Cooperation Among Stat1, Glucocorticoid Receptor, and PU.1 in Transcriptional Activation of the High-Affinity Fcγ Receptor I in Monocytes This information is current as of September 27, 2021. Saara Aittomäki, Marko Pesu, Bernd Groner, Olli A. Jänne, Jorma J. Palvimo and Olli Silvennoinen J Immunol 2000; 164:5689-5697; ; doi: 10.4049/jimmunol.164.11.5689 http://www.jimmunol.org/content/164/11/5689 Downloaded from

References This article cites 51 articles, 28 of which you can access for free at:

http://www.jimmunol.org/content/164/11/5689.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Cooperation Among Stat1, Glucocorticoid Receptor, and PU.1 in Transcriptional Activation of the High-Affinity Fc␥ Receptor I in Monocytes1

Saara Aittoma¨ki,* Marko Pesu,*† Bernd Groner,‡ Olli A. Ja¨nne,§ Jorma J. Palvimo,§ and Olli Silvennoinen2*†

IFN-␥ and glucocorticoids regulate inflammatory and immune responses through Stat1 and glucocorticoid receptor (GR) tran- scription factors, respectively. The biological responses to these polypeptides are determined by integration of various signaling pathways in a cell-type and promoter-dependent manner. In this study we have characterized the molecular basis for the func- tional cooperation between IFN-␥ and dexamethasone (Dex) in the induction of the high-affinity Fc␥ receptor I (Fc␥RI) in

monocytes. Dex did not affect IFN-␥-induced Stat1 DNA binding activity or induce novel DNA-binding complexes to the Fc␥RI Downloaded from promoter. By using cell systems lacking functional GR or Stat1, we showed that GR stimulated Stat1-dependent transcription in a ligand-dependent manner, while Stat1 did not influence GR-dependent transcription. The cooperation required phosphorylation of Tyr701, DNA binding, and the trans-activation domain of Stat1, but did not involve Ser727 phosphorylation of Stat1 or physical interaction between GR and Stat1. The costimulatory effect of Dex was not dependent on a consensus glucocorticoid response element in the Stat1-responsive promoters, but required the DNA-binding and trans-activation functions of GR, and Dex-induced protein synthesis. GR activated the natural Fc␥RI promoter construct, and this response required both Stat1 and the Ets family http://www.jimmunol.org/ transcription factor PU.1. Previously, physical association between GR and Stat5 has been shown to enhance Stat5-dependent and suppress GR-dependent transcription. The results shown here demonstrate a distinct, indirect mechanism of cross-modulation between cytokine and steroid receptor signaling that integrates Stat1 and GR pathways with cell type-specific PU.1 transcription factor in the regulation of Fc␥RI gene transcription. The Journal of Immunology, 2000, 164: 5689–5697.

onocytes and their terminally differentiated counter- tional activation of monocytes and modulation of cytokine pro- parts, macrophages, carry out a variety of functions in duction (4–7). the first-line defense against foreign invaders such as In recent years the molecular mechanisms for IFN-␥ signal M by guest on September 27, 2021 phagocytosis and microbicidal activity against intracellular and ex- transduction have been elucidated (8, 9). IFN-␥ binds to a receptor tracellular microbes. Monocytes also serve as APC and critical complex consisting of IFN-␥RI and the accessory chain IFN-␥RII. activators of specific immune responses. During the immune re- Ligand-induced dimerization of the receptor chains results in ac- sponse, activated T cells provide a reciprocal activation stimulus to tivation of Jak1 and Jak2 tyrosine kinases and phosphorylation of monocytes by secretion of cytokines such as IFN-␥, one of the the IFN-␥RI on specific tyrosine residues that serve as docking most potent monocyte-activating agents (1). An important conse- sites for the Src homology 2 (SH2) domain of the latent cytoplas- quence of IFN-␥ stimulation in monocytes is up-regulated expres- mic transcription factor Stat1. In the receptor complex Stat1 be- sion of the high-affinity receptor for IgG (Fc␥RI, CD64) (2). Fc␥RI comes tyrosine phosphorylated and forms dimers that are translo- is a 72-kDa glycoprotein expressed predominantly on monocytes. cated to the nucleus and bind cognate promoter DNA sequences, It plays an important role in endocytosis of immune complexes and referred to as IFN-␥-activated site (GAS)3 (8). The Stat1 signaling opsonized microbes and in Ab-mediated cytotoxic reactions (3). pathway is essential for induction of the Fc␥RI gene, and Stat1- Engagement of the Fc␥RI promotes cellular signal transduction deficient mice are unresponsive to IFN-␥-induced Fc␥RI expres- through Src family and Syk tyrosine kinases and results in func- sion (10). Characterization of the Fc␥RI promoter has shown that the IFN-␥ regulatory region and regions determining myeloid cell- specific expression are conferred by two cis-elements within 190 nucleotides upstream of the translation initiation site. The IFN-␥- *Institute of Medical Technology, and Department of Medical Biochemistry, Uni- inducible region is localized to an IFN-␥ response region (GRR), † versity of Tampere, and Department of Clinical Microbiology, Tampere University which contains a GAS-like Stat1 binding element (11, 12). The Hospital, Tampere, Finland; ‡Chemotherapeutisches Forschungsinstitut, Georg Speyer Haus, Frankfurt am Main, Germany; and §Institute of Biomedicine, Depart- cell type-specific expression requires a downstream myeloid cell- ments of Physiology and Clinical Chemistry, University of Helsinki, Helsinki, activating transcription element, which binds the Ets family tran- Finland scription factor PU.1/Spi-1 (12, 13). Received for publication October 14, 1999. Accepted for publication March 22, 2000. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 3 Abbreviations used in this paper: GAS, IFN-␥-activated site; AF, activation function 1 This work was supported by the Academy of Finland, the Sigrid Juselius Founda- domain; CREB, cAMP response element binding protein; CBP, CREB binding pro- tion, and the Medical Research Fund of Tampere University Hospital. tein; IRF, IFN regulatory factor; CHX, cycloheximide; DBD, DNA binding domain; 2 Address correspondence and reprint requests to Dr. Olli Silvennoinen, Department Epo, erythropoietin; EpoR, Epo receptor; Fc␥RI, Fc receptor I for IgG; GR, glucocor- of Medical Biochemistry, University of Tampere, Lenkkeilijankatu 6, FIN-33014 ticoid receptor; GRE, glucocorticoid response element; GRR, IFN-␥ response region; Tampere, Finland. E-mail address: olli.silvennoinen@uta.fi Dex, dexamethasone; RLU, relative luciferase unit; TK, thymidine kinase.

