Ha-Ras and N-Ras Regulate MAPK Activity by Distinct Mechanisms in Vivo

Ha-ras and N-ras regulate MAPK activity by distinct mechanisms in vivo

Mark Hamilton and Alan Wolfman

Department of Cell Biology, Lerner Research Institute, The Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, Ohio 44195, USA

The Ras GTPases function as molecular switches, sucient for Raf-1 activation (Stokoe and McCormick, regulating a multiplicity of biological events. However 1997). Raf activity mediates the activation of the the contribution, if any, of a speci®c c-Ras isoform (Ha-, MAPK cascade through the Raf-dependent activation N-, or Ki-ras A or B) in the regulation of a given of MEK1 (Macdonald et al., 1993; Moodie et al., 1993, biological or biochemical process, is unknown. Murine 1994; Van Aelst et al., 1993), the regulatory kinase for C3H10T1/2 ®broblasts transformed with activated the p42 and p44 MAPKs. MAPK regulates the activity

(G12V)Ha-ras or (Q61K)N-ras proliferate in serum-free of cytosolic kinases, including PLA2 (Lin et al., 1993, media and have constitutive MAPK activity. The growth and RSK2 (Xing et al., 1996) and, upon translocation factor antagonist, suramin, inhibited the serum-indepen- of active MAPK to the nucleus, the activity of dent proliferation of Ha-ras transformed ®broblasts, but transcription factors including Elk1 (reviewed by Hill not the serum-independent proliferation of N-ras trans- and Treisman, 1995). Ras activity is critical for formed cells. The inhibition of cell proliferation was proliferation since both the microinjection of neutraliz- concomitant with the abrogation of the constitutive ing Ras antibodies (Mulcahy et al., 1985) or the ectopic MAPK activity in the Ha-ras transformed ®broblasts. expression of a dominant negative (S17N)Ras protein Analysis of the Ras-signalling complexes in immunopre- (Feig and Cooper, 1988; Okuda et al., 1994) block cell cipitates from Ha-ras transformed cells revealed that proliferation. This inhibition can be circumvented by Raf-1 co-immunoprecipitated with endogenous c-N-ras activated v-raf (Smith et al., 1986). The MAPK but not (G12V)Ha-ras. Pretreatment with suramin cascade is only one aspect in the complex network of resulted in the loss of Raf-1 from c-N-ras immunopre- Ras-mediated signal transduction events, but is an cipitates. A c-N-ras antisense oligonucleotide, which essential part of Ras-dependent cell proliferation. down-regulated c-N-ras protein levels, abrogated the Although several Ras eector molecules have been constitutive MAPK activity and serum-independent identi®ed in vitro and from yeast two-hybrid screens, proliferation of (G12V)Ha-ras transformed cells. The no Ras isoform (Ha-ras,N-ras and Ki-ras A and B) data suggest that Raf-1 has a higher anity for N-ras speci®c eector molecules have conclusively been then Ha-ras in vivo, and c-N-ras function is required for identi®ed. Ras eector molecules include the Raf the serum-independent proliferation of Ha-ras trans- kinases (Moodie et al., 1993, 1994; Jaiswal et al., formed cells. 1994; Van Aelst et al., 1993; Vojtek et al., 1993), MEKK (Russell et al., 1995), RalGDS family members Keywords: Ras; Raf-1; MAPK; cell proliferation (Hofer et al., 1994; Kikuchi et al., 1994; Spaargaren and Bischo, 1994; Wolthius et al., 1996), PI 3-OH kinase (PI3K) (Rodriguez-Viciana et al., 1994), Neuro®bromin (DiBattiste et al., 1993) and AF6 Introduction (Kuriyama et al., 1996). The mechanisms which determine and regulate the formation of speci®c Ras- The Ras GTPases function as molecular switches, eector signalling complexes are not known. The best transmitting signals from the plasma membrane to characterized in vivo Ras-signalling complex is the cytosolic serine/threonine kinases. Ras is activated by association between c-Raf-1 and Ras. Using pan- growth and dierentiation factors and is absolutely reactive Ras antibodies, Hallberg et al. (1994) detected required for cell proliferation (Mulcahy et al., 1985; a small Raf-1 signal associated with c-Ras immuno- Okuda et al., 1994). Ras cycles between inactive GDP- precipitated from EGF-stimulated Rat-1 cells and bound and active GTP-bound forms. In addition to its activated T-lymphoblasts. Raf-1 was also detected in intrinsic regulatory GTPase activity, Ras activity is Ras immunoprecipitates from Rat1 cells overexpressing controlled by distinct GAP and GEF regulatory activated (G12E)Ha-ras (Finney et al., 1993). However, proteins (reviewed by Lowy and Willumsen, 1993). since Raf-1 associates with Ha-, N- and Ki-ras in a The best characterized of the Ras-dependent signalling GTP-dependent manner in vitro (Moodie et al., 1993; pathways, in vivo, is the MAPK cascade. Active Hamilton and Wolfman, unpublished data), these Ras⋅GTP binds the cytosolic Raf kinases (Moodie et studies failed to determine whether, in vivo, Raf-1 al., 1993; 1994), recruiting them to the plasma was speci®cally associated with a distinct Ras iso- membrane (Stokoe et al., 1994; Marais et al., 1995) form(s). where their activities are regulated by incompletely Since no Ras isoform speci®c eectors have been understood mechanisms. However the association of identi®ed, there is no data to conclusively distinguish Raf-1 with membrane associated Ras appears to be whether the four isoforms are functionally redundant or if they regulate distinct biological processes. The Correspondence: M Hamilton four Ras proteins share extensive sequence homology Received 14 March 1997; revised 15 October 1997; accepted 15 and are identical in their eector-binding domains. In October 1997 vitro, each Ras isoform associates with the same Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1418 downstream eectors (Raf-1 and B-raf, PI3K and NF1) in a GTP-dependent manner (Hamilton and Wolfman, unpublished observations), suggesting the possibility of functional redundancy within the Ras- µg V12H10 G12N10 C3H10T1/2 K61N10 dependent signalling cascades. Indirect evidence, Ras std membrane however, supports speci®c biological roles for the Ras Ha-ras µ isoforms. The non-homologous C-terminal hypervari- 300 g able regions (spanning amino acids 160 ± 185) are unique for each Ras isoform and are conserved N-ras among species (Lowy and Willumsen, 1993), suggest- 200 µg ing they might be functionally important. Changes in gene expression are in¯uenced by the activity of distinct Ras isoforms. The induction of c-fos by TPA Ki-ras 200 µg is inhibited by the expression of activated Ha-ras but not N-ras or Ki-ras (Carbone et al., 1991). The eciency of Ras mediated cell transformation in vitro Figure 1 Ras isoform expression in C3H10T1/2 ®broblast cell lines. Membrane enriched fractions prepared from parental exhibits a degree of cell type dependency. Ha-ras is C3H10T1/2 ®broblasts (10T1/2), and C3H10T1/2 cells expressing most potent in transforming rodent ®broblasts whereas (G12V)Ha-ras (V12H10 cells), (Q61K)N-ras (K61N10 cells), and cells of myeloid origin are more readily transformed by wild-type N-ras (G12N10 cells) were resolved by SDS ± PAGE N-ras (Maher et al., 1995). This observation re¯ects and immunoblotted with monoclonal antisera speci®c for Ha-ras, N-ras and Ki-ras. Ras proteins were visualized by ECL. 200 mgof previous studies demonstrating that mutations in membrane fraction was blotted for N-ras and Ki-ras and 300 mg speci®c Ras genes are closely associated with speci®c for Ha-ras. Recombinant Ha-ras,N-ras and Ki-ras protein classes of tumours. N-ras and Ki-ras have a high standards (100 ng) are shown on the left. Quantitation of the incidence of mutation in haematological malignancies amount of Ha-ras and N-ras in V12H10 cell membranes using the and in tumours of the gastrointestinal trace respectively image analysis programme, NIH Image, indicated that 200 mgof membrane contained approximately 44 ng of c-N-ras, and 300 mg (Rodenhuis, 1992). This accumulated data suggest that of membrane, 63 ng of Ha-ras (equivalent to 42 ng of Ha-ras in speci®c Ras isoforms may be of critical importance in 200 mg of membrane) cell lines of distinct origin. To test the hypothesis that the dierent Ras isoforms are not functionally redundant, we examined Suramin inhibits the serum-independent proliferation of the Ras signalling complexes formed in C3H10T1/2 Ha-ras but not N-ras transformed ®broblasts ®broblasts transformed by the minimal expression of an activated (G12V)Ha-ras or (Q61K)N-ras. Each Ras-induced cellular transformation, in many in- oncogenic Ras was assayed for its contribution to stances, is associated with a diminished requirement speci®c aspects of cell transformation: constitutive for exogenous growth factors or serum (Pironin et al., MAPK activity and the ability to proliferate in the 1992). This Ras-dependent serum-independent prolif- absence of exogenous serum or growth factors. eration can possibly be attributed to the production of autocrine growth factors, including HB-EGF (McCarthy et al., 1995), TGFa (Berkowitz et al., 1996), VEGF (Rak et al., 1995), IL-1a and IL-6 Results (Castelli et al., 1994), and IGF-1 (Dawson et al., 1995). Ras-transformed V12H10 and K61N10 cells were Expression of activated Ras in C3H10T1/2 ®broblasts therefore assayed for their ability to proliferate in the Western blot analysis of membrane enriched fractions absence of serum for 48 h. The expression of either from normal mouse C3H10T1/2 ®broblasts indicates activated Ha-ras or N-ras resulted in serum-indepen- that they do not express detectable levels of c-Ha-ras dent growth, with cells proliferating at a rate slightly protein (Figure 1). This observation is not unique to lower than that observed in the presence of 10% FCS C3H10T1/2 ®broblasts since Downward et al. (1990) (data not shown). In order to assess the impact of a observed that T-lymphocytes contained little, if any, potential autocrine growth factor mechanism mediating c-Ha-ras protein. C3H10T1/2 cells are readily Ras-dependent, serum-independent proliferation, cells transformed by the ectopic expression of either were incubated in serum-free DMEM in the presence activated (G12V)Ha-ras (V12H10 cells) or (Q61K)N- of increasing concentrations of the growth factor ras (K61N10 cells), as characterized by the acquisi- antagonist, suramin (Betsholtz et al., 1986; Kehinde tion of a refractile cell morphology and the ability to et al., 1995). Suramin blocks the interaction between form foci in soft agar (data not shown). C3H10T1/2 growth factors and their cognate receptors and its cells which express ectopic wild-type N-ras (G12N10 eects are readily reversible. 50 mM suramin completely cells) were not transformed. These cells retained a inhibited the serum-independent proliferation of Ha- ¯attened cell morphology, did not proliferate in the ras transformed V12H10 (Figure 2a (i)) cells and an absence of serum and did not form foci (data not unrelated Ha-ras transformed cell line, RasNIH3T3 shown). The minimal expression of either activated cells (Figure 2a (iii)). N-ras transformed K61N10 cells H-ras or N-ras protein resulted in no greater than a (Figure 2a (ii)) were refractory to suramin. In addition, onefold increase in the total expression of Ras human HT1080 ®brosarcoma cells, which contain an proteins (Figures 1 and 6e). This minimal level of allelic (Q61K)N-ras mutation, were also refractory to ectopic expression was, however, sucient to induce the growth inhibitory property of suramin (Figure 2a the morphological and proliferative characteristics of (iv)). The anti-proliferative eect of suramin was cell transformation. overcome by the direct addition of serum to suramin- Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1419 treated V12H10 cells (Figure 2b). Therefore the failure ®broblasts (Figure 3a). The suramin-mediated inhibi- of V12H10 cells to proliferate in the presence of tion of MAPK activity was serum-reversible. Serum suramin was not a consequence of cell toxicity. Thus, activated MAPK in suramin-treated V12H10 cells to activated Ha-ras and activated N-ras appear to levels comparable with serum-stimulated C3H10T1/2 promote the serum-independent growth of mouse and control V12H10 cells, indicating that suramin, ®broblasts by distinct mechanisms. itself, did not directly inhibit MAPK activity in V12H10 cells. The inhibition of MAPK activity re¯ected the absence of phosphorylated, active MAPK proteins in Ras transformed ®broblasts have constitutive MAPK suramin treated V12H10 cells. Western blot analysis of activity cell lysates indicated that suramin treatment resulted in The expression of activated Ras is closely associated almost the complete loss of phosphorylated MAPK with constitutive MAPK activity (Shibuya et al., 1992; proteins in V12H10 cells, with the level detected being Crews and Erikson, 1993; Dent et al., 1993). MAPK comparable with that detected in quiescent C3H10T1/2 was immunoprecipitated from serum-deprived parental cells. In contrast, suramin had only a minimal eect on C3H10T1/2 cells, and from control and suramin-treated the amount of phosphorylated MAPK observed in V12H10 and K61N10 cells using an antibody that K61N10 cells (Figure 3b). The association of Raf-1 with recognizes both p42 and p44 MAPKs (TR10). MAPK the plasma membrane in vivo, is essential for Raf-1 activity was measured in a direct kinase assay with activation (Stokoe et al., 1994; Marais et al., 1995; myelin basic protein (MBP) as a substrate (Moodie et Stokoe and McCormick, 1997) and consequently al., 1993). The MAPK activity of serum-deprived activation of the MAPK cascade. Western blot data C3H10T1/2 ®broblasts was negligible after 48 h in demonstrated that Raf-1 was depleted from membranes serum-free DMEM. V12H10 and K61N10 cells both prepared from suramin-treated V12H10 cells (Figure had constitutive MAPK activity. Suramin treatment resulted in almost the complete abrogation of MAPK activity in the V12H10 ®broblasts but not the K61N10 a V12H10 10T1/2 K61N10 NI --++ - + --FCS a ++--++ --- suramin

