中国科技论文在线 http://www.paper.edu.cn
Journal of Integrative Plant Biology 2007, 49 (10): 1455–1463
Analysis of Gene Expression Profile Induced by Water Stress in Upland Rice (Oryza sativa L. var. IRAT109) Seedlings using Subtractive Expressed Sequence Tags Library
∗ Haiguang Wang, Hongliang Zhang and Zichao Li
(Key Laboratory of Crop Genomics and Genetic Improvement of Ministry of Agriculture, Key Laboratory of Crop Heterosis and Utilizition of Ministry of Education and Beijing Key Lab of Crop Genetic Improvement, China Agricultural University, Beijing 100094, China)
Abstract
To identify the water stress induced genes of upland rice cultivar IRAT109, which is resistant to drought, a subtractive cDNA library was developed from polyethylene glycol- (PEG) treated and non-treated seedlings by suppression subtractive hybridization, from which 2 112 recombinant colonies were obtained. Eight hundred clones were selected randomly for sequencing analysis, and 384 unique expressed sequence tags (ESTs) were obtained. They were found to be involved in diverse biological processes, such as metabolism, transcription, signal transduction, protein synthesis and others. Notably a number of known functional genes in drought tolerance, including genes related to biosynthesis of osmoprotectants, defense against active oxygen, removal of toxic compounds, recovery of proteins and reinforcement of cell wall were also found in the study. Several genes related to deleterious responses were upregulated by PEG stress. The differential expression patterns of 11 SSH-derived ESTs were confirmed by real-time polymerase chain reaction.
Key words: expressed sequence tag; subtracted library; suppression subtractive hybridization; upland rice; water stress.
Wang H, Zhang H, Li Z (2007). Analysis of gene expression profile induced by water stress in upland rice (Oryza sativa L. var. IRAT109) seedlings using subtractive expressed sequence tags library. J. Integr. Plant Biol. 49(10), 1455–1463.
Available online at www.blackwell-synergy.com/links/toc/jipb, www.jipb.net
Water stress is one of the most important environmental developed by a long period of natural and human selection factors limiting plant growth and crop productivity. To survive under different water conditions. Lowland rice is cultivated in against the stress, plants have evolved a number of physio- paddy fields, and upland rice is grown under rainfed, naturally logical and biochemical responses (Bray 1997). Study on the well-drained soils without surface water accumulation, similar mechanism that plants evoke to tolerate water stress will be of to wheat or maize. Compared to lowland rice, upland rice can great benefit to the breeding of drought-resistant crops. reduce the demand for irrigation water by 50–70% (Wang et al. There are two different cultivation regimes for rice; the upland 2002), and is considered excellent material for studying the and lowland rice. The cultivars suitable for each regime are mechanisms of plant drought tolerance. However, reported re- search in this area has only addressed biological characteristics, allele and genetic markers (Ishikawa et al. 1992, 1997), and little is known about the gene expression in upland rice during water stress. Received 29 Nov. 2006 Accepted 24 Mar. 2007 Suppression subtractive hybridization (SSH), which is first Supported by the Specialized Research Fund for the Doctoral Program of reported in 1996 (Diatchenko et al.), is a highly effective method Higher Education of the Ministry of Education of China (20030019004) and widely used in the study of differential gene expression. In the National Natural Science Foundation of China (30250009). this study, we used SSH to obtain transcripts of responses to ∗ Author for correspondence. polyethylene glycol (PEG) stress in upland rice var. IRAT109, + Tel (Fax): 86 (0)10 6273 1414; and then carried out sequence analysis to reveal the gene E-mail:
1456 Journal of Integrative Plant Biology Vol. 49 No. 10 2007
1 2 3 4 1 2 3 M 4 5 6
Figure 1. Analysis of RNA extracted from IRAT109 seedlings.
1, Polyethylene glycol- (PEG) treated leaves; 2, PEG-treated roots; 3, Non-treated leaves; 4, Non-treated roots.
Results Figure 2. Analysis of suppression polymerase chain reaction (PCR) products.
