DOCSLIB.ORG

Proteomic Analysis Suggests a Role for Htra Serine Peptidase 1 in Immune Regulation and Thereby in Age-Related Macular Degeneration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Proteomic Analysis Suggests a Role for Htra Serine Peptidase 1 in Immune Regulation and Thereby in Age-Related Macular Degeneration Proteomic Analysis Suggests a Role for HtrA Serine Peptidase 1 in Immune Regulation and Thereby in Age-Related Macular Degeneration Inaugural-Dissertation zur Erlangung des Doktorgrades der Medizin der Medizinischen Fakultät der Eberhard Karls Universität zu Tübingen vorgelegt von Feng, Lili 2014 Dekan: Professor Dr. I. B. Autenrieth 1. Berichterstatter: Professor Dr. M. Ueffing 2. Berichterstatter: Professor Dr. R. Feil “Nothing is to be feared, it is only to be understood. Now is the time to understand more, so that we may fear less.” “Life is not easy for any of us. But what of that? We must have perseverance and above all confidence in ourselves. We must believe that we are gifted for something and that this thing must be attained.” “I am among those who think that science has great beauty. A scientist in his laboratory is not only a technician: he is also a child placed before natural phenomena which impress him like a fairy tale.” Marie Curie Statement of Authorship I hereby certify, to my best of knowledge, that this thesis contains no material that has been extracted totally or partially from a thesis, dissertation or research paper by which I have qualified for or been awarded another degree or diploma. Work described here is truthfully original my own work, except where otherwise acknowledged or referenced, whether published or unpublished. This thesis has not been submitted for the award for another degree or diploma in any other tertiary institute. Lili FENG 1 Abstract Purpose. Single-Nucleotide Polymorphisms on chromosome 10 at the region 10q26 that harbors the three genes, PLEKHA1, ARMS2 and HtrA1, show strong association with the pathogenesis of age-related macular degeneration (AMD). In the last decade, evidence was mounted that mutations in the HtrA1 gene are a major causative factor of this disorder in Caucasian populations. The current study was undertaken in order to enhance the understanding the role of this HtrA1 in the pathogenesis of AMD. Methods. A HtrA1 gene trap mouse model was employed to compare the differences in protein expression between the gene trap mouse and a wild type mouse. ARPE19 and HeLa cells were transfected with a plasmid coding for triple-tagged, proteolytically inactive HtrA1. Next, a Co-IP assay was used to isolate HtrA1 interacting proteins. Selected candidates were validated with Western blot. Potential substrates of HtrA1 were tested by an in vitro digestion assay. Results. Our study indicated that HtrA1 as a secreted protein binds to various complement components, e.g. CFP, CFD, CFI, C1r, C1s, C2, C3 and C5 in the classical pathway, as well as to components of the lectin-mediated pathway and, in particular, to components of the alternative pathway. Several of these components have been implicated in the pathological process of age-related macular degeneration. Notably, a regulatory component of the innate immune activity, Ubiquitin-like protein ISG15 directly interacts with HtrA1 in our Co-IP. Furthermore, our in vitro digestion assay showed that Ubiquitin-like protein ISG15 is a substrate of HtrA1 protease. Conclusion. The aberrant activation of the complement system by HtrA1 found in our assays underlies the importance of the immune system in the pathogenesis of AMD. Our results suggest that HtrA1 may exert its biological function through the regulation of the immune system. 2 Tables of Contents Statement of Authorship ................................................................................................................ 1 Abstract ........................................................................................................................................... 2 Tables of Contents .......................................................................................................................... 3 List of Figures ................................................................................................................................. 5 List of Tables ................................................................................................................................... 6 Abbreviations .................................................................................................................................. 