Attenuation of Telomerase Activity by a Hammerhead Ribozyme

(CANCER RESEARCH 58. 5406-5410, December I. 1998] Attenuation of Telomerase Activity by a Hammerhead Ribozyme Targeting the Template Region of Telomerase RNA in Endometrial Carcinoma Cells Yasuhiro Yokoyama,1 Yuichiro Takahashi, Ariyoshi Shinohara, Zenglin Lian, Xiaoyun Wan, Kenji Niwa, and Teruhiko Tamaya

Department of Obstetrics timi Gvnecologv, Gifu Universit\ School of Medicine. Gifit, GifÂ»500. Japan

ABSTRACT some types of RNA sequences, such as telomerase RNA. Ribozymes may surpass the efficiency of the antisense oligonucleotide in such Telomerase activity is found in almost all carcinoma cells but not in cases. In the present study, we designed hammerhead ribozymes most somatic cells, suggesting that telomerase is an excellent target for against telomerase RNA and studied the possibility of using the cancer therapy. We designed hammerhead ribozymes against human ribozymes to suppress telomerase activity in cancer cells. telomerase RNA and studied their possible use as a tool for cancer therapy. Three ribozymes targeting the 3' end of the GUC sequence at 33-35 (the template region), 168-170, and 313-315 from the 5' end of MATERIALS AND METHODS telomera.se RNA were designed. In a cell-free system, these three ham merhead ribozymes efficiently cleaved the RNA substrate. When these Cell Culture. Endometrial carcinoma cell lines Ishikawa and AN3CA were ribozyme RNAs were introduced into Ishikawa cells, which are endome- used in this study. Ishikawa cells were a kind gift from Dr. MÃ¡salo Nishida (Tsukuba University School of Medicine, Tsukuba, Japan; Ret'. 15). AN3CA trial carcinoma cells, only a ribozyme targeting the RNA template region could diminish the telomerase activity. Next we subcloned the ribozyme cells were purchased from the American Type Culture Collection. All cell lines were maintained in Eagle's MEM supplemented with 10% fetal bovine serum sequence into an expression vector and introduced this into AN3CA cells, under an atmosphere of 95% ainSVr CO, at 37Â°C. which are endometrial carcinoma cells. The clones that were obtained showed reduced telomerase activity and telomerase RNA with expression In Vitro Cleavage Reaction by Ribozymes. Because hammerhead ri of the ribozyme. These data suggest that the ribozyme against the RNA bozymes recognize a GUC sequence and cleave it most efficiently, attempts template region is a good tool to repress telomerase activity in cancer cells. were made to determine whether the GUC sequence is located within telom erase RNA and which GUC sequence could be eligible. There are 14 GUC INTRODUCTION sequences within the approximately 450-base length of the RNA. Considering the complementarity between the upstream and downstream sequences from Telomerase is a ribonucleoprotein believed to play a role in cellular each GUC, we chose three sites (34-36. 168-170, and 313-315 from the 5' senescence and immortalization (1-3). It synthesizes telomeric DNA end of telomerase RNA) as target sites. The target site of the ribozymes is with a template ot" its integral RNA and prevents the telomere from shown in Fig. 1. The ribozymes were named 36-, 170-, and 315-ribozyme after the cleavage sites from the 5' end of the RNA. shortening (4). Telomerase activity has been determined in various The bacteriophage T7 RNA polymerase system was used to produce the tissues and cells during the past years, and it has been shown that most ribozymes. A set of oligomers was designed to make the DNA template. One cancer cells, germ cell lines, and some somatic cells express telom primer contained a T7 RNA polymerase promoter sequence followed by the 5' erase activity, and that most somatic cells do not (5). Normal somatic half of the ribozyme sequence; the other primer contained the antisense cells lose telomerase activity in the early stage of embryogenesis (6), sequence of the ribozyme. Seventeen nucleotides from the 3' end of both and the restoration of telomerase activity is currently considered to primers were complementary to each other. immortalize cells and also to be a significant step in the carcinogen- The primers used for each ribozyme were as follows: (a) 36-ribozyme, esis of cells. The specificity of telomerase in cancer cells suggests that 5'-GGATCCTAATACGACTCACTATAGGTTAGGGTTACTGATGA and 5'-ATlTTlTGTTTCGTCCTCACGGACTCATCAGTAACCCTAAC; (b) it could be a good target for cancer therapy. To date, only an agent that 170-ribozyme, S'-GGATCCTAATACGACTCACTATAGGCCAGCAGCTC- induces cellular differentiation, such as retinoids, has been reported to TGATGA and S'-AAAAAATGTTTCGTCCTCACGGACTCATCAGAG- reduce telomerase activity in some carcinoma cell lines (7-9). CTGCTGGC; and (c) 315-ribozyme, 5'-GGATCCTAATACGACTCACTAT- Telomerase is composed of a RNA molecule and the associated AGGCCCCCGAGACTGATGA and 5'-GCCGCGGGTTTCGTCCTCACG- proteins (10). Telomerase RNA functions as a template for the exten GACTCATCAGTCTCGGGGGC. sion of the telomeric repeat, and protein components function in The primers were mixed to form a hemiduplex, and a PCR amplification of telomere DNA recognition and binding and RNA binding and catal 25 cycles was performed at 94Â°Cfor 1 min, 40Â°Cfor 1 min, and 72Â°Cfor 1 ysis. Therefore, telomerase RNA is an essential molecule for telom min. Unincorporated deoxynucleotide triphosphate was eliminated with a erase to exert its action (11). Sephadex G25 Quick Spin Column (Boehringer Mannheim, Tokyo. Japan). The transcription ot" RNA from the synthetic DNA template was carried out Hammerhead ribozymes are catalytic RNA molecules. They are being increasingly considered and used as human gene therapeutic using a T7-MEGAshortscript kit (Ambion, Inc.. Austin, TX). The transcription agents for human malignancies (12, 13). The ribozymes used as gene reaction mixture contained 500 ng of template DNA. 40 mM Tris-HCl (pH 7.5), therapeutic agents are, in most cases, /raii.v-acting hammerhead ri 6 HIMMgCI2, 10 mM NaCl, 2 mM spermidine, 10 mM DTT, 30 /UMnucleotide triphosphate, 1 unit//xl recombinant RNase inhibitor, and 1.0 unit//j.l T7 RNA bozymes based on the model of Haseloff and Gerlach (14). The polymerase in a 20-/J.I volume. The reaction was carried out at 37Â°Cfor 2 h. hammerhead ribozymes consist of a catalytic core and flanking anti- The reaction mixture was treated with RNase-free DNase. followed by phenol- sense sequences. The antisense sequence of the ribozymes functions chloroform extraction and ammonium acetate ethanol precipitation. in the recognition of target sites of the RNA molecules. These se Plasmid pGEM83 was prepared to produce the RNA substrate mimic of quences may carry out additional action by the ribozymes in targeting telomerase RNA. pGEM83, in which almost the full length of the cDNA of telomerase RNA was inserted, was kindly provided by Dr. Bryant Villeponteau Received 5/1/98: accepted 10/5/98. (Geron Corp., Menlo Park, CA). pGEM83 was digested with Sail (Boehringer The cosls of publication of this article were defrayed in part by the payment of page Mannheim). The transcription of RNA from plasmid templates was carried out charges. This article must therefore be hereby marked advertisement in accordance with using MAXscript in viiru transcription kits (Ambion. Inc.). The transcription 18 U.S.C. Section 1734 solely to indicate this fact. 1To whom requests for reprints should be addressed, at Department of Obstetrics and reaction mixture contained 1 /j.g of linearized plasmid DNA: 0.5 unit/ml SP6 Gynecology. Gifu University School of Medicine. 40 Tsukasa-machi. Gifu. Gifu 500- RNA polymerase; 40 mM Tris-HCl (pH 7.5): 6 mM MgCI2; 10 mM NaCl: 2 mM 8076. Japan. Phone: 81-58-267-26.11: Fax: 81-58-265-9006. spermidine: 10 mM DTT: 0.5 mM ATP, GTP, and UTP: O.I mM CTP; 50 ÃŸCi 5406

