DOCSLIB.ORG

Downloaded from the Journal Website35

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downloaded from the Journal Website35 medRxiv preprint doi: https://doi.org/10.1101/2020.10.23.20213652; this version posted October 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. 1 A global atlas of genetic associations of 220 deep phenotypes 2 3 Saori Sakaue1-5, 46, *, Masahiro Kanai1, 5-9, 46, Yosuke Tanigawa10, Juha Karjalainen5-7,9, Mitja 4 Kurki5-7,9, Seizo Koshiba11,12, Akira Narita11, Takahiro Konuma1, Kenichi Yamamoto1,13, 5 Masato Akiyama2,14, Kazuyoshi Ishigaki2-5, Akari Suzuki15, Ken Suzuki1, Wataru Obara16, 6 Ken Yamaji17, Kazuhisa Takahashi18, Satoshi Asai19,20, Yasuo Takahashi21, Takao 7 Suzuki22, Nobuaki Shinozaki22, Hiroki Yamaguchi23, Shiro Minami24, Shigeo Murayama25, 8 Kozo Yoshimori26, Satoshi Nagayama27, Daisuke Obata28, Masahiko Higashiyama29, 9 Akihide Masumoto30, Yukihiro Koretsune31, FinnGen, Kaoru Ito32, Chikashi Terao2, 10 Toshimasa Yamauchi33, Issei Komuro34, Takashi Kadowaki33, Gen Tamiya11,12,35,36, 11 Masayuki Yamamoto11,12,35, Yusuke Nakamura37,38, Michiaki Kubo39, Yoshinori Murakami40, 12 Kazuhiko Yamamoto15, Yoichiro Kamatani2,41, Aarno Palotie5,9,42, Manuel A. Rivas10, Mark J. 13 Daly5-7,9, Koichi Matsuda43, *, Yukinori Okada1,2,41,44,45, * 14 15 1. Department of Statistical Genetics, Osaka University Graduate School of Medicine, Suita, 16 Japan. 17 2. Laboratory for Statistical and Translational Genetics, RIKEN Center for Integrative 18 Medical Sciences, Yokohama, Japan 19 3. Center for Data Sciences, Harvard Medical School, Boston, MA, USA 20 4. Divisions of Genetics and Rheumatology, Department of Medicine, Brigham and 21 Women’s Hospital, Harvard Medical School, Boston, MA, USA 22 5. Program in Medical and Population Genetics, Broad Institute of Harvard and MIT, 23 Cambridge, MA, USA 24 6. Analytic and Translational Genetics Unit, Massachusetts General Hospital, Boston, MA, 25 USA 26 7. Stanley Center for Psychiatric Research, Broad Institute of Harvard and MIT, Cambridge, 27 MA, USA 28 8. Department of Biomedical Informatics, Harvard Medical School, Boston, MA, USA 29 9. Institute for Molecular Medicine Finland (FIMM), University of Helsinki, Helsinki, Finland 30 10. Department of Biomedical Data Science, School of Medicine, Stanford University, 31 Stanford, CA, USA 32 11. Tohoku Medical Megabank Organization, Tohoku University, Sendai, Japan 33 12. The Advanced Research Center for Innovations in Next-Generation Medicine (INGEM), 34 Sendai, Japan 1 NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.10.23.20213652; this version posted October 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. 35 13. Department of Pediatrics, Osaka University Graduate School of Medicine, Suita, Japan. 36 14. Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, 37 Fukuoka, Japan 38 15. Laboratory for Autoimmune Diseases, RIKEN Center for Integrative Medical Sciences, 39 Yokohama, Japan 40 16. Department of Urology, Iwate Medical University, Iwate, Japan 41 17. Department of Internal Medicine and Rheumatology, Juntendo University Graduate 42 School of Medicine, Tokyo, Japan 43 18. Department of Respiratory Medicine, Juntendo University Graduate School of Medicine, 44 Tokyo, Japan 45 19. Division of Pharmacology, Department of Biomedical Science, Nihon University School 46 of Medicine, Tokyo, Japan 47 20. Division of Genomic Epidemiology and Clinical Trials, Clinical Trials Research Center, 48 Nihon University School of Medicine, Tokyo, Japan 49 21. Division of Genomic Epidemiology and Clinical Trials, Clinical Trials Research Center, 50 Nihon University School of Medicine, Tokyo, Japan 51 22. Tokushukai Group, Tokyo, Japan 52 23. Department of Hematology, Nippon Medical School, Tokyo, Japan 53 24. Department of Bioregulation, Nippon Medical School, Kawasaki, Japan 54 25. Tokyo Metropolitan Geriatric Hospital and Institute of Gerontology, Tokyo, Japan 55 26. Fukujuji