7 1. Introduction .......................................................................................................................... 10 1.1 Definition and classification of AMD ............................................................................... 10 1.1.1 Macula ....................................................................................................................................................11 1.1.2 Photoreceptors .....................................................................................................................................12 1.1.3.1 Dry AMD ............................................................................................................... 14 1.1.3.2 Wet AMD .............................................................................................................. 15 1.2 Environmental Risk factors for AMD .............................................................................. 17 1.3 Genetic predisposition of AMD ......................................................................................... 19 1.3.1 Complement factor H (CFH) .........................................................................................................19 1.3.2 Complement factor B (CFB) and complement component 2 (C2) ....................................19 1.3.3 Complement component 3 (C3) .....................................................................................................20 1.3.4 Chromosome 10q26 (ARMS2 and HtrA1) .................................................................................20 1.4 HtrA1 ................................................................................................................................... 22 1.5 Quantitative Proteomics .................................................................................................... 24 1.6 Aims of the Study ............................................................................................................... 25 2. Materials and methods ............................................................................................................. 26 2.1 Experimental Design .......................................................................................................... 26 2.1.1 Analysis of HtrA1-deficient mouse sera .....................................................................................26 2.1.2 Identification of binding partners of HtrA1 using cultured human cell lines ..............26 2.2 ICPL labeling ...................................................................................................................... 28 3 2.3 Cell Culture ......................................................................................................................... 29 2.4 Transfection ........................................................................................................................ 30 2.5 Western Blotting ................................................................................................................. 31 2.6 Co-Immunoprecipitation ................................................................................................... 32 2.7 In vitro digestion ................................................................................................................. 32 2.8 Proteomics and Mass spectrometry (MS) ........................................................................ 32 3. Results ....................................................................................................................................... 34 3.1 Mouse Serum ICPL labeling ............................................................................................. 34 3.2 Co-IP .................................................................................................................................... 34 3.2.1 ARPE19 Cells Co-IP .........................................................................................................................34 3.2.2 HeLa Cells Co-IP-FLAG .................................................................................................................34 3.2.3 Hela Cells Co-IP-c-MYC .................................................................................................................35 3.3 IP and WB to confirm the interaction .............................................................................. 40 3.4 In vitro digestion ................................................................................................................. 40 3.4.1 Comparison of ISG15 and ISG15+HtrA1 ..................................................................................40 3.4.2 Comparison of HtrA1, ISG15 and HtrA1+ISG15 ...................................................................41 3.4.3 Digestion with control .......................................................................................................................42 4. Discussion .................................................................................................................................. 44 4.1 Immune system and AMD ................................................................................................. 45 4.2 ISG15, HtrA1 and AMD ...................................................................................................