V12H10 10T1/2 K61N10 --++ - - - +suramin

ppERK2 -+--++ --FCS

c V12H10 K61N10 --++suramin

Raf-1 b Figure 3 (a) Suramin inhibits MAPK activity in V12H10 cells. MAPK was immunoprecipitated from control, suramin-treated and serum-stimulated V12H10, C3H10T1/2 (10T1/2) and K61N10 cell lysates using a rabbit polyclonal antisera (TR10). The activity of the immunoprecipitated MAPK was measured in a direct kinase assay with MBP as a substrate. Phosphorylated proteins were resolved by SDS ± PAGE. Phosphorylated MBP was visualized and quantitated on a Molecular Dynamics Phosphor- imager. The data is representative of at least two separate experiments: (NI) non-immune serum. (b) Abrogation of phosphorylated MAPK protein by suramin. Cell lysates were prepared from serum-starved (48 h) V12H10, C3H10T1/2 and Figure 2 (a) Suramin inhibits the serum-independent prolifera- K61N10 cells+suramin. In parallel cultures, cells were serum- tion of Ha-ras transformed ®broblasts. Cells were incubated in stimulated for 10 min by the addition of FBS to 10% (v/v) serum-free medium containing 0 ± 200 mM suramin for 48 h at immediately prior to harvesting and lysis. 100 mg of cell lysates 378C. After 48 h the cells were trypsinized and counted using a were resolved by SDS ± PAGE and immunoblotted for phos- haemocytometer. The number of cells seeded on day 0 is denoted phorylated p42 and p44 MAPK. Phosphorylated MAPK was by (s). All points were performed in duplicate and the data is visualized by ECL. A phosphorylated p42 MAPK standard was representative of at least two independent experiments. Results included as a positive control. The data are representative of three are expressed as the mean+s.e.. (b) The growth inhibitory eect separate determinations. (c) Loss of membrane associated Raf-1 of suramin is reversible. V12H10 ®broblasts incubated in serum- in suramin treated V12H10 cells. Membrane enriched fractions free media for 48 h in the presence of 200 mM suramin were were prepared from control and suramin-treated V12H10 and switched to DMEM+FBS and incubated for an additional 24 or K61N10 cells, and equal amounts of membrane proteins resolved 48 h. Cells were then trypsinized and counted using a on 8% SDS ± PAGE gels and immunoblotted for Raf-1. Raf-1 haemocytometer. Results are expressed as the mean+s.e. was visualized by ECL Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1420 3c). The continued presence of Raf-1 in the membranes of suramin-treated V12H10 cells might possibly be the a result of non-Ras mechanisms of membrane localiza- tion, such as the association of Raf-1 with caveolae (Mineo et al., 1996) or with cytoskeletal elements (Stokoe et al., 1994). These observations suggest that in V12H10 cells, the suramin mediated inhibition of the MAPK cascade and cell proliferation may be related to the loss of membrane associated Raf-1. Since this was not observed with K61N10 cells, we conclude that the mechanisms by which activated Ha-ras and N-ras modulate MAPK activity dier from one another.

