Hindawi BioMed Research International Volume 2020, Article ID 6387545, 10 pages https://doi.org/10.1155/2020/6387545

Research Article Suppression of KIF22 Inhibits Cell Proliferation and Xenograft Tumor Growth in Tongue Squamous Cell Carcinoma

Yi Liu , Rong-Hua Li, Gang Ren, and Jin Jiang

Department of Stomatology, Tianjin First Central Hospital, No. 24, Fukang Road, Nankai District, Tianjin 300192, China

Correspondence should be addressed to Yi Liu; [email protected]

Received 17 August 2019; Revised 26 October 2019; Accepted 12 November 2019; Published 22 January 2020

Academic Editor: Emilia Lecuona

Copyright © 2020 Yi Liu et al. *is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background. Oral carcinoma is the sixth most common cancer and is a serious public health problem, and tongue squamous cell carcinoma (TSCC) is the most common type of oral carcinoma. Kinesin family member 22 (KIF22), also called as kinesin-like DNA binding protein (KID), is a microtubule-based motor protein and binds to both microtubules and chromosomes, transporting organelles, protein, and mRNA. *is research aimed at investigating the prognostic significance of KIF22 in TSCC. Patients and Methods. *is retrospective research collected 82 paired tissues with TSCC. KIF22 protein expression level was detected by immunohistochemical staining. Suppression of KIF22 with shRNA in CAL-27 and SCC-15 cells was to observe cell proliferation in vitro and xenograft tumor growth in vivo. Results. In TSCC tissues, the protein expression level of KIF22 was increased and correlated with tumor stage, clinical stage, and lymphatic metastasis (P � 0.013, P � 0.034 and P � 0.015, re- spectively). Suppression of KIF22 inhibited cell proliferation and xenograft tumor growth. Conclusion. KIF22 might play an important role in the progression of TSCC and could serve as a therapeutic target for TSCC.

