The Small Gtpase Rac1 Contributes to Extinction of Aversive Memories

7096 • The Journal of Neuroscience, July 26, 2017 • 37(30):7096–7110

Behavioral/Cognitive The Small GTPase Rac1 Contributes to Extinction of Aversive

Memories of Drug Withdrawal by Facilitating GABAA Receptor Endocytosis in the vmPFC

Weisheng Wang,1* Yun-Yue Ju,1* Qi-Xin Zhou,2* Jian-Xin Tang,3 Meng Li,2 Lei Zhang,4 Shuo Kang,1 Zhong-Guo Chen,1 Yu-Jun Wang,1 Hui Ji,3 XYu-Qiang Ding,4 XLin Xu,2,5,6 and Jing-Gen Liu1 1Key Laboratory of Receptor Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences and Collaborative Innovation Center for Brain Science, Shanghai 201203, China, 2Key Laboratory of Animal Models and Human Disease Mechanisms, and Laboratory of Learning and Memory, Kunming Institute of Zoology, Chinese Academy of Science, Kunming 650223, China, 3Department of Pharmacology, China Pharmaceutical University, Nanjing 210009, China, 4Department of Anatomy and Neurobiology, Collaborative Innovation Center for Brain Science, Tongji University School of Medicine, Shanghai 200092, China, 5KIZ-SU Joint Laboratory of Animal Model and Drug Development, College of Pharmaceutical Sciences, Soochow University, Suzhou 215123, China, and 6CAS Center for Excellence in Brain Science and Intelligence Technology, Shanghai 200031, China

Extinction of aversive memories has been a major concern in neuropsychiatric disorders, such as anxiety disorders and drug addiction. However, the mechanisms underlying extinction of aversive memories are not fully understood. Here, we report that extinction of conditionedplaceaversion(CPA)tonaloxone-precipitatedopiatewithdrawalinmaleratsactivatesRhoGTPaseRac1intheventromedial prefrontal cortex (vmPFC) in a BDNF-dependent manner, which determines GABAA receptor (GABAAR) endocytosis via triggering synaptic translocation of activity-regulated cytoskeleton-associated protein (Arc) through facilitating actin polymerization. Active Rac1 is essential and sufficient for GABAAR endocytosis and CPA extinction. Knockdown of Rac1 expression within the vmPFC of rats using Rac1-shRNAsuppressedGABAARendocytosisandCPAextinction,whereasexpressionofaconstitutivelyactiveformofRac1accelerated GABAAR endocytosis and CPA extinction. The crucial role of GABAAR endocytosis in the LTP induction and CPA extinction is evinced by the findings that blockade of GABAAR endocytosis by a dynamin function-blocking peptide (Myr-P4) abolishes LTP induction and CPA extinction. Thus, the present study provides first evidence that Rac1-dependent GABAAR endocytosis plays a crucial role in extinction of aversive memories and reveals the sequence of molecular events that contribute to learning experience modulation of synaptic GABAAR endocytosis.

Key words: aversive memory; drug withdrawal; endocytosis; extinction; GABAA receptor; Rac1

Significance Statement

This study reveals that Rac1-dependent GABAAR endocytosis plays a crucial role in extinction of aversive memories associated with drug withdrawal and identifies Arc as a downstream effector of Rac1 regulations of synaptic plasticity as well as learning and memory, thereby suggesting therapeutic targets to promote extinction of the unwanted memories.

Introduction drug taking (Koob, 2000; Hutcheson et al., 2001). Extinction of The aversive memory associated with drug withdrawal can evoke such memory has been proposed as a therapeutic strategy for the motivational and/or emotional states that lead to compulsive treatment of drug addiction (Barad, 2005; Davis et al., 2006; Hof- mann et al., 2006). Our previous study demonstrates that epigenetic regulation within the ventromedial prefrontal cortex (vmPFC) of Received Dec. 19, 2016; revised June 1, 2017; accepted June 8, 2017. Author contributions: W.W., Y.-Y.J., and Y.-Q.D. designed research; W.W., Y.-Y.J., Q.-X.Z., J.-X.T., M.L., L.Z., S.K., Z.-G.C., Y.-J.W., and H.J. performed research; W.W. and Y.-Y.J. analyzed data; L.X. and J.-G.L. wrote the paper. Correspondence should be addressed to either of the following: Dr. Lin Xu, Key Laboratory of Animal Models and This work was supported by Ministry of Science and Technology of China Grants 2013CB835100 and Human Disease Mechanisms, and Laboratory of Learning and Memory, Kunming Institute of Zoology, Chinese 2015CB553502 to J.-G.L., Ministry of Science and Technology of China Grant 2013CB8351003 to L.X., Foundation of Academy of Science, Kunming 650223, China, E-mail: [email protected]; or Dr. Jing-Gen Liu, Key Laboratory of National Natural Science of China Grants 81130087 and 91232716 to J.-G.L., and Committee of Science and Tech- ReceptorResearch,ShanghaiInstituteofMateriaMedica,ChineseAcademyofSciencesandCollaborativeInnovation nology of Shanghai Grant 13JC140680 to J.-G.L. Center for Brain Science, Shanghai 201203, China, E-mail: [email protected]. The authors declare no competing financial interests. DOI:10.1523/JNEUROSCI.3859-16.2017 *W.W., Y.-Y.J., and Q.-X.Z. contributed equally to this work. Copyright © 2017 the authors 0270-6474/17/377096-15$15.00/0 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal J. Neurosci., July 26, 2017 • 37(30):7096–7110 • 7097