Copyright © 2000 by The American Association of Immunologists 0022-1767/00/$02.00 5690 GLUCOCORTICOID RECEPTOR REGULATES STAT1-MEDIATED TRANSCRIPTION

Glucocorticoids have profound immunomodulatory effects. They Cell culture and transfection assays are widely used as immunosuppressive and anti-inflammatory agents HepG2, COS-7, and RAW264.7 cells (from American Type Culture Col- in autoimmune and allergic inflammatory diseases (14). Glucocorti- lection, Manassas, VA) were cultured in DMEM plus 10% FCS, and coids modulate the growth, differentiation, and function of lympho- THP-1 cells (from American Type Culture Collection) were cultured in cytes, neutrophils, eosinophils, mast cells, endothelial cells, and RPMI 1640 medium plus 10% FCS, all from Life Technologies/BRL (Gaithersburg, MD). U3A cells, provided by Dr. I. Kerr, were grown in monocytes through activation of the glucocorticoid receptor (GR) DMEM plus 10% Cosmic calf serum (HyClone, Logan, UT) (42). Human (15). GR belongs to the nuclear hormone receptor superfamily and peripheral blood monocytes were isolated from leukocyte-enriched buffy functions as a ligand-induced transcription factor. In unstimulated coats using Optiprep (Nycomed Pharma, Norway) density gradient cen- cells, GR exists in the cytoplasm in a complex with heat shock pro- trifugation according to the manufacturer’s instructions. After centrifuga- teins and immunophilins, and ligand binding dissociates the complex tion monocytes were collected from the low density cell fraction and washed twice with medium. The monocyte fraction was analyzed with and promotes nuclear transfer of GR. In the nucleus, GR homodimers forward and side scatter and for CD64 expression using FACScan. The bind to cognate DNA motifs known as glucocorticoid response ele- fraction contained ϳ60% monocytes; the rest of the cells were other mono- ments (GREs). GR displays both stimulatory and inhibitory effects on nuclear leukocytes. After isolation cells were maintained in RPMI 1640 transcription (15, 16). The molecular basis for the anti-inflammatory medium plus 10% FCS. Transfection of HepG2 and U3A cells was performed using the calcium effects of glucocorticoids has been extensively studied in T cells and phosphate precipitation method. Semiconfluent cells were transfected in nonhemopoietic cells and has been shown to involve several mecha- 3.5-cm plates with 1 ␮g of luciferase reporter plasmids, 0.5 ␮g of pCMV- nisms, including competition for limiting amounts of transcriptional ␤gal as internal transfection efficiency control, and different expression coactivators (CBP/p300/NCoA-1/p/CIP), interference with AP-1-me- plasmids as indicated in the figure legends. Twenty-four hours after trans- ␬ fection the cells received fresh medium with 1% charcoal-stripped FCS. Downloaded from diated transcription, and inhibition of NF- B activation by direct pro- Cells were either left untreated or were treated with 10 ng/ml of human tein-protein interactions as well as by induction of I␬B␣ (17–22). IFN-␥ (Immugenex, Los Angeles, CA), 5 ␮M dexamethasone (Dex; Ora- However, the molecular mechanisms of glucocorticoid effects on dexon, Organon, Oss, The Netherlands), or both for 16 h. In experiments monocytes are not clearly defined. with cycloheximide (CHX), HepG2 cells were first treated for 16 h with Dex in the presence or the absence of CHX (10 ␮g/ml), after which they Transcriptional responsiveness is controlled by transcription were either washed or directly stimulated with IFN-␥ for 6 h. Cells were factors binding to promoter sequences and their interaction with lysed into Promega’s Reporter lysis buffer, and luciferase activity was de- transcriptional coactivators/corepressors and the basal transcrip- termined with reagents from Promega, using 1254 Luminova luminometer http://www.jimmunol.org/ ␤ tion machinery. The mechanism by which Stat factors activate (Bio-Orbit). Values were normalized against -galactosidase activities. RNA polymerase II-dependent gene transcription is still largely EMSA uncharacterized, but Stat1, Stat2, Stat3, Stat5, and Stat6 have been shown to associate with the general coactivators CREB binding The GAS site from the murine IRF-1 gene (IRF-GAS, made by annealing the oligonucleotide 5Ј-CTAGAGCCTGATTTCCCCGAAATGATGAG-3Ј protein (CBP) and p300 (23–27). Regulation and specificity of and its complement) and the GRR from the human Fc␥RI gene (5Ј-GAT Stat-mediated transcriptional responses are likely to be governed ATGAGCATGGGAAAAGCATGTTTCAAGGATTTGAGATGTATTTC by combinatorial interactions and cross-talk between different tran- CCAGAAAAGGAACATGATGAAAATG-3Ј) were labeled with T4-poly- nucleotide kinase using [␥-32P]ATP and were used as probes. The 190-bp

scription factors. Recent investigations have identified one such by guest on September 27, 2021 insert from Fc␥RI-luc plasmid was excised from the vector and labeled like interaction. A steroid receptor, GR, cooperates with Stat3 in IL- the other probes. Cells were grown for 16 h in medium containing 1% 6-stimulated induction of acute phase proteins and with prolactin- charcoal-stripped FCS and were treated with IFN-␥ (100 ng/ml) for 15 min induced Stat5, in transcriptional activation of the ␤-casein pro- or with Dex (5 ␮M) for 30 min. Nuclear extracts were prepared as previ- moter (28–31). In the case of Stat5, the cross-talk not only ously described (43). Extracts (10 ␮g protein) were incubated for 30 min 32 ␮ ␮ involves physical interaction with GR, but also results in inhibition on ice with P-labeled oligonucleotide, 0.1 g/ l herring sperm DNA, and 1.5 ␮g/␮l BSA in a total volume of 15 ␮l. For supershift analysis, nuclear of GR-dependent transcription (31–33). extracts were incubated with 0.5 ␮g of anti-Stat1 Ab (N-terminal; Trans- The synthetic glucocorticoid dexamethasone (Dex) is a widely used duction Laboratories, Lexington, KY) for 30 min on ice before adding immunosuppressive and anti-inflammatory agent. Previous studies BSA, herring sperm DNA, and probe. Reactions were resolved by 4.5% ϫ have shown that IFN-␥ and Dex cooperatively induce Fc␥RI expres- PAGE in 2.2 TBE (175 V, 4°C). The gel was dried under vacuum and autoradiographed. sion in monocytes (34, 35). This study was aimed at delineating the mechanisms of action of Dex on the regulation of Fc␥RI gene ex- Flow cytometry pression, and our results indicate that GR functions as a ligand-de- Human peripheral blood monocytes were suspended in RPMI 1640 and pendent costimulator of Stat1-mediated transcription. 10% human ABϩ serum, stained with 1 ␮g of FITC-conjugated mouse anti-human-CD64 Ab (Immunotech, Marseilles, France) or with 1 ␮gof control Ab and isotype-matched FITC-conjugated mouse anti-keyhole lim- pet hemocyanin Ab (Becton Dickinson, Mountain View, CA) for 30 min Materials and Methods at 4°C, and washed twice with PBS. CD64 expression was analyzed by Plasmid constructs FACScan (Becton Dickinson) from the monocyte population in which the contaminating cells had been gated out. The experiment was performed The GAS-luc luciferase construct contains a GAS site from the IRF-1 gene three times with similar results. promoter inserted upstream of the thymidine kinase (TK) promoter driving the firefly luciferase (luc) gene. Mut-GAS-luc has an insert containing the GAS site TTTCCCCGCCA from the IRF-1 promoter with an AA to CC Immunoprecipitation and Western blot analysis substitution (underlined) (36). GRE-luc contains two copies of the rat ty- COS-7 cells were transfected as indicated with 3 ␮g of Stat5a or Stat1, 2 rosine aminotransferase gene GRE inserted upstream of the TK promoter ␮g of EpoR, and 5 ␮g of GR expression plasmids by electroporation (Gene (37). Fc␥RI-luc was constructed by cloning a fragment of Fc␥RI promoter Pulser, Bio-Rad, Hercules, CA; 260 V, 960 ␮F). Forty-eight hours after corresponding to nucleotides Ϫ189 to ϩ1 (12) by PCR using human transfection, the cells were treated with Dex (5 ␮M) for 30 min and either genomic DNA as a template and inserting it into luc vector without any Epo (40 IU/ml) or IFN-␥ (100 ng/ml) for 15 min. Cells were lysed in heterologous promoter. Nonidet P-40 lysis buffer (50 mM Tris-HCl (pH 7.4), 50 mM NaCl, ␣ ␤ Stat1 , Stat1 , Stat1Y701F, Stat1S727A, hGRwt, hGRD4x, rGR3–556, 0.5% sodium deoxycholate, 20 mM NaF, 1% Nonidet P-40, 10% glycerol, ␮ and rGR407–795, CBP, Stat5a, and EpoR have all been previously described 0.2 mM Na3VO4, 2 mM PMSF, and 20 g/ml aprotinin). One milligram (32, 33, 38, 39). The DNA-binding-deficient Stat1 (E428A,E429A) (40) of protein was immunoprecipitated with anti-Stat5a Ab (13-3600, Zymed, was generated by PCR. The murine PU.1 cDNA (provided by Dr. R. Maki) San Francisco, CA), anti-Stat1 Ab (S21120, Transduction Labora- was subcloned into the EcoRI site of pCIneo (Promega, Madison, WI) (41). tories), or anti-GR antiserum (31). Immunoprecipitates were resolved on The Journal of Immunology 5691