1. Introduction the cervical lymph nodes. Another reason is the develop- ment of locoregional recurrences [8]. Some biomarkers Oral carcinoma is the sixth most common cancer and is a which service for diagnostic and prognostic have been serious public health problem [1, 2]. Recent reports esti- studied in recent search for TSCC, but no results have mated 49,670 patients suffered from oral carcinoma in the proved suitable for routine use in clinics. United States of America and 9,700 deaths in 2017 [3]. In Vale et al. firstly reported kinesin in giant squid axons 2018, this increased up to 51,540 and caused 10,030 deaths in [9]. Subsequently, it has been reported in different species the United States of America [4]. Shield et al. reported that and tissues, such as mammalian neuronal cells, sea urchin the proportion of oral cancer rose to 28.6% in all cancers in eggs, and Drosophila [10–12]. Kinesin family member 22 North Africa and Europe [5], and this may be due to the (KIF22), also called as kinesin-like DNA binding protein unexpected rise of tongue squamous cell carcinoma (TSCC) (KID), is a microtubule-based motor protein and binds to [2]. It is well known that TSCC is the most common type of both microtubules and chromosomes, transporting organ- oral carcinoma, which has a high potential for locoregional elles, protein, and mRNA. Kinesin family has been reported invasion and nodal metastasis, so patients had a poor to be associated with important transporting molecules in prognosis [6]. *erefore, early detection of TSCC is more cells [13, 14]. In recent years, kinesin family was reported to important. Although new drugs and therapies improved play important roles in cancers. KIF26B was overexpressed quality of life and survival time, they were limited by side in breast cancer and associated with poor prognosis, larger effects. Despite increasing studies on the molecular mech- tumor size, and lymph node metastasis, and the expression anism of TSCC, the 5-year overall survival of TSCC patients of KIF26B was positively correlated with estrogen receptor is still only about 50% [7]. One reason is that tumors are [15]. KIF22, as a binding protein of microtubules and often diagnosed at a later stage and therefore have spread to chromosomes, has several reports [16]. In recent studies, 2 BioMed Research International transcription regulator was reported in some cancers. Yu 50%, 2 points; 51% to 75%, for 3 points; and 76% to 100%, 4 et al. observed that inhibition of KIF22 decreased cell points. Positive staining intensity score was 0 for no color, 1 proliferation in cancer by delaying mitotic exit [17], and they for light yellow, 2 for brown, and 3 for brown. *e two scores also found that KIF22 protein and mRNA had a high ex- are multiplied by the positive rating: 0 is negative (− ), 1–4 is pression level in several cancer tissues and promoted cell weakly positive (+), 5–8 is positive (++), and 9–12 is strongly proliferation by downregulating CDC25C to accelerating positive (+++). In this study, we divided the positive staining mitotic exit. However, the expression level and roles of of KIF22 expression as low (− and +) and high (+ and ++) KIF22 in TSCC remain to be explored. expression. In this study, we aimed at investigating the prognostic significance of KIF22 in TSCC. Firstly, we detected the 2.2. Cell Culture. CAL-27 (ATCC, USA) and SCC-15 protein expression of KIF22 in TSCC tissues and the normal (ATCC, USA) cells were cultured with high glucose DMEM tissues adjacent to cancer, and we observed that patients with (Gibco, Waltham, Massachusetts, USA) supplemented with high expression of KIF22 had a poor prognosis, low overall 10% fetal bovine serum (FBS, Gibco) or PRMI 1640 (Gibco) survival rate, and disease-free survival rate. *en, we supplemented with 20% FBS. All cells were incubated in 5% demonstrated the function of KIF22 in vitro and in vivo. CO at 37°C. *ose data showed that KIF22 might play an important role 2 in TSCC, and KIF22 could be considered as a potent prognostic factor in TSCC. 2.3. Knockdown of KIF22 and Stable Colony Formation. *e plasmid of knockdown KIF22 and negative control 2. Materials and Methods plasmid were provided by the hospital. *e shRNA sequence was 5′AAGCAAGATTGGAGCTACTCGTC3′. CAL-27 and 2.1. Tissue Collection and Immunohistochemical Assays. SCC-15 cells were transfected with shRNA and negative 82 tissues of TSCC and adjacent normal tissues were col- control plasmid using Lipofectamine 3000 (*ermo, Wal- lected from patients who underwent surgery in Tianjin First tham, Massachusetts, USA). *en, after 72 hours, shCAL-27 Central Hospital, and the protocol concerning human and shSCC-15 cells were cultured in medium with puro- specimens was approved and the informed consent before mycin (Sigma, St. Louis, Missouri, USA, 1.5 μg/ml) for two the surgery was obtained. However, we cannot provide weeks to select stable colony. consent because of the Chinese language and privacy pro- tection. According to the 2009 UICC TNM classification and 2.4. PCR. Total RNA was isolated from cells using TRIzol the 2004 WHO/ISUP classification, the following data were reagent (*ermo, Waltham, Massachusetts, USA), and then retrospectively collected: age, gender, tumor stage, differ- RNA was reverse transcribed to cDNA using High Capacity entiation, clinical stage, and lymphatic invasion. No evi- cDNA Reverse Transcription Kit (*ermo, Waltham, dence of tumor metastasis was confirmed by cross-sectional Massachusetts, USA) according to the manufacturer’s in- imaging in all patients. Tissues were formalin-fixed and struction. KIF22 primer sequence: F-5′- paraffin-embedded, and then 4 μm sections were made. CGGCCTTTTACCAATGAGAGC3′ and R-5′-GAC- *ose sections were heated in an oven at 75°C for 30 min, CAAGCAATTCTTTCTGAGACA-3′ [18]. Gapdh primer deparaffinized in xylene, and rehydrated in alcohol (100%, sequence: F-5′-CGACCACTTTGTCAAGCTCA-3′ and 100%, 95%, 85%, and 75%). Immunohistochemistry assays R-5′-GGTTGAGCACAGGGTACTTTATT-3′. DNA bands were introduced according to the specifications of immu- were stained with ethidium bromide (Solarbio, Beijing, nohistochemistry assays (Cell Signaling Technology, Dan- China, 1 ug/ml). *e quantification of PCR results was done vers, Massachusetts, USA). Briefly, antigen was retrieved by using ImageJ. Each reaction contains 25 μl of 2 × Taq Master citric acid buffer in a microwave for 15 min and then cooled Mix (CWBIO, Beijing, China), 2 μl of 10 μM forward primer, at room temperature. Endogenous peroxidase was blocked 2 μl of 10 μM reverse primer, 1 μl of template DNA, and 20 μl using blocking reagent for 5 min at room temperature and of RNase-free water. PCR conditions were as follows: pre- washed three times using PBS buffer. *en, the sections were denaturation at 95°C for 3 min, followed by 35 cycles of incubated overnight at 4°C with a monoclonal mouse anti- denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and KIF22 antibody (*ermo Fisher Scientific, Waltham, MA, extension at 72°C for 30 s and then at 72°C for 2 min. USA, 1 : 200). *e second day, the sections were washed three times in PBS and incubated with secondary antibody- HRP (Proteintech, Sanying, Wuhan, China, 1 :1000) for 1 2.5. Western Blot. Total proteins were collected from cells hour at room temperature, washed, and stained with dia- using RIPA- PMSF (Solarbio, Beijing, China, 100 :1), added minobenzidine (DAB, Cell Signaling Technology, Pudong, with 100 μl/well in 6 wells and incubated for 30 min, cen- Shanghai, China) for 5 min. *e images were collected by a trifugated for 30 min at 4°C, and then stored at − 20°C until microscope (Nikon, Tokyo, Japan). used. 30 μg of total protein was added to 10% SDS-PAGE for We scored for KIF22 nuclear expression based on separation at 90V. *en, protein bands were transferred to staining area and staining intensity. We used semi- PVDF membrane (Solarbio, Beijing, China) at 250 mA for quantitative results to judge the percentage of microscopi- 130 min. *e membrane was washed three times with TBST, cally positive cells and staining intensity. *e number of blocked in 10% nonfat milk, and incubated overnight at 4°C positive cells was <5%, 0 points; 5% to 25%, 1 point; 26% to with rabbit anti-KIF22 antibody (Abcam, Cambridge, UK, BioMed Research International 3