Load more

Recommended publications
  • Murine Osteoclasts Secrete Serine Protease Htra1 Capable of Degrading Osteoprotegerin in the Bone Microenvironment
    ARTICLE https://doi.org/10.1038/s42003-019-0334-5 OPEN Murine osteoclasts secrete serine protease HtrA1 capable of degrading osteoprotegerin in the bone microenvironment Nagahiro Ochiai1,2, Yutaka Nakachi1, Tomotaka Yokoo1, Takahiro Ichihara2, Tore Eriksson 3, Yuki Yonemoto2, 1234567890():,; Takehiko Kato2, Hitoshi Ogata2, Natsuko Fujimoto2, Yasuhiro Kobayashi4, Nobuyuki Udagawa5, Shinsuke Kaku2, Tomokazu Ueki2, Yasushi Okazaki 1,6, Naoyuki Takahashi4 & Tatsuo Suda1 Osteoclasts are multinucleated cells responsible for bone resorption. The differentiation of osteoclasts from bone marrow macrophages (BMMs) is induced by receptor activator of NF- κB ligand (RANKL). Osteoprotegerin (OPG), a decoy receptor of RANKL, inhibits osteo- clastogenesis by blocking RANKL signaling. Here we investigated the degradation of OPG in vitro. Osteoclasts, but not BMMs, secreted OPG-degrading enzymes. Using mass spec- trometry and RNA-sequencing analysis, we identified high-temperature requirement A serine peptidase 1 (HtrA1) as an OPG-degrading enzyme. HtrA1 did not degrade OPG pre-reduced by dithiothreitol, suggesting that HtrA1 recognizes the three-dimensional structure of OPG. HtrA1 initially cleaved the amide bond between leucine 90 and glutamine 91 of OPG, then degraded OPG into small fragments. Inhibitory activity of OPG on RANKL-induced osteo- clastogenesis was suppressed by adding HtrA1 in RAW 264.7 cell cultures. These results suggest that osteoclasts potentially prepare a microenvironment suitable for osteoclasto- genesis. HtrA1 may be a novel drug target for osteoporosis. 1 Research Center for Genomic Medicine, Saitama Medical University, Saitama 350-1298, Japan. 2 Pharmacology Laboratories, Taisho Pharmaceutical Co., Ltd, Saitama 331-9530, Japan. 3 Chemistry Laboratories, Taisho Pharmaceutical Co., Ltd, Saitama 331-9530, Japan. 4 Institutes for Oral Science, Matsumoto Dental University, Nagano 399-0781, Japan.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Gene Interaction of CFH, ARMS2, and ARMS2&Sol;HTRA1 on the Risk Of
    Eye (2015) 29, 691–698 © 2015 Macmillan Publishers Limited All rights reserved 0950-222X/15 www.nature.com/eye 1,2,3,5 1,2,3,5 4,5 Gene–gene interaction L Huang , Q Meng , C Zhang , LABORATORY STUDY Y Sun1,2,3, Y Bai1,2,3,SLi1,2,3, X Deng1,2,3, of CFH, ARMS2, and B Wang1,2,3,WYu1,2,3, M Zhao1,2,3 and X Li1,2,3 ARMS2/HTRA1 on the risk of neovascular age-related macular degeneration and polypoidal choroidal vasculopathy in Chinese population Abstract rs1065489 did not show significant association with nAMD (P40.01), but was strongly Purpose To evaluate the association and associated with PCV in Chinese patients 1Department of interaction of five single-nucleotide (Po0.001). Ophthalmology, Peking polymorphisms (SNPs) in three genes (CFH, University People’s Conclusions In this study, we found that the ARMS2, and ARMS2/HTRA1) with Hospital, Beijing, China interaction of ARMS2 and ARMS2/HTRA1 is neovascular age-related macular degeneration significantly associated with nAMD, and the 2 (nAMD) and polypoidal choroidal Key Laboratory of Vision interaction of CFH and ARMS2 is pronounced vasculopathy (PCV) in Chinese population. Loss and Restoration, in PCV development in Chinese population. Ministry of Education, Methods A total of 300 nAMD and 300 PCV Eye 29, – Beijing, China patients and 301 normal subjects participated (2015) 691 698; doi:10.1038/eye.2015.32; published online 13 March 2015 in the present study. The allelic variants of 3Department of Abdominal rs800292, rs2274700, rs3750847, rs3793917, and Surgical Oncology, Cancer rs1065489 were determined by matrix-assisted Institute and Hospital, Introduction laser desorption/ionization time-of-flight mass Chinese Academy of Medical Sciences, Peking – Age-related macular degeneration (AMD) is the spectrometry (MALDI-TOF-MS).