BDNF transcription is required for the extinction of conditioned aptic plasticity and learning and reveal a mechanism of extinction place aversion (CPA) to naloxone-precipitated opiate withdrawal of drug withdrawal memory. (Wang et al., 2012). However, the mechanisms by which BDNF in the mPFC contribute to the extinction of aversive memory are unknown. Materials and Methods Extinction of classical fear conditioning is an active learning Animals Sprague Dawley male rats weighing 220–250 g were obtained from the process requiring synaptic structural plasticity (Lai et al., 2012). Laboratory Animal Center, the Chinese Academy of Sciences, or Kun- Dendritic spines, which are central to synaptic structural plastic- ming Medical University. Rats were housed 3 per cage and maintained on ity (Lu¨scher et al., 2000), undergo activity-dependent structural a 12 h light/dark cycle with access to food and water ad libitum. Rac1 remodeling that has been proposed to be a cellular basis of LTP transgenic mice were purchased from The Jackson Laboratory (stock (Engert and Bonhoeffer, 1999; Toni et al., 1999) as well as learn- #012361) and reproduced and bred until 2 months old at the Animal ing and memory (Matsuzaki et al., 2004; Yang et al., 2009; Fu et Center of TongJi University. All experimental procedures were in strict al., 2012). Activity-dependent changes in spine structure rely accordance with the National Institutes of Health Guide for the care and on rearrangements of the actin cytoskeleton. One of the best- use of laboratory animals. characterized pathways for regulation of actin dynamics involves the Rho family of small GTPases, Rac1, Cdc42, and Rho (Hall, Drugs and antibodies 1998, 2005). Rac1 has been shown to play a crucial role in synapse Morphine hydrochloride was purchased from Qinghai Pharmaceutical General Factory with a permission license for its use in experiments from formation and plasticity (Luo, 2000; Nakayama et al., 2000). local government (Shanghai and Kunming). Naloxone hydrochloride Studies of the role of Rac1 in spine morphogenesis in vivo and was supplied by Sigma-Aldrich (catalog #N7758). Latrunculin A was vitro have suggested that Rac1 plays an important role in regulat- obtained from Merck/Millipore (catalog #428021) and dissolved in 25% ing the size and density of spines in neurons (Luo et al., 1996; DMSO to a final concentration of 0.5 ␮g/␮l; BDNF was obtained from Zhang et al., 2003; Tolias et al., 2005; Xie et al., 2007). Although R&D Systems (catalog #248-BD-025/CF) and dissolved in PBS to 1.5 substantial evidence demonstrates that Rac1 is essential for di- ␮g/␮l; TrkB/FC was obtained from Sigma-Aldrich (catalog #T8694) and verse forms of learning, little is known whether Rac1 participates dissolved in PBS to 1.3 ␮g/␮l; NSC23766 (catalog #2161), Myr-P4 (cat- in an opposing form of learning (extinction) and how Rac1 con- alog #1776), and Myr-S (control) were obtained from Tocris Bioscience ␮ ␮ ␮ ␮ tributes to extinction of an established memory. and dissolved in PBS to 10 g/ l, 60 pmol/ l, and 60 pmol/ l, respec- Information processing in brain is controlled by a dynamic tively. The antibodies of anti-BDNF (catalog #sc-546, RRID: AB_630940) and anti-Arc/Arg3.1 (catalog #sc-17839, RRID: AB_626696) were pur- interaction between excitatory and inhibitory neurotransmis- chased from Santa Cruz Biotechnology. The antibodies of anti-pPak1 (cat- sion. GAGAA receptors (GABAARs) constitute the major inhibi- alog #2601S, RRID: AB_330220), anti-pCofilin (catalog #3311S, RRID: tory synaptic transmission network in the brain and are essential AB_330238), and anti-Rac1/cdc42 (catalog #4651S, RRID: AB_10612265) for maintaining the excitatory/inhibitory balance of neuronal cir- were purchased from Cell Signaling Technology. The antibodies of anti- ␤ cuits (Lu¨scher et al., 2011). Modulating the strength of GABAergic GABAA 3 (catalog #05-474, RRID: AB_11212228) were purchased from inhibitory transmission has important implications for synaptic Merck/Millipore. The antibodies of anti-actin (catalog #A5441, RRID: plasticity and information processing in the brain (Smith and AB_476744) were purchased from Sigma-Aldrich. Kittler, 2010). It has been shown that inhibiting GABAergic transmission facilitates LTP induction in excitatory synapses in Intra-vmPFC microinjection many brain regions, including mPFC (Wigstro¨m and Gustafsson, Surgery. Rats (weighing 220–280 g when surgery began) or Rac1 transgenic mice (weighing 25–28 g) were anesthetized with sodium pentobar- 1983; Mott and Lewis, 1991; Lu et al., 2010) and is implicated in bital (55 mg/kg, i.p. or 7 mg/kg, i.p.), treated with atropine sulfate (0.2 the extinction of some forms of aversive memories (McGaugh et mg/kg, i.p.) and then placed in a stereotaxic apparatus (Narishige). Rats al., 1990; Berlau and McGaugh, 2006; Akirav, 2007; Hart et al., were implanted bilaterally with guide cannulae in the vmPFC (antero- 2009; Makkar et al., 2010). In contrast to the extensive efforts posterior 2.8 mm; mediolateral Ϯ0.6 mm; dorsoventral Ϫ3.5 mm). The made to understand the role of the insertion and removal of cannulae were anchored to the skull with stainless-steel screws and dental AMPARs at the postsynaptic membrane in synaptic plasticity cement. A stainless-steel blocker was inserted into each cannula before (Collingridge et al., 2004), few studies have probed the molecular and after microinjection. mechanisms and regulatory signaling pathways that locally con- Intra-vmPFC microinjection. Each infusion was 0.5 ␮l per side, infused at a rate of 0.25 ␮l/min. Bilateral microinfusions were made through 31 trol GABAAR trafficking. GABA Rs enter the endocytic pathway by a clathrin-mediated gauge injector (1.0 mm beyond the tip of guide cannulae, anteroposterior A 2.8 mm; mediolateral Ϯ0.6 mm; dorsoventral Ϫ4.5 mm) that was con- dynamin-dependent mechanism (Kittler et al., 2000; Herry and nected to a 10 ␮l microsyringe mounted in a microinfusion pump (Har- Garcia, 2003; Kittler et al., 2005). Substantial evidence demon- vard Apparatus), and the drugs were infused into the vmPFC over 2 min strates that the clathrin-mediated endocytosis of membrane re- and given an additional 2 min to diffuse. TrkB-FC and NSC23766 were ceptors is dependent on ADF/cofilin-mediated actin dynamics bilaterally microinjected into the vmPFC 30 min before extinction train- (Schafer et al., 2002; Yarar et al., 2005; Gu et al., 2010; Liu et al., ing. Myr-P4 and Myr-S were bilaterally injected into the vmPFC 60 min 2012). Given a crucial role of Rac1 for actin dynamics, we hypoth- before extinction training. Latrunculin A was bilaterally injected into the esized that it may be crucially implicated in activity-dependent vmPFC 10 min before extinction training. The doses of TrkB-FC, NSC23766, latrunculin A, and Myr-P4 were chosen based on pilot exper- GABAAR endocytosis. Therefore, we tested this hypothesis using iments or previous studies (Peters et al., 2010; Liu et al., 2012; Wang et al., the CPA model. We demonstrated that GABAAR endocytosis was necessary and sufficient for LTP expression in the vmPFC and 2012; Ding et al., 2013). extinction of drug withdrawal memory. We further show that Histology GABAAR endocytosis is dependent on Rac1-mediated actin po- After behavior test, rats were deeply anesthetized with sodium pentobar- lymerization, and we establish Arc as a critical component in the bital and perfused transcardially with 0.9% saline, followed by 4% PFA in rodent vmPFC to link activity-triggered enhancement of Rac1 PBS. The brains were removed and stored in 4% PFA for postfixation and activity to endocytosis of GABAARs. These new data provide ba- then transferred in a 30% sucrose solution (w/v in PBS) solution for ␮ sic insight into the regulation of GABAAR trafficking during syn- 3–5 d. Coronal sections (30 m thick) were cut on a cryostat (Leica), 7098 • J. Neurosci., July 26, 2017 • 37(30):7096–7110 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal stained with cresyl violet, and then examined by light microscopy to Western blotting determine the injection sites. Briefly, loading buffer was added to each protein sample and boiled at 100°C for 10 min. Then the protein samples were cooled and loaded in Behavioral procedures ϫ ϫ each lane, separated in 10%–15% SDS-PAGE, and blotted onto PVDF Apparatus. The behavioral apparatus [62 cm (length) 24 cm (width) membrane. The membranes were blocked for1hatroom temperature in 24 cm (height)] was divided into two equal-sized compartments and ϫ 5% BSA, followed by incubation overnight at 4°C with various primary separated by a removable board (10 10 cm), which allowed the rat free antibodies that included the following: anti-BDNF at a dilution of 1:500; access to each compartment. The two compartments were distinguished ␤ anti-GABAA 3, anti-pPak1, anti-pCofilin, anti-Rac1/cdc42 at a dilution by visual and tactile cues: one was a black wall with a smooth floor, of 1:2000; anti-Arc/Arg3.1 at a dilution of 1:1000; anti-actin at a dilution whereas the other was a white wall with a textured floor. There was a of 1:10,000. Then membranes were rinsed with TBST (Tris-buffered sa- camera above the middle of the apparatus to record rat activity, and the line plus 0.05% Tween 20, pH 7.4) and incubated for 1 h with peroxidase- data were stored in a computer. conjugated goat anti-rabbit or anti-mouse IgG. Membranes were rinsed Procedures. CPA procedures were performed as described by our pre- with TBST again. Then chemiluminescent detection was performed with vious study (Hou et al., 2009). Briefly, CPA consists of three phases: the ECL kit (GE Healthcare, catalog #RPN2232) and exposed against preconditioning, conditioning, and testing. In the preconditioning x-ray film (Eastman Kodak) for 30 s to 2 min. The immunopositive phase, rats were allowed to freely explore the entire apparatus for 15 min. signals were quantified by Quantity One software (Bio-Rad). Time spent in each compartment was recorded. Conditioning took place over the next 2 d. On the first day, the rats were injected with saline Immunohistochemistry of Arc (1 ml/kg, s.c.). Four hours later, they were again given saline and then Immunohistochemical assay was performed as described by our previous confined to either compartment in a counterbalanced manner for 30 study (Li et al., 2009). Briefly, the brain slices from different groups were min. On the second day, the rats were injected with either morphine cut at a thickness of 30 ␮m and washed with 0.1 mol/L phosphate buffer. (10 mg/kg, s.c) or saline. Four hours later, they were injected with nalox- The brain slices were blocked with 10% normal goat serum for2hat one (0.3 mg/kg, s.c) or saline and confined to the drug-paired side for 30 room temperature and then incubated overnight with primary antibody min. This compartment will be referred to as the “drug treatment-paired (mouse anti-Arc antibody, 1:500 dilution in 10% normal goat serum) at compartment.” Testing phase took place 24 h after the conditioning trial, 4°C. Next, the brain slices were incubated with secondary antibody (bi- and all rats were allowed to freely explore the entire apparatus for 15 min; otinylated goat anti-mouse IgG, 1:200 dilution in 10% normal goat se- the amount of time spent in each compartment was recorded. The CPA rum) for2hatroom temperature. Arc-positive sites were visualized score represents the time in the drug treatment-paired compartment using a streptavidin-ABC kit and a DAB kit using 0.1% DAB as the during the testing phase minus that during the preconditioning phase. chromogen. In control slices in which the primary antibodies were omit- Extinction procedures were performed as described previously (Myers ted or replaced by nonimmune rabbit or goat serum, no stained cells were and Carlezon, 2010; Wang et al., 2012). Briefly, extinction training began seen. The brain slices were subsequently dehydrated in alcohol and xy- 24 h after the post-training test and consisted of 30 min placement in the lene, coverslipped, and imaged on an Olympus IX51 microscope. previously naloxone-paired boxes. Three sessions of extinction training were conducted with a 24 h interval between each, and a 15 min extinc- Assay for GTPase activity tion test was performed 24 h after each extinction training. In each ses- Active Rac1 and Cdc42 pull-downs were performed as described by the sion of extinction training, the order of exposure was counterbalanced commercial active Rac1/Cdc42 Pull-Down and Detection Kit protocol across rats and reversed relative to the preceding session. Saline was (Pierce, catalog #16118). Briefly, lysates of the rat vmPFC tissue was administered immediately before each extinction training. For examin- centrifuged at 16,000 ϫ g at 4°C for 15 min, and then the supernatants ing the effects of dynamin function-blocking peptide (Myr-P4), Rac1 were transferred to a new tube and were added with GTP␥S or GDP to inhibitor NSC23766 and actin polymerization inhibitor latrunculin A on incubate at 30°C for 15 min under the condition of constant agitation.

GABAAR endocytosis and extinction of CPA, Myr-P4, NSC23766, and Then the mixtures were incubated with glutathione resin beads and latrunculin A were bilaterally infused into the vmPFC of conditioned rats glutathione S-transferase-fused Rac/Cdc42-binding domain of p21- before extinction training. For Western blotting analysis, the rats were activated kinase (Pak) at 4°C for 1 h; beads had been washed several times decapitated after last extinction training. previously to remove nonspecific binding. The beads and proteins bound to the fusion protein were washed three times with wash buffer at 4°C, eluted in Tissue sample preparations SDS sample buffer, and analyzed for bound Cdc42 and Rac1 by Western Brains were rapidly removed, frozen in liquid nitrogen, and stored in a blotting using antibodies against Cdc42 or antibodies against Rac1. Ϫ80°C freezer before dissection. Coronal brain sections (1 mm thick) were obtained by using a rat brain slicer (Braintree Scientific). The infra- Surface receptor cross-linking with bis (sulfosuccinimidyl) limbic subdivisions of the vmPFC from both hemispheres of rats were suberate (BS3) ␤ punched from brain slices by using a blunt-end, 17 gauge syringe needle Surface and intracellular levels of the 3 subunit of the GABAAR levels (1 mm inner diameter). In all subsequent procedures, the tissues were were determined by using a protein cross-linking assay as previously maintained at 4°C. Briefly, homogenate of the tissue in the 0.32 M sucrose described (Ives et al., 2002; Liu et al., 2012), with minor modifications. buffer was centrifuged at 1000 ϫ g for 10 min. The pellet was discarded, Briefly, rat brain tissue was incubated with the protein cross-linking and the supernatant was centrifuged at 17,000 ϫ g for 30 min to obtain a reagent BS3 (Pierce Biotechnology, catalog #21580) to determine S (sur- crude synaptosomal fraction. The resultant pellet was washed with 0.32 M face) and I (intracellular) levels of receptor subunit proteins. After the sucrose buffer and then centrifuged at 17,000 ϫ g for another 30 min. The last extinction training, rats were decapitated. Brains were rapidly re- synaptosomal membrane and subcellular fractionations were prepared moved, and coronal brain sections (0.5 mm thick) containing the vmPFC as described previously (Hou et al., 2009; Liu et al., 2012). Briefly, the were obtained by using a rat brain slicer (Braintree Scientific). Slices were crude synaptosomal fraction was dissolved hypo-osmotically and centri- then inserted into 2 ml Eppendorf tubes containing 1 ml of ACSF spiked fuged at 25,000 ϫ g for 25 min to precipitate a synaptosomal membrane with 2 mM BS3. The ACSF contained the following (in mM): NaCl 120, fraction. To separate F-actin and G-actin, synaptosomal membrane frac- KCl 2.5, NaHCO3 26, NaH2PO4 1.25, CaCl2 2, MgSO4 2, and D-glucose tion was lysed in buffer A (1% Triton X-100, 20 mM HEPES, 100 mM 10, and was bubbled with the gas mixture of 95% O2 and 5% CO2 for at NaCl, 2 mM EDTA, 5 mM NaF, 1 mM Na3VO4,1mM aprotinin, 1 mM least 1 h. Incubation with gentle agitation proceeded for 30 min at 4°C. leupeptin, 1 mM PMSF, pH 7.2) for 1 h and centrifuged at 10,000 ϫ g for Cross-linking was terminated by quenching the reaction with 100 mM 20 min. Pellets were dissolved in buffer B (15 mM HEPES, 0.15 mM NaCl, glycine (10 min, 4°C). The slices were pelleted for 2 min at 14,000 rpm,