1 : 2000). *e second day, the membrane was washed with 3. Results TBST and incubated with goat anti-rabbit antibody (Pro- teintech, Sanying, Wuhan, China, 1 :10000) for 1 hour at 3.1. KIF22 Is Overexpressed in TSCC and Associated with Poor room temperature. Finally, protein bands were detected Prognosis. To study the role of KIF22 in TSCC, tumor using ECL reagent kit (Solarbio, Beijing, China) and images tissues and disease information of 82 patients with TSCC were collected. Protein levels of β-actin antibody (Cell were collected. Protein expression level of KIF22 in high- Signaling Technology, Danvers, Massachusetts, USA, 1 : grade, low-grade, and adjacent normal tissues in TSCC by 1000), Ki67 (Abcam, Cambridge, UK, 1 : 2000), and PCNA was analyzed by immunohistochemical staining (Cell Signaling Technology, Pudong, Shanghai, China 1 : (Figures 1(a) and 1(b)). *e results showed that the ex- 2000) were detected by western blot in a similar way. pression level of KIF22 was different in carcinoma and in adjacent normal tissues. In addition, KIF22 had a low ex- pression level in adjacent normal tissues compared with 2.6. Colony Formation Assays. Cells were suspended in the carcinoma (positive rate: 62/82 vs. 30/82, χ2 � 9.557, complete medium, and the cell density was adjusted to 100 P � 0.002 < 0.05). By analyzing all results of immunohisto- cells/ml with complete medium. *en, 2 ml of complete chemical staining and patient’s information, including age, medium was added to every well with 200 cells in 6-well gender, tumor stage, differentiation, clinical stage, and ° plates and cultured at 37 C in 5% CO2 for two weeks. Finally, lymphatic metastasis, we could draw a conclusion that the cells were fixed by 4% paraformaldehyde for 10 minutes and expression level of KIF22 was associated with tumor stage stained with 0.1% crystal violet. *e number of colonies was (P � 0.013), clinical stage (P � 0.034), and lymph node counted manually using the microscope. metastasis (P � 0.015), but had little to do with age, gender, or differentiation (P > 0.05, respectively) (Table 1). Patients with high expression of KIF22 had a poor prognosis and 2.7. MTT Assays. MTT assays were introduced into 96-well overall survival rate, and the disease-free survival rate was plates containing 100 μl complete medium (3000 cells/well) low compared with low expression (Figure 1(c)). *e above ° and incubated for three days at 37 C in 5% CO2. After three data indicated that KIF22 might play an important role in days, the medium was replaced by 20 μl MTT solution TSCC and associated with poor prognosis. (Solarbio, Beijing, China, 5 mg/ml) and incubated for 4 hours at 37°C. *en, MTT solution was removed and 150 μl 3.2. Stable Clone of Suppression of KIF22 in CAL-27 and SCC- DMSO was added (Solarbio, Beijing, China) to every well for 15 Cells with shRNA. To further study the role of KIF22 in 10 minutes at room temperature to solubilize the formazan TSCC, stable cell clone of suppression of KIF22 in CAL-27 crystals. *e optical density (OD) was detected by using a and SCC-15 cells was established by short hairpin RNA. spectrophotometer at 570 nm. CAL-27 cells were transfected with the plasmid containing shRNA, and negative control cells were transfected with control plasmid containing random sequence. SCC-15 cells 2.8. Animal Study. Nude Balb/c mice (6–8 weeks old, were transfected in the same way. *en, the transfected cells weighing 18–22 g) were provided by Shanghai Laboratory were incubated in complete medium with puromycin until Animal Center. CAL-27 and shCAL-27 cells (5 ×106 cells/ negative cells were killed to establish stable clone. As shown mice) were suspended and transplanted subcutaneously into in Figure 2(a), the mRNA expression level of CAL-27 cells the armpit of nude mice. Tumor length and width were transfected with shRNA was lower than that of control cells measured every three days, calculating tumor volume (P < 0.05). *e result of the other cells, SCC-15 cells and (V � 0.5 × L × W [2], V: volume, L: length, and W: width) shSCC-15 cells, was similar (P < 0.05). *en, the protein [19]. After 29 days, all mice were killed, and xenograft tu- level of KIF22 was detected using western blot in CAL-27, mors were removed for examination and fixed with 4% shCAL-27, SCC-15, and shSCC-15 cells. As shown in paraformaldehyde. Protein expression level of KIF22 was Figure 2(b), KIF22 had a low expression in protein level detected by western blot and immunohistochemical staining when transfected with shRNA in CAL-27 and SCC-15 cells in xenograft tumors. (P < 0.05, respectively).