    [Show full text]
  • Genetic Susceptibility to Age-Related Macular Degeneration: a Paradigm for Dissecting Complex Disease Traits
    Human Molecular Genetics, 2007, Vol. 16, Review Issue 2 R174–R182 doi:10.1093/hmg/ddm212 Genetic susceptibility to age-related macular degeneration: a paradigm for dissecting complex disease traits Anand Swaroop1,2,*, Kari EH Branham1, Wei Chen3 and Goncalo Abecasis3,* 1Departments of Ophthalmology and Visual Sciences, 2Department of Human Genetics and 3Department of Biostatistics, University of Michigan, Ann Arbor, MI 48105, USA Received July 20, 2007; Revised July 20, 2007; Accepted July 26, 2007 Age-related macular degeneration (AMD) is a progressive neurodegenerative disease, which affects quality of life for millions of elderly individuals worldwide. AMD is associated with a diverse spectrum of clinical phe- notypes, all of which include the death of photoreceptors in the central part of the human retina (called the macula). Tremendous progress has been made in identifying genetic susceptibility variants for AMD. Variants at chromosome 1q32 (in the region of CFH ) and 10q26 (LOC387715/ARMS2) account for a large part of the genetic risk to AMD and have been validated in numerous studies. In addition, susceptibility var- iants at other loci, several as yet unidentified, make substantial cumulative contribution to genetic risk for AMD; among these, multiple studies support the role of variants in APOE and C2/BF genes. Genome-wide association and re-sequencing projects, together with gene-environment interaction studies, are expected to further define the causal relationships that connect genetic variants to AMD pathogenesis and should assist in better design of prevention and intervention. INTRODUCTION studies of AMD illustrate both the promise and challenges of new gene-mapping approaches. Early-onset maculopathies, A vast majority of common diseases are complex and such as Stargardt’s disease, have long been known to have her- multi-factorial, resulting from the interplay of genetic com- editary basis.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7,972,787 B2 Deangelis (45) Date of Patent: Jul
    US007972 787B2 (12) United States Patent (10) Patent No.: US 7,972,787 B2 Deangelis (45) Date of Patent: Jul. 5, 2011 (54) METHODS FOR DETECTINGAGE-RELATED WO WO-2006088950 8, 2006 MACULAR DEGENERATION WO WO-2006133295 A2 12/2006 WO WO-2007044897 A1 4/2007 WO WO-2008O13893 A2 1, 2008 (75) Inventor: Margaret M. Deangelis, Cambridge, WO WO-2008067551 A2 6, 2008 MA (US) WO WO-2008094,370 A2 8, 2008 WO WO-2008103299 A2 8, 2008 WO WO-2008110828 A1 9, 2008 (73) Assignee: Massachusetts Eye and Ear Infirmary, WO WO-2008103299 A3 12/2008 Boston, MA (US) OTHER PUBLICATIONS (*) Notice: Subject to any disclaimer, the term of this Hirschhornet al. Genetics in Medicine. Mar. 2002. vol. 4. No. 2, pp. patent is extended or adjusted under 35 45-61 U.S.C. 154(b) by 391 days. Yang et all. Science. 2006. 314: 992-993 and supplemental online content. (21) Appl. No.: 12/032,154 GeneCard for the HTRA1 gene available via url: <genecards.org/cgi bin/carddisp.pl?gene=Htral D, printed Jul. 20, 2010.* Lucentini et al. The Scientist (2004) vol. 18, p. 20.* (22) Filed: Feb. 15, 2008 Wacholder et al. J. Natl. Cancer Institute (2004) 96(6);434-442.* Ioannidis et al. Nature genetics (2001) 29:306-309.* (65) Prior Publication Data Halushka et al. Nature. Ju1 1999. 22: 239-247. “HtrA1: A novel TGFB antagonist.” Development (2003) 131:502. US 2008/O2O6263 A1 Aug. 28, 2008 Adams et al. “HTRA1 Genotypes Associated with Risk of Neovascular Age-related Macular Degeneration Independent of CFH Related U.S.
    [Show full text]
  • Population-Haplotype Models for Mapping and Tagging Structural Variation Using Whole Genome Sequencing
    Population-haplotype models for mapping and tagging structural variation using whole genome sequencing Eleni Loizidou Submitted in part fulfilment of the requirements for the degree of Doctor of Philosophy Section of Genomics of Common Disease Department of Medicine Imperial College London, 2018 1 Declaration of originality I hereby declare that the thesis submitted for a Doctor of Philosophy degree is based on my own work. Proper referencing is given to the organisations/cohorts I collaborated with during the project. 2 Copyright Declaration The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the licence terms of this work 3 Abstract The scientific interest in copy number variation (CNV) is rapidly increasing, mainly due to the evidence of phenotypic effects and its contribution to disease susceptibility. Single nucleotide polymorphisms (SNPs) which are abundant in the human genome have been widely investigated in genome-wide association studies (GWAS). Despite the notable genomic effects both CNVs and SNPs have, the correlation between them has been relatively understudied. In the past decade, next generation sequencing (NGS) has been the leading high-throughput technology for investigating CNVs and offers mapping at a high-quality resolution. We created a map of NGS-defined CNVs tagged by SNPs using the 1000 Genomes Project phase 3 (1000G) sequencing data to examine patterns between the two types of variation in protein-coding genes.