Hospital, Japan Anti-Tuberculosis Association, Tokyo, Japan 56 27. The Cancer Institute Hospital of the Japanese Foundation for Cancer Research, Tokyo, 57 Japan 58 28. Center for Clinical Research and Advanced Medicine, Shiga University of Medical 59 Science, Otsu, Japan 60 29. Department of General Thoracic Surgery, Osaka International Cancer Institute, Osaka, 61 Japan 62 30. Aso Iizuka Hospital, Fukuoka, Japan 63 31. National Hospital Organization Osaka National Hospital, Osaka, Japan 64 32. Laboratory for Cardiovascular Genomics and Informatics, RIKEN Center for Integrative 65 Medical Sciences, Yokohama, Japan 66 33. Department of Diabetes and Metabolic Diseases, Graduate School of Medicine, The 67 University of Tokyo, Tokyo, Japan 68 34. Department of Cardiovascular Medicine, Graduate School of Medicine, The University of 69 Tokyo, Tokyo, Japan 2 medRxiv preprint doi: https://doi.org/10.1101/2020.10.23.20213652; this version posted October 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. 70 35. Graduate School of Medicine, Tohoku University, Sendai, Japan 71 36. Center for Advanced Intelligence Project, RIKEN, Tokyo, Japan 72 37. Human Genome Center, Institute of Medical Science, The University of Tokyo, Tokyo, 73 Japan 74 38. Cancer Precision Medicine Center, Japanese Foundation for Cancer Research, Tokyo, 75 Japan 76 39. RIKEN Center for Integrative Medical Sciences, Yokohama, Japan 77 40. Division of Molecular Pathology, Institute of Medical Science, The University of Tokyo, 78 Tokyo, Japan 79 41. Laboratory of Complex Trait Genomics, Department of Computational Biology and 80 Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo, Tokyo, 81 Japan 82 42. Psychiatric & Neurodevelopmental Genetics Unit, Department of Psychiatry, Analytic 83 and Translational Genetics Unit, Department of Medicine, and the Department of Neurology, 84 Massachusetts General Hospital, Boston, MA, USA 85 43. Department of Computational Biology and Medical Sciences, Graduate school of 86 Frontier Sciences, the University of Tokyo, Tokyo, Japan 87 44. Laboratory of Statistical Immunology, Immunology Frontier Research Center 88 (WPI-IFReC), Osaka University, Suita, Japan 89 45. Integrated Frontier Research for Medical Science Division, Institute for Open and 90 Transdisciplinary Research Initiatives, Osaka University, Suita, Japan 91 46. These authors contributed equally: S Sakaue and M Kanai. 92 * Corresponding authors Saori Sakaue, M.D., Ph.D. Koichi Matsuda, M.D., Ph.D. Yukinori Okada, M.D., Ph.D. [email protected] [email protected] [email protected] Center for Data Sciences, Department of Computational Department of Statistical Harvard Medical School Biology and Medical Sciences, Genetics, Osaka University Graduate school of Frontier Graduate School of Medicine Sciences, The University of Tokyo 93 3 medRxiv preprint doi: https://doi.org/10.1101/2020.10.23.20213652; this version posted October 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. 94 Abstract 95 The current genome-wide association studies (GWASs) do not yet capture sufficient 96 diversity in terms of populations and scope of phenotypes. To address an essential need to 97 expand an atlas of genetic associations in non-European populations, we conducted 220 98 deep-phenotype GWASs (disease endpoints, biomarkers, and medication usage) in 99 BioBank Japan (n = 179,000), by incorporating past medical history and text-mining results 100 of electronic medical records. Meta-analyses with the harmonized phenotypes in the UK 101 Biobank and FinnGen (ntotal = 628,000) identified over 4,000 novel loci, which substantially 102 deepened the resolution of the genomic map of human traits, benefited from East Asian 103 endemic diseases and East Asian specific variants. This atlas elucidated the globally shared 104 landscape of pleiotropy as represented by the MHC locus, where we conducted 105 fine-mapping by HLA imputation. Finally, to intensify the value of deep-phenotype GWASs, 106 we performed statistical decomposition of matrices of phenome-wide summary statistics, 107 and identified the latent genetic components, which pinpointed the responsible variants and 108 shared biological mechanisms underlying current disease classifications across populations. 