Pou2f1 Interact to Control Lens and Olfactory Placode Development ⁎ Amy L

Developmental Biology 303 (2007) 784–799 www.elsevier.com/locate/ydbio

Genomes & Developmental Control Sox2 and Pou2f1 interact to control lens and olfactory placode development ⁎ Amy L. Donner a, , Vasso Episkopou b, Richard L. Maas a

a Division of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA b Mammalian Neurogenesis Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital Campus, Du Cane Rd., London W12 0NN, UK Received for publication 3 July 2006; revised 20 October 2006; accepted 30 October 2006 Available online 6 November 2006

Abstract

Sox2, which encodes an SRY-like HMG box transcription factor, is critical for vertebrate development. Sox2 mediates its transcriptional effects through the formation of complexes with specific co-factors, many of which are unknown. In this report, we identify Oct-1, encoded by the Pou2f1 gene, as a co-factor for Sox2 in the context of mouse lens and nasal placode induction. Oct-1, Sox2, and Pax6 are co-expressed during lens and nasal placode induction and during subsequent developmental stages. Genetic combination of Sox2 and Pou2f1 mutant alleles results in impaired induction of the lens placode, an ocular phenotype that includes anophthalmia, and a complete failure of nasal placode induction. These ocular and nasal phenotypes closely resemble those observed in Pax6 null embryos. Moreover, we identify DNA-binding sites that support the cooperative formation of a complex between Sox2 and Oct-1 and mediate Sox2/Oct-1-dependent transactivation of the Pax6 lens ectoderm enhancer in vitro. We demonstrate that the same Sox- and Octamer-binding sites are essential for Pax6 enhancer activity in the lens placode and its derivatives in transgenic mouse embryos. Collectively, these results indicate that Pou2f1, Sox2 and Pax6 are interdependent components of a molecular pathway utilized in both lens and nasal placode induction. © 2006 Elsevier Inc. All rights reserved.

Keywords: Sox2; Pax6; Pou2f1; Oct-1; Lens placode; Nasal placode; Pre-placode; E-cadherin; Cataract

Introduction al., 2006). In contrast to PPR induction, Bmp signals play a positive role in the induction of the mouse lens placode (Furuta Vertebrate sensory structures, including the lens, ear and and Hogan, 1998; Wawersik et al., 1999). Several transcription nose, develop through multi-step inductive processes that factor families including Six, Eya, Pax, Pitx, Msx and Sox are involve the formation of a neural plate stage pre-placodal expressed in and important for the formation of all placodes region (PPR) and the subsequent formation of discrete (reviewed in Streit, 2004; Bhattacharyya and Bronner-Fraser, ectodermal thickenings called placodes (reviewed in Streit, 2004; Brugmann and Moody, 2005; Schlosser, 2006). Thus, 2004; Bhattacharyya and Bronner-Fraser, 2004; Brugmann and while many molecules critical for sensory placode induction Moody, 2005; Schlosser, 2006). Induction of the PPR in chick have been identified, detailed molecular mechanisms that and Xenopus is dependent upon Fgf signaling and attenuation control different stages of placode induction, particularly in of Wnt and Bmp signaling (Litsiou et al., 2005; Ahrens and mammals, are still not fully understood. Schlosser, 2005). Similarly, Fgf signals are required for the Sox2, a Group B1 SRY-related HMG box containing trans- induction of the individual sensory placodes (Faber et al., 2001; cription factor, has emerged as an important factor in vertebrate Phillips et al., 2004; Martin and Groves, 2005; Ladher et al., sensory development (Dong et al., 2002; Fantes et al., 2003; 2005; Bailey et al., 2006), while Wnt signaling is required for Kiernan et al., 2005; Ragge et al., 2005; Hagstrom et al., appropriate placode placement (Smith et al., 2005; Ohyama et 2005; Taranova et al., 2006). While Sox2 is not expressed in the early PPR (Wood and Episkopou, 1999), it is expressed in the distinct lens, nasal, and otic placodes (Kamachi et al., ⁎ Corresponding author. Fax: +1 617 525 4751. 1998; Wood and Episkopou, 1999). Disruption of Sox2 E-mail address: [email protected] (A.L. Donner). expression in the mouse otocyst disrupts formation of the ear

0012-1606/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2006.10.047 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 785 prosensory domain and severely disrupts inner ear develop- reporter gene in pGL2. pcDNA3 (Invitrogen) was added to standardize the ment (Kiernan et al., 2005). In the chick lens, Sox2 cooperates concentration of DNA in each experiment. 50 ng of phRL-CMV (Promega) was included for standardization of the transfection efficiency. Cell lysates were with Pax6 to regulate crystallin gene expression (Kamachi et assayed for firefly and renilla luciferase activity on a Veritas Microplate al., 2001), and mutation of SOX2 in humans results in severe Luminometer using the Dual-Luciferase Reporter System (Promega). Each eye phenotypes ranging from microphthalmia to anophthalmia experiment was performed in triplicate and the data illustrated are the average of (Fantes et al., 2003; Ragge et al., 2005; Zenteno et al., 2005; at least three experiments. Fold induction is the ratio of luciferase activity Hagstrom et al., 2005). detected in experiments containing pGL109 or its derivatives versus comparable experiments with pGL2. As with other Sox family members, Sox2 requires co-factors to mediate transcriptional control over its targets (reviewed in DNA constructs Kamachi et al., 2000). Two Sox2 co-factor families have been identified, the paired-type homeodomain containing family The plasmid pETSox2-HMG was constructed by PCR amplification of the (Pax), and members of the POU family (Ambrosetti et al., 1997; HMG domain from Sox2, from pCMVSox2 (Ambrosetti et al., 1997). The PCR Botquin et al., 1998; Nishimoto et al., 1999; Ma et al., 2000; product was subcloned into pETBlue-1 (Novagen). Oct1-GST was generated by Kamachi et al., 2001; Di Rocco et al., 2001; Aota et al., 2003; PCR amplification of the POU domain (POUS-linker-POUHD) from pCGOct-1 (Tanaka and Herr, 1990) and subcloning into pGEX-3X (Amersham Pharmacia) Tanaka et al., 2004; Rodda et al., 2005; Okumura-Nakanishi et in frame with GST. Sox and POU mutant transgenic constructs were generated al., 2005). In the context of placode formation, however, the co- by PCR mutagenesis of pLNGLKS (Zhang et al., 2002) using the Quick factors that interact with Sox2 are unknown. Change™ Site-Directed Mutagenesis Kit (Stratagene) following the manufac- Here, we identify Oct-1 as a Sox2 co-factor in the context of turer's instructions. murine lens and nasal placode induction. We demonstrate that Oct-1, Sox2 and Pax6 are co-expressed in cells of the nasal and Mouse genetics lens placodes, and that compound mutations in Pou2f1 and All mouse work was performed in accordance with protocols approved by Sox2 disrupt lens and nasal morphogenesis while isolated the Harvard Animal Care and Usage Committee. Oct-1+/− mice were mutation of Pou2f1 or Sox2 does not. We provide in vitro maintained on a C57BL/6 background (Wang et al., 2004), while Sox2βgeo2 biochemical evidence that Sox2 and Oct-1 synergistically and Pax61-NeuSey mice were maintained on a C3H/HeN background (Ekonomou β − activate expression of Pax6 by cooperatively binding to the et al., 2005). Sox2 geo/+ mice were interbred with Oct-1+/ mice to generate Pax6 lens ectoderm enhancer (EE). Furthermore, we show Oct-1/Sox2 compound mutants. Double heterozygous offspring from these matings were interbred. Appropriately staged embryos and their extra- that the same Sox and Octamer DNA-binding sites are required embryonic tissues were collected, and genomic DNA from extra-embryonic for Pax6 lens enhancer activity during embryogenesis in tissue was screened by PCR (Nishiguchi et al., 1998; Wang et al., 2004; transgenic mouse models. Thus, compromised Pax6 expression Ekonomou et al., 2005). The Pax61-NeuSey allele was identified by a PCR likely accounts for the failure of lens and nasal placode fragment polymorphism producing a HincII restriction site. induction in Oct-1−/−, Sox2+/− embryos. These data are Transgenic mice were generated by standard methods (Nagy et al., 2003). Staged embryos were collected and stained for β-galactosidase activity (Nagy et consistent with common molecular mechanisms controlling al., 2003). Extra-embryonic tissue from transgenic embryos was processed for Pax6 expression during lens and nasal placode induction. genomic DNA preparation (Nagy et al., 2003). DNA was genotyped by PCR with primers specific to the LacZ gene. β-Galactosidase-positive embryos were Materials and methods dehydrated, embedded in wax, and sectioned (10 μM, transverse plane) with a microtome. Sections were counterstained briefly with hematoxylin or eosin, Cell culture and RT-PCR mounted, and photographed on a Zeiss Axiophot microscope with a Leica DFC300 digital camera. The rabbit lens epithelial cell lines B3, LEP2, and N/N1003A were cultured in DMEM supplemented with 10% rabbit serum and penicillin/streptomycin. Cells Immunofluorescence and in situ hybridization were harvested and total RNA isolated utilizing Qiagen RNeasy® Kits according to the manufacturer's instructions. RNA from E13.5 eyes was screened for Pou2 genes For all paraffin processing, embryos were fixed overnight in 4% using the degenerate primers POU2FF 5′-AGTTYGCYMRSACYTTCAARCA paraformaldehyde (PFA), washed in 1× PBS, dehydrated, and embedded in and POU2FR 5′-GTCRTTKCCATABARYTTBCCC. Specific primers for Sox2 wax. 8–10 μM transverse sections were cut on a microtome. For all frozen (SOX2LRT 5′-CACAACTCGGAGATCAGCAA and SOX2RRT 5′- sections, embryos were fixed for 1 h in 4% PFA, equilibrated in 30% sucrose, CTCCGGGAAGCGTGTACTTA); Pax6 (PAX6LRT 5′-GCAGATG- and frozen in OCT (Tissue-Tek). 10 μm transverse sections were cut on a CAAAAGTCCAGGT and PAX6RRT 5′-TTCCCAAGCAAAGATGGAAG; cryostat (Leica CM1900). Pou2f1/Oct-1 (POU2F1 5′-GCTCTTGCTTCTAGTGGCTCT and POU2R1 5′- Pax6 immunofluorescence was performed on frozen sections as described TGAAACTCTTCTCTAAGGCC); Pou2f2/Oct-2 (OCT2F 5′-CAAGCCTAC- (Purcelletal.,2005). Antibody staining for Sox2 (Chemicon International, 1:500), CCAGCCCAAAC and OCT2R 5′-GAAGCGGACA TTCGTCTCGA); and Oct-1 (Santa Cruz, 1:200), and E-cadherin (Zymed®, 1:1000) were performed on Pou5f1/Oct-3 (POU5FF 5′-GAGTCCCAGGACATGAAAGC and POU5FR 5′- frozen sections. Detection of Pax6, Oct-1, and Sox2 was enhanced by boiling in AGATGGTGGTCTGGCTGAAC) were utilized for RT-PCR on RNA from lens VECTOR® Antigen Unmasking Solution (for data on the specificity of the Oct-1 epithelial cell cultures. RT-PCR was performed using Superscript™ One-Step RT- and E-cadherin antibodies, see Fig. S3). Indirect visualization for all immunolo- PCR with Platinum® Taq according to the manufacturer's instructions (Invitrogen). calization was achieved using secondary antibodies with fluorescent conjugates. Mouse lens epithelial cells (17EM15, 21EM1, αTN4) and 293t cells were These antibodies included anti-rabbit, anti-mouse, anti-rat Cy3 (Jackson grown in DMEM supplemented with 10% fetal calf serum and penicillin/ Immunologicals, 1:500) and anti-rabbit Alexa-Fluor 488 (Molecular Probes, streptomycin. Cells were transfected at 70% confluence with FuGENE 6 1:700). All fluorescent sections were mounted with Vectashield® plus DAPI (Roche) in 12-well plates. Sox2 (Ambrosetti et al., 1997) (100 ng, 200 ng, (Vector Laboratories) and visualized on a Zeiss Axiophot microscope. A Leica 400 ng) and Oct-1 (Tanaka and Herr, 1990) (200 ng, 400 ng, 800 ng) expressing DFC350F Digital Camera was used to record images. plasmids were titrated in the presence of pGL2 (Promega) or pGL109, which In situ hybridization using DIG-labeled RNA probes was performed using contains the 109-bp minimal element of the Pax6 EE upstream of the luciferase standard procedures (Nagy et al., 2003). Alkaline phosphatase activity was 786 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 detected with the substrate NBT/BCIP. Post-fixed embryos and sections were the lens placode (Figs. 3A–C), while Oct-1 protein was photographed using a Leica DFC300 Digital Camera. expressed in the ocular and peri-ocular region including the lens placode (Fig. 3G). Sox2 and Pax6 remained co-expressed Protein purification and EMSAs throughout placode invagination and lens vesicle formation – The Sox2-HMG domain and Oct1-GST were purified from E. coli as (Figs. 3D F) until Sox2 was down-regulated at E12.5 described (Van Houte et al., 1995; Klemm et al., 1994). Each recombinant protein was greater than 90% pure on Coomassie blue stained gels. EMSAs were performed by pre-incubating pure proteins with cold, competitor oligonucleo- tides or antibody in 20 mM HEPES, pH 7.8; 10 mM EDTA, pH 8.0; 1 mM DTT;