Activity of Ras-isoform-speci®c polyclonal antisera Commercially available Ras isoform-speci®c monoclo- b nal antibodies are isoform speci®c by Western PI KB KA N Ha immunoblot analysis but fail to immunoprecipitate Raf-1 32PaGTP-labelled recombinant Ras proteins (data not shown). Therefore, rabbits were immunized with Figure 4 (a) Immunoprecipitation of endogenous c-Ras. c-Ras peptides corresponding to the C-terminal hypervari- was immunoprecipitated from a rat brain membrane enriched able regions of each of the Ras proteins and fraction using Ras-isoform-speci®c polyclonal antisera. Immuno- production bleeds tested for their ability to immunoprecipitated Ras was exchanged with [32P]aGTP. Fold increases in precipitate recombinant Ras proteins. Recombinant [32P]aGTP binding relative to a non-immune control serum are Ha-ras,N-ras and Ki-ras A and B proteins were indicated. (b) Immunoprecipitation of c-Ras : Raf-1 complexes from rat brain. A membrane enriched fraction prepared from immunoprecipitated with each of the Ras isoform seras whole rat brain was incubated with the non-hydrolyzable GTP (RIS) and the immunoprecipitates resolved on 15% analogue, GMP-PNP. This `GTP-loaded' fraction was mixed with SDS ± PAGE gels, transferred to PVDF membrane and a Raf-1 containing rat brain cytosol preparation and `c-Ras⋅GTP' immunoblotted for Ras using Ras isoform-speci®c immunoprecipitated using the Ras isoform antisera. Immunopre- monoclonal antibodies. Each RIS speci®cally immuno- cipitates were resolved on 8% SDS ± PAGE gels and immunoblotted for Raf-1. (Pl) pre-immune rabbit antisera; (KB) Ki-ras B precipitated the Ras protein with the corresponding C- antisera; (KA) Ki-ras A antisera; (N) N-ras antisera; (Ha) Ha-ras terminal region without detectable cross-reactivity with antisera. The position of Raf-1 is indicated on the right the other Ras proteins (data not shown). Each RIS was then evaluated for its ability to immunoprecipitate mammalian, post-translationally modi®ed c-Ras. c-Ras rat brain Raf-1, such as phosphorylation. We conclude, was immunoprecipitated from a membrane-enriched, therefore, that each RIS is able to immunoprecipitate detergent-solubilized rat brain particulate fraction, a the targetted Ras isoform complexed with eector tissue that contains Ha, N- and both Ki-ras proteins proteins. (data not shown). After immunoprecipitation, the immunocomplexes were incubated with [32P]aGTP in Suramin does not inhibit the activation of (G12V) the presence of EDTA to promote guanine nucleotide Ha-ras exchange. Each RIS immunoprecipitate possessed signi®cant amounts of [32P]aGTP (Figure 4a). The The anti-proliferative eect of suramin on Ha-ras amount of immunoprecipitated Ras which binds transformed cells may be a function of a non-speci®c [32P]aGTP does not re¯ect the amount of each of the down-regulation of either (G12V)Ha-ras⋅GTP levels or Ras isoforms present in the rat brain particulate the amount of Ras protein within V12H10 cells. To fraction, but rather, the amount of GTP-exchangeable address this possibility, V12H10 cells were metaboli- Ras. The amount of IgG light chain present in each cally labelled with 32P-orthophosphate and Ha-ras immunoprecipitate, however, prevented clear detection immunoprecipitated using the Ha-ras speci®c polyclo- of endogenous Ras by Western blot analysis of the RIS nal antisera. Labelled guanine nucleotides were eluted immunoprecipitate. Previously, Koide et al. (1993) had from the Ha-ras immunoprecipitates and separated by demonstrated that c-Raf-1 could be co-immunopreci- thin layer chromatography. Quantitation of the eluted pitated with recombinant Ha-ras⋅GTPgS added to cell radiolabelled GTP and GDP (Figure 5a) indicated that lysates using the non-neutralizing Y13-238 pan-Ras suramin had a minimal eect upon the amount of antibody. To evaluate the ability of each RIS to (G12V)Ha-ras⋅GTP immunoprecipitated from V12H10 immunoprecipitate Ras signalling complexes, the cells (38.7% versus 39.8% Ras⋅GTP). However membrane-enriched rat brain particulate fraction was immunoprecipitations with the pan-reactive Ras anti- incubated in the presence of EDTA and the non- body, Y13-259, indicated a modest reduction in hydrolyzable GTP analogue, GMP-PNP. This `GTP- Ras⋅GTP levels in the presence of suramin (69.9% loaded' particulate fraction was mixed with rat brain versus 50.1% Ras⋅GTP). Western blot analysis of cytosol and Ras immunoprecipitated with RIS. membrane enriched fractions prepared from V12H10 Immunoprecipitates were resolved by SDS ± PAGE cells indicated that Ha-ras,N-ras and Ki-ras protein and immunoblotted for Raf-1. Western blot analysis levels were unaected by suramin pretreatment (Figure indicated that Raf-1 co-immunoprecipitated with each 5b). Though suramin may mediate its anti-proliferative RIS as a doublet (Figure 4b), possibly re¯ecting eect by reducing the amount of Ras⋅GTP (presumably dierences in the post-translational modi®cation of N-ras and/or Ki-ras) within V12H10 cells, its Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1421

a b suramin ––++ suramin – +

GDP Ha-ras

N-ras

GTP

Ki-ras

%GTP 69.9 50.1 38.7 39.8 Y13-259 Ha-ras Figure 5 (a) Suramin does not aect (G12V)Ha-ras-GTP levels. Cell lysates from V12H10 cells labelled overnight with 32P-orthophosphate were immunoprecipitated with the Ha-ras-speci®c polyclonal antisera. Radiolabelled guanine nucleotides were eluted from the immunoprecipitates and separated by TLC. Radioactive GDP and GTP were visualized and quantitated on a Molecular Dynamics Phosphorimager. (b) Suramin does not aect Ras protein levels. Membrane enriched fractions prepared from control and suramin treated V12H10 cells were resolved by SDS ± PAGE and immunoblotted with monoclonal antisera speci®c for Ha-ras,N-ras and Ki-ras. Ras proteins were visualized by ECL inhibitory eect on V12H10 cell proliferation is not detect Raf-1 in Ha-ras immunoprecipitates was not a due to the down-regulation of (G12V)Ha-ras⋅GTP or consequence of the antiseras immunoprecipitating Ras protein levels. dierent amounts of Ha- and N-ras. Rather, the data implies that Raf-1 preferentially binds to, or has a higher anity for, N-ras. Moreover, immunoblot Raf-1 co-immunoprecipitates with N-ras but not Ha-ras analysis indicated that greater than 80% of the total To further investigate the dierences between Ha-ras Ha-ras was depleted from membranes after Ha-ras and N-ras modulation of serum-independent MAPK immunoprecipitation (data not shown). activity, both Ha-ras and N-ras were immunoprecipi- The failure to detect Raf-1 in Ras immunoprecipitated from V12H10 and K61N10 cells using the Ha-ras tates using the pan-reactive Ras Y13-238 antibody is and N-ras speci®c antisera. We observed, as expected, most likely a function of the poor ability of this that c-Raf-1 co-immunoprecipitated with N-ras in antibody to immunoprecipitate signi®cant amounts of K61N10 cells (Figure 6c) but were unable to N-ras (Cox et al., 1995), and because V12H10 cells distinguish between endogenous c-N-ras and the express only a modest level of (G12V)Ha-ras. ectopic N-ras in these immunoprecipitates. Surpris- Ha-ras:Raf-1 complexes could be detected if Ha-ras ingly though, c-Raf-1 co-immunoprecipitated with c-N- expression levels were greatly increased. Dexametha- ras in V12H10 cells (Figure 6a) and in RasNIH3T3 sone-inducible (G12V)Ha-ras Rat2:64-3 and IPTG- cells (Figure 6b). Suramin pretreatment resulted in the inducible (G12V)Ha-ras iRas3T3 ®broblasts synthesize complete loss of Raf-1 from N-ras-immunoprecipitates large, supraphysiological quantities of membrane from both V12H10 cells and from RasNIH3T3 cells. associated (G12V)Ha-ras (Figure 6e), far in excess of Identical results were observed in two other (G12V)Ha- the amount of Ha-ras present in V12H10 cells and in ras transformed C3H10T1/2 cell lines (data not RasNIH3T3 cells. Induction of (G12V)Ha-ras in these shown). Suramin, however, did not signi®cantly eect cell lines resulted in the detection of Raf-1 in Ha-ras the amount of Raf-1 associated with N-ras in the immunoprecipitates (Figure 6f). Once again, Raf-1 was K61N10 cells (Figure 6c). Suramin also failed to down- found associated with c-N-ras in both cell lines. The regulate the association of Raf-1 with N-ras in both a possibility that other Raf family kinases (B-Raf and A- second (Q61K)N-ras C3H10T1/2 cell line and in Raf) might associate with Ras in vivo was tested using human HT1080 cells (data not shown). In contrast to the pan-reactive Raf monoclonal antibody, PBB-1 previous reports (Finney et al., 1993; Hallberg et al., (Kolch et al., 1990). Figure 6g indicated that, in 1994; Koide et al., 1993), a signi®cant amount of Raf-1 V12H10 and K61N10 cells, only one Raf family kinase was not detected in Y13-238 immunoprecipitates, being co-immunoprecipitated with N-ras, and this Raf no better at co-immunoprecipitating Raf-1 than the protein co-migrated with Raf-1. No other Raf kinases control non-immune serum. Ras, though, was detected were found to co-immunoprecipitate with the Ras in Y13-238 immunoprecipitates by Western blot proteins under conditions of serum-independent pro- analysis (data not shown). Using the Ha-ras and N- liferation. We were unable to clearly distinguish ras speci®c monoclonal antibodies, which have similar whether B-Raf was present in these cells. Two anities for their respective isoforms (data not shown), additional immunoreactive bands, though, were de- near-equivalent amounts of Ha-ras and N-ras were tected in cell lysates immunoblotted with the PBB1 detected in Ras immunoprecipitates from Ha-ras antibody which did not co-migrate with either Raf-1 transformed cells (Figure 6d). Thus the failure to and A-Raf. Furthermore, neither band was detected in Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1422 the Ras immunoprecipitates. The data therefore of (G12V)Ha-ras and this Ras:Raf complex is critical indicate that Raf-1 associates with c-N-ras and not for serum-independent proliferation. However, the Ha-Ras in cells transformed by the minimal expression overexpression of Ha-ras at supraphysiological levels

