INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand corner and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

University Microfilms International A Beil & Howell Information Company 300 North Zeeb Road. Ann Arbor. Ml 48106-1346 USA 313/761-4700 800/521-0600 Order Number 9219007

Transfer RNA maturation in the archaebacterium Haloferax volcanii: A study of ribonuclease P and transfer RNA intron endonuclease

Nieuwlandt, Daniel Terry, Ph.D.

The Ohio State University, 1992

UMI 300 N. ZeebRd. Ann Arbor, MI 48106 TRANSFER RNA MATURATION IN THE ARCHAEBACTERIUM

HALOFERAX VOLCANII: A STUDY OF RIBONUCLEASE P AND

TRANSFER RNA INTRON ENDONUCLEASE

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of the Ohio State University

By

Daniel Terry Nieuwlandt, M.S.

3|« * £ % Ht

The Ohio State University

1992

Dissertation Committee: Approved by

Dr. C. Daniels

Dr. A. Darzins

Dr. J. Krzycki Advisor

Dr. J. Reeve Department of Microbiology To Mom and Dad ACKNOWLEDGEMENTS

I would like to express my sincere appreciation to Dr. Chuck Daniels for his guidance and patience throughout this project. I would also like to express my appreciation for the time and effort provided by Drs. A1 Darzins, Darrell Galloway, Joe

Krzycki, and John Reeve as members of my Dissertation committee. Thanks go to the members of the John Reeve and Joe Krzycki labs for their friendship and many helpful discussions. Special thanks go to Dr. Leo Thompson, my "mentor", for his help and friendship, and to Dr. Elizabeth Haas and Dr. Jim Brown for their advice and contributions to the RNase P research. Jorge Acevado, Dave Armbruster, Bill Oda, Traci

Baltrus, Linda McCart, and Mary Beth Carr also deserve special thanks for their help and for making our lab an interesting and fun place to work. VITA

February 5, 1962 Bom - Whittier, California

1985 ...... B. A., California State University, Fullerton, California

1988 M. S., Iowa State University, Ames, Iowa

1988-Present Graduate Research Associate, Department of Microbiology, The Ohio State University

PUBLICATIONS

Nieuwlandt, D. T., E. S. Haas, and C. J. Daniels. 1991. The RNA component of RNase P from the archaebacterium Haloferax volcanii. J. Biol. Chem. 266: 5689-5695.

Nieuwlandt, D. T., and C. J. Daniels. 1990. An expression vector for the archaebacterium Haloferax volcanii. J. Bacteriol. 172:7104-7110.

Thompson, L. D., L. D. Brandon, D. T. Nieuwlandt, and C. J. Daniels. 1989. Transfer RNA intron processing in the halophilic archaebacteria. Can. J. Microbiol. 35: 36-42.

Nieuwlandt, D. T., and P. A. Pattee. 1989. Transformation of a conditional peptidoglycan-deficient mutant of Staphylococcus aureus with plasmid DNA. J. Bacteriol. 171: 4906-4913.

Nieuwlandt, D. T. 1988. Genetic analysis and plasmid transformation of a temperature-sensitive osmotically fragile mutant of Staphylococcus aureus. M. S. Thesis. Iowa State University, Ames, LA.

FIELD OF STUDY

Major Field: Microbiology

Studies in Archaebacterial Molecular Biology

I v TABLE OF CONTENTS

DEDICATION ...... ii

ACKNOWLEDGMENTS ...... iii

VITA ...... iv

LIST OF TABLES ...... 7 ...... viii

LIST OF FIGURES...... ix

LIST OF ABBREVIATIONS...... xi

PAGE

INTRODUCTION ...... 1

LITERATURE REVIEW ...... 5 Archaebacteria...... 6 Overview of the archaebacteria ...... 6 Gene structure and expression in the archaebacteria ...... 18 Archaebacterial plasmids and phages ...... 25 Genetic exchange systems in the archaebacteria...... 28 Ribonuclease P ...... 39 Overview of ribonuclease P ...... 39 Discovery of RNase P ...... 41 Physical properties of RNase P ...... 42 Properties of the RNase P reaction ...... 46 Structure of RNase P R N A ...... 50 RNase P RNA structure-function relationships ...... 58 Substrate recognition by RNase P ...... 62 tRNA intron endonuclease ...... 67 Overview of intron processing ...... 67 Nuclear pre-tRNA introns ...... 73 Archaebacterial pre-tRNA introns ...... 84 Archaebacterial pre-rRNA introns ...... 90

MATERIALS AND METHODS ...... 92 Bacterial strains and plasm ids ...... 93 Small scale isolation of plasmid DNA from E. coH and H. volcanii ...... 94 Large scale isolation of plasmid DNA from E. coH ...... 95 Large scale isolation of plasmid DNA from H. volcanii ...... 96 Isolation of H. volcanii chromosomal DNA ...... 97 V Isolation of double-stranded replicative form (RF) bacteriophage M 1 3 D N A ...... 97 Isolation of bacteriophage M13 single-stranded DN A ...... 98 Isolation of H. volcanii and T. acidophilum R N A ...... 99 Oligonucleotide preparation ...... 99 Determination of RNA, DNA, and protein concentrations ...... 100 Nucleic acid precipitation ...... 100 Electrophoresis and visualization of nucleic acids and proteins ...... 101 U.V. shadowing of nucleic acids ...... 105 Recovery of RNA and DNA from electrophoresis gels ...... 105 Restriction and ligation of D N A ...... 106 In vitro transcription reactions ...... 107 Radiolabeling of RNA and DNA ...... 108 Preparation of transformation- and transfection-competent E. coU ...... 110 Transformation and transfection of E. coli ...... I l l H. volcanii expression vector construction ...... 112 Shuttle-expression vector copy number determination ...... 113 Reconstruction of Haloferax tRNATrP genes using the polymerase chain reaction ...... 114 Oligonucleotide-directed mutagenesis ...... 115 Reconstruction of £. cerevisiae tRNA^0 genes using the polymerase chain reaction ...... 118 Transformation of £L volcanii ...... 118 Southern blot analysis ...... 119 Northern blot analysis ...... 121 Primer extension analysis ...... 121 SI nuclease analysis ...... 122 H. volcanii intron endonuclease cleavage assay ...... 124 Yeast intron endonuclease cleavage assay ...... 125 Identification of the H. volcanii RNase P RNA ...... 126 Partial purification of I . acidophilum RNase P RNA ...... 128 H. volcanii and X- acidophilum RNase P cleavage assays ...... 130 Assay for catalytic activity by the H. volcanii RNase P RN A ...... 130 DNA sequence analysis ...... 132