2 mM MgCl2; 50 mM NaCl; 5% glycerol; and 50 ng/μL poly dG–dC. After addition of radiolabeled probes, reactions were loaded onto a running 8% native PAGE gel at 4°C. After resolution, gels were dried, exposed to film (Kodak XAR), and developed using an X-OMAT film processor. Titration of Sox2- HMG onto EE-3 began at 63 nM and increased in 1.5-fold concentration steps. For cooperative binding studies, the initial concentration of Oct1-GST was 15 nM and increased 1.2-fold in each subsequent lane. The concentration of

Sox2-HMG was 328 nM. For IC50 ratio calculations, Sox2-HMG (328 nM) was incubated with cold competitor and radiolabeled EE-3 at ratios ranging from

0.1× to 100×. For IC50 ratio and cooperativity calculations, gels were analyzed using a Phosphor Imager (Molecular Dynamics) (for representative EMSAs see Fig. S6).

Results

Sox2, Pax6, and Pou2f1 are co-expressed in developing lens and nasal placodes

To identify potential POU family co-factors for Sox2 in the lens, we performed RT-PCR on total RNA collected from E13.5 wild-type eyes and from several lens epithelial cell lines (Fig. S1). This screen identified Pou2f1, which encodes the Oct-1 protein, as a candidate POU co-factor for Sox2 in the lens. Interestingly, Pou5f1, which encodes Oct-3, a known Sox2 interacting factor (Ambrosetti et al., 1997) was not detected in lens epithelial cells (Fig. S1). To determine the in vivo relationship amongst Sox2, Pax6 and Pou2f1, we examined their expression at pre-placodal stages. Pax6, Sox2, and Pou2f1 were broadly expressed in the E8.5 embryonic head (Figs. 1A–F). Upon cross-section, Pou2f1 expression was detected in neural ectoderm (Fig. 1E′) and resembled that reported for both Pax6 and Sox2 at this time (Grindley et al., 1995; Wood and Episkopou, 1999). To definitely determine the relative onset of Pax6, Sox2 and Oct-1 expression in the presumptive lens ectoderm (PLE), we performed immunofluorescence on mouse embryos staged between 12 and 17 somites (E8.5). Pax6 protein was already observed in the PLE at the 12-somite stage and its expression was maintained in all subsequent stages (Figs. 2A–C). Sox2, on the other hand, was not detected at the 12-somite stage in the PLE (Fig. 2D). Sox2 protein was first detected in the PLE at the 15-somite stage and was maintained through subsequent pre- placodal stages (Figs. 2E–F). Similar to Sox2, Oct-1 was not detected in the PLE at the 12-somite stage, but was expressed by the 15-somite stage and maintained through subsequent stages (Figs. 2G–I). Thus, Pax6 expression precedes both Sox2 and Fig. 1. Pax6, Sox2, and Pou2f1 are broadly co-expressed in anterior pre-placode – – Oct-1 in the PLE. stage E8.5 embryos. Whole mount in situ analysis of Pax6 (A B), Sox2 (C D) and Pou2f1 (E–F) in E8.5 embryos displayed in a frontal view (A, C, E), lateral We next evaluated Pax6, Sox2 and Oct-1 protein expression view (B, D, F), or in cross-section (E′). The white line in panel E indicates plane in the lens placode and during early lens differentiation (Figs. of section for panel E′. Abbreviations: nf, neural folds; ov, optic vesicle; se, 3A–I). At E9.5, Sox2 and Pax6 were strongly co-expressed in surface ectoderm. Scale bars: 100 μm in all figures. A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 787

(Nishiguchi et al., 1998; Kamachi et al., 1998). At E11.5, Oct-1 expression was excluded from the peri-ocular region but maintained in the lens vesicle (Fig. 3H). At E13.5, Oct-1 expression was down-regulated in lens fiber cell nuclei but maintained in the anterior epithelial layer (AEL) (Fig. 3I). Thus, Pax6, Sox2 and Oct-1 are expressed in the developing lens until epithelial and fiber cells differentiate. Upon differentiation, Sox2 expression is down-regulated throughout the lens, while Oct-1 and Pax6 expression are maintained in the AEL and down-regulated in the fiber cells of the posterior lens. We also evaluated the expression of Sox2, Oct-1 and Pax6 proteins during nasal placode induction and early nasal morphogenesis (Figs. 4A–L). Pax6, Sox2, and Oct-1 were all expressed in the nasal placode at E9.0 (Figs. 4A–C). Thereafter, all three proteins continued to be expressed in most cells of the nasal pit (Figs. 4D–F) and in early derivatives of the placode, including the nasal epithelium and the developing vomero nasal organ (VNO) (Figs. 4G–L). Thus, similar to the lens, Pax6, Oct-1 and Sox2 are co-expressed in the nasal placode, during nasal pit formation and in early nasal placode derivatives.