109 The decomposed components enabled genetically informed subtyping of similar diseases 110 (e.g., allergic diseases). Our study suggests a potential avenue for hypothesis-free 111 re-investigation of human disease classifications through genetics. 112 4 medRxiv preprint doi: https://doi.org/10.1101/2020.10.23.20213652; this version posted October 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
Load more

Recommended publications
  • ABO (ISBT 001) Blood Group Alleles V1.1 171023
    Names for ABO (ISBT 001) blood group alleles v1.1 171023 Names for ABO (ISBT 001) Blood Group Alleles General description: The ABO system was discovered as in 1900 and is considered the first and clinically most important system. The ABO gene and its 7 coding exons give rise to one of two principally different glycosyltransferases. The A glycosyltransferase (GTA) catalyzes the addition of a donor substrate, UDP-N-acetylgalactosamine, to an acceptor substrate known as the H antigen. The B glycosyltransferase (GTB) differs by only four amino-acid substitutions from GTA and performs the same enzymatic reaction but uses UDP-galactose as donor substrate. In this way, genetic polymorphism gives rise to two related antigens in this system. Any polymorphism or mutation that changes the activity or specificity of the encoded enzyme may therefore alter the ABO phenotype. Alterations that completely abolish enzymic activity give rise to the blood group O phenotype, in which the H antigen remains unconverted and no A or B antigen can be detected. If the genetic alteration decreases the activity of the enzyme, or alters its subcellular location and thereby decreases conversion of H to A or B, a weak A or B subgroup phenotype can result. Furthermore, certain polymorphisms result in promiscuous enzymes that can synthesize both A and B antigen, thereby resulting in the so-called cisAB or B(A) phenotypes. The A phenotype is divided into A1 and A2. The former is more prevalent in all populations and has approximately 5 times more A epitopes per red cell. The GTA1 is also better than GTA2 at synthesizing certain forms of A, .e.g.
    [Show full text]
  • 1 Contributors of Finngen
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) BMJ Open Resp Res Contributors of FinnGen Steering Committee Aarno Palotie Institute for Molecular Medicine Finland, HiLIFE, University of Helsinki, Finland Mark Daly Institute for Molecular Medicine Finland, HiLIFE, University of Helsinki, Finland Pharmaceutical companies Howard Jacob Abbvie, Chicago, IL, United States Athena Matakidou Astra Zeneca, Cambridge, United Kingdom Heiko Runz Biogen, Cambridge, MA, United States Sally John Biogen, Cambridge, MA, United States Robert Plenge Celgene, Summit, NJ, United States Mark McCarthy Genentech, San Francisco, CA, United States Julie Hunkapiller Genentech, San Francisco, CA, United States Meg Ehm GlaxoSmithKline, Brentford, United Kingdom Dawn Waterworth GlaxoSmithKline, Brentford, United Kingdom Caroline Fox Merck, Kenilworth, NJ, United States Anders Malarstig Pfizer, New York, NY, United States Kathy Klinger Sanofi, Paris, France Kathy Call Sanofi, Paris, France University of Helsinki & Biobanks Tomi Mäkelä HiLIFE, University of Helsinki, Finland, Finland Jaakko Kaprio Institute for Molecular Medicine Finland, HiLIFE, Helsinki, Finland, Finland Petri Virolainen Auria Biobank / Univ. of Turku / Hospital District of Southwest Finland, Turku, Finland Kari Pulkki Auria Biobank / Univ. of Turku / Hospital District of Southwest Finland, Turku, Finland Terhi Kilpi THL Biobank / Finnish Institute
    [Show full text]
  • Demonstration of SNP Genotyping Using a Single Nucleotide Extension Method and the 3500 Series Genetic Analyzer