    [Show full text]
  • Specific Correlation Between the Major Chromosome 10Q26 Haplotype Conferring Risk for Age-Related Macular Degeneration and the Expression of HTRA1
    Molecular Vision 2017; 23:318-333 <http://www.molvis.org/molvis/v23/318> © 2017 Molecular Vision Received 5 December 2016 | Accepted 12 June 2017 | Published 14 June 2017 Specific correlation between the major chromosome 10q26 haplotype conferring risk for age-related macular degeneration and the expression of HTRA1 Sha-Mei Liao,1 Wei Zheng,1 Jiang Zhu,2 Casey A. Lewis,1 Omar Delgado,1 Maura A. Crowley,1 Natasha M. Buchanan,1 Bruce D. Jaffee,1 Thaddeus P. Dryja1 1Department of Ophthalmology; NIBR Informatics, Novartis Institutes for Biomedical Research, Cambridge, MA; 2Scientific Data Analysis, NIBR Informatics, Novartis Institutes for Biomedical Research, Cambridge, MA Purpose: A region within chromosome 10q26 has a set of single nucleotide polymorphisms (SNPs) that define a haplo- type that confers high risk for age-related macular degeneration (AMD). We used a bioinformatics approach to search for genes in this region that may be responsible for risk for AMD by assessing levels of gene expression in individuals carrying different haplotypes and by searching for open chromatin regions in the retinal pigment epithelium (RPE) that might include one or more of the SNPs. Methods: We surveyed the PubMed and the 1000 Genomes databases to find all common (minor allele frequency > 0.01) SNPs in 10q26 strongly associated with AMD. We used the HaploReg and LDlink databases to find sets of SNPs with alleles in linkage disequilibrium and used the Genotype-Tissue Expression (GTEx) database to search for correlations between genotypes at individual SNPs and the relative level of expression of the genes. We also accessed Encyclopedia of DNA Elements (ENCODE) to find segments of open chromatin in the region with the AMD-associated SNPs.
    [Show full text]
  • Cell-Deposited Matrix Improves Retinal Pigment Epithelium Survival on Aged Submacular Human Bruch’S Membrane
    Retinal Cell Biology Cell-Deposited Matrix Improves Retinal Pigment Epithelium Survival on Aged Submacular Human Bruch’s Membrane Ilene K. Sugino,1 Vamsi K. Gullapalli,1 Qian Sun,1 Jianqiu Wang,1 Celia F. Nunes,1 Noounanong Cheewatrakoolpong,1 Adam C. Johnson,1 Benjamin C. Degner,1 Jianyuan Hua,1 Tong Liu,2 Wei Chen,2 Hong Li,2 and Marco A. Zarbin1 PURPOSE. To determine whether resurfacing submacular human most, as cell survival is the worst on submacular Bruch’s Bruch’s membrane with a cell-deposited extracellular matrix membrane in these eyes. (Invest Ophthalmol Vis Sci. 2011;52: (ECM) improves retinal pigment epithelial (RPE) survival. 1345–1358) DOI:10.1167/iovs.10-6112 METHODS. Bovine corneal endothelial (BCE) cells were seeded onto the inner collagenous layer of submacular Bruch’s mem- brane explants of human donor eyes to allow ECM deposition. here is no fully effective therapy for the late complications of age-related macular degeneration (AMD), the leading Control explants from fellow eyes were cultured in medium T cause of blindness in the United States. The prevalence of only. The deposited ECM was exposed by removing BCE. Fetal AMD-associated choroidal new vessels (CNVs) and/or geo- RPE cells were then cultured on these explants for 1, 14, or 21 graphic atrophy (GA) in the U.S. population 40 years and older days. The explants were analyzed quantitatively by light micros- is estimated to be 1.47%, with 1.75 million citizens having copy and scanning electron microscopy. Surviving RPE cells from advanced AMD, approximately 100,000 of whom are African explants cultured for 21 days were harvested to compare bestro- American.1 The prevalence of AMD increases dramatically with phin and RPE65 mRNA expression.