Pou2f1 and Sox2 loss-of-function alleles interact genetically in lens development

To determine if Sox2 affects lens placode induction and early lens morphogenesis in cooperation with either Pax6 or Oct-1, we genetically compounded Pax6Sey/+ and Sox2βgeo2/+ mice and Oct1+/− and Sox2βgeo2/+ mice (Wang et al., 2004; Ekonomou et al., 2005). Early embryonic lethality in Sox2 null mice precluded our assessment of lens placode induction in the Sox2 null state (Avilion et al., 2003). Sox2+/−, Pax6Sey/+ compound embryos, from E9.5 to E13.5, had patterns of Pax6 Fig. 2. Pax6 precedes Sox2 and Oct-1 in the PLE. Immunofluorescence for Pax6 lens expression that were indistinguishable from those in (red, A–C), Sox2 (green, D–F), and Oct-1 (red, G–I) are shown for embryos at +/− Sey/+ Sox2 or Pax6 lenses (Fig. S2). While lens dysmor- the 12-somite (s) (A, D, G), 15s (B, E, H), or 17s stages (C, F, I). Arrows highlight phology due to reduced Pax6 gene dosage was evident in nuclei positive for Sox2 or Oct-1 expression in the PLE. Abbreviations: OV,optic both Pax6Sey/+ and Sox2+/−, Pax6Sey/+ lenses from E11.5, vesicle; PLE, presumptive lens epithelium. Sox2+/−, Pax6Sey/+ lenses were no more severely affected than Pax6Sey/+ lenses (Fig. S2). Thus, superposition of Sox2βgeo2 heterozygosity does not exacerbate the Pax6Sey/+ Severely affected Sox2/Oct-1 compound mutants have lens phenotype. While Sox2 and Pax6 are co-expressed in the anophthalmia PLE from the 15-somite stage through early lens morphogenesis, no genetic interaction between Pax61-NeuSey and Sox2- We next evaluated lens placode induction and early lens alleles was detected. development in Oct-1−/− and Oct-1−/−, Sox2+/− embryos (Figs. Since Oct-1 expression coincides with that of Sox2, we 5A–I) up to E12.5, since Oct-1−/− embryos begin to die at this next tested whether Sox2 and Pou2f1 are important for lens stage (Wang et al., 2004). At E10.5, Oct-1−/− lenses had normal placode induction and early lens morphogenesis by inter- morphology but were occasionally small (Figs. 5A–B), crossing Oct1+/− (Wang et al., 2004) and Sox2βgeo2/+ mice reflecting the reduced size of Oct-1−/− embryos (Wang et al., (Ekonomou et al., 2005). From E9.5 to E11.5, Oct-1+/−, Sox2+/− 2004). In contrast, Oct-1−/−, Sox2+/− lenses exhibited a variable embryos exhibited grossly normal lens morphology and normal phenotype that ranged from small lenses to a complete failure of patterns of Pax6 expression (Fig. S2). However, unlike either lens induction (Figs. 5C, F). The variable phenotype in Sox2+/− or Oct-1+/− mice, 100% (n=9) of Oct-1+/−,Sox2+/− Oct-1−/−, Sox2+/− lens induction occurred in the same animal, double heterozygotes developed cataracts by 6 weeks of age (Fig. and therefore did not reflect different genetic backgrounds. S2). Thus, similar to Pax6Sey/+ mice, Oct-1+/−, Sox2+/− Mildly affected Oct-1−/−, Sox2+/− lenses resembled those of compound mutant mice exhibit a discrete late defect in lens Pax6Sey/+ (Figs. 5C–D), whereas the entire peri-ocular region development, whereas mice heterozygous for either mutation of severely affected Oct-1−/−, Sox2+/− embryos resembled alone do not. that in Pax6Sey/Sey embryos (Figs. 5E–F). At E12.5, Oct-1+/−, 788 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799

Fig. 3. Sox2, Pax6 and Oct-1 are co-expressed during lens placode induction and early eye morphogenesis. Immunofluorescence and nuclear co-localization (DAPI, blue) of Pax6 (red, A, C, D, F), Sox2 (green, B–C, E–F), and Oct-1 (red, G–I) at E9.5 (A–C, G), E11.5 (D–F, H) and E13.5 (I) in the ocular region. (For Oct-1 antibody controls, see Fig. S3). Abbreviations: ael, anterior epithelial layer; fc, fiber cell compartment; lp, lens placode; lv, lens vesicle; nr, neural retina; ov, optic vesicle.

Sox2+/− lenses were normal (Fig. 5G), while Oct-1−/−, Sox2+/− ectoderm, while E-cadherin was maintained (Figs. 6J–L). These lenses were small and dysmorphic or absent (Figs. 5H–I). data indicate that, while the surface ectoderm was intact, lens Reciprocal signaling between the PLE and the optic vesicle placode induction failed. (OV) is an integral part of early eye development and depends The ocular regions of severely affected Oct-1−/−, Sox2+/− upon the close physical apposition of OV to PLE. The embryos, including the lens and OV, closely resembled those of apposition of OV to PLE appears normal even in severely Pax6Sey/Sey embryos in both morphology and marker expression effected Oct-1−/−, Sox2+/− eyes (Fig. 5F), thus failed physical (Figs. 6J–O). Pax6 expression in the surface ectoderm was lost association between the OV with the PLE does not cause the in both mouse models (Figs. 6J, M), and Sox2 expression was observed anophthalmic phenotypes. absent from the surface ectoderm and the distal OV (Figs. 6L, To better understand the defects in Oct-1−/−, Sox2+/− lenses, O, arrow heads). Thus, while lens placode induction and we evaluated the expression of the lens and surface ectoderm subsequent lens morphogenesis appear normal in Sox2+/− and markers Pax6, E-cadherin and Sox2 (Figs. 6A–O). At E10.5, Oct1−/− embryos, Oct1−/−, Sox2+/− embryos have severe Oct-1−/− lenses had normal patterns of Pax6, E-cadherin, and defects in lens placode induction that closely resemble those Sox2 expression (Figs. 6A–C, see also Fig. S3). In contrast, in Pax6Sey/Sey mutants. Oct-1−/−, Sox2+/− embryos exhibited disrupted marker expres- Since Oct-1 and Sox2 are both expressed in the OV and the sion (Figs. 6G–L). In mildly affected eyes, a small domain- ocular defects in Oct-1−/−, Sox2+/− embryos include altered positive for all three markers was observed separate from the expression of Pax6 and Sox2 in the distal OV (see above), it is surface ectoderm, indicating the presence of a small lens possible that defects in lens placode induction can be primordium (Figs. 6G–I, circles). In severely affected eyes, exacerbated by defects in the OV. To evaluate the integrity Pax6 and Sox2 expressions were both absent from the surface of the OV we performed in situ hybridization for Six3 (Figs. A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 789

Fig. 4. Sox2, Pax6 and Oct-1 are co-expressed in the nasal placode, nasal epithelium and vomero nasal organ (VNO). Immunofluorescence and nuclear co-localization (DAPI, blue, D–F) of Pax6 (red, A, D) (green G, J), Sox2 (green, B, E, H, K), and Oct-1 (red, C, F, I, L) at E9.0 (A–C), E10.5 (D–F) and E12.5 (G–L). Abbreviations: ne, nasal epithelium; np, nasal placode; npt, nasal pit; p-lp, pre-lens placode; vno, vomero nasal organ.

S5A–B) and secreted Frizzled-related protein 2 (sFrp2) (Figs. heads of Oct-1−/− and Sox2+/− embryos were indistinguish- S5C–D), which are important for formation of the retinal able from wild-type embryos (data not shown), the heads of anlage and influence the neural potential of the retina, Oct-1−/−, Sox2+/− embryos were abnormal (Figs. 7A–E). In respectively (Lagutin et al., 2001; Carl et al., 2002; Esteve et E10.5 wild-type embryos, the ocular region and nasal pits al., 2003; Van Raay et al., 2005). Expression of both Six3 and were clearly visible (Figs. 7A, E). In contrast, Oct-1−/−, sFrp2 expression in the Oct-1−/−, Sox2+/− OV were main- Sox2+/− embryos had no observable nasal pits and the tained, while Six3 transcripts were absent from the surface ocular region was either not evident (Fig. 7C) or shifted ectoderm (Fig. S5B). Thus, while the Oct-1−/−, Sox2+/− towards the anterior (Figs. 7B, D–E). mutant OV is abnormal, the expression of some genes Given the abnormal head and placode appearance, we important for retinal development is maintained. evaluated nasal placode induction and early nasal morphogenesis in Oct-1−/− and Oct-1−/−, Sox2+/− embryos (Figs. 7F–O). Nasal placode induction fails in Sox2/Oct-1 compound mouse In Oct-1−/− mice, nasal placodes were induced and Pax6 and mutants Sox2 expression were normal (Figs. 7F–G). Unlike Oct-1−/− mice, however, Oct-1−/−, Sox2+/− embryos had neither Additional evidence that Sox2 and Pou2f1 act synergistically detectable nasal placodes nor detectable Pax6 expression to control placode induction was obtained by evaluating (Fig. 7I). Sox2 expression was also lost in Oct-1−/−, Sox2+/− Oct-1−/−, Sox2+/− embryonic heads at E10.5. While the embryos (Fig. 7K). The lack of nasal placodes combined with 790 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799