    YOUR INNOVATIVE RESEARCH ABO BLOOD GROUP DETERMINATION Demonstration of SNP Genotyping Using a Single Nucleotide Extension Method and the 3500 Series Genetic Analyzer Introduction This publication describes the collaboration The Department of Legal between researchers at the Okayama Medicine, Okayama University Graduate School of Medicine, University Graduate School and at Applied Dentistry and Pharmaceutical Sciences develops research Biosystems (Foster City, CA, USA), aimed methodologies for crime detec- tion techniques that utilize DNA ® at demonstrating a SNaPshot Multiplex analyses, including the discov- System genotyping protocol on the Applied ery of new polymorphic DNA loci and tools to identify gender Biosystems® 3500xL Genetic Analyzer from sample material. Visiting fellow Dr. Doi is involved in an capillary electrophoresis (CE) instrument. ongoing effort to refine DNA- based blood typing techniques and is also developing a DNA Genotyping to determine ABO blood type identification method that is useful on composite samples. group status is a valuable tool in forensic Pictured are Dr. Yusuke Doi (top applications where routine serological right); Dr. Yuji Yamamoto (top left); Mayumi Okashita (bottom typing is not feasible. Therefore, right); and Hiroko Ide (bottom left). laboratories that are developing ABO blood group typing applications appreciate workflows that provide fast, accurate, and reliable results, particularly if the assay delivers data for samples that contain very ABO Genotyping of six SNP sites within the ABO gene (cor- low concentrations of gDNA or degraded Identification of specific combinations of responding to nucleotides 261, 297, 681, 703, gDNA. In this publication, we present a single nucleotide polymorphisms (SNPs) 802, and 803). These six sites are sufficient in the ABO locus on chromosome 9 can for accurate determination of ten common simple, rapid, and robust workflow for be used to determine ABO blood type.
    [Show full text]
  • Appendix (Finngen Partner List)
    Appendix (FinnGen partner list): Coordinators: Biobank of Eastern Finland Northern Savo Hospital District University of Helsinki, HiLIFE, University of Eastern Finland Institute for Molecular Medicine Finland FIMM South Savo Social and Health Care Authority Helsinki University Hospital (HUS) Joint Municipal Authority for North Karelia Social The National Institute of Health and Welfare (THL) and Health services (Siun sote) Eastern Savo Hospital District Funders: Central Finland Biobank Central Finland Health Care District Business Finland University of Jyväskylä Abbvie AstraZeneca Northern Finland Biobank Borealis Biogen Northern Ostrobothnia Hospital District Celgene University of Oulu Genentech, a member of the Roche Group Joint Municipal Public Utility for Northern Finland GlaxoSmithKline (GSK) central laboratory Nordlab Merck & Co., Inc., Kenilworth, NJ, USA Central Ostrobothnia Joint Municipal Authority Pfizer for Social and Health Care Sanofi Kainuu Social and Health Care Joint Municipal Authority Finnish Biobanks and their host organisations: Lappi Hospital District Länsi-Pohja Hospital District Auria Biobank Hospital District of Southwest Finland Finnish Clinical Biobank Tampere University of Turku Pirkanmaa Hospital District Satakunta Hospital District University of Tampere Vaasa Hospital District Kanta-Häme Hospital District South Ostrobothnia Hospital District Helsinki Biobank Hospital District of Helsinki and Uusimaa (HUS) THL Biobank University of Helsinki The National Institute of Health and Welfare (THL) Kymenlaakso Social and Health Services (Carea) South Karelia Social and Health Care District Blood Service Biobank (Eksote) Finnish Red Cross Blood Service Finnish Hematology Registry and Clinical Biobank (FHRB) Finnish Red Cross Blood Service Finnish Association of Hematology Institute for Molecular Medicine Finland (FIMM), University of Helsinki .