Telomerase RNA component ~450 Isogene (Nippon Gene. Inc.. Tokyo. Japan). Total RNA (500 ng) from each transfectant was reverse-transcribed with a random hexamer. followed by PCR base using two primers, 5'-AGCACAGAGCCTCGCCTTT (from the ÃŸ-actin5' untranslated region) and 5'-TGGATCCCTCGAAGCTT (from a plasmid polylinker). The cycling conditions were 94Â°Cfor 30 s, 47Â°Cfor 30 s, and 72Â°Cfor I min for 25 cycles. PCR products were electrophoresed on a 1.5% agarose gel and mounted on a nylon membrane by capillary transfer. The membrane containing an amplified 119-bp DNA was hybridized using a 32P-labeled probe that was complementary to the conserved catalytic se quences of the ribozyme (5'-CCTCACGGACTCATCAG). The labeling of the oligomer was carried out by T4 polynucleotide kinase (Toyobo. Inc.. Tokyo. 315- Japan) and [y-'2P]ATP (DuPont, Inc.). ribozyme ribozyme Northern Blotting of Telomerase RNA Expression in Transfcctants. ribozyme Total RNA was extracted with Isogene (Nippon Gene, Inc.). Total RNA (20 /j.g) was loaded on a 1.0% agarose/formaldehyde gel. electrophoresed. and Fig. I. Target sites of three ribozymes. Three ribozymes were designed to largel different sites in 450-base-long telomerase RNA. The ribozymes were named after the then mounted on a nylon membrane by capillary transfer. Northern blotting cleavage site from Ine 5' end of the RNA. was carried out using the cDNA of telomerase RNA inserted in pGRN83 and glyceraldehyde-3-phosphate dehydrogenase cDNA (Clontech Laboratories. Inc.. Palo Alto, CA). of [a-'2P]CTP (specific activity, 800 Ci/mmol: DuPom. Inc., Wilmington. Telomerase Detection Assay. Cultured cells were washed once with PBS DE); and I unit/ml recombinant RNase inhibitor in a 100-jul volume. The and scraped into a buffer [10 mM HEPES-KOH (pH 7.5). 1.5 mM MgCK. 10 reaction was carried out at 37Â°Cfor 1 h. The reaction mixture was treated with mM KCI, and 1 mM DTT]. The cells were washed in the buffer, homogenized RNase-free DNase, followed by phenol-chloroform extraction and ammonium in 200 /U.1ofa cell lysis buffer [10 mM Tris-HCl (pH 7.5). 1 mM MgCK. 1 HIM EGTA. 0.1 mM benzamidine, 5 m.MÃŸ-mercaptoethanol. 0.5% 3-[(3-cholami- acetate ethanol precipitation. The transcript was 601 bases long. The ribozyme and substrate RNA (molar ratio. 5:1) were mixed in a 10-^d dopropyl)dimethylammonio]-l-propanesulfonic acid (WAKO Chemical In reaction volume containing 50 mM Tris-HCl (pH 7.5) and 1 niM EDTA. The dustries, Inc.. Osaka. Japan), and 10% glycerol|. and incubated on ice for 30 mixture was heated at 95Â°Cfor 2 min and cooled quickly on ice, and MgCK min. Cell homogenates were then centrifuged at 12.000 X g for 20 min at 4Â°C. was added at a final concentration of 10 mM and then incubated at 37Â°Cfor 3 h. The supernatant was recovered and snap-frozen in liquid nitrogen and stored at â€”80Â°C.The concentration of protein was measured with protein assay dye The reactions were stopped by the addition of an equal volume of stop solution (Bio-Rad Laboratories, Hercules. CA). (95% formamide. 25 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene cyanol) and heated at 65Â°C for 5 min. The reaction mixture was electro- The TRAP assay was performed using a TRAPÂ£ZÂ£telomerase detection kit phoresed in a 6% polyacrylamide-7 M urea gel in Tris-borate EDTA buffer. (Oncor, Inc.. Gaithersburg, MD). In brief, 2 n\ of tissue extract and 48 jil of TRAP reaction mixture consisting of 5' end-labeled TS primer (5'-AATC- The reaction was analyzed by autoradiography. Introduction of Ribozymes into Ishikawa Cells. Ishikawa cells (5 x IO4) CGTCGAGCAGAGTT) with [-y-'2P]ATP, 50 JIM deoxynucleotide triphos- were seeded in a 6-well plate and incubated for 2 days. The medium was phate mix, a TRAP primer mix (RP primer, Kl primer, and TSK1 template), replaced with serum-free DMEM. Ribozymes were synthesized using the and 2 IU of Taq DNA polymerase in 20 mM Tris-HCl (pH 8.3). 