Fig. 5. Compound Oct1−/−, Sox2+/− mutant embryos display severe ocular defects. Histological analyses of E10.5 wild-type (A), Oct1−/− (B), Oct1−/−, Sox2+/− (C, F), Pax6Sey/+ (D) and Pax6Sey/Sey (E) embryos. Histological analyses of E12.5 Oct+/−, Sox2+/− (G) and Oct1−/−, Sox2+/− (H–I) embryos. Asterisk (*) in panel C indicates lens primordium (see Fig. 6) and asterisk (*) in panel I indicates a lack of lens tissue (see Fig. S4 for marker analyses). Abbreviations: ael, anterior epithelial layer; fc, fiber cell compartment; pt, lens pit; nr, neural retina; ov, optic vesicle; se surface ectoderm. the loss of Pax6 and Sox2 expression was similarly observed 1994; Grindley et al., 1995; Sisodiya et al., 2001). Two Pax6 in Pax6Sey/Sey embryos (Figs. 7H, J). Thus, the nasal ectoderm lens enhancers, the ectoderm enhancer (EE) and the SIMO of Oct-1−/−, Sox2+/− embryos resembles that of Pax6Sey/Sey enhancer, have been identified (Williams et al., 1998; embryos. Unlike the variable phenotype observed in the lens Kammandel et al., 1999, Kleinjan et al., 2001)(Fig. 8A). placodes of Oct-1−/−, Sox2+/− embryos, however, nasal Moreover, while Aota et al. (2003) previously identified three placodes were never detected. Sox-binding sites in the EE (Table 1A–B, Sox sites A–C), our To confirm that nasal placode induction completely failed, analysis of the sequence in and around these Sox sites also we assessed Oct-1−/−, Sox2+/− embryos at E12.5 for nasal revealed the presence of a nearly perfect octamer element (5′- placode derivatives. Although E-cadherin was uniformly ATTCAAAT-3′) which overlaps with Sox site C (Table 1A–B, expressed throughout the nasal epithelium and developing Octamer). VNO in Oct-1+/−, Sox2+/− and Pax6Sey/+ embryos (Figs. To confirm that Sox2 protein binds the EE, we purified the 7L–M), no E-cadherin expression was detected in Oct-1−/−, HMG domain of Sox2, Sox2-HMG, and titrated it onto an EE Sox2+/− or Pax6Sey/Sey embryos (Figs. 7N–O). Thus, similar subfragment, EE-3, in EMSAs (Table 1B). These experiments to Pax6Sey/Sey embryos, the induction of the nasal placodes demonstrated that at least two Sox HMG domains could fails and all nasal placode derivatives are absent in Oct-1−/−, simultaneously occupy the Sox sites in the EE, with occupation Sox2+/− embryos. of the second binding site producing a slower migrating dimeric complex (Fig. 8B, lanes 1–16). Thus, Sox2 can directly bind The Pax6 EE contains Sox2 and Oct-1-binding sites multiple sites in the EE. To test the ability of the Octamer element to bind Oct-1, we Given the severity of the Oct-1−/−, Sox2+/− eye and nasal performed EMSAs with the POU domain of Oct-1 fused to phenotypes, we hypothesized that Sox2 and Oct1 act GST, Oct1-GST (Fig. 8B, lanes 17–20). The combination of cooperatively to control the expression of genes required for Oct1-GST and probe EE-3 resulted in the formation of a specific lens and nasal placode induction. Given the similarity between protein–DNA complex. The specificity of this protein–DNA the phenotype of Oct-1−/−, Sox2+/− and Pax6Sey/Sey embryos, interaction was demonstrated with an antibody specific to Oct-1 an obvious candidate for such regulation is Pax6 (Hogan et that produced a weak super-shift complex (SS) and largely al., 1988; Hill et al., 1991; Glaser et al., 1994; Hanson et al., eliminated the Oct1-GST-EE3 protein–DNA complex (Fig. 8B, A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 791

Fig. 6. Lens placode induction fails in severely affected Oct1−/−, Sox2+/− embryos. Immunofluorescence of E10.5 Oct1−/− (A–C), Pax6Sey/+ (D–F), Oct1−/−, Sox2+/− (G–L), and Pax6Sey/Sey (M–O) embryos for Pax6 (green, A, D, G, J, M), E-cadherin (red, B, E, H, K, N), and Sox2 (green, C, F, I, L, O). DAPI nuclear stain is blue. Circles indicate small lenses. Asterisk (*) in panels J and M indicate non-specific Pax6 antibody staining in embryos that have lost Pax6 expression. Arrowheads in panels L and O indicate the domain devoid of Sox2 expression in the distal OV, while the arrows in panels J–L indicate the surface ectoderm. Abbreviations: pt, lens pit; nr, neural retina; ov, optic vesicle; se, surface ectoderm. lanes 18–19). In contrast, an antibody against the related POU of Oct-3 and an interaction between Sox2-HMG and the Oct-1 factor, Brn3a, had no affect on protein–DNA complex POU domain in the absence of DNA (Ambrosetti et al., 1997). formation (Fig. 8B, lane 20). EMSAs in which Oct1-GST was titrated onto EE-3 alone or in We also tested whether Sox2 and Oct-1 bound the EE the presence of constant amounts Sox2-HMG were performed cooperatively. Previous reports have demonstrated both coop- (Fig. 8C). The concentration of Sox2-HMG utilized was erative DNA binding between Sox2-HMG and the POU domain sufficient to bind the EE-3 as a monomer in the absence of 792 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799

Fig. 7. Nasal placode induction fails in Oct1−/−, Sox2+/− mutant embryos. (A–D) Photographs of the heads of E10.5 wild-type (A), or Oct1−/−, Sox2+/− mutant embryos (B– D). (E) Diagram illustrating inappropriate location of a small lens placode in an Oct1−/−, Sox2+/− embryo between the normal sites of lens and nasal placode formation. Immunofluorescence for Pax6 (red, F) and Sox2 (green, G) overlaid with DAPI (blue, F–G) in Oct1−/− E10.5 nasal pits. Immunofluorescence for E10.5 Pax6 (red, H–I), Sox2 (green, J–K), and E-cadherin (red, J–K) in Pax6Sey/Sey (H, J) and Oct1−/−, Sox2+/− (I, K) embryos. DAPI nuclear stain is blue (H–J). (L–O) Epithelial derivatives of the nasal placode are absent at E12.5. E-cadherin (red, L–O) immunofluorescence is shown with DAPI nuclear stain for Oct1+/−,Sox2+/− (L), Pax6Sey/+ (M), Oct1−/−, Sox2+/− (N), and Pax6Sey/Sey (O) embryos. Abbreviations: lp, lens placode; ne, nasal epithelium; npt, nasal pit; tg, tongue; vno, vomero nasal organ.

Oct1-GST (Fig. 8C, lane 9). As the concentration of Oct1-GST minimally a duplex site, DNA mutations that affect Sox2 increased in the presence of Sox2, an Oct-1/Sox2 complex of binding had to be identified empirically. This was particularly extremely slow mobility became increasingly abundant (Fig. critical given the overlap between Sox Site C and the Octamer 8C, lanes 10–15). The amount of complex formation in the element (Table 1A–B). Based on the single site in vitro presence of both Oct-1 and Sox2 exceeded the sum of the selection data of Mertin et al. (1999), a series of oligonucleo- complexes formed when Oct-1 and Sox2 were incubated with tides containing mutations in and around the Sox sites in EE-3 EE-3 separately. Thus, in vitro, Oct-1 and Sox2 bind the EE in a were generated (Table 1C). The simplest mutations were single positively cooperative manner. nucleotide substitutions at position 4 of Sox-binding sites A and B(Table 1C, SOXAM4 and SOXBM4). DM4 combined these Mutations in Sox- and Octamer-binding sites disrupt complex two position 4 mutations (Table 1C), while SOXX contained formation on the Pax6 EE two mutations in each of the same two Sox-binding sites (Table 1C). In EE-3C, the central region where the Sox sites A and B To test the importance of the Sox and Octamer DNA-binding overlap was altered, while the mutant EE-3E obliterated the sites for the activity of the EE in vivo, we first analyzed the center of Sox Site C. ability of specific EE mutants to eliminate or weaken Sox2 and Each mutant Sox site was tested in the form of an Oct-1 binding in vitro. Since the Sox2-binding site in the EE is unlabeled competitor DNA for its ability to disrupt A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 793