1% SDS, 10 mM EDTA, 1 mM DTT, 5 mM NaF, 1 mM Na3VO4,1mM and the supernatant was discarded. Pellets were resuspended in ice-cold aprotinin, 1 mM leupeptin, 1 mM PMSF, pH 7.5) for 1 h and centrifuged lysis buffer containing protease inhibitors (Roche, catalog #11836170001) at 10,000 ϫ g for 20 min. The G-actin fraction (the first supernatant) and and phosphatase inhibitors (Roche, catalog #4906837001) and homoge- the F-actin fraction (the second supernatant) were collected. nized rapidly by sonicating, samples were centrifuged at 14,000 rpm for 2 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal J. Neurosci., July 26, 2017 • 37(30):7096–7110 • 7099

min, and the supernatant fractions were collected for Western blotting. Experimental design and statistical analysis Samples were liquated and stored at Ϫ20°C for Western blotting analysis. All experimental male rats and mice were used at the ages indicated in the text. Rac1 transgenic mice were purchased from The Jackson Laboratory Lentivirus construction and infection (stock #012361). Data analysis was performed using Clampfit 10.2 (Axon Lentivirus construction and production. The Lentivirus plasmid pSicoR Instruments), Quantity One software (Bio-Rad Laboratories), Image- was purchased from Addgene, and oligos coding for the various shRNAs pro plus (Media Cybernetics), Conditioned place aversion software were annealed and cloned into HpaI-XhoI-digested pSicoR vectors. The (Anilab Software and Instruments), and Prism 5 (GraphPad Software). target shRNA regions were chosen as follows: Arc, GCTGATGGCTAC Unless stated, all values are presented as mean Ϯ SEM for the number of GACTACA; Rac1, GCAAACAGACGTGTTCTTAAT; negative control, experiments (n) indicated in the text and in the figure legends. Data were TTCTCCGAACGTGTCACGT. Lentiviruses were generated as described analyzed by unpaired Student’s t test, one-way or two-way ANOVA with ␮ ␮ below. Briefly, 5 g of Lentivirus vector and 2.5 g of each packaging Bonferroni post hoc test. Statistical significance was set at p Ͻ 0.05. The vector were cotransfected in HEK 293T cells by using the FuGENE 6 magnitude of LTP is the average of the last 5 min recordings expressed as reagent (Roche Diagnostics). Supernatants were collected 36–48 h after percentage of the baseline fEPSP. transfection, filtered through a 0.4 ␮m filter. High-titer stocks were prepared by an initial ultracentrifugation for1hat23,000 rpm (SW-28 rotor; Beckman Coulter) and a secondary tabletop centrifugation at Results 13,000 ϫ g for 30 min. Viral pellets were resuspended in 1% BSA/PBS Extinction training results in LTP induction and CPA and stored at Ϫ80°C. Viral titers were determined by infection of extinction by dynamin-dependent GABAAR endocytosis HEK293T cells, and GFP-positive cells were visualized by fluorescent CPA can be extinguished by extinction training (Myers and Car- microscopy. After concentration, viral titers were 5 ϫ 10 8 to 2 ϫ 10 9 transducing units (TU)/ml. Lentivirus expressing Arc/Arg3.1-shRNAs or lezon et al., 2010; Wang et al., 2012). Inhibiting GABAergic trans- control shRNAs was bilaterally infused into the vmPFC of rats that un- mission is implicated in the extinction of several forms of aversive derwent place aversion conditioning. Two weeks after virus infusion, the memories (Makkar et al., 2010). To elucidate the mechanisms rats were subjected to extinction training. underlying CPA extinction, we examined the effect of extinction ␤ training on GABAAR endocytosis. GABAAR 3 subunit is a major Stereotaxic injections of lentivirus into the vmPFC site for phosphorylation that determines receptor endocytosis in Rats were anesthetized with sodium pentobarbital (55 mg/kg, i.p. or neurons (Kittler et al., 2005; Jacob et al., 2009). Thus, we tested 7 mg/kg, i.p.), treated with atropine sulfate (0.2 mg/kg, i.p.). Lentiviruses ␤ (5 ϫ 10 8 to 1 ϫ 10 9 TU/ml) were stereotaxically injected into the vmPFC whether extinction training produced GABAAR 3 subunit en- (3 ␮l/site) over 5 min using a 31 gauge injector (1.0 mm beyond the tip of docytosis using BS3 cross-linking assay (Ives et al., 2002). Rats guide cannula), which was connected to a 10 ␮l microsyringe mounted in were killed at different time points after extinction training. The a microinfusion pump (Harvard Apparatus). The injector was retained vmPFC tissues were isolated quickly and treated with BS3. Im- in place for another 5 min before being withdrawn at 1 mm/min. The munoblot analysis of GABAARs in cross-linked tissue showed ␤ injections were performed bilaterally at the following coordinates, as that the S/I ratio of the 3 subunit of the GABAARs was signifi- calculated from bregma and the dura mater: anteroposterior 2.8 mm; cantly decreased at 4 and 8 h after extinction training (4 h, 14.6 Ϯ Ϯ Ϫ mediolateral 0.6 mm; dorsoventral 4.5 mm. 3.62% of control, n ϭ 6; 8 h, 36.7 Ϯ 12.56% of control, n ϭ 6; ϭ ϭ Assay for Rac1 function using Rac1 transgenic mice F(4,25) 6.645, p 0.0009; one-way ANOVA; Fig. 1A). Post hoc For adeno-associated virus (AAV) construction and infection, the Cre test revealed that there was significant decrease of the surface ␤ recombinase was cloned into the pSB1844-CMV-GFP vector. The GABAAR 3 subunit at 4 and 8 h after extinction training com- AAV2-based vector pseudotyped with AAV8 serotype capsid (AAV2/8) pared with no-extinction groups (p Ͻ 0.01, p Ͻ 0.05). No signif- ϫ 13 was purchased and supplied in titers 2–3 10 (vg/ml) genomic copies icant differences in the levels of GABAAR total protein were per milliliters (Obio Technology). Rac1 transgenic mice (weighing 25–28 g found between any of the experimental groups, quantified by when surgery began) were anesthetized with sodium pentobarbital anes- summing the optical densities of surface and intracellular bands thesia (7 mg/kg, i.p.) and then placed in the same stereotaxic apparatus. and normalizing to total protein in the lanes (F ϭ 0.3332, During the surgery, mice were bilaterally microinjection of AAV-Cre- (4,25) p ϭ 0.9677). Regulation of AMPAR trafficking is also known to GFP or control AAV-GFP into the vmPFC (anteroposterior 1.7 mm; mediolateral Ϯ0.3 mm; dorsoventral Ϫ2.5 mm). The mice were allowed be critical for synaptic plasticity and memory (Malinow and to recover from surgery for at least 1 week, during which they were Malenka, 2002; Anggono and Huganir, 2012; Liu et al., 2012). injected with norfloxacin to protect them from infection. Next, we determined whether extinction training also exerted an effect on AMPAR trafficking. It was found that extinction training In vitro electrophysiological recording had no significant effect on AMPAR endocytosis (Fig. 1-1 available Adult male rats weighing 220–280 g were anesthetized with diethyl ether at https://doi.org/10.1523/JNEUROSCI.3859-16.2017.f1-1). and decapitated. Brains were rapidly transferred into ice-cold ACSF con- Dynamin-dependent endocytosis is important in the regulation taining the following (in mM): NaCl 120, KCl 2.5, NaHCO3 26, NaH2PO4 of cell surface levels of GABAARs (Kittler et al., 2000; Herry and 1.25, CaCl2 2.0, MgSO4 2.0, and D-glucose 10, continuously bubbled with ␮ Garcia, 2003). Next, we examined the effect of Myr-P4, a dynamin a gas mixture of 95% O2. Coronal vmPFC slices (400 m) were prepared with a vibratome (VT 1000S, Leica). Slices were left to recover for 20 min function-blocking peptide, on extinction training-induced GABAAR in an incubation chamber containing ACSF heated to 36 Ϯ 1°C and then ␤3 subunit endocytosis. As shown in Figure 1B, bilateral intra- maintained at room temperature (22°C-25°C). Slices were placed in a vmPFC infusions of Myr-P4 but not inactive control peptide Myr-S recording chamber and perfused by oxygen saturated ACSF with a flow (30 pmol/0.5 ␮l/side) 60 min before extinction training resulted in a rate of 4–5 ml/min. The field EPSPs (fEPSPs) were recorded in layer 5, ␤ higher level of the S/I ratio of the 3 subunit of GABAARs (vehicle, and a stimulating electrode was placed in layer 2/3 of the vmPFC. The 100 Ϯ 25.67%, n ϭ 6; Myr-S, 121.55 Ϯ 45.46%; Myr-P4, 200.44 Ϯ fEPSPs were evoked using a bipolar platinum-iridium stimulating elec- 16.06%, n ϭ 6). One-way ANOVA of the S/I ratio of ␤3 subunits of trode (75 ␮m outside diameter) and recorded through a glass micropi- the GABA Rs revealed a main effect of group (F ϭ 16.87, p ϭ pette (3–4 M⍀, filled with ACSF). The stimulation was adjusted for each A (2,15) slice to produce reliable field potential that was ϳ50% of the maximal 0.001). Post hoc analysis confirmed that Myr-P4-infused rats exhib- ␤ response. LTP was elicited by high-frequency stimuli (50 Hz, 50 pulses, 1 ited significantly higher S/I ratios of the 3 subunit of GABAARs train) after a baseline was stably recorded for at least 20 min at a fre- relative to Myr-S or vehicle-infused rats (p Ͻ 0.01), indicating that quency of 0.033 Hz. Myr-P4 abolished extinction training-induced GABAAR endocyto- 7100 • J. Neurosci., July 26, 2017 • 37(30):7096–7110 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal

␤ Figure 1. Extinction training results in LTP induction and CPA extinction by dynamin-dependent GABAAR endocytosis. A, Extinction training resulted in endocytosis of GABAAR 3 subunits ␤ (Fig. 1-1 available at https://doi.org/10.1523/JNEUROSCI.3859-16.2017.f1-1). B, Endocytosis of GABAAR 3 subunits was prevented by bilateral infusion of dynamin function-blocking peptide (Myr-P4, 30 pmol/0.5 ␮l/side) but not scramble inactive peptide (Myr-S) into the vmPFC 60 min before extinction training (Fig. 1-2 available at https://doi.org/10.1523/JNEUROSCI.3859-16.2017.f1-2). C,The50HzstimulusinducedreliableLTPinslicesfromratsthatunderwentextinctiontrainingbutnotinthosethatdidnotundergoextinctiontraining.D,HFSat50HzfailedtoinduceLTPinslicesfromratsthat werepretreatedwithbilateralinfusionofMyr-P4(30pmol/0.5␮l/side)intothevmPFC60minbeforeextinctiontraining,butitnormallyinducedreliableLTPinslicesfromratsthatwerepretreatedwithMyr-S ␮ beforeextinctiontraining.E,InthepresenceofGABAARblockerpicrotocxin(100 M),HFSat50HzwasabletoelicitLTPinductioninslicesfromratsthatdidnotundergoextinctiontraining.F,Thesamepicrotoxin applicationdidnotinducesignificantchangeinthefacilitatedLTPinductionfoundinslicesfromratsthatunderwentextinctiontraining.G,CPAextinctionwasimpairedbyintra-vmPFCinfusionsofMyr-P4(30 pmol/0.5 ␮l/side) but not Myr-S before extinction training. H, Schematic representation of injection sites in the vmPFC for rats used in the experiments. A, B, Top, Representative blots of surface (S) and ␤ ␤ internalized(I)GABAAR 3subunitsfromthevmPFCtissuesofratspreparedatdifferenttimepointsafterextinctiontraining(A:2,4,8,and18h)or(B:4h).Bottom,QuantificationoftheS/IratioofGABAAR 3 subunit levels from Western blot data. Error bars indicate mean ϮSEM (nϭ6–8). *pϽ0.05, compared with the no-extinction control or vehicle control groups (one-way or two-way ANOVA followed by Bonferroni’s post hoc test). **pϽ0.01, compared with the no-extinction control or vehicle control groups (one-way or two-way ANOVA followed by Bonferroni’s post hoc test). The magnitude of LTP was the average of the last 5 min recordings expressed as the mean ϮSEM percentage of the baseline fEPSP. Data were analyzed with two-tailed Student’s ttests.

sis, whereas Myr-P4 had no significant effect on GABAAR trafficking LTP is widely thought to be a key mechanism underlying for- in no-extinction rats (Fig. 1-2 available at https://doi.org/10.1523/ mation of new memory (Cooke and Bliss, 2006). Given that in- JNEUROSCI.3859-16.2017.f1-2). No significant difference was ob- hibiting GABAergic transmission facilitates LTP induction in

served in the levels of GABAAR total protein between any of the excitatory synapses in many brain regions, we tested whether experimental groups. extinction training could affect LTP induction at the excitatory Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal J. Neurosci., July 26, 2017 • 37(30):7096–7110 • 7101