RESULTS...... 133 Archaebacterial ribonuclease P ...... 133 Development of an assay for RNase P activity ...... 134 Effect of cations and temperature on the H. volcanii and X. acidophilum RNase P activities ...... 139 H. volcanii RNase P substrate specificity ...... 142 Identification of the RNA component of H. volcanii RNase P ...... 143 Identification of the RNA component of X- acidophilum RNase P ... 144 Isolation and Characterization of the gene encoding the RNase P RNA form H. volcanii ...... 145 Structure of the H. volcanii RNase P RNA ...... 153 Catalytic capabilities of in vitro-transcribed H. volcanii RNase P RNA ...... 160 Catalytic capabilities of in vivo-transcribed I f volcanii RNase P RNA ...... 161

v i In vivo analysis of tRNA intron processing in Haloferax volcanii ...... 172 Construction of an H. volcanii-E. coli shuttle-expression vector .... 172 H. volcanii restriction barrier ...... 173 Shuttle-expression vector copy number determination ...... 181 Expression of modified tRNATrP gene in H. volcanii ...... 187 In vivo analysis of tRNA intron endonuclease activity on modified pre-tRNATrP substrates ...... 188 Yeast pre-tRNA1*10 as a substrate for H. volcanii tRNA intron endonuclease ...... 199

DISCUSSION ...... 210 Ribonuclease P ...... 210 Properties of RNase P from H. volcanii and T. acidophilum 210 The RNA component of H. volcanii RNase P RNA ...... 213 Catalytic capabilities of the H. volcanii RNase P RN A ...... 216 tRNA intron endonuclease ...... 220 Construction of an H. volcanii-E. coli shuttle-expression vector. . . . 220 In vivo analysis of tRNA intron endonuclease activity on mutant pre-tRNATrP substrates ...... 224 Analysis of yeast pre-tRNA**10 as a substrate for H. volcanii tRNA intron endonuclease ...... 229

APPENDIX ...... 233

LITERATURE CITED ...... 239 LIST OF TABLES

TABLE PAGE

1. Introns in archaebacterial genes ...... 85

2. Effect of DNA methylation on the transformation of H. volcanii by plasmid pWL202 ...... 179

3. Copy number of plasmids in H. volcanii ...... 182

4. List of Escherichia coli. Haloferax volcanii. Thermoplasma acidophilum. and Saccharomvces cerevisiae strains and their genotypes ...... 233

5. List of H. volcanii-E. coli shuttle vectors ...... 234

6. List of oligonucleotides ...... 236

7. List of plasm ids ...... '...... 237

viii LIST OF FIGURES

FIGURE PAGE

1. Unrooted phylogenetic tree constructed from comparisons of complete 16S or 18S rRNA sequences ...... 9

2. Archaebacterial (Archael) phylogenetic tree constructed from comparisons of complete 16S rRNA sequences ...... 11

3. Hypothetical mechanism of pre-tRNA hydrolysis by Ml RNA of RNase P 51

4. Secondary structures of the RNase P RNAs from E. coli (Ml RNA) and B. subtilis (P RNA) ...... 54

5. Conserved RNase P RNA structure and sequences within the proteobacteria and within the eubacteria ...... 56

6. Secondary and tertiary structure models of pre-tRNAAsP from E. coli ...... 63

7. Splicing mechanisms of four major groups of intron-containing precursor RNAs ...... 69

8. Location of introns within pre-tRNAs encoded by eukaryotic nuclei, chloroplasts, and archaebacteria ...... 74

9. Splicing mechanisms for intron-containing nuclear pre-tRNAs from yeast and animal cells ...... 77

10. Proposed secondary structures of the 016, 0167, and Trp-Model RNAs ...... 88

11. Construction of the H- volcanii pre-tRNAVal substrate clone ...... 135

12. Structure and cleavage assay of H. volcanii pre-tRNAVal ...... 137

13. Effect of monovalent cations on the H. volcanii and T. acidophilum RNase P activities ...... 140

14. Gel-filtration chromatography of H. volcanii RNaseP; identification of copurifying RNAs ...... 146

15. Gel-filtration chromatography of T. acidophilum RNase P; identification of copurifying RNAs ...... 148 I

16. Northern blot analysis of T. acidophilum total RNA using a probe specific for a consensus RNase P RNA sequence ...... 150

17. Southern analysis of H. volcanii genomic DNA using RNase P RNA- derived cDNA as probe ...... 154

18. Sequence of the H. volcanii RNase P RNA gene region ...... 156

19. Transcript analysis of the H. volcanii RNase P RNA activity ...... 158

20. Structure of the E. coH and H. volcanii RNase P RNA activity ...... 162

21. Heterologous reconstitution of the H. volcanii RNase P RNA activity ...... 165

22. H. volcanii transformed with pWL230; RNase P activity assays and Northern blot analysis ...... 168

23. Gel-filtration chromatography of the RNase P RNA and holoenzyme from pWL230-transformed H. volcanii WFD11 ...... 170

24. Construction of the H. volcanii-E. coli shuttle-expression vector pWL202 ...... 174

25. Sequence of the pWL202 multiple cloning region and secondary structure of tRNATrP-0167 R N A ...... 176

26. Northern blot analysis of in vivo tRNATrP-0167 transcripts ...... 183

27. Mapping of the 5' end of tRNATrP-0167 primary transcripts by primer extension ...... 185

28. Secondary structures of pre-tRNATrP substrates with modified acceptor stem sequences ...... 189

29. Cleavage assays of 016,016-AGGAG, 0167, and 0167o+r pre-tRNATrP substrates containing either the wild-type or modified acceptor stem sequences ...... 193

30. Northern blot analysis of in vivo transcripts from modified tR N A TrP g en es ...... 195

31. Multiple cloning region of pWL221 and pWL222 and a comparison of the exon-intron boundary structures of S. cerevisiae pre-tRNAPr0 and H. volcanii pre-tRNATrP ...... 201