RNA isolation 1, 2, 3, PCR products of leaves; 4, 5, 6, PCR products of roots; M, The use of SSH depends on the quality of total RNA. The marker, 100 bp, 300 bp, 500 bp, 700 bp, 900 bp, 1 200 bp. electrophoresis analysis revealed that RNA samples show both 18S- and 28S-RNA bands clearly in agarose gel (Figure 1), Sequence analysis and the ratio (28S/18S) of intensities is about 2:1, which Eight hundred clones (535 clones from leaf library and 265 demonstrated that the RNAs were integrated and suitable for clones from root library) were selected randomly and single- SSH. pass sequenced. A total of 690 clones produced readable sequences. After removing redundant sequences, 241 ESTs in leaves and 138 ESTs in roots were retained, and only 17 ESTs Construction of subtracted cDNA library in common for both tissues (Figure 4). The percentage of gene To identify water stress-inducible genes in IRAT109, a drought- expressed overlapping both tissues were only 4.43% (17/384), resistant upland rice variety, we treated plants with PEG (6000) suggesting that a large proportion of water stress inducible gene at 15% (w/v) for 9 h. The reasons for using these condi- ESTs have different expression patterns in different tissues and tions are as follows: (i) PEG (6000)-stress and soil drought that different stress protection mechanisms perhaps exist in have similar water stress effects (Kaufmann and Eckard 1971; different tissues. Zheng et al. 2004); (ii) Li et al. (2001) compared the effect of different concentrations of PEG (6000) to the growth of Functional classification of water stress induced ESTs upland rice and lowland rice seedlings, and concluded that 15% PEG (6000) could distinguish the resistance genotype All of the sequenced ESTs were annotated by comparing the and susceptible genotype; (iii) leaf chlorosis is not observed sequences with the GenBank database using BLAST programs, within 9 h in the susceptible lowland rice (LR); and (iv) genes and then classified into 17 groups according to the functional induced in the early stage are more likely to be involved categories of the Arabidopsis proteins (Table 2). A number in the signaling responses to water stress than in damaging of them are of unknown function, and others included those responses. likely to be related to metabolism, defense, transcription, signal Two SSH experiments were carried out: subtraction of transduction, protein synthesis, cellular transport, protein fate PEG-treated IRAT109 leaves cDNA (tester) from non-treated and others, suggesting that the responses of upland rice to IRAT109 leaves cDNA (driver) and that of the same for PEG- water stress are rather complex. treated and non-treated roots. After two rounds of subtrac- It is well-known that so many genes are induced under water tive hybridization and two rounds of suppression polymerase stress, but not every upregulated gene has a role in drought chain reaction (PCR), the cDNAs differentially expressed be- tolerance, the change in expression in some of them may simply tween PEG-treated and non-treated samples were enriched be the results of damages caused by stress (Bray 1997; Chaves (Figure 2). et al. 2003). In this study, we also found that some ESTs are con- The subtracted DNA fragments were then cloned into T- sidered to be related to a deleterious response. They are L11H8 easy vector, prior to transferring into Escherichia coli. A total (polygalacturonase), L7C12 (putative alpha-galactosidase), of 1 344 and 768 white colonies were derived from leaf and root L11D12 (zinc metalloproteinase-like) and R4E3 (senescence- materials, respectively. The length of insert fragments in these associated protein-like). Polygalacturonase is a cell wall- clones ranged from ∼200 to ∼700 bp (Figure 3). degrading enzyme and is induced by drought (Huberman 中国科技论文在线 http://www.paper.edu.cn
Analysis of Water Stress Induced Genes in Upland Rice 1457
1 2 3 4 5 6 7 8 9101112131415161718192021 22M2324252627282930313233
Figure 3. Polymerase chain reaction (PCR) analysis of partial clones from the subtracted library.
M, marker; bands from bottom to top represent 100 bp, 300 bp, 500 bp, 700 bp, 900 bp and 1 200 bp, respectively. Lanes 1 to 33, PCR products from different clones.
Leaf Root water stress need to be further studied. The functional genes (241 ESTs) (138 ESTs) that possibly play roles in drought tolerance are discussed in the following text.
Functional analysis of PEG stress induced genes that 224 17 121 possibly play roles in drought tolerance