a b V12H10 + suramin RasNIH3T3 + suramin lys Y RRHa NNPI YHa PI lys Y Ha NPI KB YHa N

Raf-1 Raf-1

c K61N10 + suramin d lys YYHaNPI Ha N std NI Ha N lgLC

Raf-1 Ras

iRas3T3 Rat2:64-3 --+ --suramin 200ng V12H10 V12H10 C3H10T1/2 C3H10T1/2 RasNIH3T3 Ha-ras - ++ - +IPTG or DXM

Ha-ras total Ras Ha-ras Ras blot 200250 200 200 µg membrane 1.0 1.5 relative amount of total Ras protein

f iRas3T3:(G12V)Ha-ras Rat2:(G12V)Ha-ras PI YYHaNNlys Ha PI

Raf-1 Raf-1

g V12H10 K61N10 100 µg lys H N KA KB H N KA KB cell lysate A-Raf

Raf-1

WB PBB1 pan-Raf Raf-1

A-Raf Figure 6 Raf-1 co-immunoprecipitates with N-Ras. Ras was immunoprecipitated from cell lysates prepared from control and suramin treated cells. Immunoprecipitates were resolved by SDS ± PAGE and immunoblotted for Raf-1. (a) V12H10 cells, (b) RasNIH3T3 cells and (c) K61N10 cells: (Lys) 50 mg of cell lysate; (Y) Y13-238 pan-Ras rat monoclonal antisera; (R) non-immune rat IgG; (Ha) Ha-ras antisera; (N) N-ras antisera; (KB) Ki-ras B antisera; (PI) pre-immune (N-ras) rabbit antisera. The position of Raf-1 is indicated. (d) Similar amounts of Ras are detected in Ha-ras and N-ras immunoprecipitates. Ras immunoprecipitates from Ha-ras transformed cells were resolved on a 17.5% SDS ± PAGE gel and immunoblotted for Ha-ras and N-ras as described. (NI) non-immune; (Ha) Ha-ras antisera; (N) N-ras antisera; A Ras standard (std) was included. The positions of Ras and immunoglobulin light chain (IgLC) are indicated. (e) Expression level of Ha-ras in Rat2:64-3 and iRas3T3 cells. Membrane-enriched fractions were prepared from iRas3T3, Rat2:64-3, V12H10, RasNIH3T3 and C3H10T1/2 ®broblasts, resolved on 15% SDS ± PAGE gels and immunoblotted for Ha-ras or total Ras using the Ras isoform speci®c monoclonal antisera. 200 ng of recombinant Ha-ras was included as a positive control. (f) Raf-1 co-immunoprecipitates with Ha-ras in iRas3T3 and Rat2:64-3 cells. Ha-ras and N-ras were immunoprecipitated from cell lysates prepared from IPTG induced iRas3T3 or dexamethasone (DXM) induced Rat2:64-3 cells as described. Immunoprecipitates were resolved on 8% SDS ± PAGE gels and immunoblotted for Raf-1. The position of Raf-1 is indicated. (Y) Y13 ± 238; (Ha) Ha-ras antisera; (N) N-ras antisera; (PI) Pre-immune serum; (lys) 100 mg cell lysate. (g) Raf-1 is the only Raf family kinase stably associated with Ras in vivo. Ras immunoprecipitates prepared from V12H10 and K61N10 cells were resolved on 8% SDS ± PAGE gels and immunoblotted for Raf family kinases with the pan-reactive Raf monoclonal antibody PBB1. 100 mg of lysate was resolved on the same gel for immunoblotting with monoclonal antisera speci®c for Raf-1, A-Raf or with PBB1, to determine the relative mobilities of the Raf family kinases. (Lys) 100 mg cell lysate; (H) Ha-ras antisera; (N) N-ras antisera; (KA) Ki-ras A antisera; (KB) Ki-ras B antisera; (WB) Western blot monoclonal antibody Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1423 results in the formation of a Ha-ras:Raf-1 complex. sense oligonucleotide almost completely abrogated the Consequently, the suramin-insensitive, constitutive constitutive MAPK activity (Figure 7c) and the MAPK activity observed in N-ras transformed presence of phosphorylated p42 and p44 MAPKs K61N10 ®broblasts may likely be mediated through (Figure 7d). The sense oligonucleotide had a very the stable association of Raf-1 with N-ras. slight inhibitory eect on N-ras protein levels (89.50+10.50% of control c-N-ras protein levels) and cell proliferation, but no eect either upon basal c-N-ras antisense oligonucleotides block V12H10 MAPK activity or the presence of phosphorylated ®broblast proliferation and inhibit MAPK activity p42 and p44 MAPK in V12H10 cells. The 50% To further clarify the role of c-N-ras in (G12V)Ha-ras- reduction in c-N-ras protein levels within V12H10 mediated serum-independent proliferation and consti- cells was, however, sucient to inhibit both the tutive MAPK activity, N-ras antisense oligonucleotides constitutive MAPK activity and cell proliferation. were used to speci®cally downregulate c-N-ras protein This supports our observations that minimally levels in V12H10 cells (Figure 7a). One antisense expressed (G12V)Ha-ras does not directly mediate oligonucleotide reduced the amount of N-ras by MAPK activity in murine C3H10T1/2 ®broblasts. approximately 50% (52.45+5.46% of control c-N-ras Rather, MAPK activity appears to be linked to c-N- protein levels) which was re¯ected in a signi®cant ras function, since down-regulation of N-ras protein reduction in V12H10 cell proliferation (Figure 7b). levels has a signi®cant eect upon both MAPK activity V12H10 cell proliferation was inhibited using 3 mM and and serum-independent proliferation. These data 10 mM antisense oligonucleotides, with cell numbers correlate with our observations that the suramin- reduced by 40% (P50.05) relative to untreated control mediated disruption of the N-ras:Raf-1 complex in cells and cells incubated with 10 mM N-ras sense Ha-ras transformed cells results in the near-complete oligonucleotides. More importantly, the N-ras anti- abrogation of MAPK activity and inhibition of serum-