Figure 2. Extinction training increases synaptic localization of Arc to regulate GABAAR endocytosis and CPA extinction. A, CPA rats at 1 h after extinction training showed elevation of Arc protein expression in the vmPFC, detected by using immunohistochemical analysis. B, Increase of synaptic Arc protein levels in the vmPFC was detected at 2 h after extinction training by immunobloting. C, Lentivirus-infected regions in the vmPFC were visualized by fluorescence microscope. D, Infection of the vmPFC with lentivirus expressing Arc/Arg3.1-shRNA attenuated synaptic Arc protein ␤ expression within the vmPFC. E, Infection of the vmPFC with lentivirus expressing Arc/Arg3.1-shRNA inhibited GABAAR 3 subunit endocytosis. F, Infection of the vmPFC with lentivirus expressing Arc/Arg3.1-shRNA impaired CPA extinction. Error bars indicate mean Ϯ SEM (n ϭ 6–8). **p Ͻ 0.01, compared with no-extinction or control shRNA groups. ***p Ͻ 0.001 compared with no-extinction or control shRNA groups. ##p Ͻ 0.01, compared with control shRNA groups (two-tailed Student’s t test, or one-way or two-way ANOVA followed by Bonferroni’s post hoc test). synapses of the vmPFC. Here, a weak protocol in brain slices (i.e., toxin application did not cause further LTP facilitation in the rats high-frequency stimulation [HFS]) at 50 Hz rather than 100 or that underwent extinction training (vehicle, 116.87 Ϯ 7.55%; pi- Ϯ ϭ ϭ 200 Hz, was applied to study whether LTP induction in the crotoxin, 116.79 4.34, t(20) 0.23, p 0.818; Fig. 2F), indicat- vmPFC was facilitated by extinction training. As shown in Figure ing that the effect of extinction had occluded that caused by 1C, HFS at 50 Hz was unable to induce LTP in no-extinction rats reducing GABA inhibition with picrotoxin. This suggests that (103 Ϯ 6.56%), but it induced a reliable LTP in extinction rats extinction training and picrotoxin application share the same Ϯ ϭ ϭ (124.19 12.29%, t(10) 2.27, p 0.046, compared with no- mechanism by reducing GABA inhibition in facilitating LTP. extinction rats). To determine whether LTP facilitation by ex- To determine whether GABAAR endocytosis was required for tinction training was mediated by GABAAR endocytosis, we CPA extinction, we next tested the effect of intra-vmPFC infusion assessed whether 50 Hz-induced LTP in the rats with extinction of Myr-P4 on the behavior. Bilateral intra-vmPFC infusions of training was prevented by intra-vmPFC infusion of dynamin Myr-P4 (30 pmol/0.5 ␮l/side) 60 min before extinction training ␮ ϭ function-blocking peptide (Myr-P4) (30 pmol/0.5 l/side) 60 impaired CPA extinction (main effect of Myr-P4, F(1,12) 4.832, min before extinction training. As shown in Figure 1D, HFS at 50 p Ͻ 0.05, two-way ANOVA, post hoc, p Ͻ 0.01 compared with Hz failed to induce LTP in the rats pretreated with Myr-P4 Myr-S-infused control groups; Fig. 1G). Figure 1H showed the (97.72 Ϯ 4.33%), but it induced a reliable LTP in the rats pre- location of microinjection tips in the vmPFC. Together, these treated with scramble inactive peptide (Myr-S) (116.86 Ϯ 4.10%, data suggest that LTP facilitation and CPA extinction by extinction ϭ ϭ t(13) 3.19, p 0.006, compared with rats pretreated with Myr- training are both attributable to dynamin-dependent GABAARen- P4), indicating that extinction training-facilitated LTP induction docytosis in the vmPFC. was due to dynamin-dependent GABAAR endocytosis. To further confirm that a reduced GABAergic inhibition by GABAAR Increase of synaptic Arc protein levels in the vmPFC is endocytosis was involved in LTP facilitation at the excitatory required for GABAAR endocytosis and CPA extinction synapses of the vmPFC neurons after extinction training, we fur- Several studies report that Arc interacts with dynamin and endo- ther tested whether application of the GABAAR chloride channel philin to modulate AMPA receptor endocytosis in primary neu- blocker picrotoxin could be sufficient for LTP facilitation even ronal cultures and in the amygdala (Chowdhury et al., 2006; Rial without extinction training. HFS at 50 Hz failed to induce LTP in Verde et al., 2006; Liu et al., 2012). Given that GABAARs under- nonextinction rats (96.94 Ϯ 4.26%), but it induced a reliable LTP in went endocytosis via a dynamin-dependent mechanism in the the condition with the presence of 100 ␮M picrotoxin (118.21 Ϯ vmPFC in response to extinction training (Fig. 1B), we asked ϭ ϭ 6.21%, t(23) 2.17, p 0.04; Fig. 1E). Importantly, the same picro- whether Arc played a role in extinction training-induced GABAAR 7102 • J. Neurosci., July 26, 2017 • 37(30):7096–7110 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal endocytosis and CPA extinction. To this end, we first examined the Rac1 activity in the vmPFC contributes to increase of synaptic effects of extinction training on Arc protein expression and synaptic Arc protein levels following extinction training localization in the vmPFC using immunohistochemistry and immu- Our and other previous studies have suggested that actin polym- noblotting. As shown in Figure 2A, extinction training induced a erization is involved in synaptic translocation of Arc mRNA in robust increase in the staining of Arc/Arg3.1 in the vmPFC, indic- response to LTP induction and behavioral learning (Huang et al., ative of an enhancement of Arc expression, which is consistent 2007; Liu et al., 2012). Next, we asked whether actin dynamics in with a previous study that extinction of contextual fear memory the vmPFC was required for synaptic localization of Arc in re- induces Arc protein expression in the mPFC (Mamiya et al., sponse to extinction training. We first examined the activity of 2009). Arc protein levels in the synapses were further analyzed by small GTPase Rac1 and cdc42 in the vmPFC following extinction subcellular fractionation of lysates of the vmPFC, followed by training. As shown in Figure 3A, a significant increase in the levels immunoblotting using Arc/Arg3.1 antibody (Liu et al., 2012). As of active Rac1 (Rac1-GTP) was detected in the vmPFC at 1, 2, and ϭ Ͻ shown in Figure 2B, a significant increase in Arc protein levels in 4 h after extinction training (F(3,20) 7.89, p 0.01, one-way the synaptosomal fractions of the vmPFC was detected at 2 h after ANOVA followed by Bonferroni post hoc test). However, extinction training had no significant effect on the levels of active Cdc42 extinction training (F ϭ 5.72, p Ͻ 0.01, one-way ANOVA (3,12) (Cdc42-GTP) (F ϭ 0.71, p Ͼ 0.05; Fig. 3B). Next, we exam- followed by post hoc test), indicating that extinction training in- (3,20) ined the role of Rac1 in extinction training-induced actin polym- creases synaptic Arc protein expression. erization. As shown in Figure 3C, D, extinction training resulted Next, we determined whether the increased synaptic Arc ϭ Ͻ in activation (phosphorylation) of Pak1 (F(2,20) 6.69, p 0.01) was involved in extinction training-induced endocytosis of the ϭ Ͻ ␤ and inactivation (phosphorylation) of cofilin (F(2,20) 8.13, p GABAAR 3 subunit. To do this, we used a lentivirus expressing 0.01). Accordingly, extinction training also induced actin polym- short-hairpin (sh) RNA (Arc/Arg3.1-shRNA) to knock down ϭ Ͻ erization (F(3,14) 7.89, p 0.05; Fig. 4E). All these effects were Arc/Arg3.1 mRNA within the vmPFC of rats that underwent blocked by bilateral intra-vmPFC infusions of Rac1 inhibitor place aversion conditioning. The conditioned rats received bilat- NSC23766 (0.5 ␮g/ 0.5 ␮l/side) 30 min before extinction training eral infusions of lentivirus expressing Arc/Arg3.1-shRNAs with (p Ͻ 0.01 vs vehicle-infused rats); however, NSC had no signifi- 8 9 high-titer stocks (5 ϫ 10 to 1 ϫ 10 TU/ml) or control shRNAs cant effect on cofilin and Pak1 phosphorylation in no-extinction into the vmPFC. Two weeks after virus infusion, the rats were rats (Fig. 3-1 available at https://doi.org/10.1523/JNEUROSCI. subjected to extinction training. After extinction training, rats 3859-16.2017.f3-1). In addition, actin polymerization was also were killed and their brains were isolated and sectioned into slices abolished by bilateral intra-vmPFC infusions of the actin polym- to detect the sites infected by the virus via visualization of the erization inhibitor latrunculin A (250 ng/0.5 ␮l/side) 10 min be- tagged GFP under a fluorescence microscope. As shown in Figure fore extinction training (p Ͻ 0.01 compared with vehicle-infused 2C, strong GFP fluorescence was observed in the vmPFC, indic- rats; Fig. 3E). Together, these results support that extinction train- ative of an effective infection of lentivirus expressing Arc/Arg3.1- ing induces actin polymerization within the vmPFC by activation of shRNAsA in the vmPFC. Next, we examined whether Arc the Rac1/Pak1/cofilin signaling pathway. expression was interfered by Arc/Arg3.1-shRNA. As shown in Thereafter, we examined whether actin polymerization was Figure 2D, intra-vmPFC infusion of Arc/Arg3.1-shRNA before required for elevation of synaptic Arc protein levels. Because extinction training significantly attenuated extinction training- NSC23766 and latrunculin A both blocked extinction training- ϭ Ͻ induced actin polymerization, we examined the effects of these induced synaptic Arc protein expression (t(1,10) 3.52, p 0.01, Student’s t test). Then, we examined the effect of in vivo knock- two agents on extinction training-induced increases in synaptic down of synaptic Arc protein expression using Arc/Arg3.1- Arc protein levels. As shown in Figure 3F, extinction training- shRNA on extinction training-induced endocytosis of GABA R induced enhancement of synaptic Arc protein in the vmPFC can A ϭ ␤3 subunits. As shown in Figure 2E, Arc/Arg3.1-shRNA-infected be blocked by both NSC23766 and latrunculin A (F(3,12) 5.72, Ͻ rats exhibited a significant increase in the S/I ratio of the ␤3 p 0.01, one-way ANOVA followed by post hoc test; Fig. 3F, left). Ϯ However, bilateral intra-vmPFC infusions of these two blocking subunit of the GABAAR (control shRNA, 38.74 9.20% of control, n ϭ 6; Arc/Arg3.1 shRNA, 80.89 Ϯ 9.85% of control, n ϭ 6; reagents had no effects on total Arc protein levels in the vmPFC homogenates (p Ͼ 0.05, compared with vehicle-infused rats; Fig. F ϭ 17.67, p Ͻ 0.01, one-way ANOVA). Post hoc analysis (2,15) 3F, right), indicating that actin polymerization is required for showed that there was a significant difference between control increased Arc protein levels in synapses. Overall, these results shRNA and Arc/Arg3.1-shRNA groups (p Ͻ 0.01). No significant suggest that extinction training yields enhancement of synaptic difference was observed in the levels of GABA Rs total protein A Arc protein levels by Rac1-Pak1-cofilin signaling-dependent ac- between any of the experimental groups. These results demon- tin dynamics in the vmPFC. strate that the knockdown of synaptic Arc expression with Arc/Arg3.1-shRNAs reduces GABAAR endocytosis, supporting Rac1 inhibitor NSC23766 and actin polymerization inhibitor that synaptic Arc indeed plays an essential role in regulating latrunculin A suppress extinction training-induced GABAAR GABAAR endocytosis in response to extinction training. endocytosis extinction memory We also examined the effect of synaptic Arc knockdown on Given the important role of activity-associated actin polymerization CPA extinction. As shown in Figure 2F, Arc/Arg3.1-shRNAs- in synaptic localization of Arc, it was predicted that inhibition of infected rats displayed significantly higher CPA scores than con- actin polymerization could suppress extinction training-induced trol shRNAs-infected rats (main effect of Arc/Arg3.1-shRNA GABA R endocytosis. To confirm this, we assessed the effect of ϭ ϭ Ͻ A F(1,23) 10.25, p 0.004, two-way ANOVA, post hoc, p 0.01), actin polymerization inhibition using NSC23766 and latrunculin ␤ indicating that knockdown of synaptic Arc expression in the A on the extinction training-induced GABAAR 3 endocytosis, vmPFC impaired CPA extinction. Together, these results suggest LTP facilitation, and CPA extinction. As shown in Figure 5A, that enhancement of synaptic Arc levels contributes to extinction bilateral intra-vmPFC injections of NSC23766 (0.5 ␮g/0.5 ␮l/ training-induced GABAAR endocytosis and CPA extinction. side) 30 min before extinction training significantly inhibited the Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal J. Neurosci., July 26, 2017 • 37(30):7096–7110 • 7103