How the transcription factors (NAC6, EREBP and AP2 do- Common main containing protein) affect down stream genes that confer drought tolerance in IRAT109 could not be extracted from Figure 4. Polyethylene glycol (PEG) stress induced expressed se- this gene expression study; but a number of genes encoded quence tags (ESTs) shared between leaf and root. functional proteins that probably play roles in water stress tolerance were found in the substructive library (Table 3). They et al. 1993). Alpha-galactosidase is also induced rapidly by include proteins responsible for defense against active oxygen, drought stress (Pukacka and Wojkiewicz 2002) and involved osmoprotectant biosynthesis, energy production, reinforcement in hydrolysis of cell wall components (Feurtado et al. 2001) and cell wall, recycling of amino acids, and regulation of cell turgor. storage reserves (Overbeeke et al. 1989), and also plays a role The functions of these proteins in water stress tolerance are in the degradation of chloroplast galactolipids during rice leaf discussed in the following. senescence (Lee et al. 2004). Metalloproteinase is likely to play Peroxidase (L13F8), aldehyde dehydrogenase (L7A2, R4B5) a role in plant extracellular cell matrix degradation (Delorme and metallothionein-like protein (R2G2) are directly involved et al. 2000). in defense against active oxygen, which otherwise lead to The regulatory protein, which involved in further regulation cellular oxidative damage (Kawano 2003; Akashi et al. 2004). of signal transduction and gene expression (Neill and Burnett Myo-inositol oxygenase (R6B9), phytochelatin synthetase 1999), were also found in the substructive library. Most of (L11E5), gamma-glutamylcysteine synthetase (L11F12) and them were transcription factors and protein kinases. Several 4-hydroxyphenylpyruvate dioxygenase (L15G12) are involved are reported to play important roles in plant drought tolerance in biosynthesis of ascorbate, phytochelatin, glutathione and responses. For example, NAC6 (R1F8) was induced by dehy- tocopherols; all of these products also function as defenses dration in Arabidopsis (Fujita et al. 2004) and by various stresses against active oxygen (Fryer 1992; Tsuji et al. 2003; Lorence in rice (Ohnishi et al. 2005). L14D8 (a EREBP) and R2G12 et al. 2004; Falk et al. 2005). (AP2 domain containing protein) belong to a large AP2 family Sucrose synthase (L7E2, R1G7) functioned as sugar ac- of transcription factors (Feng et al. 2005; Shigyo et al. 2006). cumulation, which is an important factor in drought tolerance The expression of some members in this family was water stress (Ingram and Bartels 1996). S-adenosylmethionine synthetase inducible (Feng et al. 2005; Gorantla et al. 2005; Lan et al. 2005; (L14D11) catalyze biosynthesis of S-adenosylmethionine, Li et al. 2005; Pandey et al. 2005). More importantly, there have which provides a methyl group to many metabolites including been many instances where overexpression of NAC and some important compatible solutes under water stress conditions, AP2 domain containing genes have enhanced stress tolerance, such as glycinebetaine, methylated polyols and polyamines including drought tolerance (Wang et al. 2004; Yi et al. 2004; (Bohnert and Jensen 1996). S-adenosylmethionine (L15A2, Gao et al. 2005; Li et al. 2005; Tang et al. 2005). R6B6) participates in polyamines biosynthesis. The unclassified or unknown proteins still represent the Glyoxalase I (L13H3), ABC transporter (L10E2, R2B3), largest group. Their roles in plant molecular response under cytochrome P-450 (L13E10, R3G6) and 1,4-benzoquinone 中国科技论文在线 http://www.paper.edu.cn
1458 Journal of Integrative Plant Biology Vol. 49 No. 10 2007
Table 1. Primers used in real time-polymerase chain reaction (RT-PCR) to verify the expression pattern of genes from the subtractive library Clone ID Forward primer sequence Reverse primer sequence L1E11 5AGTGGACAAGATGGGAGCAG3 5AGCCGATGACAATGGAAAGA3 L1F11 5GACAAAGAATACAAGCCAAATC3 5CCGACAGCACCAGAAAGA3 L2A9 5CTGCTTCTCCTGGAATGGT3 5TTGGTGGTGTCAAGTAGTTTATC3 L2D8 5TAGTTGGTGGAGCGATTTGTC3 5CCCAGAACATCTAAGGGCATC3 L5B5 5AAAAGGGAATGGAATGGG3 5GCAACCTGCGACCTAAAA3 L8D7 5CACTGTGACCCTGACTACCT3 5GACCCTCCTAATATCCAAAA3 L8F8 5GGTTATGGAGTTGGTGACGT3 5AGAATTGTGAGCACCGGATA3 L11F3 5AGAAGTGCCTCAGGGATG3 5AGCACCATAAGCAACAGC3 R1F5 5ATGGCGGTGAAGGTCTAT3 5ACATCTGGCTTAGGAGGC-3 R1G3 5GGCTGATGTCCAAAGTGTG3 5TGTCGAGATGCTGAAGAGG3 R1H4 5ACGCACAACATCGTGAGG3 5GTTCCAGGGAGAAGCCAC3 R2B4 5AACAATCACCCAGCTCCAG3 5AACGCATAAACACCCAGAC3 R3H4 5GCGTCGTCATGCTCACAC3 5GCCCCCATATTTCCTCTT3 R4F11 5ATCCGATCCGTCAGAGAGTT3 5AAAGAACCAAGGAAGAGCTA3 R6B9 5AGGTGCTGCTGCATCCC3 5AGGCCCCAAACTTGGTG3 Tubulin 5TCAGATGCCCAGTGACAGGA3 5TTGGTGATCTCGGCAACAGA3
Table 2. Biological process categorization of polyethylene glycol (PEG) systems (Thornalley 1990; Martins et al. 2001). The adenosine stress-induced expressed sequence tags (ESTs) by referring to Ara- triphosphate (ATP)-binding cassette (ABC) transporter is a bidopsis Sequencing Project functional categories. The number of ESTs multidrug resistance-associated protein and generally thought and their percentages are shown to play a major role in cellular detoxification, by transporting toxic Biological process categorization Leaf Root compounds from the cytosol into the vacuole (Klein et al. 2003). categorization Cytochrome P450 plays a crucial role in oxidative detoxification Number Ratio Number Ratio (Sandermann 1992) and biosynthesis of phytoalexins brassi- (%) (%) nolides (Bolwell et al. 1994). 