a Ras C S AS std

(His)6N-ras

c c-N-ras C S AS

b MBP

d std C AS S

p44 p42

Figure 7 (a) Reduction in c-N-ras protein levels by N-ras antisense oligonucleotides. Membrane enriched fractions prepared from V12H10 cells incubated with sense or antisense N-ras oligonucleotides for 96 h were resolved by SDS ± PAGE and immunoblotted for N-ras with a N-ras speci®c monoclonal antibody. N-ras was visualized by ECL. The relative amounts of N-ras protein were quantitated by densitometry. The data is representative of two independent experiments: (C) Control (no oligonucleotide); (S) N-ras sense oligonucleotide; (AS) N-ras antisense oligonucleotide. (b) Inhibition of serum-independent V12H10 cell proliferation by N-ras antisense oligonucleotides. V12H10 cells incubated in serum-free medium containing sense or antisense N-ras oligonucleotides for 96 h were trypsinized and counted with a haemocytometer. All points were performed in duplicate. The data is expressed as the percentage reduction in cell proliferation compared with control V12H10 cells (no oligonucleotide) and is representative of four separate experiments. (Open circle); N-ras sense oligonucleotide; (closed circle); N-ras antisense oligonucleotide. Results are expressed as mean+s.e. (*P50.05). (c) Inhibition of MAPK activity by N-ras antisense oligonucleotides. MAPK was immunoprecipitated from control V12H10 cells and V12H10 cells incubated with N-ras sense and antisense oligonucleotides for 96 h. The activity of the immunoprecipitated MAPK was measured in a direct kinase assay with MBP as a substrate. Phosphorylated proteins were resolved by SDS ± PAGE and phosphorylated MBP visualized and quantitated on a Molecular Dynamics Phosphorimager: (C) control cells; (S) N-ras sense oligonucleotide; (AS) N-ras antisense oligonucleotide. (d) Abrogation of phosphorylated MAPK by N-ras antisense oligonucleotides. Cell lysates from control and V12H10 cells incubated with N-ras sense and antisense oligonucleotides for 96 h were resolved by SDS ± PAGE and immunoblotted for phosphorylated p42 and p44 MAPK. Phosphorylated MAPK was visualized by ECL. A phosphorylated p42 MAPK protein standard (std) was included as a positive control: (C) control cells; (S) N-ras sense oligonucleotide; (AS) N-ras antisense oligonucleotide Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1424 independent proliferation. Therefore, MAPK activity Oldham et al. (1996) reported that media conditioned in (G12V)Ha-ras transformed mouse V12H10 fibro- by Ha-ras transformed epithelial cells induces the blasts is not a consequence of a complex between Raf-1 morphological transformation of normal epithelial and the activated (G12V)Ha-ras, but rather through its cells. This morphological transformation could be association with c-N-ras. Subsequently, the down- mimicked by exogenous TGFa but not be media regulation of c-N-ras protein levels or the disruption conditioned by Raf transformed epithelial cells. of the c-N-ras:Raf1 complex results in the inhibition of Suramin inhibits the binding of polypeptide growth MAPK activity and cell proliferation. The data, factors to their cognate receptors (Kehinde et al., 1995). therefore, implicates N-ras but not Ha-ras as the It can, therefore, be postulated that the anti-prolifera- regulatory Ras isoform of the MAPK cascade in Ha- tive eect of suramin may be mediated through the ras transformed C3H10T1/2 ®broblasts. blocking of a growth factor receptor-mediated association of Raf-1 with N-ras. Therefore, if N-ras directs Raf-1 signalling, N-ras transformed cells would be, and Discussion are, insensitive to the anti-proliferative eect of suramin. In addition, our data suggest that in a mouse MAPK activation is an absolute requirement for background, c-N-ras possesses a higher anity for Raf- ®broblast proliferation (Pages et al., 1993) and is 1 than does activated (G12V)Ha-ras. The action of concommitant with the expression of activated Ras in (G12V)Ha-ras might, therefore, be to facilitate the vivo. Raf-1 activation is sucient to stimulate cell synthesis and/or secretion of an unidenti®ed autocrine proliferation and MAPK activation (Dent et al., 1992; growth factor(s). In this instance, (G12V)Ha-ras and Shibuya et al., 1992; Kortenjann et al., 1994), and both c-N-ras functions might synergize to produce cell these Ras-dependent biological processes can be transformation. Alternatively, other Ras eectors may blocked by dominant negative Raf-1 constructs be directly regulated by (G12V)Ha-ras. (Schaap et al., 1993). One function of Ras⋅GTP may Little is known about the stability and duration of c- be to recruit Raf-1 to the plasma membrane for Ras-eector complexes. Our data suggest that the subsequent activation. This recruitment function of c-N-ras:Raf-1 complex is a stable entity at 48C since Ras can be circumvented by directly targetting Raf-1 Raf-1 is detected in N-ras immunoprecipitates after a to the plasma membrane by fusion with a Ki-rasB 4 h immunoprecipitation (Figure 6a ± c). The formation CAAX sequence (Stokoe et al., 1994). Although Ras- of a Ras:Eector complex is a mutually exclusive induced cell transformation has previously been process, preventing the interaction of Ras with other demonstrated to require synergy between at least two eectors, including regulatory GAP proteins (RasGAP distinct Ras activities (White et al., 1995; Joneson et and NF-1) (Moodie et al., 1995). When Ras is bound al., 1996), the interaction between Ras and Raf-1 in to an eector, GAP proteins are unable to promote the vivo is critical in the activation of the MAPK cascade hydrolysis of Ras-bound GTP. Consequently, the and for cell proliferation. In vitro, active Ras associates inactivation and dissociation of the active with the upstream eectors of the MAPK pathway, Ras:Eector complex is not regulated by GAP Raf-1 and MEK1 (Macdonald et al., 1993; Moodie et activity. Hermann et al. (1995) demonstrated that the al., 1993, 1994; Vojtek et al., 1993) and directs the Raf/ dissociation of the Ras-binding domain (RBD) of Raf- MEK/MAPK kinase cascade. Our data, however, 1 from c-Ha-ras was dependent upon the intrinsic suggest that activated (G12V)Ha-ras does not directly GTPase activity of c-Ha-ras (approximately 30 min at mediate the MAPK kinase cascade in mouse fibro- 378C). Thus, the association of Ras with an eector blasts. Activated (G12V)Ha-ras does not appear to other than a GAP protein results in a stable signalling bind Raf-1. Rather, Raf-1 co-immunoprecipitates with complex, with each eector functioning as a potential c-N-ras in Ha-ras transformed cells and is lost from GDI protein. The intrinsic GTPase activity is unaltered c-N-ras immunoprecipitates after treatment with by the association of c-Ras⋅GTP with Raf-RBD suramin. Since suramin completely abrogates MAPK (Herrmann et al., 1995). Consequently, the duration activity and cell proliferation, the data suggest that the of a c-Ras-Raf complex may depend solely on the c- association of Raf-1 with c-N-ras mediates the Ras⋅GTP-Raf-1 GTPase rate. Furthermore, it is most constitutive MAPK activity in Ha-ras transformed likely that the activation of Raf-1 occurs when Raf-1 is V12H10 cells. Stokoe and McCormick (1997) recently complexed with Ras (Stokoe and McCormick, 1997). reported that the interaction between Ras and Raf-1, Although activated (Q61K)N-ras alone appears alone, was sucient for Raf-1 activation. Moreover, sucient to activate the MAPK cascade, most the down-regulation of c-N-ras protein levels inhibits probably functioning through its binding to Raf-1, cell proliferation and abrogates MAPK activity. The the data suggests that there is a level of co-operation functional relationship between N-ras and Raf-1 is between the activated Ha-ras and c-N-ras proteins to further supported by our observations that suramin has produce a fully transformed phenotype in mouse a minimal eect upon the stability of the N-Ras:Raf-1 ®broblasts. The role of Ki-ras in serum-independent complex, MAPK activity, and the serum-independent cell proliferation was not addressed in these experi- proliferation of N-ras transformed K61N10 mouse ments and therefore cannot be excluded. Raf-1, ®broblasts. though, is unlikely to be an immediate downstream Since suramin is a growth factor antagonist, the eector for Ki-ras in V12H10 ®broblasts since Ki-ras mechanism of (G12V)Ha-ras dependent activation of was readily detected in pan-Ras Y13-238 immunopre- MAPK might involve an autocrine mechanism of cipitates (data not shown) but Raf-1 was not (Figure action. Indeed, media conditioned by V12H10 cells 6a ± c). possesses an activity that stimulates MAPK activity in Most studies of Ras signalling and Ras-signalling quiescent C3H10T1/2 ®broblasts (data not shown). complexes have utilized expression systems which Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1425 grossly overproduce activated Ras (Finney et al., 1993), The apparent distinction between the abilities of Ha- or have entailed the addition of microgramme ras and N-ras to directly control the MAPK cascade in quantities of recombinant Ras protein to cell lysates vivo contrasts the lack of distinguishable phenotype (Koide et al., 1993). These methods, though informa- reported for N-ras knockout mice (Umano et al., tive, more than likely overwhelm the normal cellular 1995). The possibility exists that during early develop- machinery that not only regulates Ras activity, but also ment there is a degree of Ras plasticity such that other potential mechanisms that determine and facilitate Ras isoforms are able to compensate for a null Ras speci®c Ras isoform-eector interactions. In vivo, this defect. These novel observations suggest that although would result in aberrant, promiscuous cellular signal- there may be a degree of functional redundancy among ling and cell transformation via non-physiological or the Ras proteins, Ha-ras and N-ras appear to control low-anity Ras-signalling complexes. Therefore, what distinct biological and biochemical activities, and that is observed may be misleading. The use of supra- c-N-ras co-operates with (G12V)Ha-ras to produce a physiological levels of ectopioc Ras, and pan-reactive fully transformed phenotype. Ras antibodies do not fully address the possibility that the Ras isoforms regulate distinct signalling cascades and biological events. We do not detect Ha-ras protein in any of the ®broblast cell lines available in the Materials and methods laboratory (data not shown), suggesting that there may be qualitative functional dierences between Ha-ras Reagents and N-ras or Ki-ras signalling events. Indeed, the All reagents were Molecular Biology grade. [32P]gATP eciency of the dierent Ras proteins to mediate cell (3000 Ci/mmol) was purchased from NEN DuPont, transformation exhibits a degree of cell-type depen- Boston, MA, and [32P]aGTP (3000 Ci/mmol) from Amer- dency. Rat2 ®broblasts can be transformed by the sham Corporation, Arlington Heights, IL. CHAPS is 3- induction of minimal amounts of (G12V)Ha-ras [(3-cholamidopropyl) dimethylammonio]-1- propanesulfonic protein (Maher et al., 1995; Yoder-Hill, Kirshmeier acid and MOPS is (3-[N-morpholino]propanesulfonic acid). and Wolfman, submitted) but not by (Q61K)N-ras or (G12D)N-ras (Yoder-Hill, Kirshmeier and Wolfman, Cell culture and transfections submitted). This supports the observations in this V12H10 ®broblasts (originally named 11A) expressing report that at minimal levels of Ras expression there activated (G12V)Ha-ras are derived from normal mouse are signi®cant dierences in Ras isoform-dependent C3H10T1/2 ®broblasts by transfection and were a kind signalling systems. gift from EJ Taparowsky (Purdue University, Lafayette, The minimal expression of activated Ras proteins is IN). RasNIH3T3 expressing activated (G12V)Ha-ras are sucient to induce cell transformation and constitutive derived from mouse NIH3T3 ®broblasts. Human HT1080 MAPK activity. Activated Ha-ras, however, appears to ®brosarcoma cells were provided by DW Leaman and indirectly activate the MAPK cascade. There appears GR Stark, (Dept. of Molecular Biology, Cleveland Clinic to be co-operation between (G12V)Ha-ras and c-N-ras Foundation). K61N10 and G12N10 ®broblasts, expressing activated (Q61K)N-ras and wild-type (G12)N-ras such that c-N-ras may function downstream of respectively, are derived from C3H10T1/2 ®broblasts by activated Ha-ras. The signi®cant inhibition of MAPK transfection with N-ras expression vectors pIBW3NT activity and serum-independent cell proliferation (Q61K) and pIBW3NN (G12) using the lipofectamine through the modest reduction in N-ras protein levels method (GIBCO/BRL) for 6 h at 378C. Rat2 ®broblasts is somewhat surprising. However, since minimal were transfected with (G12V)Ha-ras cloned into the increases in activated Ras induce cell transformation, dexamethasone inducible pMAM vector. Transfected conversely it is possible that modest decreases in Ras cells were selected in DMEM+FCS containing 750 mg/ levels could be growth inhibitory. Ecient Ras ml G418. Clonal transfected cell lines were isolated from signalling may be dependent upon a threshold level discrete foci and propagated in DMEM+FCS. iRas3T3 of Ras⋅GTP being attained. Biological processes are cells (McCarthy et al., 1995) were obtained from Martin McMahon, DNAX Corp. CA with the kind permission tightly regulated and many require the attainment of of Yoshito Kaziro, Tokyo Institute of Technology, speci®c thresholds of activity before a response is Japan. All cell lines were maintained in DMEM initiated (e.g. the action potential in neurons). It is supplemented with 10% (v/v) fetal bovine serum possible that the modest (50%) reduction in N-ras (DMEM+FCS). Y13-238 and Y13-259 hybridoma cells protein levels in N-ras antisense oligonucleotide treated were obtained from the American Tissue Culture V12H10 cells results in the inhibition of MAPK Collection and were maintained in Ultradoma medium activity by preventing achievement of a speci®c (Gibco, NY) containing 20% FCS. threshold level of active N-ras. The minimal amount of activated Ras required to induce MAPK activation Ras induction has never been determined since most studies have employed overexpression of an ectopic protein to (G12V)Ha-ras was induced in iRas3T3 cells and Rat2:64-3 cells with 5 mM IPTG or 100 mM dexamethasone, respec- determine its role in a given biological or biochemical tively, for 48 h in serum-free DMEM. event. However, it is possible that only a small amount of Ras need be activated to produce a Ras-dependent signalling cascade, since the signals that go through Serum-independent cell proliferation assays Ras undergo ampli®cation e.g. the MAPK cascade. Ras transformed ®broblasts were seeded at 1.5 ± 5.06105 Consequently, it is perfectly feasible that a certain, cells in 100 mm culture dishes and allowed to attach for 6 h de®nable amount of Ras⋅GTP or activated Ras must at 378C. Attached cells were washed twice with serum-free be present before a Ras-dependent signalling event can DMEM and incubated in the presence of 0 ± 200 mM suramin proceed. (Research Biochemicals International, Natick, MA). After Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1426 48 h the cells were trypsinized and counted using a oligonucleotide corresponding to a 20 base sequence in haemocytometer. To determine whether the anti-prolifera- exon 2 of the c-N-ras gene (GenBank Accession number tive eect of suramin was reversible, V12H10 cells were M12122), proved to be eective in down-regulating c-N-ras incubated in serum-free media for 48 h in the presence of protein levels. This was TGATTTGCTATTATTGATGG 200 mM suramin. After 48 h the cell monolayer was washed for the N-ras antisense sequence and CCATCAATAA- twice and media containing 10% FCS added. The cells were TAGCAAATCA for the N-ras sense sequence. incubated for an additional 24 or 48 h, then trypsinized and counted using a haemocytometer. The eect of N-ras sense Immunoblot analysis and antisense oligonucleotides on the serum-independent proliferation of V12H10 cells was measured by seeding 1.0 ± Mouse monoclonal and rabbit polyclonal antibodies 2.06105 cells in 100 mm culture dishes and allowing them to against Raf-1 were purchased from Transduction Labora- attach for 6 h at 378C. Attached cells were washed twice with tories, Louisville, KY. The pan-reactive Raf monoclonal serum-free DMEM and incubated for 96 h in the presence of antibody, PBB1, was obtained from Martin McMahon, 0±10 mM sense or antisense oligonucleotides, with the DNAX Corp, CA. The phosphorylated MAPK (phospho- medium replaced with fresh oligonucleotide-containing MAPK)-speci®c rabbit polyclonal antibody was purchased DMEM after 48 h. At 96 h the cells were trypsinized and from Promega, Madison, WI. Ha-ras,N-ras and Ki-ras counted using a haemocytometer. Cell proliferation in the speci®c monoclonal antibodies were purchased from Santa presence of the oligonucleotides was expressed as the Cruz Biotechnology, Santa Cruz, CA. 200 ± 300 mgof percentage of control (no oligonucleotide) cultures. denatured membrane-enriched fractions and 100 mgof denatured 1.0% CHAPS cell lysates were resolved on Preparation of membrane-enriched fractions discontinuous SDS ± PAGE gels for Ras isoform (15%) and phosphoMAPK blots (8%), respectively. Resolved Cell monolayers were washed twice with ice-cold Tris proteins were transferred to Immobilon P (Millipore, Buered Saline (TBS: 150 mM NaCl, 50 mM Tris pH 7.4), Bedford, MA) PVDF membranes and blocked with scraped and pelleted by centrifugation at 800 r.p.m. for TBS+0.1%NP40 (TBS+NP40) containing 5% dry milk 5min at 48C. A cytosol fraction was prepared by and 1% FBS for 1 h at room temperature. After washing resuspending the cell pellet in 1.0 ml of MOPS buer with TBS+NP40, the membrane was incubated with