Fig. 8. Sox2 and Oct-1 proteins interact cooperatively with the Pax6 EE. (A) Schematic representation of Pax6 showing the two major promoters (P0,P1), the 5′ ectoderm enhancer (EE) and the 3′ SIMO lens enhancer. (B) Purified Sox2-HMG protein forms monomeric and dimeric protein–DNA complexes when titrated onto radiolabeled EE-3 (for sequence, see Table 1B) in EMSA (lanes 1–16). Purified Oct1-GST forms a protein–DNA complex with EE-3 (Oct1). This complex is diminished and super-shifted (SS) by an Oct-1 specific antibody (lanes 18–19) but unaffected by a Brn3a antibody (lane 20). (C) Titration of Oct1-GST onto EE-3 in the absence (lanes 1–8) or presence of constant amounts of Sox2-HMG protein (lanes 9–15). Shifts due to Oct1-GST binding (Oct1), Sox2-HMG (Sox2) and the co- complex (Oct1/Sox2) are indicated. monomeric Sox2 complex formation on wild-type EE-3 We also tested the importance of sequences in the Octamer probe in EMSAs. The molar ratio of cold mutant competitor element for Oct1-GST-EE protein–DNA complex formation by to radiolabeled EE-3 at which 50% of the shifted complex mutating nucleotides necessary for Oct-1 protein–DNA inter- was lost was defined as the IC50 ratio (Table 2: for the action (Di Rocco et al., 2001)(Table 1C). As expected, representative EMSAs, see Fig. S6). The number of Sox site mutation of either the POU-specific (POUS, OCTPM) or POU- nucleotide substitutions correlated directly with decreased homeodomain (POUHD, OCTHM) DNA recognition sites competitor function in EMSA (Table 2). Mutation of Sox site dramatically reduced complex formation in competitive C, in EE-3E, had no effect on the affinity of Sox2-HMG for EMSAs (Fig. S6). the EE-3 subfragment (Table 2). This is consistent with the observation of Aota et al. (2003) that Sox site C did not Sox2 and Oct-1 synergistically transactivate the Pax6 EE contribute to Sox-dependent transactivation of the EE in cell culture. Thus, we discounted the Sox site C as a candidate Consistent with the observations of Aota et al. (2003) and Sox2-binding site. Zhang et al. (2002), the introduction of the minimal 109-bp 794 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799

Table 1 Table 2

Sequences of EE subfragments, consensus binding sites, EMSA probes, IC50 ratios for Sox2-HMG and EE-3 variants luciferase mutants and transgenic constructs Competitor IC50 ratio EE-3 4 EE-3E 5 SOXAM4 48 SOXBM4 21 DM4 52 SOXX 41 EE-3C 56

Oct-1 having a slightly synergistic effect on Pax6 EE activity. To ensure that the observed transcriptional activation was dependent upon the Sox and Octamer elements identified herein, we utilized two mutant luciferase constructs, SOXX and OCTX (Fig 9, see also Table 1C). SOXX, derived from pGL109, has the same sequence substitutions as the SOXX mutation described for IC50 ratio calculations. OCTX is similarly derived from pGL109, but contains 4-bp substitutions (two in each half-site of the Octamer element, Table 1C). Transcriptional activation in the presence of Sox2 and Oct-1, individually or in combination was compromised on both of these altered enhancers. Indeed, Sox2-dependent activation of the EE was largely abolished by mutation of either the Sox sequence (maximum activation 1.5-fold) or the Octamer element (maximum activation 1.5-fold) (Fig. 9,OCTX), *Wild-type sequence is lower case, while mutated nucleotides are upper case indicating that Sox2-dependent activation, in the absence of and bold. any exogenous Oct-1, is dependent upon the presence of an 1Identified herein. 2Aota et al. (2003).

Pax6 EE upstream of the luciferase gene in cell culture experiments results in transcriptional repression compared to controls. We observed transcriptional repression in each of the lens epithelial cell lines tested 17EM15, 21EM1, αTN4, B3, N/ N1003A, and LEP2 (data not shown). The strong repression mediated by the Pax6 EE forced the evaluation of the Pax6- and Sox2-binding sites out of context of the EE (Aota et al., 2003) and the analysis of the Meis-binding site with a fusion protein containing the exogenous transcriptional activation domain from VP16 (Zhang et al., 2002). While both of these approaches were useful in providing information about the regulation of the EE, we believe they limit the value of a cell culture system in representing in vivo interactions. Since there is no cell culture model that accurately recapitulates lens placode induction, we utilized a non-lens epithelial cell line, 293t, in which EE109 is weakly repressed compared to controls (0.8-fold). This allowed us to assess transcriptional activation in the context of the endogenous enhancer and eliminated the need for a non-native transcriptional activation domain. We transfected 293t cells with increasing concentrations of Sox2 or Oct-1 encoding plasmids, alone or in combination in the presence of pGL109 or pGL2. Sox2 and Oct-1, in isolation, elicited 2.6-fold and 1.4-fold activation of the pGL109, Fig. 9. Oct-1 and Sox2 synergistically transactivate the Pax6 EE in epithelial cells. Fold induction of luciferase activity in the presence of increasing respectively (Fig. 9, EE109). The combination of Sox2 and concentrations of plasmids encoding Sox2 (a: 100 ng, b: 200 ng, c: 400 ng) and Oct-1 resulted in 4.4-fold increase in luciferase activity. The Oct-1 (a: 200 ng, b: 400 ng, c: 800 ng), in isolation or together on EE109, increase in activation observed is consistent with Sox2 and SOXX, OCTX, IR, and DR luciferase reporter constructs in 293t epithelial cells. A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 795 intact Octamer element and endogenous Oct-1 or a comparable Table 3 β POU factor. The sum of Sox2-dependent activation and Oct-1- -Galactosidase expression in transgenic embryos dependent activation was statistically significantly lower than Transgene No. expressing in: the Sox2/Oct-1-dependent activation of the EE (p<0.005, t- Stage Lens Cornea Ectoderm No. Tg test). Thus, Sox2/Oct-1 activation of the Pax6EE through the EE526 E10.0 5 NA NA 5 Sox and Octamer sites is synergistic. E12.5 10 10 10 14 To determine the relative contribution of the two Sox sites (A SOXAM4 E12.5 1 1 1 12 and B) to the Oct-1/Sox2-dependent activation of the EE,we SOXBM4 E12.5 4 0 0 10 utilized two constructs, IR and DR (Fig. 9, IR and DR, see also DM4 E10.0 0 NA NA 2 E12.5 2 a 10 8 Table 1C). IR contains mutations in Sox site A: the Octamer SOXX E10.0 0 NA NA 4 element and the Sox site B are intact. DR contains mutations in E12.5 0 0 0 23 Sox site B such that the Octamer element and Sox site A are OCTHM E10.0 0 NA NA 9 intact. Transcriptional activation was not observed on the IR E12.5 9 0 0 12 construct (Fig. 9, IR). Sox2-dependent and Sox2/Oct-1 co- OCTPM E12.5 1 0 0 3 MPAX6 E12.5 0 0 0 7 activation, however, were observed on the DR template (Fig 9, DR). These results indicate that Sox2 and Oct-1 synergistically NA, not applicable. a Patchy, weak expression. activate the Pax6 EE by interaction with the Octamer element and Sox site A. highly efficient transgene expression that recapitulated the Mutations in Sox and Octamer DNA sites reduce the activity of endogenous Pax6 expression pattern in 5 out of 5 and 10 of 14, the Pax6 EE in vivo E10.0 and E12.5 embryos, respectively (Figs. 10A–B; Table 3). In contrast, the singly mutant transgenes, SOXAM4 and Since cell lines do not accurately recapitulate the environ- SOXBM4, each exhibited a reduced efficiency of transgene ment of the developing lens placode or early differentiating expression at E12.5 (1 of 12 and 4 of 10, respectively), while lenses, we assessed the consequences of mutating the Sox- SOXBM4 also exhibited an altered pattern of expression binding sites on Pax6 EE activity in transgenic mouse embryos. (Table 3). Specifically, activity of the EE in the presumptive The wild-type transgene used in these studies contained 526 bp cornea and glandular ectoderm was abolished in SOXBM4 of the Pax6 P0 upstream region, including the EE, and yielded transgenic embryos (Fig. 10B). Mutation of both Sox sites in the

Fig. 10. Sox and Octamer DNA-binding elements are required for the in vivo transcriptional activity of the Pax6 EE. (A) Schematic representation of transgenic constructs utilized. The Pax6 EE directs expression of LacZ through the TATA element of the human β-globin (βg) gene. (B) Whole mount photo of EE526 transgenic embryo at E10.0 and representative sections of E12.5 embryos transgenic for EE526, SOXAM4, SOXBM4, OCTPM, and OCTHM. The arrows indicate the lens at E10.0, the non-lens epithelium of EE526, SOXAM4 and SOXBM4 sections and the AEL of OCTPM and OCTHM images. 796 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799