1,4-benzoquinone reductase may Amino acid metabolism 11 4.56 3 2.17 play roles in the detoxification of quinone and protecting against C-compound metabolism 11 4.56 8 5.80 oxidative stress (Laskowski et al. 2002). Nucleotide metabolism 1 0.42 3 2.17 Ubiquitin (L11H1, R5F4) normally functions by being cova- Lipid, fatty acid metabolism 3 1.24 2 1.45 lently attached to abnormal proteins, which are produced by Secondary metabolism 10 4.15 5 3.62 various stresses, and targeting them for proteolysis (Belknap Phosphate metabolism 2 0.83 and Garbarino 1996). This reaction is thought to be required Cell rescue, defense 11 4.56 6 4.35 for the turnover of proteins and recycling of amino acids. Most and virulence membrane integral proteins (R6C3) are aquaporins, which are Transcription 21 8.71 15 10.87 believed to be responsible for osmoregulation (Takata 2004). Signal transduction 12 4.98 8 5.80 Heat shock protein (L11F3, L9E11) is thought to be a chap- Protein synthesis 8 3.32 5 3.62 eron and functions in protecting enzymes, protein complexes, Cellular transport 7 2.90 5 3.62 and membranes (Maestri et al. 2002). Cellulose synthase Protein fate 7 2.90 3 2.17 (L6D7) and proline-rich protein (R4F8) may play roles in pro- Energy 8 3.32 6 4.35 tecting the cell wall from collapse under stress conditions. Lipid DNA processing 4 1.66 2 1.45 transfer protein may have a function in the repair of stress- Development 4 1.66 3 2.17 induced damages in membranes or changes in the lipid com- Other 31 12.86 12 8.70 position of membranes, perhaps to regulate the permeability to Unknown protein 90 37.34 52 37.68 toxic ions and the fluidity of the membrane. Protease inhibitors Total 241 138 (R2G3) may carry out a defensive role against the proteases. Enolase (R1E6) may provide energy for the photosynthesis reductase (R1E7) function in a cellular detoxification capacity. system damaged by reactive oxygen species during various Glyoxalase I plays a role in the detoxification of methylglyoxal, abiotic stresses. Quinone oxidoreductase plays an important a potent cytotoxin, which can modify different molecular targets role in energy production and its deficiency produces more including DNA and proteins and inactivate antioxidant defense reactive oxygen species (Takahiro 2002). 中国科技论文在线 http://www.paper.edu.cn
Analysis of Water Stress Induced Genes in Upland Rice 1459
Table 3. Polyethylene glycol (PEG) stress induced functional genes that possibly play roles in water stress tolerance Function Leaf Root
Clone ID Annotation Clone ID Annotation Defense against active oxygen L13F8 Putative peroxidase R1G10 Putative germin protein L7A2 Aldehyde dehydrogenase R2G2 Metallothionein-like protein L11E5 Phytochelatin synthetase R4B5 Aldehyde dehydrogenase L15G12 4-hydroxyphenylpyruvate dioxygenase R6B9 Putative myo-inositol oxygenase L11F12 Gamma-glutamylcysteine synthetase Biosynthesis of osmoprotectants L7E2 Sucrose synthase R1G7 Sucrose synthase L15A2 S-adenosylmethionine decarboxylase R6B6 S-adenosylmethionine decarboxylase L14D11 S-adenosyl methionine synthetase Detoxification L13H3 Glyoxalase I R2B3 MRP-like ABC transporter L10E2 ABC transporter R1E7 1,4-benzoquinone reductase L13E10 Cytochrome P-450 R3G6 Putative cytochrome P450 Recycling of amino acids L11H1 Polyubiquitin R5F4 Putative ubiquitin protein Protein turnover R5H11 Ubiquitin-protein ligase 1 Chaperon L11F3 Heat shock protein 70 L9E11 Heat shock factor protein hsf8-like Reinforcement cell wall L6D7 Putative cellulose synthase catalytic R4F8 Proline-rich protein family-like subunit protein R5E5 Callose synthase-like protein Turgor maintenance L12B2 Putative membrane protein R6C3 Putative small basic membrane integral protein Repair damages in membranes R4E9 Lipid transfer protein-like Defense against the proteases R2G3 Proteinase inhibitors Energy production R1E6 Enolase R1H4 Quinone-oxidoreductase ABC, adenosine triphosphate-binding cassette; MRP, multidong resistance-associated protein.
Analysis of the reliability of SSH by real-time PCR Table 4. Comparison of gene expression in polyethylene glycol- (PEG) treated and non-treated leaves by real-time polymerase chain reaction To test the reliability of SSH, fifteen ESTs (eight from the leaf- (RT-PCR) analyses library and seven from the root-library) were selected and their Clone PEG-treated leaves Control Ratio expressions were examined by RT-PCR. Four ESTs (L2D8, L5B5, R3H4, R2B4) showed slight differential expression be- C(t)∗ C(t) 2− C(t) C(t) C(t) 2− C(t) tween PEG-treated and non-treated seedlings. The other eleven L1E11 26.532 5.184 0.028 27.292 0.008 0.013 2.15 (73.3%, 11/15) all showed significant upregulation under PEG L1F11 22.214 0.866 0.549 23.526 0.131 0.173 3.17 stress, and the expression ratios of PEG-treated samples over L2A9 23.282 1.934 0.262 24.353 0.079 0.098 2.67 the control are larger than two (Tables 4, 5). L2D8 23.459 2.111 0.231 23.182 0.126 0.220 1.05 L5B5 20.153 −1.195 2.289 19.995 1.634 2.003 1.14 L8D7 22.366 1.018 0.494 23.476 0.179 0.179 2.76 Discussion L8F8 21.895 0.547 0.684 23.125 0.229 0.229 2.99 L11F3 19.875 −1.473 2.776 21.925 0.526 1.023 2.71 In this study, we analyzed the gene expression profile induced Tubulin 21.348 20.997 by water stress in