2.9. Statistical Analysis. Data in this study were analyzed 3.3. Suppression of KIF22 Inhibits Proliferation in CAL-27 with SPSS 22.0 software. Quantitative data are presented as Cells and SCC-15 Cells. In previous reports, suppression of the mean ± standard deviation (SD), and Student’s t-test was KIF22 inhibits cell proliferation in cancer cell [17]. However, used for comparison between two groups. *e association there was no report about KIF22 in TSCC. To observe the between immunohistochemical results and patient’s in- role of KIF22 in this cancer, colony formation assays were 2 formation was evaluated using χ tests. *e connections performed in CAL-27 and SCC-15 cells, and cells transfected between KIF22 expression level and patients’ survival time with shRNA showed that knockdown of KIF22 decreased after surgery were performed by Kaplan–Meier (KM) colony formation ability (Figure 3(a)). Incubating for 2 method. *e categorical data were analyzed by chi-square weeks, compared with negative control cells, shCAL-27 and test. A value of P < 0.05 was considered as statistical shSCC-15 cells displayed fewer colonies (P < 0.05). To fur- significance. ther assess cell proliferation triggered by KIF22, MTT assays 4 BioMed Research International

Low High

100 100

200 200

(a) (b) 100 100

80 80

60 60

40 40

Overal (%) survival rate 20 20 Progression-free survival rate (%) survival rate Progression-free 0 0 02040600 204060 Time afer the surgery (months) Time afer the surgery (months) KIF22 low KIF22 low KIF22 high KIF22 high (c)

Figure 1: KIF22 is overexpressed in TSCC and associated with poor prognosis. (a) Representative images of KIF22 expression level in patients with TSCC by immunohistochemical staining. *e expression level of KIF22 was different in patients. (b) Immunohistochemical staining of KIF22 in adjacent normal tissues. (c) Overall survival rate and disease-free survival rate of patients with a high or low expression level of KIF22, respectively. were introduced in above cells. As shown in Figure 3(b), the 3.4. Knockdown of KIF22 Inhibits Xenograft Tumor Growth. result was similar with colony formation assays, shCAL-27 *e above data showed that KIF22 affected cell proliferation had a low cell proliferation compared with negative control in vitro. *en, to further study the role of KIF22 in TSCC, in cells, and SCC-15 cells had the same result (P < 0.05). In vivo experiments were performed to observe tumor growth previous studies, Ki67 [20, 21] and PCNA [22, 23] were in mice. CAL-27 cells and shCAT-27 (5 ×106 cells) were accepted protein markers associated with cell proliferation. injected subcutaneously into the armpit of mice, and tumor Protein expression levels of Ki67 (Figure 3(c)) and PCNA size was measured and tumor volume was calculated every (Figure 3(d)) were detected by western blot in cells trans- five days. As shown in Figure 4(a), xenograft tumor volume fected with shRNA and negative control cells (CAL-27, from CAL-27 cells was smaller than those from shCAT-27 shCAL-27, SCC-15, and shSCC-15), showing that sup- cells at every checkpoint. After 30 days, all tumors were pression of KIF22 led to a low expression of Ki67 and PCNA removed from mice and KIF22 protein expression level was (P < 0.05, respectively). *ose data indicated that KIF22 observed by western blot in tissues of xenograft tumors, might play an important role in cell proliferation in TSCC. showing that tumors from CAL-27 cells had higher BioMed Research International 5

Table 1: Relationships of KIF22 and clinicopathological characteristics in 82 patients with tongue squamous cell carcinoma. KIF22 expression 2 Feature All n � 82 Low High χ P n � 42 n � 40 Age (years) 2.905 0.088 <65 54 24 30 ≥65 28 18 10 Gender 1.179 0.278 Male 46 26 20 Female 36 16 20 Tumor stage 6.129 0.013∗ T1-2 36 24 12 T3-4 46 18 28 Differentiation 3.241 0.072 Low 24 16 8 High 58 26 32 Clinical stage 4.518 0.034∗ I-II 30 20 10 III-IV 52 22 30 Lymphatic metastasis 5.896 0.015∗ Yes 34 12 22 No 48 30 18

1.5 1.5

CAL-27 SCC-15

1.0 1.0

0.5 0.5 KIF22 expression KIF22 expression ∗ ∗

0.0 0.0 Control shRNA Control shRNA

(a)

KIF22 KIF22

β-Actin β-Actin 1.5 1.5

CAL-27 SCC-15

1.0 1.0

0.5 0.5 KIF22 expression KIF22 expression ∗ ∗

0.0 0.0 Control shRNA Control shRNA

(b)

Figure 2: Stable clone of suppression of KIF22 in CAL-27 cells and SCC-15 cells with shRNA. (a) KIF22 mRNA expression level in CAL- 27cells and SCC-15 cells transfected with shRNA to knockdown KIF22, respectively. (b) *e protein expression level of KIF22 in CAL-27 cells and SCC-15 cells was detected using western blot and quantified by ImageJ ∗P < 0.05. 6 BioMed Research International

CAL-27 TCA8113 150

100 Control

∗ 50 ∗ Colony numbers Colony

0 shRNA CAL-27 cell SCC-15 cell

Control shRNA

(a) 1.5 1.5 CAL-27 SCC-15

1.0 1.0

∗ ∗ 0.5 0.5 OD value (570nm) value OD OD value (570nm) value OD

0.0 0.0 Control shRNA Control shRNA

(b) Ki67 Ki67

β-Actin β-Actin 1.5 1.5 CAL-27 SCC-15

1.0 1.0

∗ ∗ 0.5 0.5 Ki67 expression Ki67 Ki67 expression Ki67

0.0 0.0 Control shRNA Control shRNA

(c) Figure 3: Continued. BioMed Research International 7

PCNA PCNA

1.5 β-Actin 1.5 β-Actin

CAL-27 SCC-15 1.0 1.0

∗ ∗ 0.5 0.5 PCNA expression PCNA PCNA expression PCNA

0.0 0.0 Control shRNA Control shRNA

(d)