1.5 mM MgCl,, T7-MEGAshortscript kit (Ambion. Inc.) as described above. 63 mM KCI. 1 mM EGTA, 0.05% Tween 20. and 0.01% BSA were mixed and The ribozyme (15 jig) was mixed with 15 ;ul of DOTAP2 (Boehringer incubated at 30Â°Cfor 30 min. PCR was then performed at 94Â°Cfor 30 s and 60Â°Cfor 30 s for 25 cycles. The PCR products were electrophoresed in a 12% Mannheim) in a total volume of 75 /J.1of HEPES buffer [20 mM (pH 7.4)] and incubated for 15 min at room temperature. The mixture was suspended in 2.0 acrylamide gel and autoradiographed. ml of DMEM. Cells were exposed to the ribozyme/DOTAP mixture every Telomere Length Estimation. Genomic DNA was isolated from cells with RapidPrep genomic DNA isolation kits (Pharmacia-Biotech, Inc.. Uppsala. 12 h. Cells were harvested at 24 and 48 h after the first exposure to the ribozyme Sweden) and digested with Hinfl restriction enzyme (Boehringer Mannheim). and submitted to the telomerase detection assay. DNA (10 /Â¿g)was loaded on a 0.6% agarose gel and electrophoresed. It was mounted on a nylon membrane by capillary transfer and hybridized with Construction of the Ribozyme Expression Vector and Transfection. (TTAGGG)6 oligonucleotide that was 5' end-labeled with [7-'2P]ATP. Two single-stranded oligodeoxynucleotides were synthesized such that the 45-bp ribozyme contained flanking Sail and Hindttl restriction sites on both ends (S'-TCGACGTTAGGGTTACTGATGAGTCCGTGAGGACGAAACA- AAAAATGA and S'-AGCTTCATTTTTTGTTTCGTCCTCACGGACTCA- RESULTS TCAGTAACCCTAACG). The oligonucleotides were 5' phosphorylated by Three kinds of hammerhead ribozymes were designed to target the T4 polynucleotide kinase (New England Biolabs, Inc., Beverly, MA), an GUC sequences in telomerase RNA, based on the model proposed by nealed, and cloned into pHÃŸAPr-1-neo (16). The sequence and orientation of Haselof'f and Gerlach (14). The structure of 36-ribozyme is shown in the ribozyme in the vector were confirmed by DNA sequencing with a sequence primer (5'-GACCAGTGTTrGCCTTTTA-3') designed from the se Fig. 2. Ribozymes (44 bases long) were transcribed with T7 RNA quences in the 5' untranslated region of ÃŸ-actin.The constructed vector was polymerase according to previously published procedures (17). First, designated pHÃŸAPr-l-neo-36RZ. we studied whether the three kinds of ribozymes could cleave the RNA substrate efficiently in a cell-free system. A '~P-labeled RNA Lipofection of Ishikawa cells and AN3CA cells with pHÃŸAPr-1-neo-36RZ or pHÃŸAPr-1-neo was performed according to the protocol recommended by substrate ol 601 bases in length was made with SP6 RNA polymerase. the manufacturer (Life Technologies, Inc.). In brief, approximately 5 X IO4 This substrate and the ribozymes were mixed at a molar ratio of 1:5, cells were transfected with 10 /Â¿gofvector DNA that had been complexed with and a cleavage reaction was then observed. As shown in Fig. 3, all of 50 /j,l of Lipofectin (Life Technologies, Inc.). Three days after transfection, the hammerhead ribozymes efficiently cleaved the 601-base telomer G418 was added to the medium to a final concentration of 1 mg/ml. The ase RNA substrate (Fig. 3). The 36-ribozyme, 170-ribozyme, and transfected cells were exposed to G4I8 for 4 weeks. 315-ribozyme cleaved it into 521- and 80-base fragments, 214- and RT-PCR and Southern Blot Analysis for Ribozyme Expression. Total 387-base fragments, and 302- and 299-base fragments, respectively. RNA was extracted from the transtectants and parental AN3CA cells using The cleaved fragments were the correct sizes, as predicted from the

