made to establish types; selections of specimens studied are cited. INTRODUCTION Recent studies of ferns in Trinidad and Tobago (Baksh-Comeau, 1996, 1999) have combined a review of the pteridophyte collection at The National Herbarium of Trinidad & Tobago with field surveys undertaken to assess the community status of these plants on both islands. This checklist has been developed as an integral part of those studies, but it is also an essential prerequisite to ongoing research covering a reclassification of the vegetation of the islands and to the preparation of a comprehensive vascular plant flora. The herbarium count and field survey revealed 251 species confirmed by voucher specimens housed in Trinidad. Additional species have been attributed to Trinidad or Tobago in early publications for Trinidad and in Floras and monographs for neighbouring areas. The number of species now believed to be indigenous in these islands is 282. Cultivated species that have escaped, and introductions which have become naturalized number 20. Early reports include Grisebach (1859-64) who listed 106 species; Eaton (1878) approximately 78 of the 150 or so species eventually collected by August Fendler; Jenman (1887) had about 184 species; Anon (1889) listed 206 binomials including a few introduced taxa; Jenman (1898-1909), in an incomplete coverage of the fern flora, described 140 taxa of which 10 were new species; Hart (1908), including some cultivated plants, listed 283 binomials of pteridophytes.
    [Show full text]
  • Conservation Appendix 6-B Listed Flora
    Appendix 6-B. List of Federal, State and County Endangered, Threatened, Rare, and Special Concern Flora in Miami-Dade County Scientific Name Common Name State Federal County Acacia choriophylla Tamarindillo; cinnecord E NL Y Acanthocereus tetragenus Triangle cactus T NL Y Acoelorraphe wrightii Everglades palm T NL Y Acrostichum aureum Golden leather fern T NL Y Adiantum capillus-veneris Venus hair fern; southern maidenhair fern NL NL Y Adiantum melanoleucum Fragrant maidenhair fern E NL Y Adiantum tenerum Brittle maidenhair fern E NL Y Aeschynomene pratensis Meadow joint-vetch E NL Y Agalinis filifolia Seminole false fox glove NL NL Y Aletris bracteata White colic root E NL Y Alvaradoa amorphoides Mexican alvaradoa E NL Y Amorpha herbacea var.crenulata Crenulate (=Miami) leadplant E E Y Amphitecna latifolia Black calabash NL NL Y Anemia wrightii Wright's pineland fern E NL Y Angadenia berteroi Pineland golden trumpet T NL Y Argusia gnaphalodes Sea rosemary E NL Y Argythamnia blodgettii Blodgett's silverbush E C Y Aristolochia pentandra Marsh's dutchmans pipe E NL Y Asplenium abscissum Cutleaf spleenwort NL NL Y Asplenium dentatum Toothed spleenwort E NL Y Asplenium serratum Wild bird nest fern E NL Y Asplenium verecundum Modest spleenwort E NL Y Asplenium x biscaynianum Biscayne spleenwort NL NL Y Asteraea lobata Lobed croton; Florida treefern NL NL Y Baccharis dioica Broombush falsewillow E NL Y Basiphyllaea corallicola Carter's orchid E NL Y Bletia patula Flor de Pesmo NL NL Y Bletia purpurea Pinepink orchid T NL Y Bourreria cassinifolia Smooth strongback E NL Y Bourreria succulenta Bahama strongback E NL Y Brassia caudata Spider orchid E NL Y Brickellia eupatorioides var.
    [Show full text]
  • Part I Chinese Plant Names Index 2010-2017
    This Book is Sponsored by Shanghai Chenshan Botanical Garden 上海辰山植物园 Shanghai Chenshan Plant Science Research Center, Chinese Academy of Sciences 中国科学院上海辰山植物科学研究中心 Special Fund for Scientific Research of Shanghai Landscaping ＆ City Appearance Administrative Bureau (G182415) 上海市绿化和市容管理局科研专项 (G182415) National Specimen Information Infrastructure, 2018 Special Funds 中国国家标本平台 2018 年度专项 Shanghai Sailing Program (14YF1413800) 上海市青年科技英才扬帆计划 (14YF1413800) Chinese Plant Names Index 2010-2017 DU Cheng & MA Jin-shuang Chinese Plant Names Index 2010-2017 中国植物名称索引 2010-2017 DU Cheng & MA Jin-shuang Abstract The first two volumes of Chinese Plant Names Index (CPNI) cover the years 2000 through 2009, with entries 1 through 5,516, and 2010 through 2017, with entries 5,517 through 10,795. A unique entry is generated for the specific name of each taxon in a specific publication. Taxonomic treatments cover all novelties at the rank of family, genus, species, subspecies, variety, form and named hybrid taxa, new name changes (new combinations and new names), new records, new synonyms and new typifications for vascular plants reported or recorded from China. Detailed information on the place of publication, including author, publication name, year of publication, volume, issue, and page number, are given in detail. Type specimens and collects information for the taxa and their distribution in China, as well as worldwide, are also provided. The bibliographies were compiled from 182 journals and 138 monographs or books published worldwide. In addition, more than 400 herbaria preserve type specimens of Chinese plants are also listed as an appendix. This book can be used as a basic material for Chinese vascular plant taxonomy, and as a reference for researchers in biodiversity research, environmental protection, forestry and medicinal botany.