Figure 3. Synaptic localization of Arc depends on actin polymerization induced by Rac1-mediated phosphorylation of Pak1 and cofilin. A, B, Extinction training resulted in activation of Rac1, but not Cdc42, in the vmPFC. C, D, Extinction training led to phosphorylation of Pak1 and cofilin, and both were blocked by bilateral intra-vmPFC infusions of Rac1 inhibitor NSC23766 (Fig. 3-1 available at https://doi.org/10.1523/JNEUROSCI.3859-16.2017.f3-1). E, Extinction training-induced actin polymerization could be inhibited by NSC23766 (0.5 ␮g/ 0.5 ␮l/side) and actin polymerization inhibitor latrunculin A (250 ng/0.5 ␮l/side), whereas they have no effects on total actin (left). F, Blockade of actin polymerization by NSC23766 and latrunculin A disrupted extinction training- inducedenhancementofArcproteinlevelsatsynapticmembranepreparations(left)buthadnoeffectsonextinctiontraining-inducedArcproteinlevelsinthevmPFChomogenates(right).Errorbars indicate mean Ϯ SEM (n ϭ 8). *p Ͻ 0.05, compared with no-extinction control groups (one-way ANOVA followed by Bonferroni’spost hoc test). **p Ͻ 0.01, compared with no-extinction control groups (one-way ANOVA followed by Bonferroni’s post hoc test).

␤ Ϯ Ͻ endocytosis of GABAAR 3 subunits (vehicle, 62.40 12.55% of 0.0003, one-way ANOVA, post hoc, p 0.01 compared with Ϯ ϭ control; NSC23766, 90.57 17.45% of control; F(2,17) 9.89, vehicle-treated rats; Fig. 5D) and also impaired CPA extinction ϭ Ͻ ϭ Ͻ p 0.0018, one-way ANOVA, post hoc, p 0.01 compared with (main effect of drug, F(1,45) 21.7, p 0.001, two-way ANOVA, vehicle-treated rats). Accordingly, bilateral intra-vmPFC injec- post hoc, p Ͻ 0.01 compared with vehicle-treated rats; Fig. 5E). tions of NSC23766 (0.5 ␮g/0.5 ␮l/side) 30 min before extinction These results further support that Rac1 activity-associated actin ϭ training also impaired CPA extinction (main effect of drug, F(1,45) polymerization plays critical roles in GABAAR endocytosis, LTP 21.7, p Ͻ 0.001, two-way ANOVA, post hoc, p Ͻ 0.01 compared facilitation, and CPA extinction. with vehicle-treated rats) (Fig. 5B). Next, we examined the effect of HFS at 50 Hz on LTP induction in vmPFC slices from rats that Genetically manipulating Rac1 activity in the vmPFC were pretreated with NSC23766 before extinction training. We bidirectionally regulates drug withdrawal memory extinction found that LTP could not be induced anymore by the stimuli in and endocytosis of GABAARs the vmPFC from rats pretreated with NSC23766 (vehicle, The above results suggest that Rac1 activity can use cofilin to Ϯ Ϯ ϭ ϭ 111.89 4.19%, NSC23766, 94.03 2.86%, t(16) 3.90, p modulate actin dynamics, which in turn enables synaptic local- 0.001; Fig. 5C). Likewise, bilateral intra-vmPFC injections of the ization of Arc that is necessary for GABAAR endocytosis, LTP latrunculin A (250 ng/0.5 ␮l/side) 10 min before extinction train- facilitation, and CPA extinction. Thus, we further confirmed the ing also resulted in significant inhibition of endocytosis of crucial role of Rac1 activity in GABAAR endocytosis and CPA ␤ Ϯ GABAAR 3 subunits (vehicle, 63.79 10.76% of control; la- extinction by genetically manipulating Rac1 levels within the Ϯ ϭ ϭ trunculin A, 98.87 12.29% of control; F(2,17) 14.77, p vmPFC. We first examined the necessity of in vivo knockdown of 7104 • J. Neurosci., July 26, 2017 • 37(30):7096–7110 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal

Figure 4. Suppression of actin polymerization by NSC23766 and latrunculin A inhibits GABAAR endocytosis, LTP facilitation, and CPA extinction. A, B, Bilateral intra-vmPFC infusion of NSC23766 ␮ ␮ ␤ (0.5 g/0.5 l/side) 30 min before extinction training inhibited the endocytosis of GABAAR 3 subunits and impaired CPA extinction. C, HFS at 50 Hz failed to elicit LTP induction in slices from rats that were pretreated with Rac1 inhibitor NSC23766 before extinction training. D, E, Bilateral intra-vmPFC infusion of latrunculin A (250 ng/0.5 ␮l/side) 10 min before extinction training inhibited ␤ Ϯ ϭ Ͻ # Ͻ the endocytosis of GABAAR 3 subunits and impaired CPA extinction. Error bars indicate mean SEM (n 6–8). **p 0.01, compared with no-extinction control groups. p 0.05, compared withvehiclecontrolgroups(one-wayANOVAfollowedbyBonferroni’sposthoctest). ##pϽ0.01,comparedwithvehiclecontrolgroups(one-wayANOVAfollowedbyBonferroni’sposthoctest).The magnitude of LTP was the average of the last 5 min recordings expressed as the mean Ϯ SEM percentage of the baseline fEPSP. Data were analyzed with two-tailed Student’s t tests.

Rac1 expression using Rac1-shRNA for GABAAR endocytosis transgenic mice, which have a loxP-flanked Neo-STOP cassette and CPA extinction. The rats that underwent CPA received bilat- preventing transcription of the constitutively active form of Rac1. eral injections of lentivirus expressing Rac1-shRNA with high- Once microinjected with the virus to express Cre recombinase, titer stocks (5 ϫ 10 8 to 1 ϫ 10 9 TU/ml) or control shRNAs into the mice would have the STOP cassette deleted and subsequently the vmPFC. Two weeks later, the rats were subjected to extinction expressed a constitutively active form of Rac1. Figure 6E showed training. Figure 6A showed that bilateral intra-vmPFC infections that bilateral intra-vmPFC infusions of Cre recombinase virus of lentivirus resulted in effective infection with Rac1-shRNA in infected the vmPFC region effectively 2 weeks after the injection. the vmPFC, as indicated by the tagged GFP staining. As shown in As shown in Figure 6F, G, Cre recombinase virus-infected rats Figure 6B, C, Rac1-shRNA-infected rats displayed a significant displayed a significant upregulation of Rac1 activity (control virus, Ϯ ϭ Ϯ ϭ ϭ reduction of Rac1 protein expression compared with the control 100 12.86%, n 6; Cre virus, 192.9 28.04%, n 6; t(1,10) 3.01 shRNA group (control shRNA, 100 Ϯ 7.882%, n ϭ 8; Rac1- p Ͻ 0.05, Student’s t test) and facilitated CPA extinction (main Ϯ ϭ ϭ ϭ ϭ Ͻ shRNA, 72.66 6.168%, n 6; t(1,12) 2.58, p 0.0241, Stu- effect of gene, F(1,34) 29.63, p 0.001, two-way ANOVA, post dent’s t test) and impaired CPA extinction (main effect of gene, hoc, p Ͻ 0.05 compared with control virus groups). Accordingly, ϭ Ͻ Ͻ F(1,22) 4.967, p 0.05, two-way ANOVA, post hoc, p 0.05 Cre recombinase virus-infected rats also showed a significant de- Ϯ compared with control shRNA groups). Accordingly, Rac1- crease in the S/I ratio for GABAARs (control virus, 100 13.29%, ϭ ϩ ϭ ϭ Ͻ shRNA-infected rats also showed a significant increase in the S/I n 9; Cre virus, 70.58 3.285%, n 9; t(1,12) 2.331, p 0.05, Ϯ ratio for GABAARs (control shRNA, 62.49 4.399% of control, Student’s t test; Fig. 6H). No significant difference in the levels of ϭ Ϯ ϭ ϭ n 7; Rac1-shRNA, 101.1 12.31% of control, n 7; F(2,18) total GABAAR protein was found between any of the experimen- 4.786, p ϭ 0.0215, one-way ANOVA, post hoc, p Ͻ 0.05 compared tal groups. These results clearly demonstrate that Rac1 activity with control shRNA groups; Fig. 6D). No significant differences within the vmPFC is sufficient for extinction training-induced in the levels of total GABAAR protein were found between any of GABAAR endocytosis and CPA extinction. the experimental groups. These results further demonstrate that Rac1 within the vmPFC is necessary and for extinction training- Increased BDNF expression in the vmPFC is required for induced GABAAR endocytosis and CPA extinction. Rac1-mediated endocytosis of GABAARs and induction of LTP Next, we examined the sufficiency of Rac1 activity within the Our previous study demonstrates that BDNF in the vmPFC is vmPFC for GABAAR endocytosis and CPA extinction using Rac1 required for extinction of drug withdrawal-associated memory Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal J. Neurosci., July 26, 2017 • 37(30):7096–7110 • 7105

Figure5. GeneticallymanipulatingRac1activityinthevmPFCbidirectionallyregulatesdrugwithdrawalmemoryextinctionandendocytosisofGABAARs.A–D,KnockdownoftheRac1expression ␤ by Rac1-shRNA impaired CPA extinction and suppressed endocytosis of GABAAR 3 subunits. A, Infection of the vmPFC with lentivirus expressing Rac1-shRNA was visualized by fluorescence microscope. B, Infection of lentivirus expressing Rac1-shRNA attenuated Rac1 expression within the vmPFC. C, Knockdown of the Rac1 expression in the vmPFC with Rac1-shRNA impaired CPA ␤ Ͻ extinction. D, Knockdown of the Rac1 expression in the vmPFC with Rac1-shRNA suppressed endocytosis of GABAAR 3 subunits. *p 0.05, compared with control shRNA or no-extinction control # Ͻ ␤ groups. p 0.05, compared with control shRNA groups. E–H, Facilitation of CPA extinction and endocytosis of GABAAR 3 subunits were observed in floxed mice to express constitutively active form of Rac1 induced by adeno-associated virus carrying Cre recombinase (AAV-Cre). E, Infection of the vmPFC with AAV-Cre was visualized by fluorescence microscope. B, Elevation of Rac1 activity was induced by expressing constitutively active Rac1 in the vmPFC through AAV-Cre. G, H, The constitutively active Rac1 mice displayed acceleration of CPA extinction and augmentation of ␤ Ͻ # Ͻ endocytosisofGABAAR 3subunits.*p 0.05,comparedwithAAV-GFPcontrolgroups(two-tailedStudent’sttestortwo-wayANOVAfollowedbyBonferroni’sposthoctest). p 0.05,compared with no-extinction control groups (two-tailed Student’s t test or two-way ANOVA followed by Bonferroni’s post hoc test). Error bars indicate mean Ϯ SEM (n ϭ 6).