2 The abbreviations used are: DOTAP, N-[l-(2,3-dioleoyloxyl)propyl]-/V,/V./V-trimeth- location of the cleavage site of the ribozyme. ylammoniummethyl sulfate; RT-PCR. reverse transcription-PCR: TRF. telomere repeat Next we introduced the ribozymes themselves into cndometrial fragment; TRAP. Telomerie repeat amplification protocol. carcinoma Ishikawa cells. Because ribozymes are considered to be 5407

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 1998 American Association for Cancer Research. RIBOZYME AGAINST TELOMERASE RNA 3' erase activity in transfectants was simply due to the clonal divergence, we included pooled clones of the vector transfectants and the ri- Cleavage bozyme transfectants. As shown in Fig. 5, most clones showed an apparently reduced telomerase activity compared with that of the vector transfectant control and parental AN3CA cells. In some clones GCCAUUUUUUGUCUAACCCUAACUGAG â€¢ (clones 5, 9, and 10), telomerase activity was almost undetectable. GUAAAAAACA AUUGGGAUUG Five of 10 clones (clones 5, 7, 8, 9, and 10) in which the telomerase activity was diminished to a variable extent were further studied for expression of the ribozyme and telomerase RNA. To study the ex pression of the ribozyme, RT-PCR and Southern blot analysis were G â€¢C performed. Ribozyme expression was found in all of the transfectants with pHÃŸAPr-1-neo-36RZ and its pooled clone (Fig. 6), implying that GU ribozyme RNA was successfully expressed in these clones, although Fig. 2. Structure of the 36-ribo/yme. The 20-mer antisense sequences against the target region were placed upstream and downstream of the catalytic core of the riho/yme. The the expression level differed in the clones. cleavage site is localized in the RNA template region, which is underlined. The expression of telomerase RNA in the transfectants was ana lyzed by Northern blotting. The telomerase RNA expression of the vector transfectants was unchanged when compared with that of the 31517036 parental AN3CA cells. Transfectants with pHÃŸAPr-l-neo-36RZ and RZ RZ RZ its pooled clone clearly reduced the level of telomerase RNA (Fig. 6). The reduction level roughly inversely paralleled the expression level of the ribozyme. This suggested that the reduced telomerase activity was associated with the reduction of the telomerase RNA expression RNA substrate i... 601 b f 521 C DOTAR 36RZ 170RZ 315RZ 2448 2448 2448 2448 2448 hrs.