    [Show full text]
  • Repetitive Elements in Humans
    International Journal of Molecular Sciences Review Repetitive Elements in Humans Thomas Liehr Institute of Human Genetics, Jena University Hospital, Friedrich Schiller University, Am Klinikum 1, D-07747 Jena, Germany; [email protected] Abstract: Repetitive DNA in humans is still widely considered to be meaningless, and variations within this part of the genome are generally considered to be harmless to the carrier. In contrast, for euchromatic variation, one becomes more careful in classifying inter-individual differences as meaningless and rather tends to see them as possible influencers of the so-called ‘genetic background’, being able to at least potentially influence disease susceptibilities. Here, the known ‘bad boys’ among repetitive DNAs are reviewed. Variable numbers of tandem repeats (VNTRs = micro- and minisatellites), small-scale repetitive elements (SSREs) and even chromosomal heteromorphisms (CHs) may therefore have direct or indirect influences on human diseases and susceptibilities. Summarizing this specific aspect here for the first time should contribute to stimulating more research on human repetitive DNA. It should also become clear that these kinds of studies must be done at all available levels of resolution, i.e., from the base pair to chromosomal level and, importantly, the epigenetic level, as well. Keywords: variable numbers of tandem repeats (VNTRs); microsatellites; minisatellites; small-scale repetitive elements (SSREs); chromosomal heteromorphisms (CHs); higher-order repeat (HOR); retroviral DNA 1. Introduction Citation: Liehr, T. Repetitive In humans, like in other higher species, the genome of one individual never looks 100% Elements in Humans. Int. J. Mol. Sci. alike to another one [1], even among those of the same gender or between monozygotic 2021, 22, 2072.
    [Show full text]
  • High Rhesus (Rh(D))
    Golassa et al. BMC Res Notes (2017) 10:330 DOI 10.1186/s13104-017-2644-3 BMC Research Notes RESEARCH ARTICLE Open Access High rhesus (Rh(D)) negative frequency and ethnic‑group based ABO blood group distribution in Ethiopia Lemu Golassa1†, Arega Tsegaye2†, Berhanu Erko1 and Hassen Mamo3* Abstract Background: Knowledge of the distribution of ABO-Rh(D) blood groups in a locality is vital for safe blood services. However, the distribution of these blood systems among Ethiopians in general is little explored. This study was, there- fore, designed to determine the ABO-Rh(D) blood group distribution among patients attending Gambella hospital, southwestern Ethiopia. Methods: A cross-sectional study was conducted between November and December 2013 (N 449). The patients were grouped into two broad categories. Those who originally moved from diferent parts of Ethiopia= and currently residing in Gambella are named ‘highlanders’ (n 211). The other group consisted of natives (Nilotics) to the locality (n 238). ABO-Rh(D) blood groups were typed =by agglutination, open-slide test method, using commercial antisera (Biotech= laboratories Ltd, Ipswich, Sufolk, UK). Results: Overall, majority of the participants (41.20%) had blood type ‘O’ followed by types ‘A’ (34.96%), ‘B’ (20.48%) and ‘AB’ (3.34%). However, blood type ‘A’ was the most frequent (44.07%) blood group among the ‘highlanders’ and 50.42% of Nilotic natives had type ‘O’. The proportion of participants devoid of the Rh factor was 19.37%. Conclusions: While the ABO blood group distribution is similar to previous reports, the Rh(D) frequency is much higher than what was reported so far for Ethiopia and continental Africa.
