DOCSLIB.ORG

Retinoic Acid Synthesis and Degradation: Implications for Proper

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Retinoic Acid Synthesis and Degradation: Implications for Proper RETINOIC ACID SYNTHESIS AND DEGRADATION: IMPLICATIONS FOR PROPER GERM CELL DEVELOPMENT By TRAVIS KENT A dissertation submitted in partial fulfilment of the requirements for the degree of DOCTOR OF PHILOSOPHY WASHINGTON STATE UNIVERSITY School of Molecular Biosciences DECEMBER 2015 © Copyright by TRAVIS KENT, 2015 All Rights Reserved © Copyright by TRAVIS KENT, 2015 All Rights Reserved To the Faculty of Washington State University: The members of the Committee appointed to examine the dissertation of TRAVIS KENT find it satisfactory and recommend that it be accepted. ____________________________________ Michael Griswold, Ph.D., Chair ____________________________________ Kwan Hee Kim, Ph.D. ____________________________________ Jon Oatley, Ph.D. ____________________________________ Terry Hassold, Ph.D. ii ACKNOWLEDGEMENTS I would like to take this opportunity to thank the people who have helped me get to where I am in my professional career. Much of the work presented in this document would not have been possible without the technical expertise from the Isoherranen and the Hassold-Hunt Laboratories. I would also like to thank my colleagues, both past and present in the Griswold Laboratory for their support over the years. My committee has also provided a much needed critical eye to my work. Finally, I would like to thank my friends and family who have provided me with the emotional support needed for me to persevere and thrive at Washington State. iii RETINOIC ACID SYNTHESIS AND DEGRADATION: IMPLICATIONS FOR PROPER GERM CELL DEVELOPMENT Abstract by Travis Kent, Ph.D. Washington State University December 2015 Chair: Michael D. Griswold Spermatogenesis is absolutely essential for mammalian reproduction. This highly organized and tightly controlled process is regulated, in part, by retinoic acid (RA). This essential molecule plays key roles in many aspects of spermatogenesis, namely spermatogonial differentiation, blood-testis barrier (BTB) reorganization, meiotic initiation, and spermiation. While the importance of RA is well known, the regulation of this molecule has not been well studied. RA availability is directly influenced by its synthesis and degradation, metabolized by the ALDH and CYP26 families respectively. It has recently been published that RA is present in a pulsatile manner across the spermatogenic cycle, but it is not known if these enzyme families play a role in this stage-specific availability of RA. The data presented here provides strong evidence that neither the ALDHs nor the CYP26s are regulated in a cyclic manner, suggesting that the availability of retinaldehyde, the precursor of RA, is responsible of the observed pulsatility. In addition to investigating the stage-specificity of the ALDH and CYP26 enzymes, specific inhibitors were used to investigate the effects on spermatogenesis in a high and low testicular RA environment. The data presented here shows that CYP26 inhibition causes precocious spermatogonial differentiation in the adult mouse and is able to drive synchronous spermatogenesis in the neonatal mouse. Additionally, both low and high testicular RA iv environments had abnormal effects on Sertoli cells. After inhibiting RA synthesis, BTB permeability was shown to be increased. Conversely, neonatal animals treated with exogenous RA were shown to have reduced Sertoli cell number, possibly due to premature cessation of proliferation. Finally, meiotic recombination was shown to be increased and decreased in a low and high testicular RA environment, respectively. These data highlight the importance of proper RA homeostasis within the testis, and illuminate some of the consequences of abnormal RA levels. Taken all together, the data presented in this work show the importance of understanding the expression and function of the ALDH and CYP26 enzymes in the mammalian testis. v TABLE OF CONTENTS Page ACKNOWLEDGEMENTS ..................................................................................................... iii ABSTRACT ............................................................................................................................. iv LIST OF TABLES ................................................................................................................... ix LIST OF FIGURES ...................................................................................................................x DEDICATION ........................................................................................................................ xii CHAPTER 1: Checking the Pulse of Vitamin A Metabolism and Signaling during Mammalian Spermatogenesis 1. TITLE PAGE ...........................................................................................................2 2. ABSTRACT .............................................................................................................3 3. INTRODUCTION ...................................................................................................4 4. SPERMATOGENESIS ............................................................................................5 5. VITAMIN A METABOLISM .................................................................................6 6. THE ROLE OF RA DURING SPERMATOGENESIS ..........................................7 a. Spermatogonial differentiation ....................................................................7 b. Meiosis .......................................................................................................10 c. Blood-testis barrier (BTB) .........................................................................11 d. Spermiogenesis and Spermiation ...............................................................13 7. WHAT IS THE CAUSE OF STAGE-SPECIFIC RA RESPONSE? ....................15 a. Retinoid metabolism ..................................................................................15 b. Retinoid signaling ......................................................................................16 c. Retinoid transport and storage ...................................................................17 vi 8. CONCLUSIONS....................................................................................................18 9. AKNOWLEDGEMENTS......................................................................................18 10. AUTHOR CONTRIBUTION ................................................................................19 11. CONFLICTS OF INTEREST ................................................................................19 12. REFERENCES AND NOTES ...............................................................................19 13. FIGURES ...............................................................................................................28 CHAPTER 2: ALDH enzyme expression is independent of the spermatogenic cycle and their inhibition causes misregulation of murine spermatogenesis 1. TITLE PAGE .........................................................................................................32 2. ABSTRACT ...........................................................................................................33 3. INTRODUCTION .................................................................................................34 4. METHODS AND MATERIALS ...........................................................................38 5. RESULTS ..............................................................................................................48 6. DISCUSSION ........................................................................................................54 7. AKNOWLEDGEMENTS......................................................................................60 8. REFERENCES ......................................................................................................61 9. FIGURES ...............................................................................................................69 10. TABLES ................................................................................................................82 CHAPTER3: Increased testicular RA has abnormal effects on spermatogenesis 1. TITLE PAGE .......................................................................................................122 2. ABSTRACT .........................................................................................................123 3. INTRODUCTION ...............................................................................................124 vii 4. METHODS AND MATERIALS .........................................................................127 5. RESULTS ............................................................................................................133 6. DISCUSSION ......................................................................................................137 7. AKNOWLEDGEMENTS....................................................................................141 8. REFERENCES ....................................................................................................142 9. FIGURES .............................................................................................................147 10. TABLES ..............................................................................................................157 CHAPTER 4: Conclusions and Future Directions 1. CONCLUSIONS..................................................................................................159 2. FUTURE DIRECTIONS .....................................................................................164