Figure 3: Suppression of KIF22 inhibited proliferation in CAL-27 cells and SCC-15 cells. (a) Representative images of colony formation assays of CAL-27 cells transfected with shRNA (shCAL-27) and SCC-15 cells transfected with shRNA (shSCC-15) (left). Qualification result of assays (right). (b) MTTassays of CAL-27 cells, shCAL-27 cells (left) and TCA18133 cell, shTCA18133 cells. (c) Protein expression level of ki67 in CAL-27 cells and shCAL-27 cells. Same detection in SCC-15 cells and shSCC-15 cells. (d) PCNA protein expression level in CAL-27 cells and shCAL-27 cells. Same detection in TCA18133 cells and shTCA18133 cells. Data represent mean ± SD. ∗P < 0.05. expression than shCAL-27 (Figure 4(b)). Immunohisto- [36], and *r463 is conserved in many species [37, 38]. chemical staining had a similar result (Figure 4(c)). Ohsugi et al. reported that the phosphorylation of KIF22 at *r463 inhibited KIF22 connected to microtubules but 4. Discussion increased the affinity to chromosomes [36]: overexpressed KIF22 in cancers increased cell proliferation by inhibiting To the best of our knowledge, this is the first study of KIF22 CDC25C, increasing mitotic exit. in TSCC. In previous reports, it was indicated that KIF22 To further investigate the role of KIF22 in TSCC, we had a high expression in several cancer tissues and was established stable KIF22 suppression in CAL-27 and SCC-15 associated with proliferation. Yu et al. detected mRNA and cells, which were derived from human TSCC. In cell pro- protein expression levels of KIF22 in 62 primary breast liferation assays, we observed that knockdown KIF22 cancer tissues and paired adjacent normal tissues, showing inhibited colony formation and cell growth. In previous re- that KIF22, in both mRNA and protein, was upregulated in ports, Ki67 and PCNA were protein markers to detect cell primary breast cancer compared with adjacent tissues [17]. proliferation in cells, so we evaluated the expression level of *en, to further study the relationship between KIF22 and Ki67 and PCNA in CAL-27 and SCC-15 cells compared with cancer development, they analyzed KIF22 in several cancers shCAL-27 and shSCC-15 cells and found that Ki67 and PCNA in Oncomine database and confirmed that KIF22 had a high had low expression in cells transfected with shRNA. *ose expression in ovarian cancer, lung cancer, and cervical data indicated that suppression of KIF22 inhibited cell pro- cancer [17]. *e above data suggested that KIF22 was liferation in vitro. Although the results are different, we also overexpressed in several tumors and associated with poor could use similar methods to explore the mechanism [39–41]. prognosis. In our study, 82 tissues of TSCC and adjacent In human breast cancer cell line, MDA-MB-435, normal tissues were collected to detect the expression level of shcontrol cells and shKIF22 cells were inoculated into the KIF22. By analyzing KIF22 expression level in cancer tissues mammary fat pads of nude mice. After 7 weeks, the result with patients’ information, we observed that expression level showed that xenograft tumors from shKIF22 cells had of KIF22 was associated with tumor stage, clinical stage, and small tumor volume [17]. Similarly, in our study, the metastasis (P < 0.05, respectively), but there was not an animal experiments were designed to verify the role in apparent correlation with differentiation (P > 0.05). vivo. As shown in Figures 4(a) and 4(b), suppression of In the previous reports, kinesin family played an es- KIF22 in cells decreased xenograft tumor growth in nude sential role in mitosis [14, 24–26] and changed the ex- mice. *is result was similar with cellular level. Miki et al. pression level of cancer cells contributing to proliferation, reported that KIF22 was regulated by SIAH-1 [14]. A such as KIF18A [27], KIF26B [15], KIF14 [28− 30], and EG5 research reported a novel pathway between KIF22 and [31− 33]. Specific inhibitors of EG5 are in phase I or phase II EGFR, CAR. KIF22 bound to microtubules which were clinical trials [34, 35]. Yu et al. reported that cells knockdown important in receptor traffic, including EGFR [42, 43]. KIF22 display a fast S to G2/M phase but slow mitotic exit KIF22 regulated microtubule stability and upregulated [17]. Similarly, our study showed that suppression of KIF22 EGFR signaling which promoted CAR phosphorylation inhibited proliferation and xenograft tumors. KIF22 is a and relocalization at plasma membrane to increase cell novel transcriptional targeting CDC25C and negatively division [44]. regulates CDC25C in mRNA and protein levels. KIF22 exists In the process of tumorigenesis, multiple factors interact several phosphorylated sites, including Ser427 and *r463 to promote tumorigenesis and development. In a 8 BioMed Research International

600 ) 3 400 ∗ Control

200 shRNA Tumor volume (mm volume Tumor

0 5 1015202530 Days aer injection Control shRNA

(a) Control shRNA

KIF22

β-Actin 1.5 1.5

1.0 1.0

0.5 ∗ 0.5 KIF22 expression ∗ KIF22 expression

0.0 0.0 Control shRNA Control shRNA

(b) (c)