    [Show full text]
  • Introduction to the Rh Blood Group.Pdf
    Introduction to the Rhesus Blood Group Justin R. Rhees, M.S., MLS(ASCP)CM, SBBCM University of Utah Department of Pathology Medical Laboratory Science Program Objectives 1. Describe the major Rhesus (Rh) blood group antigens in terms of biochemical structure and inheritance. 2. Describe the characteristics of Rh antibodies. 3. Translate the five major Rh antigens, genotypes, and haplotypes from Fisher-Race to Wiener nomenclature. 4. State the purpose of Fisher-Race, Wiener, Rosenfield, and ISBT nomenclatures. Background . How did this blood group get its name? . 1937 Mrs. Seno; Bellevue hospital . Unknown antibody, unrelated to ABO . Philip Levine tested her serum against 54 ABO-compatible blood samples: only 13 were compatible. Rhesus (Rh) blood group 1930s several cases of Hemolytic of the Fetus and Newborn (HDFN) published. Hemolytic transfusion reactions (HTR) were observed in ABO- compatible transfusions. In search of more blood groups, Landsteiner and Wiener immunized rabbits with the Rhesus macaque blood of the Rhesus monkeys. Rhesus (Rh) blood group 1940 Landsteiner and Wiener reported an antibody that reacted with about 85% of human red cell samples. It was supposed that anti-Rh was the specificity causing the “intragroup” incompatibilities observed. 1941 Levine found in over 90% of erythroblastosis fetalis cases, the mother was Rh-negative and the father was Rh-positive. Rhesus macaque Rhesus (Rh) blood group Human anti-Rh and animal anti- Rh are not the same. However, “Rh” was embedded into blood group antigen terminology. The
    [Show full text]
  • Makkonenenni.Pdf (7.786Mt)
    ! ! !""#$%&''(")"$ !"#$%&!'(&!)"*)+*&,$*"$$-%*+).*"(&!)"(/* ("-*/)0(/*1!)1("2*%$.#!0$%*("-* !34.)#$3$"&*)+*1!)1("2*(5(.$"$%%* ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! *&+,-./$(0$%)1#+#")$&"1$2)&-.3$4)+3"(-(5/$ %&6.)786$43)6#6$ 9+.(:)7$;<=>! $ ! "#$!%#&'(!)*(*+,-./&! ! #$"%%$&! '$()*+**,!-".)$,%%"! '*%"/0&! ! 123345657!6558!12982! 4:;"%%.&! 3$,;$<<";:*,!/$!)$"%$<<";:*,!=".)$,%%")$<>*<?"@*,!:$+)*"@*,! %$+:.":?;!/$!=".)$,%%":"*:.";??@*,!<";00(",*,! A">?(00+0&! ! BC! 4D/$$/$:&! ! E'!F.D$,,$!10%*<07!E'!3"((.!A$>",$",*,! '$+%$;:$/$:&! ! E'!F.D$,,$!10%*<07!$)?<$";)+.G*;;.+"!H*;$!IJ:K,*,! #0">0J;&! ! L.%$%??!MNOB! ! *,,0,1*-./2! ! *345673589:! 4;384;! <;! 4;=>644994?! -".)$,%%"! %*+00! /$! ;0"<KK! "D(";)*+0";"0! ,0J::*":0! ;*%0! ,""D",! JD@";:*::0>"0! :"*:./$! :?<*>"$! <00%*:"*:**<<";"0! :?:%"(?;:$+)*":$! >$+:*,P! -".)$,%*"<<$! .,! (*+%"::0>0!+..<"!<00%*:"*:**,!%*D":J%;*;;0!."+*Q!/$!@"$R,..;"%*;%*";*;:0!D."@.;:$!*,,$%.">$$,7! *D%0";*>00,!/$!J%;"<K<<";:*::JJ,!<00%*:"*:**;**,P!-".)$,%%"<$%"!:?<"!>."($$,!A?.(*;;$!>?.,,$! MNOC7!/.,%$!/0<%**,!A?.(*;;$!.,!+*%";:*+K":J!%J((*,*,!=".)$,%%"$P!'$()*+**,!-".)$,%%"! ;$"! :."("<?>$,! >?.,,$! MNOSP! A?.($<$",*,! =".)$,%%":."(",:$! .,! >"*<0! ;?D:**<<";*,! ??::$! /$! >$$:""!;"%;"!%*D"::0(";:0!>$;:$:$%;**,!%0J::0/"*,;0!:$+)*";"",P!'0(0,!:?:%"(?%;*,!:$>."::**,$!.<"! <";0:0!'$()*+**,!-".)$,%",!,0%J>JJ::0!)$"%$<<";:*,!$%$:**(";:*,!:?:%"/."@*,!%*;%??@*;;$!;*%0! <";0:0! D*"@0,! =".)$,%%":"*:.";??::$$,! ($+%%",.",,",! $>?<<$P! '?:%"(?%;*<<$! )J+"::"",! (JK;! ;*<>"::0(00,!$%$:**(";:*,!:?:%"/."@*,!/$!<00%*J+":J;:*,!:$+)*":$!=".)$,%%")$<>*<?"@*,!;?D:**,P!