SDS-PAGE and transferred to nitrocellulose membrane for subsequent immunoblotting. Results Dex enhances the IFN-␥-induced expression of Fc␥RI in monocytes but does not affect Stat1 DNA binding or Fc␥RI promoter binding factors IFN-␥ and Dex are both potent immunomodulatory agents, exert- ing pleiotropic effects on different cell types through activation of distinct nuclear signaling pathways mediated by Stat1 and GR, respectively. In monocytes, an important target for IFN-␥-medi- ated gene regulation is the Fc␥RI, and this response is further enhanced by Dex treatment (34, 35). These findings raised the possibility that Stat1 and GR signaling pathways cooperate func- tionally. In this study we have investigated the molecular mecha- nism for the costimulatory effect of Dex on Fc␥RI expression. Human peripheral blood monocytes were treated with optimal doses of either IFN-␥ and Dex alone or both agents together for

20 h, and the expression of Fc␥RI was analyzed using FACS. In Downloaded from accordance with previous results, IFN-␥ increased the expression of Fc␥RI (anti-CD64 staining mean fluorescence intensity, 64 vs 295; see Materials and Methods), which was further stimulated by the presence of Dex (mean fluorescence intensity, 412) (34, 35). Dex treatment alone did not influence Fc␥RI expression. Pretreat-

ment of monocytes with the GR antagonist RU486 abolished the http://www.jimmunol.org/ effect of Dex on Fc␥RI expression, but did not affect basal or IFN-␥-induced expression. Thus, GR does not directly regulate the expression of Fc␥RI, and the effect of Dex requires functional activation of both GR- and IFN-␥-induced factors. Because Stat1 is essential for IFN-␥-induced expression of Fc␥RI (10, 11), we tested the possibility that Dex regulates acti- vation events of Stat1. Human peripheral blood monocytes were left untreated or were treated with IFN-␥, Dex, or both agents for different time periods. Functional activation of Stat1 was examined by guest on September 27, 2021 by EMSA using nuclear extracts with three different probes, namely the prototype Stat1-binding GAS oligonucleotide, the Stat1 binding site containing GRR from the Fc␥RI promoter, and the proximal promoter region (nucleotides Ϫ189 to ϩ1) of Fc␥RI (12). Treatment of monocytes with IFN-␥ for 15 min induced DNA binding complexes to all three probes, and the intensities of FIGURE 1. Dex treatment does not influence Stat1 DNA binding in the retarded bands were reduced after 20 h of IFN-␥ stimulation monocytes. Human peripheral blood monocytes were treated as indi- (Fig. 1). Pretreatment of the lysate with anti-Stat1 Ab supershifted cated with IFN-␥ (100 ng/ml) and Dex (5 ␮M). The treatments were 15 the GAS binding complex. IFN-␥ induced two binding complexes min for IFN-␥ and 30 min for Dex (A) and 20 h for both IFN-␥ and Dex to the GRR oligonucleotide, and the Fc␥RI binding complexes (B). Nuclear lysates were prepared and analyzed by EMSA with 32P- contained both constitutive components and IFN-␥-induced com- labeled IRF-GAS (A, lanes 1–5; B, lanes 1–4), GRR (A, lanes 6–9; plexes, which is consistent with previous reports (11–13). Dex B, lanes 5–8), or Fc␥RI (A, lanes 10–13; B, lanes 9–12) probes. The ␥ ␥ treatment alone, either short term (30 min) or long term (20 h), did arrows indicate the positions of IFN- -induced complexes. IFN- -in- ducible complex was supershifted with specific anti-Stat1-Ab (A, lane not induce novel binding complexes to any of the oligonucleotides. ␥ ␥ 5). The constitutive Fc RI binding complexes composed of PU.1 mi- In accordance with this result, analysis of the Fc RI promoter grate close to the free probe. region failed to reveal the presence of a consensus GRE motif. Furthermore, Dex treatment did not affect the intensities or mo- bilities of the IFN-␥-induced complexes to GAS, GRR, or Fc␥RI oligonucleotides. Similar results were obtained with the mouse macrophage cell line RAW264.7 and the human monocytic cell but express very low levels of GR and are unresponsive to Dex line THP-1 (data not shown). These results indicate that the co- stimulation (see below). HepG2 cells were transfected with a lu- stimulatory effect of Dex is not due to enhanced IFN-␥ signaling ciferase reporter construct containing a GAS element placed up- and Stat1 DNA binding. Furthermore, GR does not appear to bind stream of a minimal heterologous promoter (GAS-luc). IFN-␥ directly or induce novel Fc␥RI promoter binding complexes in readily stimulated the GAS-luc activity, and Dex treatment did not monocytes. influence basal or IFN-␥-induced reporter activity (Fig. 2A). HepG2 cells were transfected with increasing amounts of GR ex- GR enhances Stat1-dependent transcription pression plasmid. Coexpression of GR did not affect basal or IFN- We examined the possibility that GR regulates the IFN-␥-induced ␥-induced reporter activity, and stimulation of the GR-transfected transcriptional activation and used a heterologous HepG2 cell sys- cells with Dex alone had no effect. However, when GR-transfected tem for this purpose. HepG2 cells are fully responsive to IFN-␥, cells were treated simultaneously with both IFN-␥ and Dex, a 5692 GLUCOCORTICOID RECEPTOR REGULATES STAT1-MEDIATED TRANSCRIPTION Downloaded from http://www.jimmunol.org/