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd
    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Izumo1 (NM 001018013) Mouse Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC211426 Izumo1 (NM_001018013) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Izumo1 (NM_001018013) Mouse Untagged Clone Tag: Tag Free Symbol: Izumo1 Synonyms: 1700058F15Rik; Izumo Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC211426 representing NM_001018013 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGCCGCATTTTACACTCTTGCTGGCAGCTCTTGCCAACTGCCTGTGTCCAGGGAGGCCCTGCATCA AATGTGACCAGTTTGTGACAGATGCGCTAAAGACTTTCGAAAACACTTACCTGAATGACCACCTGCCACA CGACATTCACAAAAATGTAATGAGGATGGTGAACCATGAAGTATCGAGCTTCGGCGTAGTCACTTCGGCT GAGGATTCCTATTTGGGGGCCGTGGACGAGAACACACTGGAACAAGCAACCTGGAGTTTTCTGAAGGATC TGAAGCGTATTACAGACAGTGACTTAAAAGGAGAGCTCTTTATAAAGGAACTATTGTGGATGCTTCGTCA TCAAAAGGACATCTTTAACAATCTTGCTAGACAGTTCCAAAAGGAAGTTCTTTGTCCCAACAAATGCGGA GTGATGTCGCAGACTTTGATCTGGTGTCTTAAGTGCGAAAAGCAGTTGCACATTTGTCGGAAATCCCTAG ATTGTGGAGAGCGCCACATAGAGGTACATCGCTCGGAAGACCTGGTCCTGGACTGTCTGCTCAGTTGGCA TCGTGCTTCTAAGGGACTTACAGATTACAGTTTTTACAGGGTTTGGGAGAACAGTTCTGAGACCTTGATT GCCAAGGGGAAAGAACCATATCTGACCAAGTCGATGGTGGGTCCAGAGGATGCTGGCAACTACCGCTGTG TGCTAGATACCATCAACCAAGGTCATGCCACCGTCATCCGCTACGATGTCACAGTATTGCCCCCAAAGCA TTCAGAGGAAAACCAACCACCGAACATCATAACCCAAGAGGAGCACGAGACTCCTGTCCACGTGACTCCA CAGACACCACCGGGGCAGGAGCCAGAGTCGGAGCTGTACCCGGAGCTGCACCCAGAGTTGTACCCGGAGC
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Binding of Sperm Protein Izumo1 and Its Egg Receptor Juno Drives Cd9
    © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 3732-3739 doi:10.1242/dev.111534 RESEARCH ARTICLE Binding of sperm protein Izumo1 and its egg receptor Juno drives Cd9 accumulation in the intercellular contact area prior to fusion during mammalian fertilization Myriam Chalbi1, Virginie Barraud-Lange2, Benjamin Ravaux1, Kevin Howan1, Nicolas Rodriguez3, Pierre Soule3, Arnaud Ndzoudi2, Claude Boucheix4,5, Eric Rubinstein4,5, Jean Philippe Wolf2, Ahmed Ziyyat2, Eric Perez1, Frédéric Pincet1 and Christine Gourier1,* ABSTRACT 2006), have so far been shown to be essential. These three Little is known about the molecular mechanisms that induce gamete molecules are also present on human egg and sperm cells. Izumo1 fusion during mammalian fertilization. After initial contact, adhesion is a testis immunoglobulin superfamily type 1 (IgSF) protein, between gametes only leads to fusion in the presence of three expressed at the plasma membrane of acrosome-reacted sperm (Satouh et al., 2012), and is highly conserved in mammals (Grayson membrane proteins that are necessary, but insufficient, for fusion: Izumo1 Izumo1 on sperm, its receptor Juno on egg and Cd9 on egg. What and Civetta, 2012). Female mice deleted for the gene have happens during this adhesion phase is a crucial issue. Here, we normal fertility, but males are completely sterile despite normal mating behavior and normal sperm production (Inoue et al., 2005). demonstrate that the intercellular adhesion that Izumo1 creates with Cd9−/− Juno is conserved in mouse and human eggs. We show that, along Similar features are observed for Cd9 on egg cells. female are healthy but severely subfertile because of defective sperm-egg with Izumo1, egg Cd9 concomitantly accumulates in the adhesion in vivo area.
    [Show full text]
  • Looking for Missing Proteins in the Proteome Of
    Looking for Missing Proteins in the Proteome of Human Spermatozoa: An Update Yves Vandenbrouck, Lydie Lane, Christine Carapito, Paula Duek, Karine Rondel, Christophe Bruley, Charlotte Macron, Anne Gonzalez de Peredo, Yohann Coute, Karima Chaoui, et al. To cite this version: Yves Vandenbrouck, Lydie Lane, Christine Carapito, Paula Duek, Karine Rondel, et al.. Looking for Missing Proteins in the Proteome of Human Spermatozoa: An Update. Journal of Proteome Research, American Chemical Society, 2016, 15 (11), pp.3998-4019. 10.1021/acs.jproteome.6b00400. hal-02191502 HAL Id: hal-02191502 https://hal.archives-ouvertes.fr/hal-02191502 Submitted on 19 Mar 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Journal of Proteome Research 1 2 3 Looking for missing proteins in the proteome of human spermatozoa: an 4 update 5 6 Yves Vandenbrouck1,2,3,#,§, Lydie Lane4,5,#, Christine Carapito6, Paula Duek5, Karine Rondel7, 7 Christophe Bruley1,2,3, Charlotte Macron6, Anne Gonzalez de Peredo8, Yohann Couté1,2,3, 8 Karima Chaoui8, Emmanuelle Com7, Alain Gateau5, AnneMarie Hesse1,2,3, Marlene 9 Marcellin8, Loren Méar7, Emmanuelle MoutonBarbosa8, Thibault Robin9, Odile Burlet- 10 Schiltz8, Sarah Cianferani6, Myriam Ferro1,2,3, Thomas Fréour10,11, Cecilia Lindskog12,Jérôme 11 1,2,3 7,§ 12 Garin , Charles Pineau .