32. Secondary structures of S. cerevisiae pre-tRNAPr0 and pre-tRNAPro_rn 205

33. Northern blot analysis of in vivo and in vitro tRNA1*1,0 and tRNA1*110'*11 gene transcripts ...... 207 x ABBREVIATIONS

a alpha

Amp ampicillin P beta bp base pair

BSA bovine serum albumin cpm counts per minute

DNA deoxyribonucleic acid dNTPs dATP, dCTP, dGTP, dTTP

A delta, deletion

DTT dithiothreitol

EDTA ethylenediamintetraacetic acid y gamma g gram hr hour

IPTG isopropylthio-P-galactoside kbp kilobase pair kdal kilodaltons

Mev mevinolin

M micro

Mg microgram

Ml microliter

x i fxM micromolar

mg milligram

ml milliliter

mM millimolar

min minutes

M molar

MW molecular weight

mRNA messenger RNA

ng nanogram

nM nanomolar

nt nucleotide

PEG polyethylene glycol

RNA ribonucleic acid rpm revolutions per minute rRNA ribosomal RNA

SDS sodium dodecyl sulfate

SDS-PAGE SDS polyacrylamide gel electrophoresis

TBE Tris-borate EDTA buffer

TE 10 mM Tris Cl, pH 8.0,1 mM EDTA

TEMED N,N,N'-tetramethylethylenedi amine tRNA transfer RNA

X-gal 5-bromo-4-chloro-3-indolyl-(3-D-galactopyranoside INTRODUCTION

The archaebacteria are a phylogeneticaUy distinct and diverse group of prokaryotic- like organisms, as evolutionarily distant from the eubacteria as they are from the eukaryotes. Many molecular properties of the archaebacteria are unique to these organisms, while others are characteristically eubacterial or eukaryotic in nature. Like all organisms, however, archaebacterial tRNAs are transcribed as longer precursor molecules that must be processed by a set of enzymes to produce the mature, functional tRNAs.

These processing reactions include removal of 5* and 3' flanking sequences, the addition of the sequence CCA to the 3' terminus, specific base modifications, and in some cases, the removal of introns. This dissertation project has involved the characterization of two enzymes involved in tRNA processing in the halophilic archaebacterium Haloferax volcanii: ribonuclease P (RNase P) and tRNA intron endonuclease.

RNase P is an endoribonuclease responsible for generating the mature 5' termini of tRNA precursors. RNase P from all characterized eubacterial and eukaryotic sources is composed of both RNA and protein. Indirect evidence suggests that this is true for archaebacterial RNase P as well. The enzyme from eubacterial sources is the best characterized, and it has been firmly established that the RNA subunit of the eubacterial

RNase P functions as the catalytic component of the enzyme. It was the discovery in the early 1980s of the catalytic capability of eubacterial RNase P RNA and the self-splicing intron from the 26S rRNA of Tetrahvmena thermophilus that convinced the scientific community that proteins are not the only molecules capable of biological catalysis.

Despite the common feature of RNA catalysis shared by the eubacterial RNase P enzymes, sequence analysis has shown that there is considerable divergence between these RNAs.

The RNase P RNAs from Escherichia coli and Bacillus subtilis exhibit only 43% sequence

similarity (Reich et al., 1986). However, a comparison of a phylogeneticaUy diverse

group of eubacteria has shown that these RNAs share a common structural core, where

conserved nucleotides are localized to similar structural regions (James et al., 1988; Pace

et al., 1989; Brown et al., 1991). While evidence suggests that eukaryotic RNase P

complexes require RNA, there is no direct evidence that the RNAs by themselves are

catalytically active. In addition, these RNAs bear little sequence similarity to their

eubacterial counterparts and lack most of the structural core characteristics of these RNAs.

Differences in the structure and catalytic capabilities of the RNase P RNAs from the

eubacteria and eukaryotes bring to question the nature of archaebacterial RNase P

enzymes. Preliminary characterizations of the RNase P activities from two archaebacteria,

H. volcanii and Sulfolobus solfataricus have been reported (Lawrence et al., 1987; Darr et

al., 1990). H. volcanii RNase P was found to be micrococcal nuclease-sensitive and to have a buoyant density of 1.61 g/ml in cesium sulfate, suggesting that the enzyme has an

RNA component and, like the eubacterial RNase P, is composed of a large RNA and a small protein. S. solfataricus RNase P was not sensitive to micrococcal nuclease and had a buoyant density of 1.27 g/ml in cesium sulfate. The low density suggests that the enzyme has a higher protein:RNA ratio, resembling the eukaryotic nuclear and organellar

RNase P enzymes. These preliminary studies revealed a possible diversity among the archaebacterial RNase P enzymes and left unresolved the role of RNA in catalysis.

In this study, the RNase P activities from the archaebacteria H. volcanii and

Thermoplasma acidophilum were further characterized, and the RNAs that copurify with these activities were identified. The gene encoding the RNA component of H. volcanii

RNase P was isolated. Transcripts from this gene can assume a structure that is similar to eubacterial RNase P RNA structures and shares many of the invariant nucleotides of these RNAs. Both in vitro and in vivo transcripts of RNase P RNA were incapable of catalyzing cleavage of pre-tRNAs under a variety of in vitro reaction conditions.

However, catalytic activity was observed when this RNA was combined with B. subtilis

RNase P protein, a protein which lacks catalytic activity.

Introns have been identified in eukaryotic nuclear and organellar genes for proteins, rRNAs, and tRNAs. Within the eubacteria, they have been identified only in tR N A ^11 genes froms various cyanobacteria (Xu et al., 1990; Kuhsel et al., 1990) and in a few bacteriophage protein genes (Chu et al., 1984; 1987; Sjoberg et al., 1986; Goodrich-Blair et al., 1990). Among the archaebacteria, introns have been shown to occur in several tRNA genes and, in two cases, within 23S rRNA genes (Table 1). Following transcription of intron-containing genes, the intron must be cleaved out and the coding sequences (exons) ligated together to generate the functional RNA molecule. Eukaryotic introns have been classified into four major groups on the basis of the splicing mechanism employed for their removal: group I, group n, nuclear mRNA, and nuclear tRNA introns.

Some of the group I and group II introns are capable of self-excision, while all of the known nuclear mRNA and nuclear tRNA introns require exogenous protein enzymes for their removal. All but nuclear mRNA-type introns have been found to occur in eukaryotic tRNA genes. Nuclear tRNA-type introns are restricted to nuclear tRNA genes and are always located at the same site within pre-tRNAs, one nucleotide away from the 3' side of the anticodon. In contrast, organellar tRNA introns are either of the group I or group II type, and are found at various positions within pre-tRNAs (Perlman et al., 1990).