    [Show full text]
  • Fern (Non-Idiindigenous Vi Ne)  Light Green Ornamental  # 4 Categgyory 1 Invasive (Langeland, K.A
    Potential for Use of Native Phytopathogens as Biocontrol Agents for Invasive Plant Species K. Jayachandran, K. G. Shetty, Tainya Clarke, LeRoy Rodgers III, ShiLi Miao, and Robert Johnson 1. Theoretical basis or Rationale 2. Discovery – Survey, collection and isolation 3Elti3. Evaluation – PthPathogen iiticity testing Invasive Exotic Species Biological invasions increasingly threaten the biologgyggyical diversity and ecological integrity of natural ecosystems. Invasive species have contributed to the decline of endangered and threatened species in the United States. Non-indigenous weeds alone cost U.S. agriculture $7-27 billion per year. Global warming/climate change effect on the invasive species spread is a serious concern. Natural and agricultural ecosystems in Flor ida are be ing threat ened b y th e continuing exotic aquatic, wetland, and ttilltiiterrestrial plant invasions: Problems with utilization and management of water resources Disturb and displace the native flora and fauna itlin natural areas Negative effects on productivity of crop and pastures lands Managing invasive plants in natural areas is challenging: Economic, environmental health risks with herbicides. Certain weeds are not controlled effectively by availa ble meth od s. Discovery and development of novel weed- maaageetagetsadtecoogesaeonagement agents and technologies are of greater importance now than ever before. Problem of Invasive exotic plants in Florida There are about 1000 non-native plant species in Florida There are more than 50 exotic invasive plant
    [Show full text]
  • Indusia in North-East Indian Adiantum
    Pleione 11(2): 241 - 248. 2017. ISSN: 0973-9467 © East Himalayan Society for Spermatophyte Taxonomy doi:10.26679/Pleione.11.2.2017.241-248 Observations on indusia in Adiantum L. (Pteridaceae : Vittarioideae) of North-East India S. D. Yumkham1, P. K. Singh1 and S. D. Khomdram2 1Ethnobotany & Plant Physiology Laboratory, Centre of Advance Studies in Life Sciences, Manipur University, Canchipur - 795 003, Manipur, India 2Corresponding author: Department of Botany, Mizoram University, Aizawl-796004, Mizoram, India E-mail: [email protected] [Received 09.10.2017; Revised 29.11.2017; Accepted 07.12.2017; Published 31.12.2017] Abstract The present paper highlights the indusial character in eight (8) species of Adiantum L. (Pteridaceae- Vittarioideae) found in North East India. These include A. capillus-veneris L., A. caudatum L., A. edgeworthii Hook., A. flabellulatum L., A. incisum Forssk., A. peruvianum Klotzsch, A. philippense L. and A. raddianum C. Presl. Data on the morphology of indusia, spore size and exine ornamentation are studied in order to assess their systematic significance. A key to species based on indusial characters is also incorporated. Key words: Adiantum, North East India, Morphology, Indusia, Exine ornamentation INTRODUCTION The Maiden-hair ferns, Adiantum L. (Pteridaceae: Vittarioideae) are well known and popular as ornamentals for their beauty with graceful and attractive evergreen fronds. The genus is represented by 200 species distributed in tropical and sub-tropical to temperate regions (Prado et al. 2007). They usually grow in moisture rich areas with low intensity of sunlight. Sometimes, they are seen growing as base epiphyte on moss-humus laden trees like Ficus benghalensis L., Mimusops elengi L., Phoenix sylvestris (L.) Roxb., Kigelia pinnata (Jacq.) DC.