    [Show full text]
  • © Copyright 2018 Faith M. Stevison
    © Copyright 2018 Faith M. Stevison In Vitro to In Vivo Translation of Complex Drug-Drug Interactions Involving Retinoic Acid Faith M. Stevison A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2018 Reading Committee: Nina Isoherranen, Chair Kenneth E. Thummel Yvonne S. Lin Program Authorized to Offer Degree: Pharmaceutics University of Washington Abstract In Vitro to In Vivo Translation of Complex Drug-Drug Interactions Involving Retinoic Acid Faith M. Stevison Chair of the Supervisory Committee: Professor and Vice Chair, Nina Isoherranen Pharmaceutics all-trans-retinoic acid (atRA), the active metabolite of vitamin A, is a ligand for several nuclear receptors and acts as a critical regulator of many physiological processes. The cytochrome P450 26 (CYP26) enzymes are responsible for atRA clearance and are potential drug targets to increase concentrations of endogenous atRA in a tissue-specific manner. The first project of this thesis aimed to establish the relationship between CYP26 inhibition, by the potent CYP26A1 and B1 inhibitor talarozole, and altered atRA concentrations in tissues, and to quantify the increase in endogenous atRA concentrations necessary to alter atRA signaling in target organs. The second part of this thesis focused on evaluating exogenous atRA and retinoid dosing on gene regulation. Several in vitro and preclinical studies have suggested that atRA down-regulates CYP2D6 expression and activity. Both atRA and its stereoisomer 13-cis retinoic acid (13cisRA) are used clinically, and steady state exposures of atRA are similar after dosing with atRA or 13cisRA. The second aim of this thesis was to determine whether 13-cis retinoic acid (13cisRA) or its active metabolites, atRA and 4-oxo-13cisRA, cause a drug-drug interaction (DDI) with CYP2D6, decreasing the clearance of the CYP2D6 probe dextromethorphan.
    [Show full text]
  • Robert Foti to Cite This Version
    Characterization of xenobiotic substrates and inhibitors of CYP26A1, CYP26B1 and CYP26C1 using computational modeling and in vitro analyses Robert Foti To cite this version: Robert Foti. Characterization of xenobiotic substrates and inhibitors of CYP26A1, CYP26B1 and CYP26C1 using computational modeling and in vitro analyses. Agricultural sciences. Université Nice Sophia Antipolis, 2016. English. NNT : 2016NICE4033. tel-01376678 HAL Id: tel-01376678 https://tel.archives-ouvertes.fr/tel-01376678 Submitted on 5 Oct 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Université de Nice-Sophia Antipolis Thèse pour obtenir le grade de DOCTEUR DE L’UNIVERSITE NICE SOPHIA ANTIPOLIS Spécialité : Interactions Moléculaires et Cellulaires Ecole Doctorale : Sciences de la Vie et de la Santé (SVS) Caractérisation des substrats xénobiotiques et des inhibiteurs des cytochromes CYP26A1, CYP26B1 et CYP26C1 par modélisation moléculaire et études in vitro présentée et soutenue publiquement par Robert S. Foti Le 4 Juillet 2016 Membres du jury Dr. Danièle Werck-Reichhart Rapporteur Dr. Philippe Roche Rapporteur Pr. Serge Antonczak Examinateur Dr. Philippe Breton Examinateur Pr. Philippe Diaz Examinateur Dr. Dominique Douguet Directrice de thèse 1 1. Table of Contents 1. Table of Contents ..............................................................................................................................
    [Show full text]
  • Restoring Retinoic Acid Attenuates Intestinal Inflammation and Tumorigenesis in APC Min/+ Mice
    Published OnlineFirst September 16, 2016; DOI: 10.1158/2326-6066.CIR-15-0038 Research Article Cancer Immunology Research Restoring Retinoic Acid Attenuates Intestinal Inflammation and Tumorigenesis in APCMin/þ Mice Hweixian Leong Penny1, Tyler R. Prestwood1, Nupur Bhattacharya1, Fionna Sun1, Justin A. Kenkel1, Matthew G. Davidson1, Lei Shen1, Luis A. Zuniga2, E. Scott Seeley1, Reetesh Pai3, Okmi Choi1, Lorna Tolentino1, Jinshan Wang4, Joseph L. Napoli4, and Edgar G. Engleman1 Abstract Chronic intestinal inflammation accompanies familial adeno- exhibited further reductions in intestinal RA with concomitant matous polyposis (FAP) and is a major risk factor for colorectal increases in inflammation and tumor burden. Conversely, resto- cancer in patients with this disease, but the cause of such inflam- ration of RA by pharmacologic blockade of the RA-catabolizing mation is unknown. Because retinoic acid (RA) plays a critical role enzyme CYP26A1 attenuated inflammation and diminished in maintaining immune homeostasis in the intestine, we hypoth- tumor burden. To investigate the effect of RA deficiency on the esized that altered RA metabolism contributes to inflammation gut immune system, we studied lamina propria dendritic cells and tumorigenesis in FAP. To assess this hypothesis, we analyzed (LPDC) because these cells play a central role in promoting þ RA metabolism in the intestines of patients with FAP as well as tolerance. APCMin/ LPDCs preferentially induced Th17 cells, but þ APCMin/ mice, a model that recapitulates FAP in most respects. reverted to inducing Tregs following restoration of intestinal RA We also investigated the impact of intestinal RA repletion and in vivo or direct treatment of LPDCs with RA in vitro.