Although archaebacterial tRNA introns are also found at various positions within pre- tRNAs, they do not contain the structural elements characteristic of group I and group II introns, and they are dependent upon protein enzymes for their removal.

The mechanism of tRNA intron removal by the eukaryotic nuclear tRNA intron endonuclease is dependent upon the conserved intron location. The intron endonuclease interacts with conserved features of the mature tRNA domain of pre-tRNAs, then uses a

measuring mechanism to sense the distance from the top of the anticodon stem to the 5'

and 3' cleavage sites (Perlman et al., 1990). Since not all archaebacterial tRNA introns

are located at the same position as eukaryotic tRNA introns, these organisms were

expected to use a different mechanism to identify their cleavage sites. The mechanism of

tRNA intron processing in H. volcanii has been analyzed in vitro by Thompson and

Daniels (1988; 1990). A partially purified intron endonuclease from this organism has

been shown to precisely excise a 104-nucleotide intron from Haloferax pre-tRNATrP

transcripts. This enzyme does not require mature tRNA structure in intron-containing

precursors, or the complete intron. A comparative analysis of archaebacterial intron-

containing tRNAs suggested that a conserved structure, in which the cleavage sites are

located in two three-nucleotide bulge loops separated by four base pairs, could serve as the recognition element for the archaebacterial intron endonuclease. Thompson and

Daniels (1990) demonstrated that the H. volcanii intron endonuclease requires the presence of the bulge loops at the cleavage sites and that the identification of these sites does not involve a mechanism which senses the distance from the top of the anticodon stem to the 5' and 3' cleavage sites.

In this study, it was determined whether the substrate recognition properties of the

H. volcanii intron endonuclease which were observed in vitro held true in vivo. The in vivo studies involved the construction and characterization of an expression vector capable of expressing mutant tRNA genes in H. volcanii. The in vivo results confirmed the requirement for defined exon-intron boundary structures in pre-tRNATrP, and the lack of a requirement for the complete intron, for substrate recognition and cleavage by the H. volcanii intron endonuclease. LITERATURE REVIEW

The traditional view that all organisms can be divided into two kingdoms, the prokaryotes and eukaryotes, was seriously questioned during the late 1970s when it was discovered that the archaebacteria are phylogeneticaUy distant from both groups (Woese and Fox, 1977). Based on the use of rRNA sequence similarities as an evolutionary chronometer, Woese and Fox (1977; Fox et al., 1980) proposed the now widely accepted view that there are at least three kingdoms of living organisms: the eubacteria (true bacteria), the eukaryotes, and the archaebacteria. The archaebacteria are a very diverse group of organisms comprised of three main phenotypes: methanogens, halophiles, and sulfur-dependent thermophiles. Members of this kingdom tend to inhabit extreme environments. The methanogenic archaebacteria are obligate strict anaerobes that obtain energy for growth by reducing carbon dioxide to methane or converting the methyl group of acetate, methanol, or methylated amines to methane (Whitman, 1985). Many methanogens are extreme thermophiles or halophiles as weU. The halophilic archaebacteria require environments with high concentrations of sodium chloride (2 to 5.2

M), with some members of this group also requiring high pH (9-10; Kushner, 1985).

The sulfur-dependent thermophiles have temperature optima of 55-105°C and are known to either reduce or oxidize sulfur as an energy source (Stetter and ZiUig, 1985; ZiUig et al.,

1990). The archaebacteria exhibit many unique molecular characteristics as well as features that are either eubacterial or eukaryotic in nature. For example, they have rRNA operons and operon structures in general similar to the eubacteria. Like eukaryotes, some stable RNA genes are interrupted by introns, and many genes, like those encoding

5 ribosomal proteins and RNA polymerases, encode eukaryotic-like proteins (Brown et al.,

1989).

The recognition of the archaebacteria as a separate evolutionary lineage has led a desire to define their evolutionary position and to understand the biochemistry of cellular processes that permit these cells to inhabit extreme environments. This study focused on the characterization of two enzymes involved in tRNA maturation in the halophilic archaebacterium Haloferax volcanii: tRNA intron endonuclease and ribonuclease P.

Particular attention was placed on the comparison of these enzyme activities from H. volcanii with those from the eubacteria and eukaryotes. A review of the literature pertaining to this study is provided below.

Archaebacteria

An overview of the archaebacteria:

Until the advent of molecular biology, a reliable phylogenetic system of microbial classification was unattainable. Unlike higher plants and animals, microorganisms are morphologically simple and their shapes are phylogeneticaUy uninformative. While comparisons of molecular organization and submicroseopic traits are more informative, their use in microbial classification led to a deceptive dichotomous division of all living organisms into prokaryotes and eukaryotes (Woese, 1987). The division was deceptive because the prokaryotic group was initially defined in only noncomparable negative terms; they were prokaryotes because they lacked features present in eukaryotic cells (nuclear membrane, mitochondria, etc.). All non-eukaryotic-like organisms were placed in a single phylogeneticaUy coherent taxon (Stanier, 1970) without regard for the possibility that members within this group may be as phylogeneticaUy distant from each other as they are from the eukaryotes. Although the definition of the prokaryote eventually expanded to include comparable molecular properties, this characterization was based essentially on one organism, Escherichia coli. whose properties were falsely assumed to represent all prokaryotes (Woese, 1991).

The onset of molecular biology provided a new set of "traits" for analysis and eventually brought an end to the prokaryote-eukaryote dichotomy dogma. It soon became realized that the most accurate and reliable method of inferring phylogenetic relationships was by macromolecular sequence comparisons (Zuckerkandl and Pauling, 1965; Fitch and

Margoliash, 1967). Although many methods have been used to compare nucleic acid and protein sequences from different organisms (Fox and Stackebrandt, 1987), the best method with current technology for assessing evolutionary relatedness among microorganisms is the comparison of ribosomal RNA (rRNA) sequences. The 16S (or

18S) rRNA molecules are excellent molecular chronometers; they are universal in distribution, constant in function, easily isolated, appear not to undergo genetic transfer between species, and being large molecules they contain a large amount of information.

In addition, certain rRNA sequence "domains" change so slowly over time that they permit the most ancient relationships among all organisms to be deciphered. Other rRNA domains change more rapidly over time which allows an accurate measurement of small phylogenetic distances.