    [Show full text]
  • 615.Full.Pdf
    Copyright 6 1995 hy the Genetics Society of America Developmental Genetical Analysis and Molecular Cloning of the abnormal oocyte Gene of Drosophila melamgaster John Tomkiel,” Laura Fanti: Maria Berloco: Luigi Spinelli,+John W. Tamk~m,~ Barbara T. Wakimoto*9sand Sergio Pimpinellit” *Department of Genetics, University of Washington, Seattle, Washington 98195, +Zstituto di Genetica, Universita di Ban‘, 70126 Ban’, Italy, IDepartment of Biology, University of California, Santa Cruz, California 95064 and $Department of Zoology, University of Washington, Seattle, Washington 981 95 Manuscript received September 6, 1994 Accepted for publication March 8, 1995 ABSTRACT Studies of the abnormal oocyte (abo) gene of Drosophila mlanogaster have previously been limitedto the analysis of a single mutant allele, abnmmal oocyte’ (abo’). The abo’ mutation causes a maternal-effect lethality that can be partially rescued zygotically by the abo+ allele and by increasing the dosage of specific regions of heterochromatin denoted ABO. This report describes the propertiesof abo’, a new Pelement-induced allelethat allowed us to reexamine the natureof maternaleffect defect. Comparisons of the phenotype of progeny of abo‘/abo’ and abo’/abo’ females show that the preblastoderm lethality previously described asa component of the abo mutant maternal effect results froma recessive fertilization defect associated with the abo’ chromosome. We demonstrate here that the abeinduced maternaleffect lethality occurs predominately late in embryogenesis after cuticle deposition but before hatching. The phenocritical period forzygotic rescue by heterochromatin coincideswith this periodof late embryogene- sis. We have used the abo’ mutation to map and molecularly clone the gene.We show that the abo gene is located in the 32C cytogenetic interval and identify the putative abo transcript from mFWA isolated from adult females.
    [Show full text]
  • An Ancient Deletion in the ABO Gene Affects the Composition of the Porcine Microbiome by Altering Intestinal N-Acetyl-Galactosam
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.16.206219; this version posted July 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Effect of the ABO locus on the porcine gut microbiome Page 1 of 66 1 An ancient deletion in the ABO gene affects the composition of the porcine microbiome 2 by altering intestinal N-acetyl-galactosamine concentrations. 3 Hui Yang1*, Jinyuan Wu1*, Xiaochang Huang1, Yunyan Zhou1, Yifeng Zhang1, Min Liu1, Qin Liu1, 4 Shanlin Ke1, Maozhang He1, Hao Fu1, Shaoming Fang1, Xinwei Xiong1, Hui Jiang1, Zhe Chen1, 5 Zhongzi Wu1, Huanfa Gong1, Xinkai Tong1, Yizhong Huang1, Junwu Ma1, Jun Gao1, Carole 6 Charlier2,1, Wouter Coppieters2,1, Lev Shagam2, Zhiyan Zhang1, Huashui Ai1, Bin Yang1, Michel 7 Georges2,1,$ ,† , Congying Chen1, $,†, Lusheng Huang1, $,†,#. 8 1National Key Laboratory for Swine genetic improvement and production technology, 9 Ministry of Science and Technology of China, Jiangxi Agricultural University, NanChang, Jiangxi 10 Province, 330045, PR China. 2Unit of Animal Genomics, GIGA-Institute and Faculty of 11 Veterinary Medicine, University of Liege, 4000 Liege, Belgium. 12 *Contributed equally to this work. $Senior authors. †Corresponding authors. #Lead contact. 13 14 Summary 15 We have generated a large heterogenous stock population by intercrossing eight divergent 16 pig breeds for multiple generations. We have analyzed the composition of the intestinal 17 microbiota at different ages and anatomical locations in > 1,000 6th- and 7th- generation 18 animals. We show that, under conditions of exacerbated genetic yet controlled 19 environmental variability, microbiota composition and abundance of specific taxa (including 20 Christensenellaceae) are heritable in this monogastric omnivore.