(Wang et al., 2012), although the mechanisms underlying BDNF cytosis by using TrkB-FC indicates that BDNF participates in

that contribute to extinction of such memory are unclear. We dynamin-dependent GABAAR endocytosis in the vmPFC. hypothesized that the molecular events occurred following ex- To further determine whether the increase of BDNF expres- tinction training might be BDNF-dependent. To test this hypoth- sion was essential for LTP facilitation after extinction training, we esis, we first examined the effect of extinction training on BDNF examined LTP induction in extinction-trained rats that were pre- expression in the vmPFC. As shown in Figure 6A, extinction treated with the TrkB receptor antagonist K252a (35.7 ␮M/␮l/per training significantly increased synaptic BDNF protein levels 1, 2, side) before extinction training. We found that LTP was no lon- and 3 h after training (p Ͻ 0.05, one-way ANOVA followed by ger induced in the extinction trained rats pretreated with K252a Ϯ Ϯ ϭ ϭ Bonferroni post hoc test), consistent with our previous study (vehicle, 115.32 4.46%, K252a, 94.44 2.44%, t(16) 4.16, p (Wang et al., 2012). Next, we determined whether increased 0.0007; Fig. 6D). Together, these results clearly demonstrate that BDNF expression was involved in activation of Rac1, endocytosis increased BDNF expression was linked to activation of Rac1, en-

of GABAAR, and facilitation of LTP. We found that the activation docytosis of GABAAR, and facilitation of LTP. of Rac1 induced by extinction training was blocked significantly by bilateral intra-vmPFC infusions of BDNF scavenger TrkB-FC Discussion (0.65 ␮g/0.5 ␮l/side) and Rac1 inhibitor NSC23766 (0.5 ␮g/0.5 CPA is a highly sensitive animal model for measurement of the ␮ ϭ Ͻ l/side) 30 min before extinction training (F(3,20) 7.89, p aversive memories of opiate withdrawal (Stinus et al., 2000; Azar ␤ 0.01). To further confirm whether GABAAR 3 subunit endocy- et al., 2003). CPA, once formed, is long-lasting (Stinus et al., tosis is linked to the elevated BDNF expression in the vmPFC 2000) but can be extinguished by extinction training (Myers and following extinction training, we assessed the effect of the BDNF Carlezon et al., 2010; Wang et al., 2012). The present study reveals scavenger TrkB-FC on extinction training-induced endocytosis that extinction training activates Rac1 in a BDNF-dependent manner, ␤ of GABAAR 3 subunits at synapses. As shown in Figure 6C, which determines the extinction of CPA to naloxone-precipitated ␮ ␮ bilateral infusions of TrkB-FC (0.65 g/0.5 l/side) into the opiate withdrawal by facilitating GABAAR endocytosis through vmPFC 30 min before extinction training resulted in a significant triggering synaptic translocation of Arc via regulation of actin ␤ increase in the S/I ratio of the 3 subunit of the GABAARs polymerization (Fig. 7). Therefore, our findings provide new (vehicle, 15.87 Ϯ 5.02% of control; TrkB-FC: 49.23 Ϯ 17.38% insight into the molecular mechanisms by which a previously ϭ Ͻ of control; F(2,14) 41.22, p 0.001, one-way ANOVA). Post hoc established memory could be extinguished, thereby suggesting analysis revealed a significant difference between vehicle and therapeutic targets to promote extinction of the unwanted Ͻ TrkB-FC groups (p 0.05). Thus, reduction of GABAAR endo- memory. 7106 • J. Neurosci., July 26, 2017 • 37(30):7096–7110 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal

Figure 6. BDNF scavenger TrkB-FC suppresses extinction training-induced activation of Rac1, endocytosis of GABAARs, and induction of LTP. A, Extinction training increased BDNF protein expression in the vmPFC. B, Extinction training induced Rac1 activation was blocked by intra-vmPFC infusion of BDNF scavenger TrkB-FC (0.65 ␮g/0.5 ␮l/side) and Rac1 inhibitor NSC23766 before ␤ extinctiontraining.C,EndocytosisofGABAAR 3subunitswassuppressedbyintra-vmPFCinfusionofBDNFscavengerTrkB-FCbeforeextinctiontraining.D,HFSat50HzfailedtoelicitLTPinduction in slices from rats that were pretreated with TrkB receptor antagonist k252a (35.7 ␮M/␮l/side), given by intra-vmPFC infusion bilaterally before extinction training. *p Ͻ 0.05, compared with no-extinction control groups. **p Ͻ 0.01, compared with no-extinction control groups. #p Ͻ 0.05, compared with vehicle control groups (one-way ANOVA followed by Bonferroni’s post hoc test). The magnitude of LTP was the average of the last 5 min recordings expressed as the mean Ϯ SEM percentage of the baseline fEPSP. Data were analyzed with two-tailed Student’s t tests.

Important role of mPFC GABAAR endocytosis in extinction rats, the same picrotoxin application produces no additional LTP of drug withdrawal memory facilitation in extinction rats. This occlusion of LTP induction The vmPFC is a key component of the brain’s extinction circuitry suggests that extinction training and picrotoxin application share (Quirk et al., 2006; Sotres-Bayon et al., 2006). Studies based on the same mechanism in facilitating LTP induction by reducing lesion and pharmacological manipulation show that the vmPFC GABAergic transmission, and indicates that GABAAR-mediated is required for long-term extinction of fear memory (Quirk et al., GABAergic transmission normally suppresses LTP induction in 2000; Milad and Quirk, 2002; Milad et al., 2004; Santini et al., vmPFC excitatory neurons, and extinction training facilitates 2004; Sotres-Bayon et al., 2006). Our recent study also demon- LTP induction by reducing GABAergic inhibition through the strates that the vmPFC is required for extinction of drug with- endocytosis of GABAARs. drawal memory (Wang et al., 2012). GABAARs are the main mediators of inhibitory transmission in the brain. Activity- Arc serves as a critical regulator for GABAAR endocytosis dependent regulation of GABAergic transmission is essential for GABAARs enter the endocytosis pathway by a clathrin-mediated synaptic plasticity and information processing in the brain (Da- and dynamin-dependent mechanism (Kittler et al., 2000; Herry vies et al., 1991; Paulsen and Moser, 1998; Smith and Kittler, and Garcia, 2003; van Rijnsoever et al., 2005). In neurons, endo-

2010). In the present study, we found that extinction training cytosis of GABAARs occurs primarily by interactions of the ␤ resulted in suppressing the efficacy of inhibitory synaptic trans- GABAAR 3 subunits with the clathrin adaptor protein AP2 (Kit- mission in the vmPFC by increasing of GABAAR endocytosis, tler et al., 2000; Jovanovic et al., 2004; Jacob et al., 2009; Lu et al., which was required for LTP induction and extinction of drug 2010), a process that is essential for the targeting of receptors into withdrawal memory, because blockade of GABAAR endocytosis clathrin-coated pits. Receptors delivered into clathrin-coated pits by a dynamin function-blocking peptide (Myr-P4) abolished by AP2 are then internalized by dynamin, a component of the LTP induction and extinction of drug withdrawal memory. The endocytic machinery, mediated scission of clathrin-coated pits essential role of the diminishing GABAergic transmission for from the plasma membrane (Hill et al., 2001; Merrifield et al., vmPFC LTP induction is further demonstrated by using the 2002). Blockade of the effect of dynamin by a dynamin function

GABAAR antagonist picrotoxin. Suppressing GABAergic transmission blocking peptide can prevent GABAAR endocytosis in the hip- with picrotoxin facilitates LTP induction in no-extinction control pocampus, amygdala, and nucleus accumbens (Kittler et al., Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal J. Neurosci., July 26, 2017 • 37(30):7096–7110 • 7107

Figure 7. A synaptic model proposed for extinction of memory. Extinction training activates Rac1 in a BDNF-dependent manner in the vmPFC. Active Rac1 induces synaptic actin polymerization via activating Pak1-cofilin signal pathway. Meanwhile, extinction training also results in Arc mRNA transcription. Arc mRNA is then translocated at dendritic spines through actin polymerization- dependentmachinery.Withinthedendriticspines,Arcproteinsarerapidlytranslatedandthenformacomplexwithdynamin(Dyn)tofacilitateGABAARendocytosis,therebyleadingtoLTPinduction and CPA extinction.

2000; Chen et al., 2006; Terunuma et al., 2008; Lin et al., 2011). action with dynamin. Previous studies have shown that Arc Consistent with these studies, we found that LTP induction and interacts with dynamin to modulate AMPAR endocytosis, thus CPA extinction induced by extinction training were abolished allowing it to mediate LTD induction (Chowdhury et al., 2006; by blocking GABAAR endocytosis using a dynamin function- Rial Verde et al., 2006; Wang and Kriegstein, 2008; Liu et al., blocking peptide Myr-P4 (Fig. 4B), indicating that dynamin is 2012). The present study extends previous findings by showing involved in the endocytosis of GABAARs induced by extinction that Arc can mediate LTP induction by facilitation of GABAAR training. More importantly, this study reveals that the activity- endocytosis, and identifies Arc as a downstream effector of Rac1 regulated cytoskeleton-associated protein Arc is response for regulations of synaptic plasticity as well as learning and memory. triggering dynamin-dependent GABAAR endocytosis. Arc is known to be important for the stabilization of synaptic Activation of Rac1 in a BDNF-dependent manner is critical plasticity and long-term memory formation (Steward et al., 1998; for synaptic localization of Arc through actin polymerization Guzowski et al., 1999, 2000; Cooke and Bliss, 2006; Plath et al., Localization of Arc mRNA at active synapses is one of the critical 2006). Its expression is dynamically regulated by learning expe- events that are required for its regulatory effect on synaptic plas- riences and stimulus protocols generating LTP (Link et al., 1995; ticity (Tzingounis and Nicoll, 2006). Synaptic actin polymeriza- Steward et al., 1998; McIntyre et al., 2005; Ploski et al., 2008; tion may be a possible mechanism underlying Arc localization at Mamiya et al., 2009; Liu et al., 2012). In the present study, we active synapse because the actin filaments within the dendritic found that extinction training resulted in robust increase of spines can serve as a path for mRNA and protein trafficking synaptic Arc expression in the vmPFC. We further demonstrated (Langford and Molyneaux, 1998; Kaech et al., 2001) or act as an that knockdown of synaptic Arc expression in the vmPFC using anchor for mRNA and protein docking (Allison et al., 1998; Lis-

Arc/Arg3.1-shRNA suppressed GABAAR endocytosis and extinc- man and Zhabotinsky, 2001). One of the major regulators of tion of drug withdrawal memory (Fig. 2E,F), suggesting that Arc synaptic actin dynamics is the actin depolymerizing protein co- plays an important role in GABAAR endocytosis and extinction of filin; its phosphorylation and dephosphorylation are important drug withdrawal memory. Given the evidence that extinction for actin polymerization and depolymerization (Bamburg, 1999). training-induced GABAAR endocytosis could be blocked by the Cofilin-regulated actin dynamics has been associated with inser- dynamin function-interfering peptide (Fig. 1B) and that Arc has tion and endocytosis of AMPA receptors (Gu et al., 2010; Liu et been shown to interact with components of the endocytic ma- al., 2012; Wang et al., 2013). chinery dynamin (Chowdhury et al., 2006), the present study Cofilin phosphorylation is regulated by parallel signaling suggests that Arc may trigger GABAAR endocytosis via inter- pathways through the Rho GTPase effectors RhoA kinase or Pak 7108 • J. Neurosci., July 26, 2017 • 37(30):7096–7110 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal

(Rex et al., 2009). Pak is a critical regulator of actin dynamics in Collingridge GL, Isaac JT, Wang YT (2004) Receptor trafficking and synap- the cortex (Hayashi et al., 2004), is concentrated in spines of tic plasticity. Nat Rev Neurosci 5:952–962. CrossRef Medline mature cortical neurons, and has been shown to promote synap- Cooke SF, Bliss TV (2006) Plasticity in the human central nervous system. Brain 129:1659–1673. CrossRef Medline tic actin dynamics via phosphorylation of cofilin through activa- Davies CH, Starkey SJ, Pozza MF, Collingridge GL (1991) GABA autoreceptors tion of LIM kinase (Edwards et al., 1999; Hayashi et al., 2004). Pak regulate the induction of LTP. Nature 349:609–611. CrossRef Medline activity is largely controlled by Rac1 and Cdc42 (Manser et al., Davis M, Ressler K, Rothbaum BO, Richardson R (2006) Effects of 1994; Edwards et al., 1999). The present study demonstrated that D-cycloserine on extinction: translation from preclinical to clinical work. extinction training activated Rac1, but not Cdc42, phosphory- Biol Psychiatry 60:369–375. CrossRef Medline lated Pak1 and cofilin, and induced actin polymerization, which Ding ZB, Wu P, Luo YX, Shi HS, Shen HW, Wang SJ, Lu L (2013) Region- was required for the synaptic localization of Arc, because inhibi- specific role of Rac in nucleus accumbens core and basolateral amygdala in consolidation and reconsolidation of cocaine-associated cue memory tion of actin polymerization with the Rac1 inhibitor NSC23766 in rats. Psychopharmacology (Berl) 228:427–437. CrossRef or the actin polymerization inhibitor latrunculin A abolished the Edwards DC, Sanders LC, Bokoch GM, Gill GN (1999) Activation of LIM- enhancement of synaptic Arc localization (Fig. 3F). Accordingly, kinase by Pak1 couples Rac/Cdc42 GTPase signalling to actin cytoskeletal the inhibition of actin polymerization with NSC23766 or latrun- dynamics. Nat Cell Biol 1:253–259. CrossRef Medline Engert F, Bonhoeffer T (1999) Dendritic spine changes associated with hip- culin A also suppressed GABAAR endocytosis and extinction of drug withdrawal memory (Fig. 5A,D). These results indicate a pocampal long-term synaptic plasticity. Nature 399:66–70. CrossRef critical role of Rac1 activation for extinction training-induced Medline Fu M, Yu X, Lu J, Zuo Y (2012) Repetitive motor learning induces coordi- GABAAR endocytosis and extinction of drug withdrawal mem- nated formation of clustered dendritic spines in vivo. Nature 483:92–95. ory. This conclusion is further supported by the results obtained CrossRef Medline from genetically manipulating Rac1 expression within the vmPFC. Gu J, Lee CW, Fan Y, Komlos D, Tang X, Sun C, Yu K, Hartzell HC, Chen G, Knockdown of Rac1 expression by using Rac1-shRNA sup- Bamburg JR, Zheng JQ (2010) ADF/cofilin-mediated actin dynamics regulate AMPA receptor trafficking during synaptic plasticity. Nat Neu- pressed GABAAR endocytosis and extinction of drug withdrawal memory, whereas expression of a constitutively active form of rosci 13:1208–1215. CrossRef Medline Rac1 accelerated GABA R endocytosis and extinction of drug Guzowski JF, McNaughton BL, Barnes CA, Worley PF (1999) Environment- A specific expression of the immediate-early gene Arc in hippocampal neu- withdrawal memory (Fig. 6). Furthermore, we found that ac- ronal ensembles. Nat Neurosci 2:1120–1124. CrossRef Medline tivation of Rac1 induced by extinction training was BDNF- Guzowski JF, Lyford GL, Stevenson GD, Houston FP, McGaugh JL, Worley dependent because infusion of the BDNF scavenger TrkB-FC PF, Barnes CA (2000) Inhibition of activity-dependent arc protein ex- into the vmPFC before extinction training abolished extinction pression in the rat hippocampus impairs the maintenance of long-term training-induced activation of Rac1, phosphorylation of Pak1 potentiation and the consolidation of long-term memory. J Neurosci and cofilin, and polymerization of actin (Fig. 3) as well as endo- 20:3993–4001. Medline cytosis of GABA Rs and induction of LTP (Fig. 6). BDNF is the Hall A (1998) G proteins and small GTPases: distant relatives keep in touch. A Science 280:2074–2075. CrossRef Medline most studied neurotrophin involved in learning and memory Hall A (2005) Rho GTPases and the control of cell behaviour. Biochem Soc (Minichiello, 2009). Our results support that BDNF plays a cru- Trans 33:891–895. CrossRef Medline cial role in synaptic plasticity and diverse forms of learning and Hart G, Harris JA, Westbrook RF (2009) Systemic or intra-amygdala injec- memory, and provides first evidence that BDNF can contribute tion of a benzodiazepine (midazolam) impairs extinction but spares re- extinction of conditioned fear responses. Learn Mem 16:53–61. CrossRef to synaptic and behavioral plasticity by facilitating GABAARen- docytosis through Rac1-dependent synaptic localization of Arc. Medline Hayashi ML, Choi SY, Rao BS, Jung HY, Lee HK, Zhang D, Chattarji S, Kirkwood A, Tonegawa S (2004) Altered cortical synaptic morphology References and impaired memory consolidation in forebrain-specific dominant- Akirav I (2007) NMDA partial agonist reverses blocking of extinction of negative PAK transgenic mice. Neuron 42:773–787. CrossRef Medline aversive memory by GABA(A) agonist in the amygdala. Neuropsychop- Herry C, Garcia R (2003) Behavioral and paired-pulse facilitation analyses harmacology 32:542–550. CrossRef Medline of long-lasting depression at excitatory synapses in the medial prefrontal Allison DW, Gelfand VI, Spector I, Craig AM (1998) Role of actin in an- cortex in mice. Behav Brain Res 146:89–96. CrossRef Medline choring postsynaptic receptors in cultured hippocampal neurons: dif- Hill E, van Der Kaay J, Downes CP, Smythe E (2001) The role of dynamin ferential attachment of NMDA versus AMPA receptors. J Neurosci and its binding partners in coated pit invagination and scission. J Cell Biol 18:2423–2436. Medline 152:309–323. CrossRef Medline Anggono V, Huganir RL (2012) Regulation of AMPA receptor trafficking and Hofmann SG, Meuret AE, Smits JA, Simon NM, Pollack MH, Eisenmenger K, synaptic plasticity. Curr Opin Neurobiol 22:461–469. CrossRef Medline Shiekh M, Otto MW (2006) Augmentation of exposure therapy with Azar MR, Jones BC, Schulteis G (2003) Conditioned place aversion is a D-cycloserine for social anxiety disorder. Arch Gen Psychiatry 63:298– highly sensitive index of acute opioid dependence and withdrawal. Psy- 304. CrossRef Medline chopharmacology (Berl) 170:42–50. CrossRef Medline Hou YY, Lu B, Li M, Liu Y, Chen J, Chi ZQ, Liu JG (2009) Involvement of Bamburg JR (1999) Proteins of the ADF/cofilin family: essential regulators actin rearrangements within the amygdala and the dorsal hippocampus in of actin dynamics. Annu Rev Cell Dev Biol 15:185–230. CrossRef Medline aversive memories of drug withdrawal in acute morphine-dependent rats. Barad M (2005) Fear extinction in rodents: basic insight to clinical promise. J Neurosci 29:12244–12254. CrossRef Curr Opin Neurobiol 15:710–715. CrossRef Medline Huang F, Chotiner JK, Steward O (2007) Actin polymerization and ERK Berlau DJ, McGaugh JL (2006) Enhancement of extinction memory consoli- phosphorylation are required for Arc/Arg3.1 mRNA targeting to acti- dation: the role of the noradrenergic and GABAergic systems within the ba- vated synaptic sites on dendrites. J Neurosci 27:9054–9067. CrossRef solateral amygdala. Neurobiol Learn Mem 86:123–132. CrossRef Medline Medline Chen G, Kittler JT, Moss SJ, Yan Z (2006) Dopamine D3 receptors regulate Hutcheson DM, Everitt BJ, Robbins TW, Dickinson A (2001) The role of GABAA receptor function through a phospho-dependent endocytosis withdrawal in heroin addiction: enhances reward or promotes avoidance? mechanism in nucleus accumbens. J Neurosci 26:2513–2521. CrossRef Nat Neurosci 4:943–947. CrossRef Medline Medline Ives JH, Drewery DL, Thompson CL (2002) Differential cell surface expres- Chowdhury S, Shepherd JD, Okuno H, Lyford G, Petralia RS, Plath N, Kuhl sion of GABAA receptor alpha1, alpha6, beta2 and beta3 subunits in D, Huganir RL, Worley PF (2006) Arc/Arg3.1 interacts with the endo- cultured mouse cerebellar granule cells influence of cAMP-activated sig- cytic machinery to regulate AMPA receptor trafficking. Neuron 52:445– nalling. J Neurochem 80:317–327. CrossRef Medline 459. CrossRef Medline Jacob TC, Wan Q, Vithlani M, Saliba RS, Succol F, Pangalos MN, Moss SJ Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal J. Neurosci., July 26, 2017 • 37(30):7096–7110 • 7109