FIGURE 2. GR stimulates Stat1-dependent reporter gene activation. A, HepG2 cells were transfected with 1 ␮g of GAS-luc reporter construct and 0, 0.1, 0.5, or 1.5 ␮g of GR expression plasmid. The amount of transfected DNA was kept constant in different experiments by adding empty expression vector by guest on September 27, 2021 when appropriate. Transfection efficiencies were monitored by cotransfection of pCMV-␤-gal plasmid. Cells were treated with IFN-␥ (10 ng/ml), Dex (5 ␮M), or both or were left untreated for 16 h before measuring the luciferase activity. B, HepG2 cells were transfected with GAS-luc or a mutated Stat1 binding site containing construct (Mut-GAS) alone or with 0.5 ␮g of GR expression plasmid. Cells were treated as described in A. C, U3A cells were transfected with 1 ␮g of GAS-luc and as indicated with 0.4 ␮g of various Stat1 expression plasmids (Stat1␣, Stat1␤, Stat1S727A, Stat1 DB Mut (Stat1E428A, E429A)) and GR (0.05 ␮g) expression plasmid and treated as described in A. Three experiments were performed. The luciferase values were normalized to ␤-galactosidase activity and are presented as relative luciferase units (RLU).

strong synergistic increase in GAS-luc reporter activity was ob- GAS-luc reporter, and cotransfection of GR with Stat1␣ resulted in served. This increase in reporter activity was proportional to the synergistic activation of the reporter in response to IFN-␥ and Dex amount of transfected GR. To confirm that GR directly up-regu- stimulation (Fig. 2C). In GR-transfected U3A cells, Dex induced lates the Stat1-mediated transcription, HepG2 cells were cotrans- some basal, Stat1-independent reporter activity. Stat1␤ was not fected with GR and a reporter construct in which the Stat1-binding able to mediate activation of GAS-luc, and cotransfection of GR site was mutated (Mut-GAS). Treatment of the cells with Dex, and Stat1␤ and simultaneous exposure to Dex and IFN-␥ had no IFN-␥, or their combination did not influence Mut-GAS-luc re- significant effect on the reporter activity compared with Dex treat- porter activity (Fig. 2B), indicating that GR specifically enhances ment alone. The different Stat1 constructs used in these experi- the Stat1-dependent transcription. ments were expressed at similar levels (data not shown). Dimerization, nuclear localization, and DNA binding of Stat1 DNA binding and the trans-activation domain of Stat1 are are critically dependent on phosphorylation of a single C-terminal required for cooperation with GR Tyr701 residue (38). We next investigated whether the nuclear lo- Stat1 is expressed as two alternatively spliced variants, Stat1␣ and calization and DNA binding of Stat1 are required for cooperation Stat1␤. The Stat1␤ isoform lacks the 38 C-terminal residues (38). with GR. Cotransfection of GR with the Stat1Y701F mutant and IFN-␥ stimulates the tyrosine phosphorylation and DNA binding stimulation with IFN-␥ and Dex resulted in only basal activation of of both isoforms, but only Stat1␣ is transcriptionally active. To the reporter, and the cooperation between Stat1 and GR was abol- study the structural requirements of Stat1 for cooperation with GR, ished (data not shown). Because the Stat1Y701F mutant does not we used the Stat1-deficient U3A fibrosarcoma cell line (42). U3A translocate to the nucleus, the lack of cooperation could result from cells were transfected with either the GAS-luc reporter alone or the cytoplasmic localization of Stat1. Therefore, we tested the together with GR and Stat1␣ or Stat1␤. Transfection of Stat1␣ DNA-binding-deficient mutant of Stat1 (E428A,E429A), which rendered the cells responsive to IFN-␥-induced activation of the becomes tyrosine phosphorylated and translocates to the nucleus in The Journal of Immunology 5693

FIGURE 3. Stat1 does not regulate GR-dependent gene activation. U3A cells were transfected with 1.5 ␮g of GRE-luc, 0.5 ␮g of GR expression vector, and 1 ␮g of different Stat1 mutants (Stat1␣, Stat1␤, Stat1S727A, Stat1Y701F) as indicated. The cells were treated with IFN-␥ (10 ng/ml) and Dex (5 ␮M) as indicated for 16 h, and the normalized luciferase values of three experiments with SDs are shown. Downloaded from

response to IFN-␥ (40). As expected, the Stat1E428A,E429A mu- tant did not induce IFN-␥-dependent reporter activation and also

failed to cooperate with GR (Fig. 2C). The C-terminus of Stat1 http://www.jimmunol.org/ contains also a serine residue (Ser727), which is phosphorylated upon cytokine stimulation and is required for Stat1 association with nuclear MCM5 coactivator (38, 44). However, activation of GR in both Stat1S727A and Stat1␣-transfected cells resulted in a FIGURE 4. Physical association of GR with Stat5a, but not with 2-fold increase in reporter activity. These results indicate that nu- Stat1. COS-7 cells were transfected (Tx) as indicated with Stat5a (1 clear translocation and DNA binding of Stat1, but not its phos- ␮g), Epo receptor (2 ␮g), Stat1 (1 ␮g), and GR (5 ␮g) expression 727 phorylation on Ser , are required for functional cooperation with vectors. Where indicated, the cells were treated with Epo (40 IU/ml) or GR. In addition, GR is not able to substitute for the function of the IFN-␥ (100 ng/ml) for 15 min and with Dex (5 ␮M) for 30 min. A, One trans-activation domain of Stat1 in reporter gene activation. milligram of whole cell extract was immunoprecipitated with anti- by guest on September 27, 2021 Stat5a, anti-Stat1, or control (contr.) Ab; separated on SDS-PAGE; and Stat1 does not affect GR-dependent transcription immunoblotted with anti-GR antiserum. B, Similarly, 1 mg of cell ex- To investigate whether Stat1 would reciprocally regulate GR-de- tract was immunoprecipitated with anti-GR antiserum and probed with either anti-Stat5a or anti-Stat1 Abs. Twenty micrograms of total cell pendent transcription, activation of a GRE-containing reporter lysates (TCL) were included as controls. The arrows indicate the posi- construct (GRE-luc) was analyzed in U3A cells. Dex treatment tions of the GR, Stat1, and Stat5a proteins. activated GRE-luc in U3A cells (Fig. 3). The induction was further enhanced by ectopic expression of GR, and, as expected, the re- porter activity was not affected by IFN-␥ treatment. Cotransfection of GR with Stat1␣ or the different Stat1 variants (Stat1␤, duced post-translational regulation, e.g., phosphorylation, would Stat1Y701F, Stat1S727A) had no effect on Dex-induced activation be required for association, but stimulation with Dex and IFN-␥ of the GRE-luc reporter in either the presence or the absence of did not induce complex formation between Stat1 and GR (Fig. 4A). IFN-␥ stimulation. Similar results were obtained in HepG2 cells in Stat5 is activated by multiple cytokines, including Epo. As a con- which activation of GRE-luc required transfected GR, but costimu- trol, COS-7 cells were transfected with EpoR, Stat5, and GR ex- lation with IFN-␥, and cotransfection of Stat1␣ or different Stat1 pression vectors, and Stat5 and GR were found to coimmunopre- variants, did not affect the Dex-induced activation of GRE-luc re- cipitate in a ligand-independent manner (Fig. 4). These results porter (data not shown). indicate that the functional cooperation between Stat1 and GR does not involve direct protein-protein interaction, and imply that GR interacts with Stat5, but not with Stat1 GR cooperates with different Stat proteins by mechanisms that are To gain further insight into the mechanism of cooperation between distinct. Stat1 and GR, we investigated whether the proteins physically in- teract. Another Stat family member, Stat5, is previously shown to The DNA binding domain of GR is required for functional associate with GR, and this interaction occurs in the cytoplasm in cooperation with Stat1 a prolactin-independent manner (32). To study the association be- GR has a modular structure composed of three functional domains; tween Stat1 and GR, coimmunoprecipitation experiments were a constitutively active N-terminal activation function domain performed from COS-7 cells transfected with expression vectors (AF1), a central DNA binding domain (DBD), and a C-terminal encoding Stat1 and GR. Immunoblotting of the Stat1 immunocom- ligand binding domain that harbors trans-activation function plex with anti-GR Ab failed to detect any coprecipitated GR (Fig. (AF2) and recruits coactivator proteins (15, 17). We delineated the 4A). Likewise, immunoblotting of GR immunoprecipitates with functional domains of GR that were required for stimulation of anti-Stat1 Ab did not detect any coimmunoprecipitation of the two Stat1-dependent transcription by using various GR mutants in proteins (Fig. 4B). We also tested the possibility that ligand-in- HepG2 cells. Expression and function of the GR mutants were 5694 GLUCOCORTICOID RECEPTOR REGULATES STAT1-MEDIATED TRANSCRIPTION