    [Show full text]
  • Datasheet Inhibitors / Agonists / Screening Libraries a DRUG SCREENING EXPERT
    Datasheet Inhibitors / Agonists / Screening Libraries A DRUG SCREENING EXPERT Product Name : Talarozole R enantiomer Catalog Number : T13422L CAS Number : 870093-23-5 Molecular Formula : C21H23N5S Molecular Weight : 377.51 Description: Talarozole R enantiomer is a potent and selective inhibitor of cytochrome P450 26-mediated breakdown of endogenous all-trans retinoic acid. Storage: 2 years -80°C in solvent; 3 years -20°C powder; DMSO 51 mg/mL (135.10 mM) Solubility ( < 1 mg/ml refers to the product slightly soluble or insoluble ) Receptor (IC50) Others In vitro Activity Talarozole R enantiomer treatment increased the mRNA expression of CRABP2, KRT4, CYP26A1, and CYP26B1 dose- dependently, and decreased the expression of KRT2 and IL-1alpha compared with vehicle-treated skin. No mRNA change in retinol-metabolizing enzymes was obtained. There was no induction of epidermal thickness or overt skin inflammation in talarozole-treated skin. Immunofluorescence analysis confirmed the upregulation of KRT4 protein, but no upregulation of CYP26A1 and CYP26B1 expression was detected [1] [2]. In vivo Activity Talarozole R enantiomer slightly diffused into the skin only when dissolved in propylene glycol, isopropyl myristate, or ethanol. Although only 0.1% of the dose applied was found in the skin itself after 12-24 h, this was sufficient to achieve local concentrations well above the half-maximal inhibitory concentration value for talarozole. The distribution of talarozole within the skin was investigated: 80% was located in the epidermis, while the remaining 20% was found in the dermis [3]. Reference 1. Pavez Loriè E, Cools M, Borgers M, Topical treatment with CYP26 inhibitor talarozole (R115866) dose dependently alters the expression of retinoid-regulated genes in normal human epidermis.
    [Show full text]
  • Transcriptomics and Genomics in Prostate Cancer
    Transcriptomics and Genomics in Prostate Cancer Prof. Dr. Guido Jenster Experimental Urological Oncology Erasmus MC Rotterdam [email protected] Basic Research: The prostate cancer problem Transcriptomics and genomics of prostate cancer - What is the PCa problem and how to address it? - DNA sequencing - Common, rare and private mutations - Personalized Medicine - Metastasis - RNA sequencing - Small RNAs - Long RNAs - Liquid biopsies The prostate cancer problem How to address the prostate cancer problem: Early detection and cure via Hormone-, chemo-, immuno- Prevention surgery/radiation therapy therapy Bone metastasis Functional: Markers: Therapy targets: Understanding the -cancer risk? -which new medicines? components and -cancer present? -which order and combination? processes responsible -treatment needed? -therapy resistance? for cancer development -which treatment? and progression -treatment successful? Markers and therapy targets for prostate cancer Markers and therapy targets: An inventory of the differences between normal and cancer cells: Fusion genes DNA Gene mutations Novel RNAs RNA Small RNAs PCa nanobodies Protein Androgen receptor Metabolites Hormones Fatty acids Morphology Exosomes Cellular behavior Pathology / Imaging Genes and pathways responsible for prostate cancer initiation and progression TMPRSS2-ERG fusion PTEN inactivation Myc overexpression P53 AR inactivation amplification DNAseq Data Analysis Copy Number SNVs / InDels Abberations TF Binding B-Allele Frequency DNAseq data Chromatin Interactions Structural Variations
    [Show full text]