387 302. 299-

214

â€¢*- 80 is

Fig. 3. In vitro cleavage reaction. The riho/.ymes and substrale RNA were mixed and Ã-if.4. Ribo/vme RNA was introduced into Ishikawa cells. Note that the 36-rihozyme incubated for 3 h. All three ribozymes cleaved the RNA substrate, which was 601 bases long. RZ, ribozyme. diminished telomerase activity most efficiently in 48 h. C control: ÃœOTAP.DOTAP (liposome) only; RZ. ribozyme; AV.internal standard.

0.' unstable in medium supplemented with fetal bovine serum, a serum- free medium was used. The ribozymes were mixed with cationic liposome and then introduced into the endometrial carcinoma cells. At ^p 48 h after the first administration of ribozymes, telomerase activity e>e>e>eie>e>e>e> e> f was diminished most significantly in the cells in which 36-ribozyme was introduced (Fig. 4). It was thus concluded that 36-ribozyme was the most promising in the transfection study. We subcloned the 36-ribozyme sequence into pHÃŸAPr-1-neo and introduced it into Ishikawa cells. However, no clones resistant to G418 (1 mg/ml) were obtained. Then we used AN3CA, another endometrial carcinoma cell line. By introducing pHÃŸAPr-1-neo or pHÃŸAPr-l-neo-36RZ into AN3CA cells and a subsequent selection with l mg/ml G418, we obtained approximately 50 or 70 clones of transfectant with pHÃŸAPr-1-neo or pHÃŸAPr-l-neo-36RZ, respec tively. Ten clones were arbitrarily chosen from among the pHÃŸAPr- l-neo-36RZ transfectant clones, and their telomerase activity was studied as a first step in the screening. Other pHÃŸAPr-1-neo or Fig. 5. Telomerase activity in transfectants and parental AN3CA cells. Vector P., a pooled clone of vector transfectant; Ribozyme P., a pooled clone of 36-ribozyme trans- pHÃŸAPr-l-neo-36RZ transfectant clones were collected and used as a fectanl; Lanes CI-C10. clones 1-10; IS. internal standard. Note that the telomerase pooled clone. To rule out the possibility that the alteration of telom- activity was reduced in all of the ribozyme transfectants including the pooled clone. 5408