upland rice var. IRAT109. IRAT109 is an Numbers in the “C(t)” column are the mean value of two replicates. extremely drought-tolerant cultivar, its index of drought resis- Numbers in the “Ratio” column are the ratios of 2− C(t) value of the tance (IDR, the ratio of average yield per plant under upland PEG-treated sample over that of control. conditions to average yield per plant under lowland conditions) is 1.17 (Li et al. 2005). So study the water stress inducible genes in IRAT109 are important not only for further understanding the A water stress inducible cDNA library was developed using molecular mechanisms of drought response in higher plants SSH with cDNAs from PEG-treated seedlings as drivers and but also for improving the stress tolerance of crops by genetic those from unstressed seedlings as testers. BLAST analysis manipulation. showed that many of the ESTs obtained from the library had 中国科技论文在线 http://www.paper.edu.cn
1460 Journal of Integrative Plant Biology Vol. 49 No. 10 2007
Table 5. Comparison of gene expression in polyethylene glycol- (PEG) thus maintaining the integrity of cellular components. Some treated and non-treated roots by real-time polymerase chain reaction upregulated gene transcripts seemed to strengthen the cell analyses wall and boost levels of osmotants so that turgor could be Clone PEG-treated roots Control Ratio maintained. In the present study, some ESTs were found to be upreg- C(t) C(t) 2− C(t) C(t) C(t) 2− C(t) ulated by salt stress in rice, as has been revealed in other R1F5 26.927 2.950 0.129 28.002 4.846 0.035 3.69 studies. The ESTs are: metallothionein-like protein (R2G2) − − R1G3 20.635 3.342 10.140 21.923 1.233 2.351 4.31 (Kawasaki et al. 2001), S-adenosylmethionine decarboxylase − − R3H4 22.834 1.143 2.208 22.041 1.115 2.166 1.02 (L15A2), 60S ribosomal protein (L14B10), 40S ribosomal pro- − − R1H4 20.532 3.445 10.891 21.873 1.283 2.433 4.48 tein (R5C7) (Ozturk et al. 2002), sucrose synthase (R1G7) − − R2B4 20.085 3.892 14.846 19.495 3.661 12.649 1.17 (Dejardin et al. 1999), phosphoenolpyruvate carboxykinase − − R4F11 19.651 4.326 20.057 20.635 2.521 5.740 3.49 (L13A5) (Cushman et al. 1989) and alcohol dehydrogenase R6B9 24.728 0.751 0.594 25.254 2.098 0.234 2.54 (L9B7) (Brosche and Strid 1999). Similarly, a comparison with Tubulin 23.977 23.156 cold stress inducible genes of Arabidopsis also revealed several Numbers in the “C(t)” column are the mean value of two replicates. common genes such as those for enolase (R4F9), senescence- − Numbers in the “Ratio” column are the ratios of 2 C(t) value of associated protein-like (R4E3) (Lee and Lee 2003), alcohol PEG-treated sample over that of control. dehydrogenase (L9B7) (Jung et al. 2003). Moreover, we also found some biotic stress inducible genes in the substruc- tive library. For example, metallothionein-like protein (R5A11), significant protein homology to genes from rice and other plants, S-adenosylmethionine decarboxylase (L15A2), heat shock pro- previously identified as water stress-related genes, such as tein 70 (L11F3) and putative 60S ribosomal protein (L14B10) alcohol dehydrogenase (Seki et al. 2002), protein phosphatase are induced by fungal-stress (Shim et al. 2004). Mitochondrial 2C (Hirayama et al. 1995), RNA binding protein (Ingram and carrier protein (L2E8) and nucellin-like aspartic protease (L7C6) Bartels 1996), metallothionein-like proteins and enolase (Reddy are upregulated by the damage caused by brown planthopper, et al. 2002). This appears to support the validity of the subtracted which is a rice-specific herbivore that ingests assimilates from cDNA library. the phloem (Yuan et al. 2005). These observations suggest Functional categories showed that the genes represented by that there is great cross talk not only in signaling pathways for those ESTs had a wide range of roles in different cell activities, drought, cold, and high-salinity stresses previously confirmed in which indicated that upland-rice seedlings responded to water rice (Rabbani et al. 2003) and Arabidopsis (Seki et al. 2002), stress at a global level. These ESTs can be classified into four but in some biotic stresses. major groups. The first group consists of functional proteins that probably play roles in water stress tolerance (Table 3). The second group consists of regulatory proteins. They are protein Materials and Methods kinases, protein phosphatases, transcription factors, splicing factors, and transcription termination factors. The third group Plant growth and stress treatments consists of proteins related to damages induced by water stress. Only a few genes (L11H8, L7C12, L11D12 and R4E3) belong to Seeds of upland rice (UR) var. IRAT109 were germinated this sort, suggesting that the seedlings of IRAT109 are slightly at 32 ◦C for 2 days, and then the germinated seeds were affected by the PEG stress. The fourth group consists of many transferred to hydroponic growth conditions at 28 ± 2 ◦C, proteins involved in various metabolism processes, such as 200 µmol/m2 per s light intensity with 14-h light/10-h- ark amino acid metabolism, carbohydrate metabolism, secondary photoperiod and 80% relative humidity. The solution was metabolism, lipid, fatty acid and isoprenoid metabolism, phos- changed every 2 days. The nutrient solution contained