    [Show full text]
  • Molecular Profiling of Aromatase Inhibitor–Treated Postmenopausal Breast Tumors Identifies Immune-Related Correlates of Resist
    Published OnlineFirst March 14, 2013; DOI: 10.1158/1078-0432.CCR-12-1000 Clinical Cancer Predictive Biomarkers and Personalized Medicine Research Molecular Profiling of Aromatase Inhibitor–Treated Postmenopausal Breast Tumors Identifies Immune-Related Correlates of Resistance Anita K. Dunbier1,2,5, Zara Ghazoui1,2, Helen Anderson1,2, Janine Salter1, Ashutosh Nerurkar1, Peter Osin1, Roger A'hern3, William R. Miller4, Ian E. Smith1, and Mitch Dowsett1,2 Abstract Purpose: Estrogen withdrawal by treatment with aromatase inhibitors is the most effective form of endocrine therapy for postmenopausal estrogen receptor–positive (ERþ) breast cancer. However, response to therapy varies markedly and understanding of the precise molecular effects of aromatase inhibitors and causes of resistance is limited. We aimed to identify in clinical breast cancer those genes and pathways most associated with resistance to aromatase inhibitors by examining the global transcriptional effects of AI treatment. Experimental Design: Baseline and 2-week posttreatment biopsies were obtained from 112 postmen- opausal women with ERþ breast cancer receiving neoadjuvant anastrozole. Gene expression data were obtained from 81 baseline and 2-week paired samples. Pathway analysis identified (i) the most prevalent changes in expression and (ii) the pretreatment genes/pathways most related to poor antiproliferative response. Results: A total of 1,327 genes were differentially expressed after 2-week treatment (false discovery rate < 0.01). Proliferation-associated genes and classical estrogen-dependent genes were strongly downregulated whereas collagens and chemokines were upregulated. Pretreatment expression of an inflammatory signature correlated with antiproliferative response to anastrozole and this observation was validated in an inde- pendent study. Higher expression of immune-related genes such as SLAMF8 and TNF as well as lymphocytic infiltration were associated with poorer response (P < 0.001) and validated in an independent cohort.
    [Show full text]
  • HTRA1 (NM 002775) Human Tagged ORF Clone – RC222362 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC222362 HTRA1 (NM_002775) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HTRA1 (NM_002775) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HTRA1 Synonyms: ARMD7; CADASIL2; CARASIL; HtrA; L56; ORF480; PRSS11 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 HTRA1 (NM_002775) Human Tagged ORF Clone – RC222362 ORF Nucleotide >RC222362 representing NM_002775 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGATCCCGCGCGCCGCTCTTCTCCCGCTGCTGCTGCTGCTGCTGGCGGCGCCCGCCTCGGCGCAGC TGTCCCGGGCCGGCCGCTCGGCGCCTTTGGCTGCCGGTTGCCCAGACCGCTGCGAGCCGGCGCGCTGCCC GCCGCAGCCGGAGCACTGCGAGGGCGGCCGGGCCCGGGACGCGTGCGGCTGCTGCGAGGTGTGCGGCGCG CCCGAGGGCGCCGCGTGCGGCCTGCAGGAGGGCCCGTGCGGCGAGGGGCTGCAGTGCGTGGTGCCCTTCG GGGTGCCAGCCTCGGCCACGGTGCGGCGGCGCGCGCAGGCCGGCCTCTGTGTGTGCGCCAGCAGCGAGCC GGTGTGCGGCAGCGACGCCAACACCTACGCCAACCTGTGCCAGCTGCGCGCCGCCAGCCGCCGCTCCGAG AGGCTGCACCGGCCGCCGGTCATCGTCCTGCAGCGCGGAGCCTGCGGCCAAGGGCAGGAAGATCCCAACA GTTTGCGCCATAAATATAACTTTATCGCGGACGTGGTGGAGAAGATCGCCCCTGCCGTGGTTCATATCGA ATTGTTTCGCAAGCTTCCGTTTTCTAAACGAGAGGTGCCGGTGGCTAGTGGGTCTGGGTTTATTGTGTCG
    [Show full text]
  • And Non-Risk-Associated Variants at the 10Q26 AMD Locus Influence ARMS2 Mrna Expression but Exclude Pathogenic Effects Due to Protein Deficiency