(20 mM MOPS pH 7.4, 5 mM MgCl2,2mM EDTA, 10% primary antibody for 1 h at room temperature. Mem- (v/v) glycerol, plus protease and phosphatase inhibitors) branes were washed ®ve times with TBS+NP40 (10 min containing 0.05% (w/v) saponin and incubating on ice for wash) and then incubated for 1 h with anti-mouse or anti- 30 min. Cell ghosts were collected by centrifugation at rabbit horseradish peroxidase (HRP) conjugated secondary 13 000 r.p.m. for 10 min at 48C in a refrigerated bench antibodies (1 : 3000 working dilution). After washing, the microcentrifuge. The pellet was washed three times with immunoreactive bands were visualized using standard ice-cold TBS and an enriched membrane fraction prepared enhanced chemiluminescence (ECL) techniques. by extracting the cell pellet for 20 min on ice with 200 ± 500 mlof1.0%(w/v)CHAPSinMOPSbuer(CHAPS Co-immunoprecipitation of Raf-1 with Ras lysis buer). All of the Ras proteins are solubilized by the addition of 1.0% CHAPS (Wolfman, unpublished observa- Cell monolayers were washed twice with ice-cold TBS, tion). Insoluble cellular debris was pelleted by centrifuga- scraped and pelleted by centrifugation at 800 r.p.m. for tion at 13 000 r.p.m. at 48C. The protein concentration of 5minat48C. The cell pellet was lysed in 500 mlofice-cold the membrane enriched fractions was determined by 1% CHAPS lysis buer (20 mM MOPS pH 7.4, 1% (w/v) Bradford assay. CHAPS, 10% (v/v) glycerol, 150 mM NaCl, 2 mM EDTA,