The method initially employed to compare rRNA sequences is called oligonucleotide cataloguing (Uchida et al., 1974; Woese et al., 1976). With this method, purified 16S (or

18S) rRNA is completely digested with ribonuclease Tj, an endoribonuclease specific for guanisine residues. The resulting oligonucleotides are separated by two-dimensional paper electrophoresis and sequenced. The catalogue of sequences from a given organism is then compared with that from other organisms in a binary fashion to determine their degree of evolutionary relatedness (Fox et al., 1977a). The measure of relatedness between two organisms is provided by an association coefficient termed Sab - The 8 application of this method led to the archaebacterial concept and a meaningful system of bacterial phylogeny. A comparison of a large number of oligonucleotide catalogues revealed that methanogens were closely related to each other but widely separated from the rest of the prokaryotes and from the eukaryotes (Balch et al., 1977; Fox et al., 1977a).

Additional comparisons established that other organisms, extreme halophiles and sulfur- dependent thermophiles, were specifically related to the methanogen group but also only distantly related to other prokaryotes and eukaryotes (Magrum et al., 1978; Fox et al.,

1980). Based upon these findings, Woese and Fox (1977; Fox et al., 1980) proposed that this group of organisms, which they termed the archaebacteria, comprise a third primary kingdom, with the eukaryotes and eubacteria (true bacteria) representing the other two kingdoms.

The concept of the archaebacteria as a phylogeneticaUy distinct group was subsequently strengthened when the complete sequences of 16S or 18S rRNAs from various archaebacteria, eubacteria, and eukaryotes were determined. As presented in

Figure 1, there is an obvious distinction between the three kingdoms. In addition, two main divisions within the archaebacteria were revealed. The methanogens, extreme halophiles, and the sulfur-dependent thermophile genera Thermoplasma. Thermococcus.

Pvrococcus. and Archaeoglobus comprise one division; the remaining sulfur-dependent thermophiles comprise the other division. The evolutionary relatedness of the different archaebacteria is presented as a phylogenetic tree in Figure 2. To further emphasize that the archaebacteria and eubacteria, while both prokaryotes in the original "negative cytological" sense, are not necessarily related to one another, Woese et al. (1990) recently proposed a new formal system of organisms with new terminology. With this classification, aU organisms are placed at the highest level into three domains: the Archaea

(archaebacteria), the Bacteria (eubacteria), and the Eucarya (eukaryotes). Major lineages Figure 1. Unrooted phylogenetic tree constructed from comparisons of complete 16S or

18S rRNA sequences. The scale bar corresponds to 0.1 mutational events per

sequence position and provides an approximate measure of evolutionary time.

Taken from Woese and Olsen (1986).

9 10

ARCHAEBACTERIA Halobacterium volcanii Sulfoiobus solfataricus Methanospirillum hungatei Methanobacterium formicicum Tharmoproteus tanax Methanococcus vannieiii Thermococcus cater 0.1

% % t*cW° EUBACTERIA EUKARYOTES

Figure 1. Figure 2. Archaebacterial (Archael) phylogenetic tree constructed from comparisons of

complete 16S rRNA sequences. The root of the tree was established by the

use of bacterial sequences as an out group. Three main methanogen groups are

indicated by Roman numerals. Generic abbreviations: A., Archaeoglobus: D.,

Desulfurococcus: H., Haloferax: M., Methanobacterium: Me., Methanococeus:

Mp., Methanoplanus: Mt., Methanothermus: Mth., Methanothrix: P.,

Pvrodictium: S., Sulfolobus: T., Thermoplasma: Tc., Thermococcus: Tf.,

Thermofilum: and Tp., Thermoproteus. Taken from Woese (1991). — Me. jannaschii Mc. thermolithotrophicus

l Me. vannielii r -Me. voltae

-Mt. fervidus — M. thermoautotrophicum

M. formicicum

------M. arboriphilus

— Ms. hungatei —M p. lim icola . Msa. barken —Mth. soehngenii

■ H. volcanii

— T. acidophilum

■ A fulgidus

■Tc. cater

■ Tp. tenax — Tf. pendens P. occultum

S. solfataricus

— D. m obilis

Figure 2. 13 of each domain, for instance the two main divisions of the archaebacteria, are termed kingdoms.

The methanogens, extreme halophiles, and sulfur-dependent thermophiles represent the three basic phenotypes found within the archaebacteria. The methanogenic archaebacteria are obligate anaerobes commonly found in sediments, sludge digesters, guts of insects, large bowel of animals, and cattle rumen. All methanogens are also obligate methane producers as well; their sole source of energy comes from the reduction of carbon dioxide to methane or conversion of the methyl groups of acetate, methanol, or methylated amines to methane. Many coenzymes involved in methanogenesis appear to be unique to these organisms and have attracted much attention (Whitman, 1985).

Methanogens are found in both mesophilic and thermophilic environments. The most extreme thermophilic species, Methanopvrus. can grow at temperatures up to 110°C, the highest confirmed temperature at which any organism has been found to survive (Huber et al., 1989). Certain strains of the methanogen Methanohalophilus are extremely halophilic, requiring 1.7 to 4.3 M NaCl for growth (Lai et al., 1991). The halophilic archaebacteria are mesophilic organisms characterized by a requirement for high concentrations of sodium chloride (2 to 5.2 M). The intracellular salt concentration at least matches that found externally, although it is composed predominantly of K+ rather than Na+ cations

(Kushner, 1985). Members of the halophiles are the only archaebacteria capable of photosynthesis; they convert light to ATP by means of a proton pump based on bacteriorhodopsin or related retinal-containing proteins (Stoeckenius, 1985; Duschl et al.,

1990). Halophiles typically inhabit evaporation ponds and salt lakes such as the Dead

Sea. Some species, termed haloalkalophiles, have been isolated from extremely alkaline

African salt lakes where they are capable of surviving at up to pH 11.5 (Tindall et al.,

1984). Owing to their common presence in spoiled foods and hides preserved with salt, 14 the halophiles were the first of the archaebacteria to be studied systematically (Ingram,

1957).

The sulfur-dependent thermophiles are defined by their ability to grow at high temperatures and the involvement of sulfur in their energy metabolism. Some members of this group oxidize sulfur, some reduce it, and some are capable of both depending upon whether they are grown aerobically or anaerobically (Stetter and Zillig, 1985). These organisms not only have temperature optima ranging from 55 to 108°C, but most also require acidic environments; pH optima of between 1-3 is typical. Until isolates were recovered that were capable of growth at neutral pH values, this group was referred to as the thermoacidophiles. Sulfur-dependent thermophiles can often be found in acidic hot springs, volcanic areas, and deep sea hydrothermal vents.