(2009) GABA(A) receptor membrane trafficking regulates spine matu- threonine protein kinase activated by Cdc42 and Rac1. Nature 367:40– rity. Proc Natl Acad Sci U S A 106:12500–12505. CrossRef Medline 46. CrossRef Medline Jovanovic JN, Thomas P, Kittler JT, Smart TG, Moss SJ (2004) Brain- Matsuzaki M, Honkura N, Ellis-Davies GC, Kasai H (2004) Structural basis derived neurotrophic factor modulates fast synaptic inhibition by regu- of long-term potentiation in single dendritic spines. Nature 429:761–766. lating GABA(A) receptor phosphorylation, activity, and cell-surface CrossRef Medline stability. J Neurosci 24:522–530. CrossRef Medline McGaugh JL, Introini-Collison IB, Nagahara AH, Cahill L, Brioni JD, Cas- Kaech S, Parmar H, Roelandse M, Bornmann C, Matus A (2001) Cytoskel- tellano C (1990) Involvement of the amygdaloid complex in neuro- etal microdifferentiation: a mechanism for organizing morphological modulatory influences on memory storage. Neurosci Biobehav Rev 14: plasticity in dendrites. Proc Natl Acad Sci U S A 98:7086–7092. CrossRef 425–431. CrossRef Medline Medline McIntyre CK, Miyashita T, Setlow B, Marjon KD, Steward O, Guzowski JF, Kittler JT, Delmas P, Jovanovic JN, Brown DA, Smart TG, Moss SJ (2000) McGaugh JL (2005) Memory-influencing intra-basolateral amygdala Constitutive endocytosis of GABAA receptors by an association with the drug infusions modulate expression of Arc protein in the hippocampus. adaptin AP2 complex modulates inhibitory synaptic currents in hip- Proc Natl Acad Sci U S A 102:10718–10723. CrossRef Medline pocampal neurons. J Neurosci 20:7972–7977. Medline Merrifield CJ, Feldman ME, Wan L, Almers W (2002) Imaging actin and Kittler JT, Chen G, Honing S, Bogdanov Y, McAinsh K, Arancibia-Carcamo dynamin recruitment during invagination of single clathrin-coated pits. IL, Jovanovic JN, Pangalos MN, Haucke V, Yan Z, Moss SJ (2005) Nat Cell Biol 4:691–698. CrossRef Medline Phospho-dependent binding of the clathrin AP2 adaptor complex to Milad MR, Quirk GJ (2002) Neurons in medial prefrontal cortex signal GABAA receptors regulates the efficacy of inhibitory synaptic transmis- memory for fear extinction. Nature 420:70–74. CrossRef Medline sion. Proc Natl Acad Sci U S A 102:14871–14876. CrossRef Medline Milad MR, Vidal-Gonzalez I, Quirk GJ (2004) Electrical stimulation of me- Koob GF (2000) Neurobiology of addiction: toward the development of dial prefrontal cortex reduces conditioned fear in a temporally specific new therapies. Ann N Y Acad Sci 909:170–185. CrossRef Medline manner. Behav Neurosci 118:389–394. CrossRef Medline Lai CS, Franke TF, Gan WB (2012) Opposite effects of fear conditioning and Minichiello L (2009) TrkB signalling pathways in LTP and learning. Nat Rev extinction on dendritic spine remodelling. Nature 483:87–91. CrossRef Neurosci 10:850–860. CrossRef Medline Medline Mott DD, Lewis DV (1991) Facilitation of the induction of long-term potenti- Langford GM, Molyneaux BJ (1998) Myosin V in the brain: mutations lead to ation by GABAB receptors. Science 252:1718–1720. CrossRef Medline neurological defects. Brain Res Brain Res Rev 28:1–8. CrossRef Medline Myers KM, Carlezon WA Jr (2010) D-cycloserine facilitates extinction of Li M, Hou YY, Lu B, Chen J, Chi ZQ, Liu JG (2009) Expression pattern of naloxone-induced conditioned place aversion in morphine-dependent neural synaptic plasticity marker-Arc in different brain regions induced rats. Biol Psychiatry 67:85–87. CrossRef Medline by conditioned drug withdrawal from acute morphine-dependent rats. Nakayama AY, Harms MB, Luo L (2000) Small GTPases Rac and Rho in the maintenance of dendritic spines and branches in hippocampal pyramidal Acta Pharmacol Sin 30:282–290. CrossRef Medline neurons. J Neurosci 20:5329–5338. Medline Lin HC, Tseng YC, Mao SC, Chen PS, Gean PW (2011) GABAA receptor Paulsen O, Moser EI (1998) A model of hippocampal memory encoding endocytosis in the basolateral amygdala is critical to the reinstatement of and retrieval: GABAergic control of synaptic plasticity. Trends Neurosci fear memory measured by fear-potentiated startle. J Neurosci 31:8851– 21:273–278. CrossRef Medline 8861. CrossRef Medline Peters J, Dieppa-Perea LM, Melendez LM, Quirk GJ (2010) Induction of fear Link W, Konietzko U, Kauselmann G, Krug M, Schwanke B, Frey U, Kuhl D extinction with hippocampal-infralimbic BDNF. Science 328:1288–1290. (1995) Somatodendritic expression of an immediate early gene is regu- CrossRef Medline lated by synaptic activity. Proc Natl Acad Sci U S A 92:5734–5738. Plath N, Ohana O, Dammermann B, Errington ML, Schmitz D, Gross C, Mao CrossRef Medline X, Engelsberg A, Mahlke C, Welzl H, Kobalz U, Stawrakakis A, Fernandez Lisman JE, Zhabotinsky AM (2001) A model of synaptic memory: a E, Waltereit R, Bick-Sander A, Therstappen E, Cooke SF, Blanquet V, CaMKII/PP1 switch that potentiates transmission by organizing an AMPA Wurst W, Salmen B, et al. (2006) Arc/Arg3.1 is essential for the consoli- receptor anchoring assembly. Neuron 31:191–201. CrossRef Medline dation of synaptic plasticity and memories. Neuron 52:437–444. CrossRef Liu Y, Zhou QX, Hou YY, Lu B, Yu C, Chen J, Ling QL, Cao J, Chi ZQ, Xu L, Medline Liu JG (2012) Actin polymerization-dependent increase in synaptic Ploski JE, Pierre VJ, Smucny J, Park K, Monsey MS, Overeem KA, Schafe GE Arc/Arg3.1 expression in the amygdala is crucial for the expression of (2008) The activity-regulated cytoskeletal-associated protein (Arc/Arg3.1) aversive memory associated with drug withdrawal. J Neurosci 32:12005– is required for memory consolidation of pavlovian fear conditioning in the 12017. CrossRef Medline lateral amygdala. J Neurosci 28:12383–12395. CrossRef Medline Lu H, Cheng PL, Lim BK, Khoshnevisrad N, Poo MM (2010) Elevated Quirk GJ, Russo GK, Barron JL, Lebron K (2000) The role of ventromedial BDNF after cocaine withdrawal facilitates LTP in medial prefrontal cortex prefrontal cortex in the recovery of extinguished fear. J Neurosci 20:6225– by suppressing GABA inhibition. Neuron 67:821–833. CrossRef Medline 6231. Medline Luo L (2000) Rho GTPases in neuronal morphogenesis. Nat Rev Neurosci Quirk GJ, Garcia R, Gonza´lez-Lima F (2006) Prefrontal mechanisms in 1:173–180. CrossRef Medline extinction of conditioned fear. Biol Psychiatry 60:337–343. CrossRef Luo L, Hensch TK, Ackerman L, Barbel S, Jan LY, Jan YN (1996) Differential Medline effects of the Rac GTPase on Purkinje cell axons and dendritic trunks and Rex CS, Chen LY, Sharma A, Liu J, Babayan AH, Gall CM, Lynch G (2009) spines. Nature 379:837–840. CrossRef Medline Different Rho GTPase-dependent signaling pathways initiate sequential Lu¨scher B, Fuchs T, Kilpatrick CL (2011) GABAA receptor trafficking- steps in the consolidation of long-term potentiation. J Cell Biol 186:85– mediated plasticity of inhibitory synapses. Neuron 70:385–409. CrossRef 97. CrossRef Medline Medline Rial Verde EM, Lee-Osbourne J, Worley PF, Malinow R, Cline HT (2006) Lu¨scher C, Nicoll RA, Malenka RC, Muller D (2000) Synaptic plasticity and Increased expression of the immediate-early gene arc/arg3.1 reduces dynamic modulation of the postsynaptic membrane. Nat Neurosci 3:545– AMPA receptor-mediated synaptic transmission. Neuron 52:461–474. 550. CrossRef Medline CrossRef Medline Makkar SR, Zhang SQ, Cranney J (2010) Behavioral and neural analysis of Santini E, Ge H, Ren K, Pen˜a de Ortiz S, Quirk GJ (2004) Consolidation of GABA in the acquisition, consolidation, reconsolidation, and extinction fear extinction requires protein synthesis in the medial prefrontal cortex. of fear memory. Neuropsychopharmacology 35:1625–1652. CrossRef J Neurosci 24:5704–5710. CrossRef Medline Medline Schafer DA, Weed SA, Binns D, Karginov AV, Parsons JT, Cooper JA (2002) Malinow R, Malenka RC (2002) AMPA receptor trafficking and synaptic Dynamin2 and cortactin regulate actin assembly and filament organiza- plasticity. Annu Rev Neurosci 25:103–126. CrossRef Medline tion. Curr Biol 12:1852–1857. CrossRef Medline Mamiya N, Fukushima H, Suzuki A, Matsuyama Z, Homma S, Frankland Smith KR, Kittler JT (2010) The cell biology of synaptic inhibition in health PW, Kida S (2009) Brain region-specific gene expression activation re- and disease. Curr Opin Neurobiol 20:550–556. CrossRef Medline quired for reconsolidation and extinction of contextual fear memory. Sotres-Bayon F, Cain CK, LeDoux JE (2006) Brain mechanisms of fear ex- J Neurosci 29:402–413. CrossRef Medline tinction: historical perspectives on the contribution of prefrontal cortex. Manser E, Leung T, Salihuddin H, Zhao ZS, Lim L (1994) A brain serine/ Biol Psychiatry 60:329–336. CrossRef Medline 7110 • J. Neurosci., July 26, 2017 • 37(30):7096–7110 Wang et al. • Small GTPase Rac1 and Extinction of Aversive Memories of Drug Withdrawal

Steward O, Wallace CS, Lyford GL, Worley PF (1998) Synaptic activation tion in the neocortex via NMDA receptor activation. J Neurosci 28:5547– causes the mRNA for the IEG Arc to localize selectively near activated 5558. CrossRef Medline postsynaptic sites on dendrites. Neuron 21:741–751. CrossRef Medline Wang WS, Kang S, Liu WT, Li M, Liu Y, Yu C, Chen J, Chi ZQ, He L, Liu JG Stinus L, Caille S, Koob GF (2000) Opiate withdrawal-induced place aver- (2012) Extinction of aversive memories associated with morphine with- sion lasts for up to 16 weeks. Psychopharmacology (Berl) 149:115–120. drawal requires ERK-mediated epigenetic regulation of brain-derived CrossRef Medline neurotrophic factor transcription in the rat ventromedial prefrontal cor- Terunuma M, Xu J, Vithlani M, Sieghart W, Kittler J, Pangalos M, Haydon PG, tex. J Neurosci 32:13763–13775. CrossRef Medline Coulter DA, Moss SJ (2008) Deficits in phosphorylation of GABA(A) re- Wang Y, Dong Q, Xu XF, Feng X, Xin J, Wang DD, Yu H, Tian T, Chen ZY ceptors by intimately associated protein kinase C activity underlie com- (2013) Phosphorylation of cofilin regulates extinction of conditioned promised synaptic inhibition during status epilepticus. J Neurosci 28: aversive memory via AMPAR trafficking. J Neurosci 33:6423–6433. 376–384. CrossRef Medline CrossRef Medline Wigstro¨m H, Gustafsson B (1983) Facilitated induction of hippocampal Tolias KF, Bikoff JB, Burette A, Paradis S, Harrar D, Tavazoie S, Weinberg RJ, long-lasting potentiation during blockade of inhibition. Nature 301:603– Greenberg ME (2005) The Rac1-GEF Tiam1 couples the NMDA recep- 604. CrossRef Medline tor to the activity-dependent development of dendritic arbors and spines. Xie Z, Srivastava DP, Photowala H, Kai L, Cahill ME, Woolfrey KM, Shum Neuron 45:525–538. CrossRef Medline CY, Surmeier DJ, Penzes P (2007) Kalirin-7 controls activity-dependent Toni N, Buchs PA, Nikonenko I, Bron CR, Muller D (1999) LTP promotes structural and functional plasticity of dendritic spines. Neuron 56:640– formation of multiple spine synapses between a single axon terminal and 656. CrossRef Medline a dendrite. Nature 402:421–425. CrossRef Medline Yang G, Pan F, Gan WB (2009) Stably maintained dendritic spines are as- Tzingounis AV, Nicoll RA (2006) Arc/Arg3.1: linking gene expression to sociated with lifelong memories. Nature 462:920–924. CrossRef Medline synaptic plasticity and memory. Neuron 52:403–407. CrossRef Medline Yarar D, Waterman-Storer CM, Schmid SL (2005) A dynamic actin cyto- van Rijnsoever C, Sidler C, Fritschy JM (2005) Internalized GABA- skeleton functions at multiple stages of clathrin-mediated endocytosis. receptor subunits are transferred to an intracellular pool associated Mol Biol Cell 16:964–975. CrossRef Medline with the postsynaptic density. Eur J Neurosci 21:327–338. CrossRef Zhang B, Zhang Y, Shacter E (2003) Caspase 3-mediated inactivation of rac Medline GTPases promotes drug-induced apoptosis in human lymphoma cells. Wang DD, Kriegstein AR (2008) GABA regulates excitatory synapse forma- Mol Cell Biol 23:5716–5725. CrossRef Medline