    Human Molecular Genetics, 2011, Vol. 20, No. 7 1387–1399 doi:10.1093/hmg/ddr020 Advance Access published on January 20, 2011 Risk- and non-risk-associated variants at the 10q26 AMD locus influence ARMS2 mRNA expression but exclude pathogenic effects due to protein deficiency Ulrike Friedrich1, Connie A. Myers2, Lars G. Fritsche1, Andrea Milenkovich1, Armin Wolf3, Joseph C. Corbo 2 and Bernhard H.F. Weber1,∗ 1Institute of Human Genetics, University of Regensburg, Franz-Josef-Strauss-Allee 11, 93053 Regensburg, Germany, 2Department of Pathology and Immunology, Washington University School of Medicine, 660 South Euclid Avenue, St Louis, MO 63110, USA and 3Department of Ophthalmology, Ludwig-Maximilians University, Mathildenstrasse 8, 80336 Munich, Germany Received December 11, 2010; Revised and Accepted January 13, 2011 Fifteen variants in 10q26 are in strong linkage disequilibrium and are associated with an increased risk for age-related macular degeneration (AMD), a frequent cause of blindness in developed countries. These var- iants tag a single-risk haplotype encompassing the genes ARMS2 (age-related maculopathy susceptibility 2) and part of HTRA1 (HtrA serine peptidase 1). To define the true AMD susceptibility gene in 10q26, several studies have focused on the influence of risk alleles on the expression of ARMS2 and/or HTRA1,butthe results have been inconsistent. By heterologous expression of genomic ARMS2 variants, we now show that ARMS2 mRNA levels transcribed from the risk haplotype are significantly reduced compared with non-risk mRNA isoforms. Analyzing variant ARMS2 constructs, this effect could specifically be assigned to the known insertion/deletion polymorphism (c.(∗)372_815del443ins54) in the 3′-untranslated region of ARMS2.
    [Show full text]
  • Molecular Pathology of Age-Related Macular Degeneration
    Progress in Retinal and Eye Research 28 (2009) 1–18 Contents lists available at ScienceDirect Progress in Retinal and Eye Research journal homepage: www.elsevier.com/locate/prer Molecular pathology of age-related macular degeneration Xiaoyan Ding a,b,1, Mrinali Patel a,c,1, Chi-Chao Chan a,* a Immunopathology Section, Laboratory of Immunology, National Eye Institute, 10 Center Drive, 10/10N103, Bethesda, MD 20892-1857, USA b Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou 510060, PR China c Howard Hughes Medical Institute, Chevy Chase, MD, USA abstract Keywords: Age-related macular degeneration (AMD) is a leading cause of irreversible blindness in the world. Age-related macular degeneration Although the etiology and pathogenesis of AMD remain largely unclear, a complex interaction of genetic Inflammation and environmental factors is thought to exist. AMD pathology is characterized by degeneration involving Single nucleotide polymorphism the retinal photoreceptors, retinal pigment epithelium, and Bruch’s membrane, as well as, in some cases, Genetics alterations in choroidal capillaries. Recent research on the genetic and molecular underpinnings of AMD Retinal pigment epithelium Retinal photoreceptors brings to light several basic molecular pathways and pathophysiological processes that might mediate Drusen AMD risk, progression, and/or response to therapy. This review summarizes, in detail, the molecular Vascular endothelial growth factor pathological findings in both humans and animal models, including genetic variations in CFH, CX3CR1, Bruch’s membrane and ARMS2/HtrA1, as well as the role of numerous molecules implicated in inflammation, apoptosis, Molecular pathology cholesterol trafficking, angiogenesis, and oxidative stress. Published by Elsevier Ltd. Contents 1. Introduction . ........................................................2 1.1.
    [Show full text]