Research on the biochemistry of the archaebacteria support their distinct phylogenetic position. Although many of their biochemical properties are eukaryotic- or eubacterial-like, a number of features are unique to this group. In contrast to the fatty acid ester-linked glycerol lipids predominating the cell membranes of eubacterial and eukaryotic cells, all archaebacterial cell membranes contain isopranyl glycerol ether lipids. The archaebacterial glycerolipids generally occur as glycerol diethers and diglycerol tetraethers.

The diethers are composed of two C 20 phytanyl chains ether-linked to glycerol, whereas tetraethers consist of two C 40 biphytanyl chains ether-linked to two opposite glycerol molecules (Langworthy, 1985). Diglycerol tetraethers are generally restricted to thermophilic archaebacteria. It is believed that the tetraether lipids stabilize the membranes at higher temperatures by forming covalently bonded lipid bilayers (i.e., monolayers) that span the cytoplasmic membrane (Sprott et al., 1991).

The lack of muramic acid and D-amino acids in archaebacterial cell walls easily distinguishes them from the peptidoglycan layers of eubacteria. At least four different basic cell wall types can be found among the archaebacteria (Kandler and Konig, 1985). 15 The most commonly found are the Type 1 cell walls present in gram-positive archaebacteria. Although in overall structure they resemble the gram-positive eubacterial cell wall, murein is replaced by either pseudomurein (Methanobacteriales), a nonsulfated

(Methanosarcinal or a sulfated (Halococcusl acidic heteropolysaccharide. Pseudomurien is a polymer of glucan and peptide subunits that includes N-acetyl-L-talosaminuronic acid, a compound which has not been found anywhere else in nature (Konig and Kandler,

1979; Kandler, 1988). Type 2 walls, found in the gram-positive Methanothermus fervidus. consist of pseudomurein covered by a crystalline surface layer (S layer) of glycoprotein subunits in a hexagonal array (Nuber et al., 1988). Typical gram-negative archaebacteria (includes members of each of the three basic phenotypes) exhibit a Type 3 cell wall. These walls consist solely of an S layer composed of protein or glycoprotein subunits in a hexagonal or tetragonal arrangement (Kandler and Konig, 1985). Type 4, found in Methanospirillum. is the most complex cell wall. The surface structure of this archaebacterium is an S-layer sheath composed of a series of proteinaceous hoops which are attached to one another to form a hollow cylinder in which chains of cells reside. Cells within the sheath are separated by "cell spacers" of unknown composition (Kandler and

Konig, 1985; Beveridge et al., 1990). Two archaebacterial genera, Thermoplasma and

Methanoplasma. lack any kind of cell wall, thus resembling the eubacterial mycoplasmas in this respect (Kandler and Konig, 1985).

Also unique to the archaebacteria are a number of modified nucleosides (nine identified to date) resulting from the posttranscriptional modification of tRNA. In addition to the unique tRNA modifications, a number of modifications are found in all three kingdoms, while others are characteristically eukaryotic or eubacterial (McCloskey, 1986;

Edmonds et al., 1991). Overall, however, it has been suggested that the modification of tRNA in archaebacteria is decidedly more eukaryotic than eubacterial in nature (Edmonds et al., 1991). Hyperthermophilic (growth temperatures above 70°C) archaebacteria are 16 also the only organisms from which a reverse gyrase activity (i.e., ATP-dependent positive supercoiling of DNA) has been found. The absence of this activity in mesophilic and moderately thermophilic archaebacteria suggests that, within this kingdom, it is a requirement for life at high temperatures (Bouthier de la Tour et al., 1990).

While DNA-dependent RNA polymerases (RNAPs) from all three kingdoms have a characteristic subunit pattern, those from the archaebacteria exhibit relatively large variations in subunit type (Gropp et al., 1986). The subunit structures and polypeptide sequences of archaebacterial RNAPs more closely resemble nuclear eukaryotic than eubacterial RNAPs (Huett et al., 1983). Unlike in eukaryotes, however, there is no evidence for more than one RNAP class in archaebacteria; a single RNAP appears to transcribe mRNA, rRNA and tRNA genes.

The archaebacteria share a number of properties with the eukaryotes. With the exclusion of introns discovered within bacteriophage protein genes (Chu et al., 1984;

Chu et al., 1987; Sjoberg et al., 1986; Goodrich-Blair et al., 1990) and in tRNA1^11 genes from various cyanobacteria (Xu et al., 1990; Kuhsel et al., 1990), introns have been found only in eukaryotic and archaebacterial genomes (discussed in detail below).

Histone-like proteins have been identified in several archaebacteria (Brown et al., 1981;

Shioda et al., 1989). The most thoroughly studied of these proteins, HTa from

Thermoplasma acidophilum and HMf from Methanothermus fervidus. have amino acid sequences similar to those of eukaryotic histones (Delange et al., 1981; Sandman et al.,

1990). In fact, the HMf histone is closer in sequence to four eukaryotic histones (H2A,

H2B, H3, and H4) than these four are to one another (Sandman et al., 1990). As in eukaryotes, the initiation of protein synthesis from mRNA appears to occur in archaebacteria with methionyl-tRNA rather than with N-formylmethionyl-tRNA as in eubacteria (Gupta, 1985). Archaebacteria also contain a protein synthesis elongation 17 factor (EF-2) that is ADP-ribosylated by diphtheria toxin, as are eukaryotic EF-2s, but not eubacterial elongation factors (Klink, 1985).

Many archaebacterial properties are characteristically eubacterial. Archaebacterial cellular organization and morphology are clearly prokaryotic-like. Also, the rRNAs found in archaebacterial ribosomes are similar to those found in eubacterial ribosomes. Both groups have 70S ribosomes containing one molecule of 5S, 16S, and 23S rRNA

(Matheson, 1985; Visentin et al., 1972). The similar sedimentation coefficients are misleading, however, as the 30S and 50S subunits from archaebacteria contain many unique features (Lake et al., 1982; Henderson et al., 1984). Like eubacterial 23S rRNAs, archaebacterial 23S rRNAs contain sequences at their 5' termini that are homologous to eukaryotic 5.8S rRNA sequences. In many cases, archaebacterial rRNAs are organized in operons similar to the eubacterial rRNA operons. Many polypeptide-encoding genes in archaebacteria are also organized in operons or operon-like structures (Brown et al.,

1989).