DM4 transgene essentially eliminated the activity of the EE at mutation of Pou2f1 and Sox2 produces ocular cataracts. both E10.0 and E12.5 (Table 3); the two transgenic embryos Cataracts are a sensitive readout of subtle disturbances in lens that expressed β-galactosidase at E12.5 exhibited patchy, weak development, and are a cardinal feature observed in Pax6Sey/+ expression that was not detectable in serial cross-sections (data mice. not shown). The transgene SOXX, with the most severe Homozygous mutation of Pou2f1 results in small embryos mutations in the duplex Sox sites by in vitro criteria, had no ∼4% of the time (Wang et al., 2004), and consistent with this, detectable in vivo activity (Table 3). Thus, the effects of the we observe a morphologically normal but small lens pits in a various mutations on Sox binding in vitro correlate directly with small fraction of Oct-1−/− embryos. However, in Oct-1−/−, their effects on EE expression in vivo. Furthermore, the duplex Sox2+/− embryos, while lens phenotypes within a single embryo Sox sites A and B are necessary for EE activity in the lens pit, were variable (potentially due to the hypomorphic nature of the the differentiating lens, the presumptive cornea and ocular Oct-1 allele and see below) (Wang et al., 2004), severe defects glandular ectoderm. occurred in both lens and nasal placode induction. These We also assayed the in vivo activity of the EE with a mutated embryos generally exhibit microphthalmia in one eye and Octamer element. At E10.0, mutation of the POUHD half-site anophthalmia in the other, and a complete failure of nasal abolished enhancer activity in the lens (Table 3, OCTHM). At placode induction. Since compound mutations of Sox2 and +/− +/− −/− +/− E12.5, transgenic embryos with mutations in either the POUS or Pou2f1 in Oct-1 , Sox2 or in Oct-1 , Sox2 embryos POUHD half-site behaved similarly, with the absence of all produce phenotypes not observed when the genes are mutated ectoderm expression outside the lens (Fig. 10B; Table 3). independently, Pou2f1 and Sox2 act cooperatively during the Interestingly, the effect of these mutations in the differentiating induction of the lens and nasal placodes. lens was not uniform. Expression in the AEL was maintained in Although we provide evidence for Oct-1/Sox2-dependent OCTPM and OCTHM transgenic embryos, while expression in activation of the Pax6 EE, it is likely that another POU factor in the fiber cell compartment was lost (Fig. 10B). The Octamer the lens also interacts with Sox2 to activate Pax6 expression element is therefore necessary for Pax6 EE activity in the lens through the EE. The activity of the Pax6 EE is strictly pit, the lens primary fiber cells and in the ectoderm surrounding dependent upon an intact Octamer element, but is not strictly the lens at E12.5. It is not, however, necessary for the activity of dependent upon Oct-1, since Pax6 expression and lens the Pax6 EE in the AEL. In total, our in vivo transgenic data morphogenesis are normal in Oct-1−/− embryos. Alternatively, demonstrate that the Octamer and Sox DNA-binding sites are Oct-1 expression from the hypomorphic Pou2f1 allele, even in each required for activity of the Pax6 EE in the early lens, the the homozygous condition, may be sufficient for activation of differentiating lens and the peri-ocular ectoderm and that the the EE and maintenance of Pax6 expression. Homozygous utilization of these sites is distinct in the differentiating lens mutation of Pou2f1 in conjunction with heterozygosity for epithelium and primary fiber cells. Sox2, however, prevents Oct/Sox2 complex formation on the EE and disrupts expression of Pax6. Discussion In addition to lens and nasal placode defects in Oct1−/−, Sox2+/− mice, we have observed dysmorphology of Rathke's Sox2 and Oct-1 are co-factors required for lens and nasal pouch and the adenohypophysis (ALD and RLM, unpublished placode induction data). Thus, all Pax6-dependent PPR derivatives are disrupted in these embryos. These observations are consistent with the While Sox transcription factors can bind similar DNA utilization of a common molecular pathway, involving Pou2f1, sequences (Kamachi et al., 1999), individual Sox proteins Sox2 and Pax6 in mammalian lens, nasal and Rathke's pouch control distinct downstream targets (Kamachi et al., 1999, placode induction and differentiation. 2000). Thus, it is believed that Sox factors affect transcription by forming complexes with other proteins, and that accessory Sox2 and Oct-1 maintain Pax6 expression through the EE co-factors provide transcriptional specificity. Pax6 and Oct-3 are two co-factors that have been characterized for Sox2 Sox2 and Oct-1 are important for lens and nasal placode (Ambrosetti et al., 1997; Kamachi et al., 2001; Aota et al., 2003; induction because they directly control the expression of Pax6. Rodda et al., 2005; Okumura-Nakanishi et al., 2005). Here, we Sox2 and Oct-1 proteins are first detectable in the mouse PLE at identify Oct-1 as an important co-factor for Sox2 during lens the 15-somite stage, after the onset of Pax6 expression. Thus, and nasal placode induction. Sox2 and Oct-1 cannot be required for the initial activation of In contrast to previous reports that Oct-1 is ubiquitously Pax6. However, Sox2 and Oct-1 are both expressed prior to expressed (reviewed in Ryan and Rosenfeld, 1997), we find that mouse lens specification, which occurs at the 23-somite stage during embryonic development Oct-1 exhibits a developmen- (Furuta and Hogan, 1998). Furthermore, Pax6 expression is tally dynamic and tissue-specific pattern of expression. The dynamically restricted from a broad domain of the head surface dynamic profile of Oct-1 expression overlaps extensively with ectoderm to the PLE during pre-specification stages (Grindley that of Sox2 in the early neuroepithelium, in the lens and nasal et al., 1995). Thus, Sox2 and Oct-1 may stabilize Pax6 placodes and their derivatives. While heterozygous mutation of expression in the PLE during lens specification. either Pou2f1 or Sox2 alone has no phenotypic consequences Sox2 and Oct-1 bind cooperatively to the Pax6 EE and the for lens or nasal development, compound heterozygous disruption of Sox or Octamer DNA-binding sites abolishes A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 797

Pax6 EE-dependent transcriptional activation in cell culture. Embryos homozygous for the Sox2βgeo2 allele alone cannot be Octamer and Sox site mutations also eliminate Pax6 EE- evaluated for lens defects due to the severity of the early dependent expression in the lens of transgenic mouse embryos. phenotype (Avilion et al., 2003; Ekonomou et al., 2005). Thus, the Octamer and Sox sites identified herein are required Embryos homozygous for the Pax61-NeuSey allele already fail for the in vivo activity of the Pax6 EE. to induce a lens placode; thus the phenotypic consequence of The Pax6 EE, however, is not the only enhancer required for Pax6Sey/Sey compounded with Sox2 mutation on lens develop- appropriate Pax6 expression in the early lens (Dimanlig et al., ment cannot be meaningfully evaluated. Furthermore, mice 2001). Indeed Pax6 expression in the head surface ectoderm, heterozygous for the Pax61-NeuSey allele have cataracts. Thus, which initiates at E8.0 (Grindley et al., 1995), precedes the the Pax6 heterozygous mutation in isolation has the same earliest detectable activity of the Pax6 EE at E8.75 (Dimanlig et phenotype as Oct1+/−, Sox2+/− mice, and compounding al., 2001). Thus, the Octamer and Sox elements described heterozygosity for the alleles Pax61-NeuSey and Sox2βgeo2 has herein may be necessary for the activity of the Pax6 EE without no additional phenotypic consequences. controlling the pre-15-somite stage head surface ectoderm It is notable that the Oct-1/Sox2 complex that we expression of Pax6. identify herein and the Pax6/Sox2 complex characterized in Homozygous deletion of the Pax6 EE in Pax6ΔEE/ΔEE Aota et al. (2003) both predominately utilize Sox Site A. mice reduces Pax6 expression, delays lens placode induction Thus, alternative Sox2 complexes may control different and results in microphthalmia (Dimanlig et al., 2001). Mildly aspects of Pax6 regulation. For example, during lens effected Oct-1−/−, Sox2+/− lenses resemble Pax6ΔEE/ΔEE differentiation the Sox sites are required for Pax6 EE lenses, while severely effected Oct-1−/−, Sox2+/− lenses are activity in the AEL and the fiber cell compartment, while more severely affected than Pax6ΔEE/ΔEE lenses. There are the Octamer site is only necessary in the fiber cell several possible explanations for this result. As mentioned compartment. Thus, the Pax6/Sox complex might function previously, there are at least two enhancers that control Pax6 in the AEL, while the Oct-1/Sox2 complex is utilized expression in the lens. The SIMO enhancer has been shown during primary fiber cell differentiation. to direct expression to the lens placode and its derivatives in Sox2 is activated downstream of Pax6, since Sox2 expression transgenic mice (Kleinjan et al., 2001). In the most highly is lost in homozygous Pax6 null embryos (Furuta and Hogan, conserved domain of the SIMO element there are at least 1998; Ashery-Padan and Gruss, 2001). Indeed, we observe the eight sites that bind Sox proteins in vitro and one Octamer loss of Sox2 expression in our compound Oct-1−/−, Sox2+/− element (ALD and RLM, unpublished data). Thus, it is mice in both the surface ectoderm and the distal OV. Since Sox2 possible that Oct1 and Sox2 control Pax6 lens expression expression is detectable in both Oct-1−/− and Sox2+/− mice, we through other Pax6 enhancers such as the SIMO enhancer. presume that this is a consequence of disrupted Pax6 expression Secondly, loss of Oct-1 and Sox2 in the lens may reduce or in the compound mutants. eliminate the expression of genes other than Pax6 that are Sox2 also acts upstream of Pax6 during lens induction. Our important for lens placode induction and subsequent differ- current analyses provide evidence that Sox2, acting through the entiation. Finally, the loss of Oct-1 and Sox2 in the OV may EE, is required for the maintenance of Pax6 expression in the result in non-tissue autonomous defects in lens development. mouse PLE for lens placode induction and subsequent lens While we have assessed expression of several OV markers, morphogenesis. Kamachi et al. (2001) demonstrated that tissue-specific deletion of Pou2f1 and Sox2 will be required ectopic expression of Sox2 up-regulated Pax6 in chick head to fully address this possibility since many of the molecules ectoderm. Based on these data, Kondoh and colleagues required for OV-PLE signaling are not known. However, proposed that Pax6 maintenance in the chick lens is Sox2- given the existence of multiple placode defects in the Oct-1−/−, dependent (Kondoh et al., 2004). Our data are consistent with Sox2+/− embryos and the normal physical apposition between the model of Kondoh et al. (2004) and expand it to include the the OV with PLE, it is unlikely that a defect in the OV is the co-factor, Oct-1, which acts in concert with Sox2 to maintain exclusive cause of the observed lens placode defect. Pax6 expression.