Figure 4: Knockdown KIF22 inhibited xenograft tumor growth. (a) Tumor growth curve in nude mice (left). CAL-27 cells and shCAT-27 were injected subcutaneously into the armpit of mice, tumor size was measured every 3 days, and tumor volume was calculated. Rep- resentative images of xenograft tumor (right). (b) Protein expression level of KIF22 in xenograft tumor by western blot. (c) Representative images of immunohistochemical staining of KIF22 in xenograft tumors (top) and qualification (bottom). multicenter cohort, Jin reported that the expression of and associated with poor prognosis. Inhibition of KIF22 KDM4A was an independent predictor factor for the sur- suppressed cell proliferation and xenograft tumors. *us, vival time in TSCC and significantly associated with lymph KIF22 might be a target for TSCC therapy. node metastasis and pathological stages. *is finding was validated by TCGA data [45]. Arita et al. analyzed FBXW7 Abbreviations expression between tumor tissues and paired adjacent normal tissues from 15 patients and 110 patients with TSCC, KIF22: Kinesin family member 22 showing that FBXW7 was significantly decreased in cancer KM: Kaplan–Meier tissues compared with adjacent normal tissues [46]. In our DAB: 3,3-Diaminobenzidin study, suppression effect of KIF22 was observed, and then HRP: Horseradish peroxidase downstream pathways should be detected. PCNA: Proliferating cell nuclear antigen *e limitation of this study is that this is a retrospective PBS: Phosphate-buffered saline research with a small number of cases in single center. We PAGE: Polyacrylamide gel electrophoresis observed the role of KIF22 in TSCC by only suppression of SD: Standard deviation KIF22 in vitro and in vivo. *e overexpression of KIF22 should PCR: Polymerase chain reaction be conducted to further observer the role in vitro and in vivo. DMSO: Dimethyl sulfoxide In summary, this is the first study of KIF22 in TSCC, and shRNA: Short hairpin RNA we observed that KIF22 was upregulated in tissues of TSCC TSCC: Tongue squamous cell carcinoma. BioMed Research International 9