All archaebacteria posses a stable 7S RNA of approximately 300 nucleotides. A consensus structure for 7S RNAs of archaebacteria is very similar to that for 4.5 S RNAs of eubacteria and 7S RNAs of eukaryotes (Kaine, 1990; Haas et al., 1990; Struck et al.,

1988). At least one role of 4.5S RNA is an essential involvment in translation; the precise function is not yet known (Brown, 1987). The eukaryotic 7S RNA is a component of a ribonucleoprotein (signal recognition particle) that participates in protein secretion (Walter and Blobel, 1983). Brown (1991) has recently demonstrated that archaebacterial 7S

RNA, but not eukaryotic 7S RNA, is capable of complementing a deletion in the structural gene (ffs) for 4.5S RNA in E. coli. Although the function of 7S RNA in the archaebacteria is not known, this result suggests that, like in the eubacteria, it has a role in translation. 18 Gene structure and expression in the archaebacteria:

Archaebacterial genomes appear to be similar in size and structure to those of the eubacteria. The known approximate sizes for archaebacterial genomes range from 0.8 X

109 daltons for Thermoplasma acidophilum (Searcy and Doyle, 1980) to 2.3 X 109 daltons for Halobacterium halobium and Halococcus morrhuae (Moore and McCarthy,

1969). These values are comparable to the relatively large eubacterial genome of E. coti

(2.5 X 109 daltons; Moore and McCarthy, 1969). Both archaebacterial and eubacterial chromosomal DNAs are circular, whereas eukaryotes have linear chromosomal DNAs

(Yamagishi and Oshima, 1990). Also like eubacterial genomes, archaebacterial genomes exhibit a broad range of G+C contents; from 25.8% mole G+C in Methanosphaera stadtmaniae (Miller and Wolin, 1985) to 68% mole G+C in Halobacterium sodomense

(Jones et al., 1987). While direct correlations between high G+C content and high growth temperatures have been observed in eubacteria (Stenesh et al., 1968), this does not appear to be the case with archaebacteria. Instead, DNA in thermophilic archaebacteria appears to be protected from thermal denaturation by high internal salt concentrations and

"histone-like" DNA -binding proteins (Searcy, 1986; Stein and Searcy, 1978; Grote et al.,

1986; Imbert et al., 1990).

Although little is known about DNA modification systems in archaebacteria, it is clear that they are present in some cases (Juez et al., 1990; Lodwick et al., 1986; Patterson and Pauling, 1985). A halobacterial phage (N) with a fully cytosine-methylated genome has been described (Vogelsang-Wenke and Oesterhelt, 1988). As another example, Juez et al. (1990) have detected modifications in the genome of Haloferax mediterranei which appear to be related to changes in the salt concentration of the growth medium. These modifications were suggested to include the possible methylation of nucleosides within

PstI restriction enzyme recognition sequences (Juez et al., 1990). Distinct A+T-rich DNA fractions (satellite DNA) have been discovered in the

genomes of many methanogens and halophiles (Pfeifer, 1986; Bollschweiler et al., 1985;

Klein and Schnorr, 1984; Moore and McCarthy, 1969b). In methanogens, these A+T-

rich sequences are found in intergenic regions throughout the chromosome (Klein and

Schnorr, 1984; Bollschweiler et al., 1985). In halobacteria, the A+T-rich DNA is

associated with a large heterogeneous fraction of extrachromosomal circular DNA

(plasmid DNA and DNA probably derived from the chromosome) as well as several A+T-

rich islands within the chromosome (Pfeifer and Betlach, 1985; Pfeifer, 1986; Ebert et al.,

1986). The halobacterial A+T-rich regions contain a disproportionate number of insertion

sequences (ISs) (Pfeifer and Betlach, 1985; Sapienza and Doolittle, 1982), many of which

are also relatively A+T-rich (referenced in Ng et al., 1991). The Halobacterium halobium

NRC-1 genome alone contains about 50 different families of IS elements (Sapienza and

Doolittle, 1982; Sapienza et al., 1982). The presence of these IS elements are in large part

responsible for the characteristic high-frequency DNA rearrangements and phenotypic

variabilities observed in Halobacterium halobium (Sapienza et al., 1982; Ng et al., 1991).

Archaebacterial IS elements are similar in size to eubacterial IS elements, ranging from

520 to 1895 bp in length (Brown et al., 1989). Most are also similar in structure, containing terminal inverted repeats (8 to 29 bp) and resulting in duplication of the target

DNA sequence upon transposition (Brown et al., 1989). An exception is the IS element

ISH1.8, present in two copies on an H. halobium phage

(Schnabel et al., 1984). The copies of ISH1.8 are in an inverted orientation relative to each other and are capable of mediating either the inversion or excision of the intervening sequence (Schnabel, 1984). Excision of the sequence (L-region) between the flanking

ISH1.8 elements creates the 12 kb plasmid pL(|)H, which confers immunity to phage (j)H 20 infection (Schnabel, 1984). Similar IS element-induced DNA inversions and excisions are known to occur in the eubacteria (Plasterk et al., 1984).

Gene organization in the archaebacteria most closely resembles that found in the eubacteria. Many protein-, rRNA-, and tRNA-encoding genes are organized in operons or operon-like structures. Genes for various ribosomal proteins from H. cutirubrum

(Shimmin et al., 1989), H. marismortui (Arndt and Weigel, 1990; Bergmann and Arndt,

1990), M- vanielii (Baier et al., 1990), and S. solfataricus (Shimmin et al., 1989) are present in operon structures. It is interesting that while these genes are in a eubacterial- like arrangement, the gene products appear to be much more closely related to the corresponding eukaryotic ribosomal proteins (Ramirez et al., 1989). A similar situation exists for archaebacterial RNA polymerase genes. While the RNA polymerases have subunit structures and polypeptide sequences more similar to their eukaryotic counterparts, the structural genes encoding the largest subunits of the polymerase are in operons homologous to those of eubacteria (Zillig et al., 1989). The well-characterized genes encoding the multisubunit enzyme methyl coenzyme M reductase from the methanogens M. thermoautotrophicum strain Marburg, M- voltae. M- vanielii. M- fervidus. and M- barkeri are also organized in operons (reviewed in Brown et al., 1989).