RNA is a direct participant in the telomerase molecule as an essential element. We demonstrated that the reduction of telomerase RNA expression was associated with the attenuation of telomerase activity. This did not appear to come from clonal divergence, because the Â«bA O telomerase activity and telomerase RNA in the pooled clone of ribozyme transfectant were clearly diminished compared with that of the parental cells and the vector transfectant. However, in some clones in which telomerase activity was almost undetectable, telomerase Ri bozyme RNA was still expressed at a steady level. This may suggest that besides catalysis by the ribozyme, the antisense sequence of the ribozyme against the RNA may interfere with enzyme activity in situ. Tel omerase RNA To date, two protein components of human telomerase have been identified. TP1 is a protein binding to telomerase RNA (26, 27). Its mRNA can be a target of ribozymes, but it has been reported that its expression level does not parallel telomerase activity. In addition, its G3PDH expression is not limited in the tissues with positive telomerase activity. hTERT is a catalytic subunit of telomerase (28, 29). It has been demonstrated that the expression level of this mRNA parallels Fig. 6. Ribozyme and telomerase RNA expression. Rihozyme expression was studied by RT-PCR and Southern blotting. Telomerase RNA and glyceraldehyde-3-phosphate telomerase activity. This seems to be a major regulator of telomerase dehydrogenase were analyzed by Northern blotting. Ribozyme was expressed in all of the activity. It means that the mRNA of this protein can be another target transfectants. Telomerase RNA expression was diminished in all of the transfectants. of the hammerhead ribozyme, although the effect of the ribozyme on Telomerase RNA was expressed in C5, C9. and CIO, whose telomerase activity was almost undetectable. as shown in Fig. 5. Vector P.. a pooled clone of vector transfectant: telomerase activity would be indirect. Ribozvme P., a pooled clone of 36-ribozyme transfectant: C5, C9, and CIO, clones with We have chosen endometrial carcinoma cells as a target cancer for greatly reduced telomerase activity: C8. a clone with moderately reduced telomerase the ribozyme, but many studies have demonstrated that normal endo- activity: C7, a clone with slightly reduced telomerase activity; C3PDH. glyceraldehyde- 3-phosphate dehydrogenase. metrium possesses telomerase activity (30, 31). In this context, when considering the introduction of ribozymes in vivo, endometrial carci noma may not be a good target cancer for the ribozyme. We have level. However, in the clones in which telomerase activity was almost previously reported that the telomerase activity of the endometrium is undetectable, telomerase RNA was steadily expressed. regulated by progestins (30). The secretory endometrium and decidual The TRF length of clones 5, 9, and 10, in which telomerase activity endometrium induced by progestins do not express telomerase activity was reduced significantly, was analyzed by Southern blot hybridiza at a detectable level. This implies that pretreatment with progestins tion. As shown in Fig. 7, the TRF of these clones was apparently can totally abolish telomerase activity in the normal endometrium. In shortened. combination with progestin, the ribozyme can selectively target can cer cells. DISCUSSION In immortal cells, it has been demonstrated that telomerase activity is associated with the cell cycle (32). The highest telomerase activity For the ribozymes to recognize and catalyze the target sites, the target region must be sufficiently exposed on the outer surface of the three-dimensional structure of the molecules. In the present study, the 36-ribozyme that targeted the RNA template region reduced the telomerase activity most efficiently, implying that this region is lo cated at the outer surface of the telomerase molecule. This finding is kb consistent with the experiment using antisense oligonucleotide in 23.1- which the targeting of this template region caused the most significant reduction in the telomerase activity of mouse cells (18). The template region of telomerase RNA is crucial for enzyme 9.4â€” activity, but a recent investigation has demonstrated that another part 6.6- of telomerase RNA is also regulatory for enzyme activity (19). We chose the GUC sequence as a cleavage site and studied the efficiency of the ribozymes targeting three different GUC sites. However, ham 4.4â€” merhead ribozymes can cleave the 3' end of some other triplet sequences such as CUC, GUA, or GUU as efficiently as they do GUC (20). This implies that there may be many other sites where ribozymes can cleave telomerase RNA more efficiently. 2.3â€” It has been shown that the enzyme activity of telomerase is not 2.0â€” associated with the expression level of telomerase RNA in some tumors and cells (21, 22). However, a rough correlation was found between a cultured cell line and T lymphocytes (23, 24). Recently, the crucial role of the RNA component in telomere shortening has been demonstrated in the cells of a telomerase RNA knockout mouse (25). 0.6â€” Despite the complex between them, we reasoned in this experiment Fig. 7. Southern blot analysis of the TRF. Three clones with greatly attenuated that the breakdown of telomerase RNA molecules by the ribozymes telomerase activity were analyzed. All clones showed shorter TRFs. Vector P., a pooled must lead to the attenuation of telomerase activity, because telomerase clone of vector Iransfectant. 5409