phate metabolism, and nucleotide metabolism. A number of 1.43 mmol/L NH4NO3, 0.27 mmol/L NaH2PO4·2H2O,
genes in response to water stress were assigned to the series 0.51 mmol/L K2SO4, 1.0 mmol/L CaCl2, 1.46 mmol/L
of metabolism category. Changes in primary metabolism are MnSO4·7H2O, 0.19 mmol/L Na2SiO3,9.5µmol/L MnCl2·4H2O, −2 a general response to stress in plants (Ingram and Bartels 7.5 × 10 µmol/L (NH4)6Mo7O24·4H2O, 18.8 µmol/L H3BO3,
1996). 0.15 µmol/L ZnSO4·7H2O, 0.16 µmol/L CuSO4·5H2O,
Based on the annotation information of the differentially 35.6 µmol/L FeCl3·6H2O, pH 5.5–6.0. Four weeks after expressed sequences, we have proposed a model to explain transfer, the seedlings were exposed to 15% (w/v) polyethylene the drought tolerance of upland rice, IRAT109. PEG treatment glycol (PEG, molecular weight, 6 000) for 9 h, then leaves stimulated or maintained the expression of many transcription and roots were cut off, frozen in liquid nitrogen, and stored at factors, which then presumably upregulated the expression of −80 ◦C until use. The procedure was the same for the control genes that help prevent the accumulation of oxidative stress, but without the PEG treatment. 中国科技论文在线 http://www.paper.edu.cn
Analysis of Water Stress Induced Genes in Upland Rice 1461
RNA isolation Acknowledgements Total RNA was isolated from PEG-treated and control seedling The authors thank Dr Nanfei Xu (BASF Plant Science, USA) for samples with TRIZOL reagent (Dingguo, Beijing, China), and + his helpful suggestions. poly (A) RNA was enriched using a PolyATract mRNA isolation kit (Promega, Madison, WI, USA). References Suppression subtractive hybridization Akashi K, Nishimura N, Ishida Y, Yokota A (2004). Potent hydroxyl The suppression subtractive hybridization was carried out using radical-scavenging activity of drought-induced type-2 metallothionein a PCR-select cDNA subtractive kit (Clontech, Mountain View, in wild watermelon. Biochem. Biophys. Res. Commun. 323, 72– CA, USA) according to the manufacturer’s protocol. Subtraction 78. was carried out using cDNA synthesized from PEG-treated Belknap WR, Garbarino JE (1996). The role of ubiquitin in plant plants as tester and that from control plants served as driver senescence and stress responses. Trends Plant Sci. 1, 331–335. to enrich genes that are induced by PEG stress. An Advantage Bohnert HJ, Jensen RG (1996). Strategies for engineering water-stress PCR cloning kit (Clontech) was used to selectively amplify the tolerance in plants. Trends Biotechnol. 14, 89–97. cDNA fragments preferentially present in the tester from the Bolwell GP, Bozak K, Zimmerlin A (1994). Plant cytochrome P450. subtraction hybridization products. Phytochemistry 37, 1491–1506. Bray EA (1997). Plant responses to water deficit. Trends Plant Sci. 2, 48–54. Construction of subtracted cDNA library Brosche M, Strid A (1999). Cloning, expression, and molecular char- Plymerase chain reaction-amplified cDNA produced by SSH, acterization of a small pea gene family regulated by low levels of was ligated into the pGEM-T easy vector (Promega) and ultraviolet B radiation and other stresses. Plant Physiol. 121, 479– transformed into competent E. coli (strain DH5a). Individual 87. positive clones were picked (based on blue/white selection) and Chaves MM, Maroc JP, Pereira JS (2003). Understanding plant re- grown overnight in Luria-Bertani (LB) medium containing 15% sponses to drought—from genes to the whole plant. Funct. Plant glycerol. Biol. 30, 239–264. Cushman JC, Meyer G, Michalowski CB, Schmitt JM, Bohnert HJ (1989). Salt stress leads to differential expression of two iso- Sequencing analysis genes of phosphoenolpyruvate carboxylase during Crassulacean acid metabolism induction in the common ice plant. Plant Cell 1, Eight hundred clones randomly selected from the subtracted 715–725. cDNA library, which was constructed by SSH, were all single- Dejardin A, Sokolov LN, Kleczkowski LA (1999). Sugar/osmoticum pass sequenced using T7 reverse universal primer (Aoke, levels modulate differential abscisic acidindependent expression Beijing, China). Unique ESTs were selected and annotated of two stress-responsive sucrose synthase genes in Arabidopsis. using the National Center for Biotechnology Information non- Biochem. J. 344, 503–509. redundant databases by BLASTN and BLASTX with an e-value Delorme VGR, McCabe PF, Kim DJ, Leaver CJ (2000). A matrix threshold of 1e−08. Functional classification of the ESTs was metalloproteinase gene is expressed at the boundary of senescence carried out according to the functional categories of Arabidopsis and programmed cell death in cucumber. Plant Physiol. 123, 917– proteins (http://mips.gsf.de/proj/thal/db/index.html). 