Sox2 and Pax6 are interdependent factors required for eye Acknowledgments development The authors are grateful to Lisa Dailey, Winship Herr, Hisato Sox2 and Pax6 proteins act together to regulate the Kondoh, Robin Lovell-Badge, John Reddan, Phil Sharp, and transcription of the chicken δ-crystallin gene and the Pax6 Dean Tantin for the reagents. Lena Du from the BWH EE (Kamachi et al., 2001; Aota et al., 2003). In Sox2βgeo2/+, transgenic facility performed the transgenic injections. The Pax6Sey/+ double heterozygous mice, however, we did not Pax6 antibody developed by A. Kawakami was obtained from detect synergistic effects of Sox2 and Pax6 on lens placode the Developmental Studies Hybridoma Bank (NICHD and induction or lens differentiation. This may indicate that Sox2/ University of Iowa). This work was supported by grant R01 Pax6 complex formation is not essential for murine lens EY010123-10 to RLM. A.L.D. was supported by fellowships placode induction or the early activity of the Pax6 EE. F32-DE05735 from NIDCR and T32-EY07145 from NEI Alternatively, the lack of phenotypic evidence for this administered by the Postdoctoral Training Program in the interaction may derive from the alleles utilized in this study. Molecular Bases of Eye Diseases. 798 A.L. Donner et al. / Developmental Biology 303 (2007) 784–799

Appendix A. Supplementary data aniridia, anophthalmia, and central nervous system defects. Nat. Genet. 7, 463–471. Grindley, J.C., Davidson, D.R., Hill, R.E., 1995. The role of Pax-6 in eye and Supplementary data associated with this article can be found, nasal development. Development 121, 1433–1442. in the online version, at doi:10.1016/j.ydbio.2006.10.047. Hagstrom, S.A., Pauer, G.J., Reid, J., Simpson, E., Crowe, S., Maumenee, I.H., Traboulsi, E.I., 2005. SOX2 mutation causes anophthalmia, hearing loss, References and brain anomalies. Am. J. Med. Genet. 138, 95–98. Hanson, I.M., Fletcher, J.M., Jordan, T., Brown, A., Taylor, D., Adams, R.J., Ahrens, K., Schlosser, G., 2005. Tissues and signals involved in the induction of Punnett, H.H., van Heyningen, V., 1994. Mutations at the PAX6 locus are placodal Six1 expression in Xenopus laevis. Dev. Biol. 288, 40–59. found in heterogeneous anterior segment malformations including Peters' Ambrosetti, D.-C., Basilico, C., Dailey, L., 1997. Synergistic activation of the anomaly. Nat. Genet. 6, 168–173. Fibroblast Growth factor 4 enhancer by Sox2 and Oct-3 depends on protein– Hill, R.E., Favor, J., Hogan, B.L.M., Ton, C.T., Saunders, G.F., Hanson, I.M., protein interactions facilitated by a specific spatial arrangement of factor Prosser, J., Jordan, T., Hastie, N.D., van Heyningen, V., 1991. Mouse Small binding sites. Mol. Cell. Biol. 17, 6321–6329. eye results from mutations in a paired-like homeobox-containing gene. Aota, S., Nakajima, N., Sakamoto, R., Wantabe, S., Ibarake, N., Okazaki, K., Nature 354, 522–525. 2003. Pax6 autoregulation mediated by direct interaction of Pax6 protein Hogan, B.L., Hirst, E.M., Horsburgh, G., Hetherington, C.M., 1988. Small eye with the head surface ectoderm-specific enhancer of the mouse Pax6 gene. (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Dev. Biol. 257, 1–13. Development 103, 115–119 (Suppl.). Ashery-Padan, R., Gruss, P., 2001. Pax6 lights-up the way for eye development. Kamachi, Y., Uchikawa, M., Collignon, J., Lovell-Badge, R., Kondoh, H., 1998. Curr. Opin. Cell Biol. 13, 706–714. Involvement of Sox1, 2 and 3 in the early and subsequent molecular events Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., Lovell-Badge, of lens induction. Development 125, 2521–2532. R., 2003. Multipotent cell lineages in early mouse development depend on Kamachi, Y., Cheah, K.S., Kondoh, H., 1999. Mechanism of regulatory target SOX2 function. Genes Dev. 17, 126–140. selection by SOX high-mobility-group domain proteins as revealed by Bailey, A.P., Bhattacharyya, S., Bronner-Fraser, M., Streit, A., 2006. Lens comparison of SOX1/2/3 and SOX9. Mol. Cell. Biol. 19, 107–120. specification is the ground state of all sensory placodes, from which FGF Kamachi, Y., Uchikawa, M., Kondoh, H., 2000. Pairing Sox off: with partners in promotes olfactory identity. Dev. Cell 11, 505–517. the regulation of embryonic development. Trends Genet. 16, 182–187. Bhattacharyya, S., Bronner-Fraser, M., 2004. Hierarchy of regulatory events in Kamachi, Y., Uchikawa, M., Tanouchi, A., Sekido, R., Kondoh, H., 2001. Pax6 sensory placode development. Curr. Opin. Genet. Dev. 14, 520–526. and SOX2 form a co-DNA-binding partner complex that regulates initiation Botquin, V., Hess, H., Fuhrmann, G., Anastassiadis, C., Gross, M.K., Vriend, of lens development. Genes Dev. 15, 1272–1286. G., Scholer, H.R., 1998. New POU dimer configuration mediates Kammandel, B., Chowdhury, K., Stoykova, A., Aparicio, S., Brenner, S., Gruss, antagonistic control of an osteopontin preimplantation enhancer by Oct-4 P., 1999. Distinct cis-essential modules direct the time-space pattern of the and Sox-2. Genes Dev. 12, 2073–2090. Pax6 gene activity. Dev. Biol. 205, 79–97. Brugmann, S.A., Moody, S.A., 2005. Induction and specification of the Kiernan, A.E., Pelling, A.L., Leung, K.K.H., Tang, A.S.P., Bell, D.M., Tease, vertebrate ectodermal placodes: precursors of the cranial sensory organs. C., Lovell-Badge, R., Steel, K.P., Cheah, K.S.E., 2005. Sox2 is required for Biol. Cell 97, 303–319. sensory organ development in the mammalian inner ear. Nature 434, Carl, M., Loosli, F., Whittbrodt, J., 2002. Six3 inactivation reveals its essential 1031–1035. role for the formation and patterning of the vertebrate eye. Development Kleinjan, D.A., Seawright, A., Schedl, A., Quinlan, R.A., Danes, S., van 129, 4057–4063. Heyningen, V., 2001. Aniridia-associated translocations, DNase hypersen- Dimanlig, P.V., Faber, S.C., Auerbach, W., Makarenkova, H.P., Lang, R.A., sitivity, sequence comparison, and transgenic analysis redefine the 2001. The upstream ectoderm enhancer in Pax6 has an important role in lens functional domain of PAX6. Hum. Mol. Genet. 10, 2049–2059. induction. Development 128, 4415–4424. Klemm, J.D., Rould, M.A., Aurora, R., Herr, W., Pabo, C.O., 1994. Crystal Di Rocco, G., Gavalas, A., Pöpperl, H., Krumlauf, R., Mavilio, F., Zappavigna, structure of the Oct-1 POU domain bound to an octamer site: DNA V., 2001. The recruitment of SOX/OCT complexes and the differential recognition with tethered DNA-binding modules. Cell 77, 21–32. activity of HOXA1 and HOXB1 modulate the hoxb1 auto-regulatory Kondoh, H., Uchikawa, M., Kamachi, Y., 2004. Interplay of Pax6 and Sox2 in enhancer function. J. Biol. Chem. 276, 20506–20515. lens development as a paradigm of genetic switch mechanisms for cell Dong, S., Leung, K.K.H., Pelling, A.L., Lee, P.Y.T., Tang, A.S.P., Heng, H.H. differentiation. Int. J. Dev. Biol. 48, 819–827. Q., Tsui, L.C., Tease, C., Fisher, G., Steel, K.P., Cheah, K.S.E., 2002. Ladher, R.K., Wright, T.J., Moon, A.M., Mansour, S.L., Schoenwolf, G.C., Circling, deafness, and yellow coat displayed by yellow submarine (Ysb) and 2005. FGF8 initiates inner ear induction in chick and mouse. Genes Dev. 19, light coat and circling (Lcc) mice with mutations on chromosome 3. 603–613. Genomics 79, 777–784. Lagutin, O., Zhu, C.C., Furuta, Y., Rowitch, D.H., McMahon, A.P., Oliver, G., Ekonomou, A., Kazanis, I., Malas, S., Wood, H., Alifragis, P., Denaxa, M., 2001. Six3 promotes the formation of ectopic optic vesicle-like structures in Karagogeos, D., Constanti, A., Lovell-Badge, R., Episkopou, V., 2005. mouse embryos. Dev. Dyn. 221, 342–349. Neuronal migration and ventral subtype identity in the telencephalon depend Litsiou, A., Hanson, S., Streit, A., 2005. A balance of FGF, BMP and WNT on SOX1. PloS Biol. 3, 1111–1122. signaling positions the future placode territory in the head. Development Esteve, P., Trousse, F., Rodríguez, J., Bovolenta, P., 2003. SFRP1 modulates 132, 4051–4062. retina cell differentiation through a β-catenin-independent mechanism. Ma, Y., Certel, K., Gao, Y., Niemitz, E., Mosher, J., Mukherjee, A., Mutsuddi, J. Cell Sci. 116, 2471–2481. M., Huseinovic, N., Crews, S.T., Johnson, W.A., Nambu, J.R., 2000. Faber, S.C., Dimanlig, P., Markarnkova, H.P., Shirke, S., Ko, K., Lang, R.A., Functional interactions between Drosophila bHLH/PAS, Sox, and the POU 2001. Fgf receptor signaling plays a role in lens induction. Development transcription factors regulate CNS midline expression of the slit gene. J. 128, 4425–4438. Neurosci. 20, 4596–4605. Fantes, J., Ragge, N.K., Lynch, S.A., McGill, N.I., Collin, J.R., Howard- Martin, K., Groves, A.K., 2005. Competence of cranial ectoderm to respond to Peebles, P.N., Hayward, C., Vivian, A.J., Williamson, K., van Heyningen, Fgf signaling suggests a two-step model of otic placode induction. V., FitzPatrick, D.R., 2003. Mutations in SOX2 cause anophthalmia. Nat. Development 133, 877–887. Genet. 33, 461–463. Mertin, S., McDowall, S.G., Harley, V.R., 1999. The DNA-binding specificity Furuta, Y., Hogan, B.L.M., 1998. BMP4 is essential for lens induction in the of SOX9 and other SOX proteins. Nucleic Acids Res. 27, 1359–1364. mouse embryo. Genes Dev. 12, 3764–3775. Nagy, A., Gertsenstein, M., Vintersten, K., Behringer, R., 2003. Manipulating Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J., Maas, R.L., the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory 1994. PAX6 gene dosage effect in a family with congenital cataracts, Press, Cold Spring Harbor, NY. A.L. Donner et al. / Developmental Biology 303 (2007) 784–799 799