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 1998 American Association for Cancer Research. RIBOZYME AGAINST TELOMERASE RNA is (bund in the S phase of the cell cycle (33, 34), whereas quiescent 13. Kashani-Sabet. M., Funaio. T.. Tone. T., Jiao, L., Wang, W.. Yoshida, E., Kashfinn. cells do not possess telomerase activity at a detectable level. In this B. I.. Shitara. T., Wu, A. M.. Moreno, J. G., Traweek. S. T., Ahlering, T. E., and Scanion. K. J. Reversal of the malignant phenotype by an anti-ras ribozyme. Anti- study. AN3CA transfectants with the 36-ribozyme clearly grew more sense Res. Dev., 2: 3-15. 1992. slowly than did the parental cell line (data not shown). The doubling 14. Haseloff, J.. and Gerlach, W. L. Simple RNA enzymes with new and highly specific time of the transfectant became doubled at the maximum. The trans- endonuclease activities. Nature (Lond.), 344: 585-591, 1988. 15. Nishida. M., Kasahara. K.. Kaneko. M.. Iwasaki. H.. and Hayashi. K. Establishment fectant of AN3CA with attenuated telomerase activity passed almost of a new human endometrial carcinoma cell line, Ishikawa cells, containing estrogen 30 passages and still steadily proliferated. On the other hand, we could and progesterone receptor. Acta Obstet. Gynaecol. Jpn.. 37: 1103-1 111. 1985. not obtain the 36-ribozyme transfectant with Ishikawa cells. We tried 16. Gunning. P.. Leavitt, J.. Muscat, G., Ng, S.. and Kedes, L. A human ÃŸ-actin expression vector system directs high-level accumulation of antisense transcripts. another expression vector (pcDNA3) in Ishikawa cells but could not Proc. Nail. Acad. Sci. USA. 04: 4831-4835. 1987. obtain the ribo/.yme transfectant. This may be explained by the 17. Milligan, J. F.. Groebe, D. R.. Witherell. G. W.. and Uhlenbeck, O. C. Oligoribo- toxicity of the 36-ribozyme for some cell lines. nucleotidc synthesis using T7 RNA polymerase and synthetic DNA templates. Nu The 36-ribozyme used in this experiment is a promising agent for cleic Acids Res., 15: 8783-8798. 1987. 18. Blasco. M. A.. Funk. W.. Villeponteau. B., and Greider. C. W. Functional charac repressing telomerase activity. In this ribozyme, the antisense se terization and developmental regulation of mouse telomerase RNA. Science quences flanking the catalytic core spanned 20 nucleotides. It has been (Washington DC). 269: 1267-1270, 1995. shown that the length of the flanking antisense sequence affects 19. Bhattacharyya, A., and Blackburn. E. H. A functional telomerase RNA swap in vivo reveals the importance of nontemplate RNA domains. Proc. Nati. Acad. Sci. USA. 94: ribo/.yme kinetics (35). This may suggest that there is room for further 2823-2827. 1997. improvement in the efficiency of 36-ribozyme. 20. Koizumi. M.. Iwai, S.. and Ohtsuka, E. Construction of a series of several self- cleaving RNA duplexes using synthetic 21-mers. FEBS Lett.. 22Â«:228-230, 1988. 21. Avilion. A. A.. Piatyszek. M. A.. Gupta. J.. Shay. J. W.. Bacchetti, S., and Greider, ACKNOWLEDGMENTS C. W. Human telomerase RNA and telomerase activity in immortal cell lines and tumor tissues. Cancer Res., 56: 645-650. 1996. We thank Dr. Musato Nishida for the Ishikawa cells. Dr. Larry Kedes. 22. Blasco. M. A.. Rizen. M.. Greider. C. W.. and Hanahan. D. Differential regulation of Stanford University School of Medicine, Palo Alto, CA, for pHÃŸAPr-1-neo. lelomerase activity and telomerase RNA during multi-stage tumorigenesis. Nat. Genet.. 12: 200-204. 19%. and Dr. Bryant Villeponteau for pGRN83. 23. Bodnar. A. G.. Kim, N. W.. Effros. R. B.. and ChiÃ¹.C. P. Mechanism of lelomerase induction during T cell activation. Exp. Cell Res., 228: 58-64, 1996. REFERENCES 24. Broccoli. D.. Godley, L. A.. Donehower, L. A., Varmus, H. E.. and deLange. T. Telomerase activation in mouse mammary tumors; lack of detectable telomere 1. de Lange. T. Aclivalion of lelomerase in a human lumor. Proc. Nail. Acad. Sci. USA. shortening and evidence for regulation of telomerase RNA with cell proliferation. 91: 2882-2885, 1994. Mol. Cell. Biol., 16: 3765-3772, 1996. 2. Allsopp, R. C.. Chang. E.. Kashefi-Aazam. M.. Rogaev, E. I.. Pialyszek. M. A., Shay, 25. Lee. H. W.. Blasco. M. A.. Gottlieb, G. J.. Homer. J. W. N.. Greider. C. W.. and J. W.. and Harley. C. B. Telomere shortening is associated with cell division in vitro DePinho, R. A. Essential role of mouse telomerase in highly proliferative organs. and in vivo. Exp. Cell Res.. 220; 194-200, 1995. Nature (Lond.). 392: 569-574, 1998. 