    [Show full text]
  • ABO Blood Group a Transferase and Its Codon 69 Substitution
    www.nature.com/scientificreports OPEN ABO blood group A transferase and its codon 69 substitution enzymes synthesize FORS1 antigen of FORS Received: 12 March 2019 Accepted: 17 June 2019 blood group system Published: xx xx xxxx Miyako Yamamoto 1, Maria Cristina Tarasco1,2, Emili Cid 1,3, Hidetomo Kobayashi1,4 & Fumiichiro Yamamoto 1,3 Human histo-blood group A transferase (AT) catalyzes the biosynthesis of oligosaccharide A antigen important in blood transfusion and cell/tissue/organ transplantation. This enzyme may synthesize Forssman antigen (FORS1) of the FORS blood group system when exon 3 or 4 of the AT mRNA is deleted and/or the LeuGlyGly tripeptide at codons 266–268 of AT is replaced by GlyGlyAla. The Met69Ser/Thr substitutions also confer weak Forssman glycolipid synthase (FS) activity. In this study, we prepared the human AT derivative constructs containing any of the 20 amino acids at codon 69 with and without the GlyGlyAla substitution, transfected DNA to newly generated COS1(B3GALNT1 + A4GALT) cells expressing an enhanced level of globoside (Gb4), the FS acceptor substrate, and immunologically examined the FORS1 expression. Our results showed that all those substitution constructs at codon 69 exhibited FS activity. The combination with GlyGlyAla signifcantly increased the activity. The conserved methionine residue in the ABO, but not GBGT1, gene-encoded proteins may implicate its contribution to the separation of these genes in genetic evolution. Surprisingly, with increased Gb4 availability, the original human AT with the methionine residue at codon 69 was also demonstrated to synthesize FORS1, providing another molecular mechanism of FORS1 appearance in cancer of ordinary FORS1- negative individuals.
    [Show full text]
  • SUPPLEMENTARY DATA ABO Blood Group Determined by Genotyping in the NEO Study in the NEO Genotype Data, Only Rs8176749:G>A Was Directly Genotyped on the Array
    SUPPLEMENTARY DATA ABO blood group determined by genotyping in the NEO study In the NEO genotype data, only rs8176749:G>A was directly genotyped on the array. Rs7853989:G>C was derived by imputation, with an imputation quality of 0.99. Rs8176719:insC and rs8176750:delC were not available and replaced by rs8176645:A>T (R2=0.98 with rs8176719:insC, imputation quality of 0.80) and rs8176704:G>A (R2=0.99 with rs8176750:delC, imputation quality of 0.99) separately. The best guess genotypes for the imputed SNPs were determined by the highest probability of the genotype with a minimum threshold of 0.7. If the highest probability of the genotype was below the minimum threshold, the genotype of that SNP was set to missing. Theoretically, 15 combinations of the four ABO alleles were possible, and 14 out of the 15 combinations were observed in the current NEO study population. Modelling the effects of ABO gene expression changes on insulin secretion in vitro The knock-down efficiency was assessed by Q-PCR (Light Cycler 480-II Real-time PCR system - Roche) on total RNA extracted using RNeasy kit (Qiagen), and reversed transcribed using M-MLV reverse transcriptase (Invitrogen). Fold induction was calculated using the DeltaCT method with GAPDH as housekeeping gene. The primers used were the following: ABO-Fw: ACAGACACTGAACCATCCTGGGTT; ABO-Rv: AGACAAACACTGCGAAGGGAAGGA; GAPDH-Fw: ATCATCCCTGCATCCACTG; GAPDH-Rv: ATCATACTTGGCAGGTTTCTCC. Transduced MIN6 cells were subjected to a GSIS assay. Briefly, cells were pre-incubated in a modified Krebs-Ringer bicarbonate buffer with HEPES (KRBH) containing 2 mmol/l glucose for 1.5 h at 37°C.
    [Show full text]