FIGURE 6. GR activation enhances IFN-␥-induced transcription from the natural Fc␥RI promoter. One microgram of Fc␥RI-luc reporter containing 190 bp from the Fc␥RI promoter was transfected into HepG2 cells with empty vector, 0.05 ␮g PU.1, and 0.5 ␮g GR expression plasmids as indicated. The cells were treated with IFN-␥, Dex, or both for 16 h. Shown are the mean normalized luciferase values of three experiments with SDs. Downloaded from

porter and the Fc␥RI promoter lack consensus GRE motifs, thus GR does not appear to interact directly with the Stat1-dependent promoter. To investigate this issue further, we studied whether the GR effect required de novo protein synthesis. HepG2 cells were sequentially treated first with Dex for 16 h in the presence or the http://www.jimmunol.org/ absence of the protein synthesis inhibitor CHX, after which the cells were either washed or directly stimulated with IFN-␥ for6h. FIGURE 5. DNA binding and trans-activation activity of GR are re- quired for cooperation with Stat1. A, HepG2 cells were transfected with 1 The results presented in Fig. 5B show that inhibition of protein ␮g of GAS-luc and either empty vector or 0.5 ␮g of different GR mutants synthesis during Dex treatment abrogated the stimulatory effect of ␥ GR on Stat1-dependent transcription. It should be noted that CHX (GR wt, GRD4x, GR407–795,GR3–556) and treated with 10 ng/ml IFN- and 5 ␮M Dex as indicated for 16 h. The normalized luciferase values of three pretreatment alone did not affect the IFN-␥ response when the independent experiments with SDs are shown as relative luciferase units inhibitor was washed away. Taken together, these results strongly (RLU). B, HepG2 cells were transfected with 1 ␮g of GAS-luc reporter

suggest that GR is enhancing the Stat1-dependent gene activation by guest on September 27, 2021 construct and 0.5 ␮g of GR expression plasmid as indicated. Cells were by inducing the synthesis of transcriptional coregulators. treated with CHX (10 ␮g/ml), Dex (5 ␮M), or both or were left untreated for 16 h. Thereafter, cells were either washed with PBS, and new medium GR action on Fc␥RI promoter is dependent on Stat1 and PU.1 was added, or the cells were left unwashed. Cells were then treated with ␥ ␥ IFN-␥ (10 ng/ml) for 6 h, where indicated, before measuring luciferase In the Fc RI promoter, the IFN- -inducible region is conferred by activity. GRR, and the cell-type specific expression requires a downstream myeloid cell-activating transcription element, which binds the Ets family transcription factor PU.1/Spi-1 (11, 13). To study directly the regulation of the natural Fc␥RI promoter, a luciferase reporter driven by the regulatory region of the native Fc␥RI promoter (nu- confirmed by immunoblotting and GRE-luc reporter assays (data cleotides Ϫ189 to ϩ1) was constructed (Fc␥RI-luc) (12). HepG2 not shown). We analyzed whether the DBD of GR was required for cells allowed the analysis of individual transcription factors in reg- stimulation of Stat1-dependent transcription. Mutant GRD4x, con- ulation of Fc␥RI-luc expression, because these cells lack endoge- taining four amino acid substitutions in the DBD (N454D/A458T/ nous PU.1 and express very low levels of GR. Transfection of R460D/D462C) failed to enhance Stat1-dependent reporter activ- Fc␥RI-luc into HepG2 cells, either alone or together with GR, did ity in HepG2 cells after IFN-␥ and Dex stimulation (Fig. 5). not result in any reporter activity after IFN-␥ and Dex stimulations Similar results were obtained with another DBD mutant (A458T; (Fig. 6). Transfection of PU.1 into HepG2 cells stimulated Fc␥RI- data not shown). The ability of the N-terminal deletion mutant luc activity, which is in accordance with the basal expression of GR , which lacks the AF1 domain, was tested for its coop- 407–795 Fc␥RI in monocytes. The presence of PU.1 was also absolutely eration with Stat1. In cells transfected with GR , the IFN-␥- 407–795 required for the IFN-␥ induction of Fc␥RI-luc reporter. When both induced reporter activity was less efficiently increased by Dex PU.1 and GR were coexpressed in HepG2 cells, Dex increased the treatment compared with wild-type GR, indicating that the AF1 IFN-␥-dependent activation of Fc␥RI-luc reporter to a comparable domain of GR is needed for optimal stimulation of Stat1-depen- degree to that observed in monocytes. Together these results dem- dent transcription (Fig. 5). Deletion of the GR ligand binding do- onstrate that the stimulatory effect of GR on Fc␥RI is dependent on main, which also mediates association of the latent GR to 90-kDa both Stat1 and PU.1. heat shock protein, results in a constitutively active GR variant. ␥ The C-terminal deletion mutant GR3–556 stimulated the IFN- - induced reporter activity in the absence of Dex as efficiently as Discussion ligand-stimulated wild-type GR. IFN-␥ and glucocorticoids display profound immunomodulatory These results indicated that stimulation of Stat1-dependent ac- effects, and the final biological responses are determined by inte- tivity requires specific regions of GR that are important for the gration of different signaling pathways and cell type- and promot- receptor’s own trans-activation ability. However, the GAS-luc re- er-specific factors. In this study we have investigated the molecular The Journal of Immunology 5695 mechanism by which Dex and IFN-␥ regulate Fc␥RI expression in studies. The stimulatory effect of GR on Fc␥RI activity required monocytes. Our results demonstrate that the stimulatory effect of both activated Stat1 and the presence of PU.1. This result is in Dex on Fc␥RI expression is mediated by functional cross-talk accordance with previous studies showing that the myeloid cell- among three distinct transcription factors: GR, Stat1, and PU.1. specific expression of Fc␥RI and IFN-␥ responsiveness are depen- A possible mechanism for the costimulatory effect of Dex on dent on PU.1 (12, 13, 47) and demonstrate that all other transcrip- Fc␥RI expression is the enhancement of IFN-␥-dependent signal- tion factors required for Fc␥RI expression are also present in ing events through inducing the expression of the IFN-␥ receptor nonhemopoietic cells. PU.1 contains both acidic and glutamine- or other critical signaling proteins, such as Jak kinases or Stat1, or rich activation domains, which may individually regulate specific alternatively, through inducing Fc␥RI promoter-binding transcrip- gene responses (41). Our results indicate that the trans-activation tion factors. In monocytes, Dex treatment, either short or long domains of GR cannot replace the function of PU.1 in Fc␥RI ex- term, did not modulate the IFN-␥-induced Stat1 DNA binding ac- pression. We also tested the possibility that PU.1 would be a target tivity or protein expression (data not shown) or induce novel DNA for GR regulation, but Dex did not influence PU.1 protein levels or binding complexes to the Fc␥RI promoter. Thus, Dex does not DNA binding in monocytes (data not shown). appear to directly regulate the immediate IFN-␥ signaling events The costimulatory effect of Dex on Stat1-dependent reporter ac- or Fc␥RI promoter-binding factors. tivity required GR-mediated induction of protein synthesis and the With the use of heterologous cell systems devoid of functional DBD and trans-activation domains of GR, but was not dependent GR or Stat1, we demonstrated that GR stimulated in a ligand- on GRE in the promoter. It should be noted that the cooperation dependent manner activation of a minimal Stat1-dependent re- between Stat5 and GR depends only on the trans-activation do- porter as well as the natural Fc␥RI promoter. GR stimulated the main of GR. The GR antagonist RU486, which blocks the ligand- Downloaded from GAS reporter more efficiently than the natural Fc␥RI promoter, and AF2-dependent trans-activation of GR, but not the nuclear suggesting that the costimulus provided by GR activates Stat1- translocation, abolished the enhancing effect of Dex on Fc␥RI ex- dependent transcription more efficiently in the context of the TK pression in monocytes. These findings are consistent with a model minimal promoter than in the natural promoter. The magnitude of where GR induces transcription of a coactivator involved in Stat1- GR-mediated enhancement of the natural Fc␥RI promoter activity dependent activation of RNA polymerase II-mediated transcrip-