Data Availability [12] S. T. Brady, “A novel brain ATPase with properties expected for the fast axonal transport motor,” Nature, vol. 317, *e data used to support the findings of the study are in- no. 6032, pp. 73–75, 1985. cluded within the article. [13] N. Hirokawa, Y. Noda, Y. Tanaka, and S. Niwa, “Kinesin superfamily motor proteins and intracellular transport,” Nature Reviews Molecular Cell Biology, vol. 10, no. 10, Ethical Approval pp. 682–696, 2009. All applicable international, national, and/or institutional [14] H. Miki, Y. Okada, and N. Hirokawa, “Analysis of the kinesin superfamily: insights into structure and function,” Trends in guidelines for the care and use of human specimens and Cell Biology, vol. 15, no. 9, pp. 467–476, 2005. animals were followed. *e animal study was carried out in [15] Q. Wang, Z. B. Zhao, G. Wang et al., “High expression of accordance with the guidelines approved by the Animal KIF26B in breast cancer associates with poor prognosis,” PloS Experimentation Ethics Committee of Tianjin First Central One, vol. 8, no. 4, Article ID e61640, 2013. Hospital. *e protocol was approved by the committee, and [16] N. Tokai, A. Fujimoto-Nishiyama, Y. Toyoshima et al., “Kid, a all efforts were made to minimize suffering. novel kinesin-like DNA binding protein, is localized to chromosomes and the mitotic spindle,” @e EMBO Journal, Conflicts of Interest vol. 15, no. 3, pp. 457–467, 1996. [17] Y. Yu, X.-Y. Wang, L. Sun et al., “Inhibition of KIF22 sup- *e authors declare that they have no conflicts of interest. presses cancer cell proliferation by delaying mitotic exit through upregulating CDC25C expression,” Carcinogenesis, vol. 35, no. 6, pp. 1416–1425, 2014. References [18] H. Bruzzoni-Giovanelli, P. Fernandez, L. Veiga et al., “Distinct [1] J. Ferlay, E. Steliarova-Foucher, J. Lortet-Tieulent et al., expression patterns of the E3 ligase SIAH-1 and its partner “Cancer incidence and mortality patterns in Europe: estimates Kid/KIF22 in normal tissues and in the breast tumoral for 40 countries in 2012,” European Journal of Cancer, vol. 49, processes,” Journal of Experimental & Clinical Cancer Re- no. 6, pp. 1374–1403, 2013. search, vol. 29, p. 10, 2010. [2] M. A. Raffat, N. I. Hadi, M. Hosein, S. Mirza, S. Ikram, and [19] S. Naito, A. C. von Eschenbach, R. Giavazzi, and I. J. Fidler, Z. Akram, “S100 proteins in oral squamous cell carcinoma,” “Growth and metastasis of tumor cells isolated from a human Clinica Chimica Acta, vol. 480, pp. 143–149, 2018. renal cell carcinoma implanted into different organs of nude [3] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, mice,” Cancer Research, vol. 46, no. 8, pp. 4109–4115, 1986. 2017,” CA: A Cancer Journal for Clinicians, vol. 67, no. 1, [20] T. Scholzen and J. Gerdes, “*e Ki-67 protein: from the pp. 7–30, 2017. known and the unknown,” Journal of Cellular Physiology, [4] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, vol. 182, no. 3, pp. 311–322, 2000. 2018,” CA: A Cancer Journal for Clinicians, vol. 68, no. 1, [21] Z. Darzynkiewicz, H. Zhao, S. Zhang, M. Y. Lee, E. Y. Lee, and pp. 7–30, 2018. Z. Zhang, “Initiation and termination of DNA replication [5] K. D. Shield, J. Ferlay, A. Jemal et al., “*e global incidence of during S phase in relation to cyclins D1, E and A, p21WAF1, lip, oral cavity, and pharyngeal cancers by subsite in 2012,” Cdt1 and the p12 subunit of DNA polymerase delta revealed CA: A Cancer Journal for Clinicians, vol. 67, no. 1, pp. 51–64, in individual cells by cytometry,” Oncotarget, vol. 6, no. 14, 2017. pp. 11735–11750, 2015. [6] T. Sasahira, A. K. Bosserhoff, and T. Kirita, “*e importance [22] F. J. Kubben, A. Peeters-Haesevoets, L. G. Engels et al., of melanoma inhibitory activity gene family in the tumor “Proliferating cell nuclear antigen (PCNA): a new marker to progression of oral cancer,” Pathology International, vol. 68, study human colonic cell proliferation,” Gut, vol. 35, no. 4, no. 5, pp. 278–286, 2018. pp. 530–535, 1994. [7] H. Mehanna, V. Paleri, C. M. L. West, and C. Nutting, “Head [23] R. Bologna-Molina, A. Mosqueda-Taylor, N. Molina-Fre- and neck cancer-part 1: epidemiology, presentation, and chero, A. Mori-Estevez, and G. Sanchez-Acuna, “Comparison preservation,” Clinical Otolaryngology, vol. 36, no. 1, of the value of PCNA and Ki-67 as markers of cell pro- pp. 65–68, 2011. liferation in ameloblastic tumors,” Medicina Oral Patolog´ıa [8] L. Boldrup, P. J. Coates, G. Laurell, T. Wilms, R. Fahraeus, and Oral Y Cirugia Bucal, vol. 18, no. 2, pp. e174–e179, 2013. K. Nylander, “Downregulation of miRNA-424: a sign of field [24] C. Zhu, J. Zhao, M. Bibikova et al., “Functional analysis of cancerisation in clinically normal tongue adjacent to squa- human microtubule-based motor proteins, the kinesins and mous cell carcinoma,” British Journal of Cancer, vol. 112, dyneins, in mitosis/cytokinesis using RNA interference,” no. 11, pp. 1760–1765, 2015. Molecular Biology of the Cell, vol. 16, no. 7, pp. 3187–3199, [9] R. Vale, T. Reese, and M. Sheetz, “Identification of a novel 2005. force-generating protein, kinesin, involved in microtubule- [25] A. A. Levesque and D. A. Compton, “*e chromokinesin Kid based motility,” Cell, vol. 42, no. 1, pp. 39–50, 1985. is necessary for chromosome arm orientation and oscillation, [10] W. M. Saxton, M. E. Porter, S. A. Cohn, J. M. Scholey, but not congression, on mitotic spindles,” @e Journal of Cell E. C. Raff, and J. R. McIntosh, “Drosophila kinesin: charac- Biology, vol. 154, no. 6, pp. 1135–1146, 2001. terization of microtubule motility and ATPase,” Proceedings [26] S. Soeda, K. Yamada-Nomoto, and M. Ohsugi, “*e micro- of the National Academy of Sciences, vol. 85, no. 4, tubule-binding and coiled-coil domains of Kid are required to pp. 1109–1113, 1988. turn off the polar ejection force at anaphase,” Journal of Cell [11] J. M. Scholey, M. E. Porter, P. M. Grissom, and J. R. McIntosh, Science, vol. 129, no. 19, pp. 3609–3619, 2016. “Identification of kinesin in sea urchin eggs, and evidence for [27] C. Zhang, C. Zhu, H. Chen et al., “Kif18A is involved in its localization in the mitotic spindle,” Nature, vol. 318, human breast carcinogenesis,” Carcinogenesis, vol. 31, no. 9, no. 6045, pp. 483–486, 1985. pp. 1676–1684, 2010. 10 BioMed Research International