927. Diatchenko L, Chrislau YF, Campbell AP, Chenchik A, Mooadam F, Huang B et al. (1996). Suppression subtractive hybridization: A Real-time PCR method for generating differentially regulatedor tissue- specific cDNA Real-time polymerase chain reaction reactions were carried out probe. Proc. Natl. Acad. Sci. USA 93, 6025–6030. using a DNA Engine OpticonTM (Bio-Rad, Hercules, CA, USA), Falk J, Brosch M, Schafer A, Braun S, Krupinska K (2005). Char- and the same total RNA samples were used for the SSH. First acterization of transplastomic tobacco plants with a plastid localized strand cDNA was synthesized using avian myeloblastosis virus barley 4-hydroxyphenylpyruvate dioxygenase. J. Plant Physiol. 162, reverse transcriptase (Promega). SYBR Green I was used as a 738–42. fluorescence label. The EST-specific primers were designed by Feng JX, Liu D, Pan Y, Gong W, Ma LG, Luo JC et al. (2005). An Primer 5.0 and synthesized by Sangon Company (Shanghai, annotation update via cDNA sequence analysis and comprehensive China). The rice tubulin gene was used as an endogenous profiling of developmental, hormonal or environmental responsive- reference for data normalization. Transcript concentration was ness of the Arabidopsis AP2/EREBP transcription factor gene family. calculated by 2- c(t). Primer sequences are listed in Table 1. Plant Mol. Biol. 59, 853–868. 中国科技论文在线 http://www.paper.edu.cn
1462 Journal of Integrative Plant Biology Vol. 49 No. 10 2007
Feurtado JA, Banik M, Bewley JD (2001). The cloning and characteri- Laskowski MJ, Dreher KA, Gehring MA, Abel S, Gensler AL, Sussex zation of -galactosidase present during and following germination of IM (2002). FQR1, a novel primary auxin-response gene, encodes tomato (Lycopersicon esculentum Mill.) seed. J. Exp. Bot. 52, 1239– a flavin mononucleotide-binding quinone reductase. Plant Physiol. 1249. 128, 578–590. Fryer MJ (1992). The antioxidant effect of thylakoid vitamin E (a- Lee JY, Lee DH (2003). Use of serial analysis of gene expression tocopherol). Plant Cell Environ. 15, 381–392. technology to reveal changes in gene expression in arabidopsis Fujita M, Fujita Y, Maruyama K, Seki M, Hiratsu K, Ohme-Takagi M, pollen undergoing cold stress. Plant Physiol. 132, 517–529. et al. (2004). A dehydration-induced NAC protein, RD26, is involved Lee RH, Lin MC, Chen SCG (2004). A novel alkaline a-galactosidase in a novel ABA-dependent stress-signaling pathway. Plant J. 39, gene is involved in rice leaf senescence. Plant Mol. Biol. 55, 281– 863–876. 295. Gao SQ, Xu HJ, Cheng XG, Chen M, Xu ZS, Li LC et al. (2005). Li XP, Tian AG, Luo GZ, Gong ZZ, Zhang JS, Chen SY (2005a). Improvement of wheat drought and salt tolerance by expression of Soybean DRE-binding transcription factors that are responsive to a stress-inducible transcription factor GmDREB of soybean (Glycine abiotic stresses. Theor. Appl. Genet. 110, 1355–1362. max). Chin. Sci. Bull. 50, 2714–2723. Li ZC, Liu WX, Zhao DL (2001). Comparison of growing tendency during Gorantla M, Babu PR, Lachagari VBR, Feltus FA, Paterson AH, young seedling between paddy rice and upland rice under PEG water Reddy AR (2005). Functional genomics of drought stress response stress. J. China Agric.Univ. 6, 16–20 (in Chinese with an English in rice: Transcript mapping of annotated unigenes of an indica rice abstract). (Oryza sativa L. cv. Nagina 22). Cur. Sci. 89, 496–514. LiZC,MuP,LiCP,ZhangHL,LiZK,GaoYMetal.(2005b). QTL Hirayama T, Ohto C, Mizoguchi T, Shinozaki K (1995). A gene mapping of root traits in a doubled haploid population from a cross encoding a phosphatidylinositol-specific phospholipase C is induced between upland and lowland japonicarice in three environments. by dehydration and salt stress in Arabidopsis thaliana. Proc. Natl. Theor. Appl. Genet. 110, 1244–1252. Acad. Sci. USA 92, 3903–3907. Lorence A, Chevone BI, Mendes P, Nessler CL (2004). myo-inositol Huberman M, Pressman E, Jaffe MJ (1993). Pith autolysis in plants: oxygenase offers a possible entry point into plant ascorbate biosyn- IV. The activity of polygalacturonase and cellulase during drought thesis. Plant Physiol. 134, 1200–1205. stress induced pith autolysis. Plant Cell Physiol. 34, 795–801. Maestri E, Klueva N, Perrotta C, Gulli M, Nguyen HT, Marmiroli N Ingram J, Bartel D (1996). The molecular basis of dehydration tolerance (2002). Molecular genetics of heat tolerance and heat shock proteins in plant. Plant Mol. Biol. 47, 377–403. in cereals. Plant Mol. Biol. 48, 667–681. Ishikawa R, Maeda K, Harada T, Niizeki M, Saito K (1992). Genotypic Martins AM, Cordeiro CA, Ponces Freire AM (2001). In situ analysis of variation for 17 isozyme genes among Japanese upland varieties in methylglyoxal metabolism in Saccharomyces cerevisiae. FEBS Lett. rice. Jpn. J. Breed. 42, 737–746. 499, 41–44. Ishikawa R, Harata Y, Tuchimine Y, Senda M, Akada S, Harada T Neill SJ, Burnett EC (1999). Regulation of gene expression during water et al. (1997). Complex constitutive nature of Japanese upland rice, deficit stress. Plant Growth Regul. 