    [Show full text]
  • Plant Profile, Phytochemistry and Pharmacological Activity of Plant Adiantum Capillus Veneris Linn
    Drug Designing & Intellectual Properties International Journal DOI: 10.32474/DDIPIJ.2021.03.000174 ISSN: 2637-4706 Review Article Plant profile, Phytochemistry and pharmacological activity of Plant Adiantum capillus veneris Linn. (Hansraj) Sameer Shakur Shaikh*1, Abdul Haque Bamer1, Prasad Govindrao Jamkhande2, Abdul samad3, Quadri Mohammad Shoeb4 1department of pharmacology, Durgamata institute of Pharmacy, Dharmapuri, Parbhani -Maharashtra, India. 2Center for the research in Pharmaceutical science, Sharda Bhavan Education Society’s Nanded college of Pharmacy, Nanded 431605, Maharashtra, India. 3Bharati Vidyapeeth (Deemed to be) University, Poona College of Pharmacy, Pune- Maharashtra, India. *Corresponding author: PSameer Shakur Shaikh, Pharmacology Department, Durgamata institute of Pharmacy, Dharmapuri, Parbhani, Maharashtra, India Received: February 5, 2021 Published: February 19, 2021 Abstract More than half of the world’s population relies on traditional medicine and the main role of traditional medicine including the use of plant extract and their active constituents. Among them Adiantum capillus veneris Linn. A small size wooden herb plant of the family Adiantaceae commonly called Parsioshan, Hansraj, Maidenhair fern, and Ghodkhuri. The plant has leaves, stem, and root that have been reported for possessing antioxidant, anti-microbial, anti-fungal, anti-diabetic, antipyretic, wound healing action and it is contraindicated in pregnancy due to its anti-implantation effect. It is most common in the treatment of hair fall and skin disease. The steroids, and reducing sugars. The present review focuses on details of geographical distribution, phytochemical parameters, phytoconstituents,screening of phytochemical and pharmacological analysis showed properties the presence of Adiantum of flavonoids, capillus alkaloids, veneris Linn tannins, (Hansraj) saponins, so far. cardiac glycosides, terpenoids, Keywords: Adiantum cappilus veneris L; Hapane; neohopane; antidibetic pharmacology Introduction traditional oriental, and Native American Indian medicine.
    [Show full text]
  • Phytochemical Constituents and Pharmacological Activities of Plants from the Genus Adiantum : a Review
    Pan et al Tropical Journal of Pharmaceutical Research October 2011; 10 (5): 681-692 © Pharmacotherapy Group, Faculty of Pharmacy, University of Benin, Benin City, 300001 Nigeria. All rights reserved . Available online at http://www.tjpr.org http://dx.doi.org/10.4314/tjpr.v10i5.18 Review Article Phytochemical Constituents and Pharmacological Activities of Plants from the Genus Adiantum : A Review 1 1 1 1 1 2 C Pan , YG Chen *, XY Ma , JH Jiang , F He and Y Zhang 1Department of Chemistry, Yunnan Normal University, Kunming 650500, 2School of Pharmacy, Kunming Medical College, Kunming 650031, China. Abstract Adiantum is a genus of ca. 200 species in the family Adiantaceae, distributed extensively across the world from cool temperate zones to hot tropical regions. A lot of Adiantum species have been used in traditional Chinese medicine to cure human and animal diseases including relief of internal heat or fever, enhancement of urination, removal of urinary calculus, and sundry other curative claims. Chemical studies have shown the presence of various classes of compounds, the main ones being triterpenoids, flavonoids, phenyl propanoids, steroids, alicyclic acids, lipids and long-chain compounds. The extract of this genus as well as pure compounds isolated from it have been demonstrated to possess multiple pharmacological activities such as analgesic, antinociceptive, anti-implantation, and antimicrobial activities. In this review, we have addressed the phytochemistry and pharmacological activities of the Adiantum species in order to collate existing information on this plant as well as highlight its multi-activity properties as a medicinal agent. Keywords: Adiantum species, Adiantaceae, Phytochemical constituents, Pharmacological activities.
    [Show full text]
  • The Pteridaceae Family Diversity in Togo
    Biodiversity Data Journal 3: e5078 doi: 10.3897/BDJ.3.e5078 Taxonomic Paper The Pteridaceae family diversity in Togo Komla Elikplim Abotsi‡, Aboudou R. Radji‡, Germinal Rouhan§, Jean-Yves Dubuisson§, Kouami Kokou‡ ‡ Université de Lomé, Lomé, Togo § Museum National d'Histoire Naturelle, Paris cedex 05, France Corresponding author: Komla Elikplim Abotsi ([email protected]) Academic editor: Daniele Cicuzza Received: 10 Apr 2015 | Accepted: 10 Jul 2015 | Published: 15 Jul 2015 Citation: Abotsi K, Radji A, Rouhan G, Dubuisson J, Kokou K (2015) The Pteridaceae family diversity in Togo. Biodiversity Data Journal 3: e5078. doi: 10.3897/BDJ.3.e5078 Abstract Background The Pteridaceae family is the largest fern family in Togo by its specific and generic diversity. Like all other families of ferns in the country, Pteridaceae are poorly studied and has no identification key. The objective of this study is to perform a taxonomic revision and list establishment of this family of leptosporangiate ferns in the light of current available knowledge about the family. Pteridaceae was also assessed in terms of its diversity and conservation status, this was conducted through the recent field data and the existing herbaria specimens. The current study permits to confirm the presence of Pteris similis Kuhn. which brought the number of Pteridaceae to 17 in Togo. New information This study provides first local scientific information about the fern flora of Togo. It confirmed the presence of Pteris similis Kuhn. in Togo and brought the Pteridaceae family diversity to 17 species. A species identification key is provided for the easy identification of the Pteridaceae of Togo.
    [Show full text]