5mM MgCl2, 0.05% (v/v) NP40, plus protease and Antibody production phosphatase inhibitors) for 20 min on ice. Lysates were clari®ed by centrifugation at 13 000 r.p.m. for 10 min at Polyclonal antiseras were raised to peptides corresponding 48C in a refrigerated bench microcentrifuge. Clari®ed to Ha-ras amino acids 166 ± 180, Ki-rasAandKi-rasB lysates were pre-absorbed with 200 ml of Protein A amino acids 173 ± 183, and N-ras amino acids 166 ± 179. Sepharose (PAS) for 10 min on ice and recentrifuged at Peptides were synthesized and coupled to bovine serum 13 000 r.p.m. for 5 min at 48C (PAS was prepared as a 1 : 4 albumin (BSA), using the bifunctional reagent m-Maleimi- slurry in TBS+NP40). The protein concentration of the dobenzoyl-N-hydroxysuccinimide ester (Sigma, St Louis, lysates was determined by Bradford assay. 50 mlofRas MO). BSA-Ras peptide conjugates were puri®ed from speci®c polyclonal antisera was added to the lysates and unconjugated peptides by gel ®ltration on a 14.060.5 cm permitted to immunoreact for 3 h at 48C with constant Sephadex G25 column and dialyzed against TBS. Rabbits rotation. Insoluble material was pelleted by centrifugation were immunized according to standard protocols (Biode- at 13 000 r.p.m. for 10 min at 48C, and the reclari®ed sign International, Kennebunk, ME). Production bleeds lysate transferred to a clean eppendorf containing 200 ml were assayed for their ability to immunoprecipitate PAS and precipitated for 1 h at 48C. Immunoprecipitates recombinant Ras proteins and to detect recombinant Ras were collected by centrifugation at 48Candwashed®ve protein by Western analysis. Each Ras antisera did not times with ice-cold TBS+NP40. Laemlli buer was added cross react with the other Ras proteins as determined by and the immunoprecipitates heated for 5 min at 1008C. Western blot analysis and immunoprecipitation of The immunoprecipitates were resolved on 8% SDS ± PAGE 32PaGTP-labelled Ras. The pan-Ras reactive Y13-238 and gels and transferred to an Immobilon P membrane for Y13-259 rat monoclonal antibodies were obtained from Western blot analysis. Membranes were blotted for Raf-1 hybridoma culture supernatants by concentration through with a Raf-1 speci®c monoclonal antibody and detected a Centriprep 30 membrane (Amicon, Beverly, MA). with a HRP-conjugated anti-mouse secondary antibody. Immunoreactive bands were visualized by ECL. N-ras sense and antisense oligonucleotide sequences Immunoprecipitation of c-Ras by Ras-isoform speci®c ThemurineN-ras mRNA sequence was analysed using the polyclonal antibodies RNA folding programme, Mulfold. Several N-ras speci®c sense and antisense phosphorothioate-modi®ed DNA Rat brain contains c-Ha-ras,c-N-ras and c-Ki-ras proteins oligonucleotides were synthesized (Eckstein, 1985). One (data not shown). A rat brain particulate fraction was Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1427 solubilized in 20 mM MOPS pH 7.4 buer containing 1.0% Measurement of MAPK activity CHAPS, 0.04% deoxycholate, and protease inhibitors (Wolfman and Macara, 1990). c-Ras isoforms were Cells were grown for 48 h in serum-free media with or immunoprecipitated from 3.5 mg of the membrane- without suramin, or for 96 h in the presence of N-ras sense enriched brain fraction using Ras-isoform speci®c poly- and antisense oligonucleotides. In serum-stimulation clonal antisera or Y13-238 for 3 h at 48C. Insoluble experiments, 48 h serum-starved cells were stimulated for material was pelleted by centrifugation at 13 000 r.p.m. 10 min by the addition of FBS to 10% (v/v) directly to the for 10 min at 48C, and the clari®ed lysate incubated with culture dish. Cell monolayers were washed and the cells PAS for 1 h at 48C to precipitate Ras. Immunoprecipitates scraped and lysed as previously described. MAPKs were were washed three times with P21+NP40 buer containing immunoprecipitated from 250 mgofcelllysateusinga rabbit polyclonal antisera to MAPK (TR10) or a non- 10 mM EDTA and three times with P21 buer containing immune rabbit serum precoupled to PAS. MAPK was 10 mM EDTA. Endogenous c-Ras was detected by immunoprecipitated for 2 h at 48C with constant rotation. exchanging Ras bound guanine nucleotides for [32P]aGTP (3000 Ci/mmol) in the presence of EDTA. Immunopreci- Immunoprecipitates were washed twice with TBS+NP40, pitates were incubated with 50 ml of P21 buer containing twice with P21+NP40 buer (20 mM MOPS pH 7.4, 200 mM Sucrose, 4 mM MgCl ,1mM DTT, 0.02% NP40) 10 mM EDTA, 1 mM ATP and 10 mCi [32P]aGTP for 2 90 min at room temperature. The GTP-exchange reaction and a ®nal wash with P21 buer. 50 mlofkinasebuer (P21 buer containing 10 mM ATP, 10 mM MgCl ,10mCi was stopped by the addition of MgCl to 20 mM and the 2 2 32 immunoprecipitates washed three times with P21 buer [ P]gATP and 10 mM phosphatase inhibitors; Moodie et al., 1993) containing 25 mM myelin basic protein (MBP; containing 20 mM MgCl2. Scintillation ¯uid was added and the radioactivity associated with the immunoprecipitates Sigma, St Louis, MO) was added to each immunoprecipi- measured. tate and incubated at 378C for 20 min. The kinase reaction was stopped by the addition of 50 mlof26Laemlli buer and the phosphorylated proteins resolved on a discontin- Ha-ras-GTP measurements uous 15% SDS ± PAGE gel. Phosphorylated MBP was visualized and quantitated on a Molecular Dynamics V12H10 cells grown to 50% con¯uency in complete media Phosphorimager. were switched to phosphate-free Eagles Modi®ed Essential Media containing 0.1% FBS in the absence or presence of 200 mM suramin for 48 h. [32P]orthophosphate was added to each dish (0.1 mCi/ml) 18 h prior to harvesting. Cells were washed twice with ice-cold TBS and lysed in 500 mlof ice-cold 1% CHAPS lysis buer. Ha-ras was immunoprecipitated from the lysates as described previously. Acknowledgements Immunoprecipitates were collected by centrifugation at This work was supported by NIH grant #GM49652 and 48C, washed ®ve times with ice-cold TBS+NP40 and once American Heart Association Established Investigator with ice cold P21 buer (200 mM sucrose, 20 mM MOPS, Award #96001110 to AW. We wish to thank J Lang for

4mM MgCl2,1mM dithiothreitol, pH 7.4). Radiolabelled the photoimaging, CM Weyman for her helpful discussion nucleotides were released from the Ha-ras immunoprecipi- and critical review of the manuscript, and M Cathcart for tates by heating for 5 min at 1008Cin50mlofP21buer her assistance in designing the N-ras oligonucleotides. containing 5 mM EDTA, chilled on ice and centrifuged. TR10 anti-p42/p44 MAPK antibody was a kind gift from 5 ml of eluted nucleotides was spotted onto a PEI-F MJ Weber, Health Sciences Center, University of Virginia. Cellulose thin layer chromatography (TLC) plate and Ki-rasAandKi-rasB bacterial expression vectors were developed using a 0.75 M Tris/0.45 M HCl/0.35 M LiCl generous gifts from BM Willumsen, University of Copen- solvent system. The TLC plate was air-dried and the hagen, Denmark, and RJ Skinner, The Wellcome Research radioactivity associated with the guanine nucleotide spots Laboratories, England, respectively. The N-ras bacterial that co-migrated with GDP and GTP standards visualized expression vector was kindly provided by A Hall, and quantitated using a Molecular Dynamics Phosphor- University College London, England. Wild-type (G12) N- imager. The ratio of Ras bound GTP was expressed as a ras and transforming (Q61K)N-ras expression vectors percentage of total Ras bound guanine nucleotides using (pIBW3NN and pIBW3NT) were a generous gift from A the formula (GTP/GDP+GTP)6100%. Pellicer, NYU Medical Center, New York, NY.