29, 23–33. Oryza sativa L. Euphytica 98, 197–203. Ohnishi T, Sugahara S, Yamada T, Kikuchi K, Yoshiba Y, Hirano HY Jung SH, Lee JY, Lee DH (2003). Use of SAGE technology to reveal et al. (2005). OsNAC6, a member of the NAC gene family, is induced changes in gene expression in Arabidopsis leaves undergoing cold by various stresses in rice. Genes Genet. Syst. 80, 135–139. stress. Plant Mol. Biol. 52, 553–567. Overbeeke N, Fellinger AJ, Toonen MY, van Wassenaar D, Verrips Kaufmann MR, Eckard AN (1971). Evaluation of water stress control CT (1989). Cloning and nucleotide sequence of the -galactosidase with polyethylene glycol by analysis of guttation. Plant Physiol. 47, cDNA from Cyamopsis tetragonoloba (guar). Plant Mol. Biol. 13, 453–456. 541–550. Kawano T (2003). Roles of the reactive oxygen species-generating Ozturk ZN, Talame V, Deyholos M, Michalowski CB, Galbraith DW, peroxidase reactions in plant defense and growth induction. Plant Gozukirmizi N et al. (2002). Monitoring large-scale changes in Cell Rep. 21, 829–837. transcript abundance in drought- and salt-stressed barley. Plant Mol. Kawasaki S, Borchert C, Deyholos M, Wang H, Brazille S et al. Biol. 48, 551–573. (2001). Gene expression profiles during the initial phase of salt stress Pandey GK, Grant JJ, Cheong YH, Kim BG, Li LG, Luan S (2005). in rice. Plant Cell 13, 889–906. ABR1, an APETALA2-domain transcription factor that functions as Klein M, Perfus-Barbeoch L, Frelet A, Gaedeke N, Reinhardt D, a repressor of ABA response in Arabidopsis. Plant Physiol. 139, Mueller-Roeber B et al. (2003). The plant multidrug resistance ABC 1185–1193. transporter AtMRP5 is involved in guard cell hormonal signalling and Pukacka S, Wojkiewicz E (2002). Carbohydrate metabolism in Norway water use. Plant J. 33, 119–129. maple and sycamore seeds in relation to desiccation tolerance. J. Lan LF, Li MN, Lai Y, Xu WY, Kong ZS, Ying K et al. (2005). Plant Physiol. 159, 273–279. Microarray analysis reveals similarities and variations in genetic Rabbani MA, Maruyama K, Abe H, Khan MA, Katsura K, Ito Y et al. programs controlling pollination/fertilization and stress responses in (2003). Monitoring expression profiles of rice genes under cold, rice (Oryza sativa L.). Plant Mol. Biol. 59, 151–164. drought, and high-salinity stresses and abscisic acid application 中国科技论文在线 http://www.paper.edu.cn
Analysis of Water Stress Induced Genes in Upland Rice 1463
using cDNA microarray and RNA gel-blot analyses. Plant Physiol. towards functional characterization of a metabolic pathway funda- 133, 1755–1767. mental to biological life. Biochem. J. 269, 1–11. Reddy AR, Ramakrishna W, Sekhar AC, Ithal N, Babu PR, Bonaldo Tsuji N, Hirayanagi N, Iwabe O, Namba T, Tagawa M, Miyamoto MF et al. (2002). Novel genes are enriched in normalized cDNA Setal.(2003). Regulation of phytochelatin synthesis by zinc and libraries from drought-stressed seedlings of rice (Oryza sativa L. cadmium in marine green alga, Dunaliella tertiolecta. Phytochemistry subsp. indica cv. Nagina 22). Genome 45, 204–211. 62, 453–459. Sandermann H (1992). Xenobiotics. Trends Biochem. Sci. 17, 82–84. Wang HQ, Bouman BAM, Zhao DL, Wang CG, Moya PF (2002). Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y et al. (2002). Aerobic rice in northern China: Opportunities and challenges. In Monitoring the expression profiles of 7000 Arabidopsis genes under Bouman BAM, Hengsdijk H, Hardy B, Bindraban PS, Tuong TP, drought, cold and high-salinity stresses using a fulllength cDNA Ladha JK, eds. Water-wise Rice Production. International Rice microarray. Plant J. 31, 279–292. Research Institute, Los Banos. pp. 143–154. Shigyo M, Hasebe M, Ito M (2006). Molecular evolution of the AP2 Wang H, Huang ZJ, Chen Q, Zhang ZJ, Zhang HB, Wu YM et al. subfamily. Gene 366, 256–265. (2004). Ectopic overexpression of tomato JERF3 in tobacco activates Shim KS, Cho SK, Jeung JU, Jung KW, You MK, Ok SH et al. (2004). downstream gene expression and enhances salt tolerance. Plant Identification of fungal (Magnaporthe grisea) stress-induced genes Mol. Biol. 55, 183–192. in wild rice (Oryza minuta). Plant Cell Rep. 22, 599–607. Yi SY, Kim JH, Joung YH, Lee S, Kim WT, Yu SH et al. Takahiro Y (2002). The energy-transducing NADH: Quinone oxidore- (2004). The pepper transcription factor CaPF1 confers pathogen ductase, complex I. Mol. Aspects Med. 23, 345–368. and freezing Tolerance in Arabidopsis. Plant Physiol. 136, 2862– Takata K, Matsuzaki T, Tajika Y (2004). Aquaporins: Water channel 2874. proteins of the cell membrane. Prog. Histochem. Cytochem. 39,1– Yuan HY, Chen XP, Zhu LL, He GC (2005). Identification of genes re- 83. sponsive to brown planthopper Nilaparvata lugensStal (Homoptera: Tang W, Charles TM, Newton RJ (2005). Overexpression of the Delphacidae) feeding in rice. Planta 221, 105–112. pepper transcription factor CaPF1 in transgenic virginia pine (Pinus Zheng J, Zhao JF, Tao YZ, Wang JH, Liu YJ, Fu JJ et al. (2004). virginiana mill.) confers multiple stress tolerance and enhances Isolation and analysis of water stress induced genes in maize organ growth. Plant Mol. Biol. 59, 603–617. seedlings by subtractive PCR and cDNA macroarray. Plant Mol. Biol. Thornalley PJ (1990). The glyoxalase system: New developments 55, 807–823.
(Handling editor: Jianhua Zhang)