3. Harley. C. B. Telomere loss: mitolic clock or genetic time bomb? MutÃ¢t.Res.. 256. 26. Harrington. L.. McPhail. T.. Mar. V.. Zhou. W.. Oulton. R.. Program. A. E.. Bass. 271-282. 1991. M. B.. Amida. I., and Robinson, M. O. A mammalian telomerase-associated protein. 4. Greider. C. W.. and Blackburn. E. H. A lelomcric sequence in the RNA of Teirahy- Science (Washington DC), 275: 973-977, 1997. tnt'iut telomerase required for telomere repeat synthesis. Nature (Lond.). 337: 331- 337, 1989. 27. Nakayama, J.. Saito, M., Nakaniura. H.. Matsuura. A., and Ishikawa. F. TLPI : a gene 5. I mull 'l.i.l V.. and Wright. W. E. Telomeres and telomerase: a simple picture becomes encoding a protein component of mammalian telomerase is a novel member of WD complex. Cell. X7: 369-375, 1996. repeats family. Cell. H/Ã•:875-884. 1997. 6. Wright. W. E.. Piatyszek. M. A.. Rainey. W. E., Byrd. W.. and Shay. J. W. 28. Meyerson. M., Counter, C. M., Eaton. E. N.. Ellisen. L. W., Steiner. P.. Caddie. S. D., Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet., Ziaugra. L.. Beijersbergen. R. L.. Davidoff. M. J.. Liu. Q.. Bacchetti. S., Haber, D. A., 18: 173-179. 1996. and Weinberg. A. hEST2. the putative human telomerase catalytic subunit gene, is 7. Sharma. H. W.. Sokoloski. J. A.. Perez, J. A.. Maltese. J. Y., Sartorelli. A. C.. Stein. up-regulated in tumor cells and during immortalization. Cell. 90: 785-795. 1997. C. A.. Nichols, G., Khalcd. Z., Telang, N. T.. and Narayanan. R. Differentiation of 29. Nakamura. T. M., Morin, G. B.. Chapman. K. B.. Weinrich, S. L.. Andrews, W. H., immortal cells inhibits telomerase activity. Proc. Nati. Acad. Sci. USA, 92: 12343- Lingner. J.. Harley, C. B.. and Cech, T. R. Telomerase catalytic subunit homologs 12346. 1995. from fission yeast and human. Science (Washington DC). 277: 955-959, 1997. 8. Albanell, J.. Han. W.. Mellado, B.. Gunawardane. R.. Svher. H. I., Dmitrovsky. E., 30. Yokoyama. Y., Takahashi. Y.. Morishita, S., Hashimoto. M., Niwa. K., and Tamaya, and Moore, M. A. Telomerase activity is repressed during differentiation of matura T. Telomerase activity in the human endometrium throughout the menstrual cycle. tion-sensitive but not resistant human tumor cell lines. Cancer Res.. 56: 1503-1508. Mol. Hum. Reprod., 4: 173-177, 1997. 19%. 31. Kyo, S.. Takakura. M.. Kohama. T.. and Inoue. M. Telomerase activity in human 9. Xu. D.. Gruher, A.. Peterson. C.. and Pisa. P. Suppression of telomerase activity in endomelrium. Cancer Res., 57: 610-614, 1997. HL60 cells after treatment with differentiating agents. Leukemia (Baltimore). 10: 1354-1357, 1996. 32. Holt, S. E.. Wright, W. E., and Shay. J. W. Regulation of ielomerase activity in immortal cell lines. Mol. Cell. Biol., 16: 2932-2939. 1996. 10. Shore. D. Telomerase and telomere-binding proteins: controlling the endgame. Trends Biochem. Sci.. 22: 233-235. 1997. 33. Kruk. P. A.. Orren, D. K.. and Bohr. V. A. Telomerase activity is elevated in early S phase in hamster cells. Biochem. Biophys. Res. Commun., 233: 717-722. 1997. 11. Feng. J.. Funk, W. D.. Wang. S. S.. Weinrich. S. L.. Avilion. A. A.. ChiÃ¹, C. P.. Adams. R. R.. Chang, E.. Allsopp. R. C. Yu. J.. Le. S.. West. M. D.. Harley, C. B.. 34. Zhu, X.. Kumar. R.. Mandai. M.. Sharma, N.. Sharma. H. W.. Dhingra. U.. Sokoloski, Andrews. W. H., Greider, C. W., and Villeponteuu, B. The RNA component of human A. A., Hsiao. R., and Narayanan, R. Cell cycle-dependent modulation of telomerase telomerase. Science (Washington DC). 269: 1236-1241, 1995. activity in tumor cells. Proc. Nati. Acad. Sci. USA, 93: 6091-6095. 1996. 12. Yokoyama, Y.. Morishita, S.. Takahashi, Y.. Hashimoto. M.. and Tamaya. T. Mod 35. Goodchild. J.. and Kohli, V. Ribozymes that cleave an RNA sequence from human ulation of c-frnx proto-oncogene in an ovarian carcinoma cell line by a hammerhead immunodeficiency virus: the effect of flanking sequence on rate. Arch. Biochem. ribozyme. Br. J. Cancer. 76: 977-982. 1997. Biophys.. 284: 386-391, 1991.

5410

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 1998 American Association for Cancer Research. Attenuation of Telomerase Activity by a Hammerhead Ribozyme Targeting the Template Region of Telomerase RNA in Endometrial Carcinoma Cells

Yasuhiro Yokoyama, Yuichiro Takahashi, Ariyoshi Shinohara, et al.

Cancer Res 1998;58:5406-5410.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/58/23/5406

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/58/23/5406. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.