was similar to the level of enhancement on Fc␥RI surface expres- tion. However, recruitment of an auxiliary protein through inter- http://www.jimmunol.org/ sion in monocytes after Dex treatment. The cooperation between action with GR cannot be formally ruled out. The transcriptional GR and Stat1 required tyrosine phosphorylation and DNA binding coactivators CBP and p300 function as integrators for several nu- of Stat1 as well as Stat1-dependent transcriptional activity, but was clear signaling pathways, including Stats and steroid receptors, by not dependent on Ser727 phosphorylation. Our results also revealed stimulating transcription and catalyzing histone acetylation (18, that the AF1 and AF2 domains of GR are not able to substitute for 23, 45, 48). We also investigated the possibility that the enhancing the trans-activation domain of Stat1 for induction of transcription. effect of GR on Fc␥RI promoter activation was mediated by the Stat5 mutants lacking the C-terminal trans-activation domain were coactivator CBP. Ectopic expression of CBP in HepG2 cells did previously found to synergize with GR in ␤-casein induction (25, not enhance the IFN-␥-induced Fc␥RI-luc activity (data not 33), indicating that GR cooperates differently with Stat1 and Stat5. shown), indicating that CBP was not a rate-limiting component in by guest on September 27, 2021 Glucocorticoids regulate gene transcription through several this response. Furthermore, MHC class II expression is stimulated mechanisms. In addition to GR-GRE interaction, GR can modulate in monocytes by IFN-␥ through Stat1 and class II trans-activator gene responses by a mechanism independent of DNA binding, factors, and GR inhibits this response by squelching of CBP (49). involving direct protein-protein interactions between GR and other Thus, the differential effect of Dex on Fc␥RI and MHC class II transcription factors and coactivators (17–22, 45). In cytokine re- expression, and the findings that Fc␥RI does not contain GRE, and ceptor signaling, GR has been shown to cooperate with prolactin- that Stat1 and GR are not physically associating argue against a induced Stat5 and with IL-6 in acute phase protein synthesis role for CBP in the costimulatory action of GR. However, several through cooperation with C/EBP␤ and Stat3 (28–31). The func- other transcriptional coactivators exist (17, 50), and more are tional cooperation between GR and Stat5 is well established in the likely to be identified, and it will be important to determine their induction of ␤-casein gene expression, and it involves both direct contributions to Stat1-mediated gene responses and regulation protein-protein interaction as well as DNA binding (31–33, 46). In by GR. accordance with these findings, Stat5 was found in this work to Dex displays diverse and sometimes even opposite effects on coimmunoprecipitate with GR in an Epo-independent manner. In various cell types, and Fc␥RI is a good example of cell type- contrast, we could not detect cellular association between Stat1 specific regulation of GR. In immature myeloid leukemia cell lines and GR in coimmunoprecipitation or EMSA experiments. Further- Dex treatment results in inhibition of IFN-␥-induced Fc␥RI ex- more, Stat5 has been shown to suppress the GR-mediated tran- pression (34, 35). We also analyzed the effect of Dex treatment on scription (31, 33), but Stat1 did not have any effect on GR-depen- myeloid leukemic HL-60 cells, and our results excluded activation dent transcriptional activation. Taken together, these results or DNA binding of Stat1 as well as the expression of GR or PU.1 indicate that GR is regulating cytokine-induced gene activation by proteins as targets for the inhibitory effect of Dex (data not shown). distinct mechanisms, depending on which Stat is activated. In the The inhibitory effect of Dex was not directly related to the differ- case of Stat5-mediated gene responses, the cooperation occurs entiation stage of the cells, because induction of macrophage dif- through direct protein-protein interaction, whereas stimulation of ferentiation of HL-60 cells by 12-O-tetradecanoyl-phorbol-13- Stat1-dependent responses does not involve physical interaction acetate treatment (48 h) did not alter the Dex-mediated repression between GR and Stat1. It is possible that GR modulates Stat3- on Fc␥RI expression. Therefore, it seems likely that the difference dependent responses through a similar mechanism as with Stat1, in Dex effect between normal monocytes and transformed leuke- because the costimulatory effect of Dex on IL-6-induced hapto- mia cells is due to inherent properties of the cells. At least two globin expression has been shown to depend on the trans-activa- possible mechanisms can be envisioned for the inhibitory effect of tion domain of Stat3 (30). Dex in HL-60 cells: GR is either inducing a repressive factor The precise mechanisms of Stat1-mediated transcriptional acti- and/or the inhibition is due to competition of transcriptional vation are currently unknown and an important subject for future coactivators. 5696 GLUCOCORTICOID RECEPTOR REGULATES STAT1-MEDIATED TRANSCRIPTION