Nishiguchi, S., Wood, H., Kondoh, H., Lovell-Badge, R., Episkopou, V., 1998. Streit, A., 2004. Early development of the cranial sensory nervous system: from Sox1 directly regulates the gamma-crystallin genes and is essential for lens a common field to individual placodes. Dev. Biol. 276, 1–15. development in mice. Genes Dev. 12, 776–781. Tanaka, M., Herr, W., 1990. Differential transcriptional activation by Oct-1 and Nishimoto, M., Fukushima, A., Okuda, A., Muramatsu, M., 1999. The gene for Oct-2: interdependent activation domains induce Oct-2 phosphorylation. the embryonic stem cell coactivator UTF1 carries a regulatory element Cell 60, 375–386. which selectively interacts with a complex composed of Oct-3/4 and Sox-2. Tanaka, S., Kamachi, Y., Tanouchi, A., Hamada, H., Jing, N., Kondoh, H., 2004. Mol. Cell. Biol. 19, 5453–5465. Interplay of SOX and POU factors in regulation of the Nestin gene in neural Ohyama, T., Mohamed, O.A., Taketo, M.M., Dufort, D., Groves, A.K., 2006. primordial cells. Mol. Cell. Biol. 24, 8834–8846. Wnt signals mediate a fate decision between otic placode and epidermis. Taranova, O.V., Magness, S.T., Fagan, B.M., Wu, Y., Surzenko, N., Hutton, Development 133, 865–875. S.R., Pevny, L.H., 2006. SOX2 is a dose-dependent regulator of retinal Okumura-Nakanishi, S., Saito, M., Niwa, H., Ishikawa, F., 2005. Oct-3/4 and neural progenitor competence. Genes Dev. 20, 1187–1202. Sox2 regulate Oct-3/4 gene in embryonic stem cells. J. Biol. Chem. 280, Van Houte, L.P.A., Chuprina, V.P., van der Wetering, M., Boelens, R., Kaptein, 5307–5317. R., Clevers, H., 1995. Solution structure of the sequence-specific HMG box Phillips, B.T., Storch, E.M., Lekven, A.C., Riley, B.B., 2004. A direct role for of the lymphocyte transcriptional activator Sox-4. J. Biol. Chem. 270, Fgf but not Wnt in otic placode induction. Development 131, 923–931. 30516–30524. Purcell, P., Oliver, G., Mardon, G., Donner, A.L., Maas, R.L., 2005. Pax6- Van Raay, T.J., Moore, K.B., Iordanova, I., Steele, M., Jamrich, M., Harris, W.A., dependence of Six3, Eya1, and Dach1 expression during lens and nasal Vetter, M.L., 2005. Frizzled 5 signaling governs the neural potential of placode induction. Gene Expr. Patterns 6, 110–118. progenitors in the developing Xenopus retina. Neuron 46, 23–36. Ragge, N.K., Lorenz, B., Schneider, A., Bushby, K., de Sanctis, L., de Sanctis, Wang, V.E.H., Schmidt, T., Chen, J., Sharp, P.A., Tantin, D., 2004. Embryonic U., Salt, A., Collin, R.O., Vivian, A.J., Free, S.L., Thompson, P., lethality, decreased erythropoiesis, and defective octamer-dependent Williamson, K.A., Sisodiya, S.M., van Heyningen, V., FitzPatrick, D.R., promoter activation in Oct-1-deficient mice. Mol. Cell. Biol. 24, 2005. SOX2 anophthalmia syndrome. Am. J. Med. Genet. 135A, 1–7. 1022–1032. Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, B., Ng, H.H., Robson, P., Wawersik, S., Purcell, P., Rauchman, M., Dudley, A.T., Robertson, E.J., Maas, 2005. Transcriptional regulation of nanog by OCT4 and SOX2. J. Biol. R., 1999. BMP7 acts in murine lens placode development. Dev. Biol. 207, Chem. 280, 24731–24737. 176–188. Ryan, A.K., Rosenfeld, M.G., 1997. POU domain family values: flexibility, Williams, S.C., Atlmann, C.R., Chow, R.L., Hemmati-Brivanlou, A., Lang, partnerships, and developmental codes. Genes Dev. 11, 1207–1225. R.A., 1998. A highly conserved lens transcriptional control element from Schlosser, G., 2006. Induction and specification of the cranial placodes. Dev. the Pax-6 gene. Mech. Dev. 73, 225–229. Biol. 294, 303–351. Wood, H.B., Episkopou, V., 1999. Comparative expression of the mouse Sox1, Sisodiya, S.M., Free, S.L., Williamson, K.A., Mitchell, T.N., Willis, C., Stevens, Sox2 and Sox3 genes from pre-gastrulation to early somite stages. Mech. J.M., Kendall, B.E., Shorvon, S.D., Hanson, I.M., van Heyningen, V., 2001. Dev. 86, 197–201. PAX6 haploinsufficiency causes cerebral malformation and olfactory Zenteno, J.C., Gascon-Guzman, G., Tovilla-Canales, J.L., 2005. Bilateral dysfunction in humans. Nat. Genet. 28, 214–216. anophthalmia and brain malformations caused by a 20-bp deletion in the Smith, A.N., Miller, L.A., Song, N., Taketo, M.M., Lang, R.A., 2005. The SOX2 gene. Clin. Genet. 68, 564–566. duality of beta-catenin function: a requirement in lens morphogenesis and Zhang, X., Friedman, A., Heaney, S., Purcell, P., Maas, R.L., 2002. Meis signaling suppression of lens fate in periocular ectoderm. Dev. Biol. 285, homeoproteins directly regulate Pax6 during vertebrate lens morphogenesis. 477–489. Genes Dev. 16, 2097–2107.