[28] J. Madhavan, K. Coral, K. Mallikarjuna et al., “High ex- promote cancer cell proliferation,” Science Signaling, vol. 11, pression of KIF14in retinoblastoma: association with older no. 515, Article ID eaaq1060, 2018. age at diagnosis,” Investigative Opthalmology & Visual Sci- [45] X. Jin, H. Xu, X. Wu et al., “KDM4A as a prognostic marker of ence, vol. 48, no. 11, pp. 4901–4906, 2007. oral squamous cell carcinoma: evidence from tissue micro- [29] T. W. Corson and B. L. Gallie, “KIF14 mRNA expression is a array studies in a multicenter cohort,” Oncotarget, vol. 8, predictor of grade and outcome in breast cancer,” In- no. 46, pp. 80348–80357, 2017. ternational Journal of Cancer, vol. 119, no. 5, pp. 1088–1094, [46] H. Arita, M. Nagata, R. Yoshida et al., “FBXW7 expression 2006. affects the response to chemoradiotherapy and overall sur- [30] T. W. Corson, A. Huang, M.-S. Tsao, and B. L. Gallie, “KIF14 vival among patients with oral squamous cell carcinoma: a is a candidate oncogene in the 1q minimal region of genomic single-center retrospective study,” Tumor Biology, vol. 39, gain in multiple cancers,” Oncogene, vol. 24, no. 30, no. 10, 2017. pp. 4741–4753, 2005. [31] J. Remon, N. Abedallaa, E. Taranchon-Clermont et al., “CD52, CD22, CD26, EG5 and IGF-1R expression in thymic malig- nancies,” Lung Cancer, vol. 108, pp. 168–172, 2017. [32] C. Liu, N. Zhou, J. Li, J. Kong, X. Guan, and X. Wang, “Eg5 overexpression is predictive of poor prognosis in hepato- cellular carcinoma patients,” Disease Markers, vol. 2017, Article ID 2176460, 9 pages, 2017. [33] Q. Jin, F. Huang, X. Wang et al., “High Eg5 expression predicts poor prognosis in breast cancer,” Oncotarget, vol. 8, no. 37, pp. 62208–62216, 2017. [34] D. Huszar, M. E. *eoclitou, J. Skolnik, and R. Herbst, “Kinesin motor proteins as targets for cancer therapy,” Cancer and Metastasis Reviews, vol. 28, no. 1-2, pp. 197–208, 2009. [35] J. R. Infante, A. Patnaik, C. F. Verschraegen et al., “Two Phase 1 dose-escalation studies exploring multiple regimens of litronesib (LY2523355), an Eg5 inhibitor, in patients with advanced cancer,” Cancer Chemotherapy and Pharmacology, vol. 79, no. 2, pp. 315–326, 2017. [36] M. Ohsugi, N. Tokai-Nishizumi, K. Shiroguchi, Y. Y. Toyoshima, J. Inoue, and T. Yamamoto, “Cdc2-mediated phosphorylation of Kid controls its distribution to spindle and chromosomes,” @e EMBO Journal, vol. 22, no. 9, pp. 2091–2103, 2003. [37] C. Antonio, I. Ferby, H. Wilhelm et al., “Xkid, a chromoki- nesin required for chromosome alignment on the metaphase plate,” Cell, vol. 102, no. 4, pp. 425–435, 2000. [38] H. Funabiki and A. W. Murray, “*e Xenopus chromokinesin Xkid is essential for metaphase chromosome alignment and must be degraded to allow anaphase chromosome move- ment,” Cell, vol. 102, no. 4, pp. 411–424, 2000. [39] M. Yang, L. Zhang, X. Wang, Y. Zhou, and S. Wu, “Down- regulation of miR-203a by lncRNA PVT1 in multiple mye- loma promotes cell proliferation,” Archives of Medical Science, vol. 14, no. 6, pp. 1333–1339, 2018. [40] J.-Y. Li, C.-P. Liu, W.-C. Shiao et al., “Inhibitory effect of PDGF-BB and serum-stimulated responses in vascular smooth muscle cell proliferation by hinokitiol via up-regu- lation of p21 and p53,” Archives of Medical Science, vol. 14, no. 3, pp. 579–587, 2018. [41] Z. Luo, J. Pan, Y. Ding, Y. S. Zhang, and Y. Zeng, “*e function and clinical relevance of lncRNA UBE2CP3-001 in human gliomas,” Archives of Medical Science, vol. 14, no. 3, pp. 1308–1320, 2018. [42] W. Liu, L. X. Fan, X. Zhou, W. E. Sweeney Jr., E. D. Avner, and X. Li, “HDAC6 regulates epidermal growth factor receptor (EGFR) endocytic trafficking and degradation in renal epi- thelial cells,” PloS One, vol. 7, no. 11, Article ID e49418, 2012. [43] Z. Yao, K. Darowski, N. St-Denis et al., “A global analysis of the receptor tyrosine kinase-protein phosphatase inter- actome,” Molecular Cell, vol. 65, no. 2, pp. 347–360, 2017. [44] R. Pike, E. Ortiz-Zapater, B. Lumicisi, G. Santis, and M. Parsons, “KIF22 coordinates CAR and EGFR dynamics to M EDIATORSof INFLAMMATION

The Scientifc Gastroenterology Journal of Research and Practice Diabetes Research Disease Markers World Journal Hindawi Hindawi Publishing Corporation Hindawi www.hindawi.com Volume 2018 Hindawi Hindawi http://www.hindawi.comwww.hindawi.com Volume 20182013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal of International Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Submit your manuscripts at www.hindawi.com

BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal of Obesity

Evidence-Based Journal of Stem Cells Complementary and Journal of Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013

Parkinson’s Disease

Computational and Mathematical Methods Behavioural AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018