T cells are an important target for the immunomodulatory effects complex mediates transcriptional activation and AP-1 inhibition by nuclear of glucocorticoids. Despite the overall suppressive effect on T cell receptors. Cell 85:403. 19. Auphan, N., J. A. DiDonato, C. Rosette, A. Helmberg, and M. Karin. 1995. cytokine production, glucocorticoid treatment has been shown to Immunosuppression by glucocorticoids: inhibition of NF-␬B activity through result in increased IgE production in vivo (6, 51). The effects of induction of I␬B synthesis. Science 270:286. glucocorticoids on accessory monocytes may provide insight into 20. Yang-Yen, H. F., J. C. Chambard, Y. L. Sun, T. Smeal, T. J. Schmidt. 1990. this seemingly paradoxical response. Glucocorticoids modulate cy- Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. tokine production in monocytes, which leads to enhanced IL-10 Cell 62:1205. synthesis and suppression of IL-12 synthesis, thereby promoting 21. Ray, A., and K. E. Prefontaine. 1994. Physical association and functional an anti-inflammatory response and Th2-type cytokine and IgE syn- antagonism between the p65 subunit of transcription factor NF-␬B and the thesis (6). Interestingly, ligation of Fc␥RI on monocytes results in glucocorticoid receptor. Proc. Natl. Acad. Sci. USA 91:752. ␥ 22. De Bosscher, K., M. L. Schmitz, W. Vanden Berghe, S. Plaisance, W. Fiers, a similar cytokine response (4), and increased expression of Fc RI and G. Haegeman. 1997. Glucocorticoid-mediated repression of nuclear fac- by Dex may be a regulatory mechanism for this immunomodula- tor-␬B-dependent transcription involves direct interference with transactiva- tory response. tion. Proc. Natl. Acad. Sci. USA 94:13504. In this study we have analyzed the mechanisms of Dex in reg- 23. Zhang, J. J., U. Vinkemeier, W. Gu, D. Chakravarti, C. M. Horvath, and ␥ J. E. Darnell, Jr. 1996. Two contact regions between Stat1 and CBP/p300 in ulation of Fc RI, which plays an important role in monocyte func- interferon gamma signaling. Proc. Natl. Acad. Sci. USA 93:15092. tions. Detailed understanding of the molecular mechanisms of glu- 24. Bhattacharya, S., R. Eckner, S. Grossman, E. Oldread, Z. Arany, A. cocorticoids in different cell types is crucial for optimizing their D’Andrea, and D. M. Livingston. 1996. Cooperation of Stat2 and p300/CBP ␣ clinical use and allow the development of derivatives with im- in signalling induced by interferon- . Nature 383:344. 25. Pfitzner, E., R. Jahne, M. Wissler, E. Stoecklin, and B. Groner. 1998. p300/ proved therapeutic value targeted specifically to a desired function. CREB-binding protein enhances the prolactin-mediated transcriptional induc- Downloaded from tion through direct interaction with the transactivation domain of Stat5, but Acknowledgments does not participate in the Stat5-mediated suppression of the glucocorticoid response. Mol. Endocrinol. 12:1582. We thank Paula Kosonen for technical assistance and Drs A. Cato, 26. Nakashima, K., M. Yanagisawa, H. Arakawa, N. Kimura, T. Hisatsune, J. E. Darnell, Jr., R. Goodman, O. Heikinheimo, I. Kerr, A. Lagerstedt, and M. Kawabata, K. Miyazono, and T. Taga. 1999. Synergistic signaling in fetal R. Maki for kindly providing reagents. brain by STAT3-Smad1 complex bridged by p300. Science 284:479.