References

Berkowitz EA, Hissong MA and Lee DC. (1996). Oncogene, DiBattiste D, Golubic M, Stacey D and Wolfman A. (1993). 12, 1991 ± 2002. Oncogene, 8, 637 ± 643. Betsholtz C, Johnsson A, Heldin C-H and Westermark B. Downward J, Graves JD, Warne PH, Rayter S and Cantrell (1986). Proc. Natl. Acad. Sci. USA, 83, 6440 ± 6444. DA. (1990). Nature, 346, 719 ± 723. Carbone A, Gusella GL, Radzioch D and Varesio L. (1991). Eckstein F. (1995). Annu. Rev. Biochem., 54, 367 ± 372. Oncogene, 6, 731 ± 737. Feig LA and Cooper GM. (1988). Mol. Cell. Biol., 8, 3235 ± CastelliC,SensiM,LupettiR,MortariniR,PanceriP, 3243. Anichini A and Parmiani G. (1994). Cancer Res., 54, Finney RE, Robbins SM and Bishop MJ. (1993). Curr. Biol., 4785 ± 4790. 3, 805 ± 812. Cox AD, Solski PA, Jordan JD and Der CJ. (1995). Methods Hallberg B, Rayter SI and Downward J. (1994). J. Biol. Enzymology, 255, 195 ± 426. Chem., 269, 3913 ± 3916. Crews CM and Erikson RL. (1993). Cell, 55, 915 ± 920. Herrmann C, Martin GA and Wittinghofer A. (1995). J. Dawson TP, Radulescu A and Wynford-Thomas D. (1995). Biol. Chem., 270, 2901 ± 2905. Cancer. Res., 55, 915 ± 920. Hill CS and Treisman R. (1995). Cell, 80, 199 ± 211. Dent P, Haser W, Haystead TAJ, Vincent LA, Roberts TM, Hofer F, Fields S, Schneider C and Martin GS. (1994). Proc. and Sturgill TW. (1992). Science, 257, 1404 ± 1407. Natl. Acad. Sci. USA, 91, 11089 ± 11093. Dent P, Haser W, Haystead TAJ, Vincent LA, Roberts TM Jaiswal RK, Moodie SA, Wolfman A and Landreth GE. and Sturgill TW. (1992). Mol. Biol. Cell., 4, 483 ± 493. (1994). Mol. Cell. Biol., 14, 6944 ± 6953. Raf-1 associates with c-N-ras alone in Ha-ras transformed cells M Hamilton and A Wolfman 1428 Joneson T, White MA, Wigler MH and Bar-Sagi D. (1996). Pages G, Lenormand P, L'Allemain G, Chambard J-C, Science, 271, 810 ± 812. Meloche S and Pouyssegur J. (1993). Proc. Natl. Acad. Sci. Kehinde EO, Terry TR, Mistry N, Horsburgh T, Dandhu DP USA, 90, 8319 ± 8323. and Bell PRF. (1995). Cancer Surveys, 23, 217 ± 234. Pironin M, Clement G, Benzakour O, Barritault D, Kikuchi A, Demo SD, Ye ZH, Chen YW and Williams LT. Lawrence D and Vigier P. (1992). Int. J. Cancer, 51, (1994). Mol. Cell. Biol., 14, 7483 ± 7491. 980 ± 988. Koide H, Satoh T, Nakafuku M and Kaziro Y. (1993). Proc. Rak J, Mitsuhashi Y, Bayko L, Filmus J, Shirasawa S, Natl. Acad. Sci. USA, 90, 8683 ± 8686. Sasazuki T and Kerbel RS. (1995). Cancer Res., 55, 4575 ± Kolch W, Weissinger E, Mischak H, Troppmair J, Showalter 4580. SD, Lloyd P, Heidecker G and Rapp UR. (1990). Rodenhuis S. (1992). Cancer Biol., 3, 241 ± 247. Oncogene, 5, 713 ± 720. Rodriguez-Viciana P, Warne PH, Dhand R, Vanhaesebroeck Kortenjann M, Thomae O and Shaw PE. (1994). Mol. Cell. B, Gout I, Fry MJ, Water®eld MD and Downward J. Biol., 14, 4815 ± 4824. (1994). Nature, 370, 527 ± 532. Kuriyama M, Harada N, Kuroda S, Yamamoto T, Russell M, Lange-Carter CA and Johnson GL. (1995). J. Nakafuku M, Iwamatsu A, Yamamoto D, Prasad R, Biol. Chem., 270, 11757 ± 11760. Croce C, Canaani E and Kaibuchi K. (1996). J. Biol. Schaap D, van der Wal J, Howe LR, Marshal CJ and van Chem., 271, 607 ± 610. Blitterswijk WJ. (1993). J. Biol. Chem., 268, 20232 ± 20236. Lin L-L, Wartmann M, Lin AY, Knopf JL, Seth A and Davis Shibuya EK, Polverno AJ, Chang E, Wigler M and RJ. (1993). Cell, 72, 269 ± 278. Ruderman JV. (1992). Proc. Natl. Acad. Sci. USA, 89, Lowy DR and Willumsen BM. (1993). Annu. Rev. Biochem., 9831 ± 9835. 62, 851 ± 891. Smith MR, DeGudicibus SJ and Stacey DW. (1986). Nature, Macdonald SG, Crews CM, Wu L, Driller J, Clark R, 320, 540 ± 543. Erikson RL and McCormick F. (1993). Mol. Cell. Biol., Spaargaren M and Bischo JR. (1994). Proc. Natl. Acad. Sci. 13, 6615 ± 6620. USA, 91, 12609 ± 12613. Maher J, Baker DA, Manning M, Dibb NJ and Roberts Stokoe D, Macdonald SG, Cadwallader K, Symons M and IAG. (1995). Oncogene, 11, 1639 ± 1647. Hancock JF. (1994). Science, 264, 1463 ± 1467. Marais R, Light Y, Paterson HF and Marshall CJ. (1995). Stokoe D and McCormick F. (1997). EMBO J., 16, 2384 ± EMBO J., 14, 3136 ± 3145. 2396. McCarthy SA, Samuels ML, Pritchard CA, Abraham JA and Umano H, Edelmann W, Pellicer A and Kucherlapati R. McMahon M. (1995). Genes Dev., 9, 1953 ± 1964. (1995). Proc. Natl. Acad. Sci. USA, 92, 1709 ± 1713. Mineo C, James GL, Smart EJ and Anderson RGW. (1996). Van Aelst L, Barr M, Marcus S, Polverino A and Wigler M. J. Biol. Chem., 271, 11930 ± 11935. (1993). Proc. Natl. Acad. Sci. USA, 90, 6213 ± 6217. Moodie SA, Willumsen BM, Weber MJ and Wolfman A. Vojtek AB, Hollenberg SM and Cooper JA. (1993). Cell, 74, (1993). Science, 260, 1658 ± 1661. 205 ± 214. Moodie SA, Paris MJ, Kolch W and Wolfman A. (1994). White MA, Nicolette C, Minden A, Polverino A, Van Aelst Mol. Cell. Biol., 14, 7153 ± 7162. L, Karin M and Wigler MH. (1995). Cell, 80, 533 ± 541. Moodie SA, Paris M, Villafrance E, Kirshmeier P, Will- Wolfman A and Macara IG. (1990). Science, 248, 67 ± 69. umsen BM and Wolfman A. (1995). Oncogene, 11, 447 ± Wolthius RMF, Bauer B, Veer LJV, Vries-Smith AMM, 454. Cool RH, Spaargaren M, Wittinghofer A, Burgering BMT Mulcahy LS, Smith MR and Stacey DW. (1995). Nature, and Bos JL. (1996). Oncogene, 13, 353 ± 362. 313, 241 ± 243. Xing J, Ginty DD and Greenberg ME. (1996). Science, 273, Okuda K, Ernst TJ and Grith JD. (1994). J. Biol. Chem., 959 ± 963. 269, 24602 ± 24607. Oldham SM, Clark GL, Gangarosa LM, Coey Jr RJ and Der CJ. (1996). Proc. Natl. Acad. Sci. USA, 93, 6294 ± 6298.