27. Gingras, S., J. Simard, B. Groner, and E. Pfitzner. 1999. p300/CBP is required http://www.jimmunol.org/ for transcriptional induction by interleukin-4 and interacts with Stat6. Nucleic References Acids Res. 27:2722. 1. Nacy, C. A., and M. S. Meltzer. 1991. T-cell-mediated activation of macro- 28. Zhang, Z., S. Jones, J. S. Hagood, N. L. Fuentes, and G. M. Fuller. 1997. phages. Curr. Opin. Immunol. 3:330. STAT3 acts as a co-activator of glucocorticoid receptor signaling. J. Biol. 2. Guyre, P. M., P. M. Morganelli, and R. Miller. 1983. Recombinant immune Chem. 272:30607. interferon increases immunoglobulin G Fc receptors on cultured human 29. Takeda, T., H. Kurachi, T. Yamamoto, Y. Nishio, Y. Nakatsuji, M. Ki, and mononuclear phagocytes. J. Clin. Invest. 72:393. Y. Murata. 1998. Crosstalk between the interleukin-6 (IL-6)-JAK-STAT and 3. Unkeless, J. C. 1989. Function and heterogeneity of human Fc receptors for the glucocorticoid-nuclear receptor pathway: synergistic activation of IL-6 immunoglobulin G. J. Clin. Invest. 83:355. response element by IL-6 and glucocorticoid. J. Endocrinol. 159:323. 4. Sutterwala, F. S., G. J. Noel, P. Salgame, and D. M. Mosser. 1998. Reversal 30. Kim, H., and H. Baumann. 1997. The carboxyl-terminal region of STAT3 of proinflammatory responses by ligating the macrophage Fc␥ receptor type controls gene induction by the mouse haptoglobin promoter. J. Biol. Chem. by guest on September 27, 2021 I. J. Exp. Med. 188:217. 272:14571. 5. Durden, D. L., H. M. Kim, B. Calore, and Y. Liu. 1995. The Fc␥RI receptor 31. Stocklin, E., M. Wissler, F. Gouilleux, and B. Groner. 1996. Functional in- signals through the activation of hck and MAP kinase. J. Immunol. 154:4039. teractions between Stat5 and the glucocorticoid receptor. Nature 383:726. 6. Blotta, M. H., R. H. DeKruyff, and D. T. Umetsu. 1997. Corticosteroids inhibit IL-12 production in human monocytes and enhance their capacity to 32. Cella, N., B. Groner, and N. E. Hynes. 1998. Characterization of Stat5a and induce IL-4 synthesis in CD4ϩ lymphocytes. J. Immunol. 158:5589. Stat5b homodimers and heterodimers and their association with the glucocor- 7. Kiefer, F., J. Brumell, N. Al-Alawi, S. Latour, A. Cheng, A. Veillette, ticoid receptor in mammary cells. Mol. Cell. Biol. 18:1783. S. Grinstein, and T. Pawson. 1998. The Syk protein tyrosine kinase is essen- 33. Stoecklin, E., M. Wissler, R. Moriggl, and B. Groner. 1997. Specific DNA tial for Fc␥ receptor signaling in macrophages and neutrophils. Mol. Cell. binding of Stat5, but not of glucocorticoid receptor, is required for their Biol. 18:4209. functional cooperation in the regulation of gene transcription. Mol. Cell. Biol. 8. Darnell, J. E., Jr., I. M. Kerr, and G. R. Stark 1994. Jak-STAT pathways and 17:6708. transcriptional activation in response to IFNs and other extracellular signaling 34. Girard, M. T., S. Hjaltadottir, A. N. Fejes-Toth, and P. M. Guyre. 1987. proteins. Science 264:1415. Glucocorticoids enhance the ␥-interferon augmentation of human monocyte 9. Silvennoinen, O., P. Saharinen, K. Paukku, K. Takaluoma, and P. Kovanen. immunoglobulin G Fc receptor expression. J. Immunol. 138:3235. 1997. Cytokine receptor signal transduction through Jak tyrosine kinases and Stat transcription factors. APMIS 105:497. 35. Pan, L. Y., D. B. Mendel, J. Zurlo, and P. M. Guyre. 1990. Regulation of the 10. Durbin, J. E., R. Hackenmiller, M. C. Simon, and D. E. Levy. 1996. Targeted steady state level of Fc␥RI mRNA by IFN-␥ and dexamethasone in human disruption of the mouse Stat1 gene results in compromised innate immunity monocytes, neutrophils, and U-937 cells. J. Immunol. 145:267. to viral disease. Cell 84:443. 36. Pine, R., A. Canova, and C. Schindler. 1994. Tyrosine phosphorylated p91 11. Pearse, R. N., R. Feinman, K. Shuai, J. E. Darnell, Jr., and J. V. Ravetch. binds to a single element in the ISGF2/IRF-1 promoter to mediate induction 1993. Interferon ␥-induced transcription of the high-affinity Fc receptor for by IFN␣ and IFN␥, and is likely to autoregulate the p91 gene. EMBO J. IgG requires assembly of a complex that includes the 91-kDa subunit of 13:158. transcription factor ISGF3. Proc. Natl. Acad. Sci. USA 90:4314. 37. Palvimo, J. J., P. Reinikainen, T. Ikonen, P. J. Kallio, A. Moilanen, and O. A. 12. Eichbaum, Q. G., R. Iyer, D. P. Raveh, C. Mathieu, and R. A. Ezekowitz. Ja¨nne. 1996. Mutual transcriptional interference between RelA and androgen 1994. Restriction of interferon ␥ responsiveness and basal expression of the receptor. J. Biol. Chem. 271:24151. myeloid human Fc␥R1b gene is mediated by a functional PU.1 site and a transcription initiator consensus. J. Exp. Med. 179:1985. 38. Wen, Z., Z. Zhong, and J. E. Darnell, Jr. 1995. Maximal activation of tran- 13. Perez, C., E. Coeffier, F. Moreau-Gachelin, J. Wietzerbin, and P. D. Benech. scription by Stat1 and Stat3 requires both tyrosine and serine phosphoryla- 1994. Involvement of the transcription factor PU.1/Spi-1 in myeloid cell- tion. Cell 82:241. restricted expression of an interferon-inducible gene encoding the human 39. Chrivia, J. C., R. P. Kwok, N. Lamb, M. Hagiwara, M. R. Montminy, and high-affinity Fc␥ receptor. Mol. Cell. Biol. 14:5023. R. H. Goodman. 1993. Phosphorylated CREB binds specifically to the nuclear 14. Barnes, P. J. 1998. Anti-inflammatory actions of glucocorticoids: molecular protein CBP. Nature 365:855. mechanisms. Clin. Sci. 94:557. 40. Horvath, C. M., Z. Wen, and J. E. Darnell, Jr. 1995. A STAT protein domain 15. Beato, M., P. Herrlich, and G. Schutz. 1995. Steroid hormone receptors: many that determines DNA sequence recognition suggests a novel DNA-binding actors in search of a plot. Cell 83:851. domain. Genes Dev. 9:984. 16. Karin, M. 1998. New twists in gene regulation by glucocorticoid receptor: is DNA binding dispensable? Cell 93:487. . 41. Klemsz, M. J., and R. A. Maki. 1996. Activation of transcription by PU.1 17. Torchia, J., D. W. Rose, J. Inostroza, Y. Kamei, S. Westin, C. K. Glass, and requires both acidic and glutamine domains. Mol. Cell. Biol. 16:390. M. G. Rosenfeld. 1997. The transcriptional co-activator p/CIP binds CBP and 42. Muller, M., C. Laxton, J. Briscoe, C. Schindler, T. Improta, J. E. Darnell, Jr., mediates nuclear-receptor function. Nature 387:677. G. R. Stark, and I. M. Kerr. 1993. Complementation of a mutant cell line: 18. Kamei, Y., L. Xu, T. Heinzel, J. Torchia, R. Kurokawa, B. Gloss, S. C. Lin, central role of the 91 kDa polypeptide of ISGF3 in the interferon-␣ and -␥ R. A. Heyman, D. W. Rose, C. K. Glass, et al. 1996. A CBP integrator signal transduction pathways. EMBO J. 12:4221. The Journal of Immunology 5697

43. Saharinen, P., N. Ekman, K. Sarvas, P. Parker, K. Alitalo, and Targeted disruption of the PU.1 gene results in multiple hematopoietic ab- O. Silvennoinen. 1997. The Bmx tyrosine kinase induces activation of the normalities. EMBO J. 15:5647. ␦ Stat signaling pathway, which is specifically inhibited by protein kinase C . 48. Chakravarti, D., V. J. LaMorte, M. C. Nelson, T. Nakajima, I. G. Schulman, Blood 90:4341. H. Juguilon, M. Montminy, and R. M. Evans. 1996. Role of CBP/P300 in 44. Zhang, J. J., Y. Zhao, B. T. Chait, W. W. Lathem, M. Ritzi, R. Knippers, and nuclear receptor signalling. Nature 383:99. J. E. Darnell, Jr. 1998. Ser727-dependent recruitment of MCM5 by Stat1␣ in IFN-␥-induced transcriptional activation. EMBO J. 17:6963. 49. Fontes, J. D., S. Kanazawa, D. Jean, and B. M. Peterlin. 1999. Interactions 45. Shikama, N., J. Lyon, and N. B. La Thangue. 1997. The p300/CBP family: between the class II transactivator and CREB binding protein increase tran- integrating signals with transcription factors and chromatin. Trends Cell. scription of major histocompatibility complex class II genes. Mol. Cell. Biol. Biol. 7:230. 19:941. 46. Lechner, J., T. Welte, J. K. Tomasi, P. Bruno, C. Cairns, J. Gustafsson, and 50. Chakravarti, D., V. Ogryzko, H.Y. Kao, A. Nash, H. Chen, Y. Nakatani, and W. Doppler. 1997. Promoter-dependent synergy between glucocorticoid receptor R. M. Evans. 1999. A viral mechanism for inhibition of p300 and PCAF ␤-casein gene transcription. J. Biol. Chem. 272: and Stat5 in the activation of acetyltransferase activity. Cell 96:393. 20954. 47. McKercher, S. R., B. E. Torbett, K. L. Anderson, G. W. Henkel, D. J. Vestal, 51. Zieg, G., G. Lack, R. J. Harbeck, E. W. Gelfand, and D. Y. Leung. 1994. In vivo H. Baribault, M. Klemsz, A. J. Feeney, G. E. Wu, C. J. Paige, et al. 1996. effects of glucocorticoids on IgE production. J. Allergy Clin. Immunol. 94:222. Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021