Other polypeptide-encoding genes organized in operon-like structures include the formate dehydrogenase-encoding genes of Methanobacterium formicicum (Shuber et al., 1986), tryptophan-biosynthetic genes from H. volcanii. M- voltae, and M- thermoautotrophicum

Marburg (Lam et al., 1990; Sibold and Henriquet, 1988; Meile et al., 1991), the VP1,

VP2, and VP3 coat and core protein-encoding genes of the Sulfolobus virus-like particle

SSV1 (discussed above), and genes for subunits of the ATPase complex from S. acidocaldarius (Denda et al., 1990).

In most cases, archaebacterial rRNAs are also organized in operons (reviewed in

Brown et al., 1989). The rRNA operons of the halophiles and methanogens most closely resemble typical eubacterial rRNA operons. These archaebacteria contain one to four rRNA transcriptional units per genome, each with closely linked 16S, 23S, and 5S rRNA genes with a tRNA gene present within the 16S-23S intergenic space and often another immediately downstream of the 5S gene. In the extremely thermophilic methanogen

Methanothermus fervidus. genes encoding the 7S RNA and tRNASer are present immediately upstream of the 16S gene in one of the two rRNA operons of this organism.

The lack of promoter-like sequences between these genes suggests they might be cotranscribed with the rRNAs. Such an association has not been previously demonstrated

(Haas et al., 1990). M- vanielii and M- voltae each contain a 5S rRNA gene that is not linked to their 16S-23S-5S operons, rather they are located within transcriptional units encoding tRNA genes (Wich et al., 1984; Wich et al., 1986a). In the sulfur-dependent thermophiles, one copy of each rRNA gene is present per genome and the 5S gene is not linked to the 16S-23S genes; tRNA genes are also not found in the 16S-23S intergenic space. The sulfur-"dependent" thermophile Thermoplasma acidophilum is unique in that it is the only known prokaryotic organism in which the 16S, 23S, and 5S rRNAs are all expressed from separate transcription units (Ree and Zimmermann, 1990). Thermus thermophilus and Pirellula marina are the only known eubacteria without 16S-23S-5S rRNA gene operons. In contrast to the sulfur-dependent thermophiles, the 16S rRNA genes from these organisms are transcriptionally separated from the linked 23S-5S rRNA genes (Hartmann et al., 1991; Liesack and Stackebrandt, 1989).

Archaebacterial tRNA genes are organized in gene clusters, in individual transcriptional units, and in multigene transcriptional units (reviewed in Brown et al.

1989). Of the over 60 published archaebacterial tRNA sequences, 41 are from H. volcanii

(Sprinzl et al., 1989). The genome organization of seven of these H. volcanii tRNA genes has been determined: a tRNAcys gene is located in one of the two rRNA operons while a tRNA A13 gene is present in both operons. Two identical tRNAVal genes are 22 closely linked, and the tRNAiMet, tRNASer, tRNALys, and tRNATrP genes appear to form single gene transcriptional units (Daniels et al., 1986). A tRNA A13 gene is also present in both rRNA operons of M- fervidus. and one of these operons contains a tRNASer gene.

M- vannielii contains the largest identified tRNA operon with seven tRNA genes and a single 5S rRNA gene (Wich et al., 1984; Wich et al., 1986b). A second tRNA operon in

ML vannielii contains five tRNA genes. The seven remaining sequenced tRNA genes from M- vannielii are either within the rRNA operon or in monocistronic or dicistronic transcriptional units (Brown et al., 1989). Six tRNA-encoding genes from S. solfataricus and five from T. ten ax have been sequenced; these all form transcriptional units containing only one or two tRNA genes (Kaine et al., 1983; Kaine, 1987; Wich et al., 1987).

The characterization of archaebacterial promoters by comparative sequence analysis, transcript mapping, and RNA polymerase footprinting led to the proposal that all archaebacterial promoters are related and composed of two conserved sequence elements; box A (consensus TTTAa /tATA) centered about 25 nucleotides upstream of the transcription start site, and box B (consensus a / tTG a /c ) containing the transcription start site (Brown et al., 1989; Brown et al., 1988; Gropp et al., 1989; Thomm et al., 1988;

Thomm and Wich, 1988; Thomm et al., 1989). This promoter structure is unlike that of eubacterial promoters which consist of two defined sequence elements centered at about

35 and 10 nucleotides upstream of the transcription start site (McClure, 1985).

Archaebacterial promoters do, however, resemble eukaryotic RNA polymerase II promoters (Wasylyk, 1988) and the TATA box-containing RNA polymerase IQ promoters

(Sollner-Webb, 1988). This similarity in promoter structure is paralleled by similarities between archaebacterial and eukaryotic RNA polymerases (Zillig et al., 1989; Puhler et al., 1989). The initial promoter structure proposal was strengthened with functional data coming from recently developed in vitro transcription systems. Frey et al. (1990) have demonstrated that cell free extracts of M- vannielii faithfully initiate and terminate in vitro 23 transcription of M* vannielii tRNAVal and tRNA^S genes that contain only 13 and 17 nucleotides of sequence, respectively, upstream of the putative box A sequences. Further purification of the RNA polymerase by phosphocellulose chromotography yielded an enzyme that lost its ability to transcribe the tRNAVal gene accurately. The enzyme activity directing accurate expression of this template was reconstituted by the addition of a protein fraction devoid of RNA polymerase, indicating a requirement for a transcription factor.

Knaub and Klein (1990) have demonstrated specific in vitro transcription from the methyl coenzyme M reductase gene promoter of M- thermoautotrophicum with homologous RNA polymerase. As with M. vannielii. specific transcription initiation was not obtained with highly purified RNA polymerase preparations, suggesting that loosely associated initiation factors are required. A deletion analysis of the promoter region showed that the removal of the 5' half of the box A sequence results in a drastic reduction of specific transcription.

Since minor amounts of specific transcripts were still obtained, the box A sequence is apparently not completly indispensable. Removal of regularly spaced oligo-dA sequences upstream of the box A sequence results in a twofold reduction in transcription, indicating a role for these sequences in transcription initiation.

A cell-free extract from Sulfolobus sp. B12 specifically initiates transcription of the

5S rRNA and 16S-23S rRNA genes at the known in vivo start sites (Hudepohl et al.,

1990). Specific transcription initiation was absolutely dependent on the box A promoter element. As observed with the methanogenic RNA polymerases, initiation of transcription by purified Sulfolobus RNA polymerase was only semi-specific and box A-independent.

A low molecular weight sucrose gradient fraction of the extract was found to complement the purified RNA polymerase to whole extract-like specificity. The above in vitro transcription studies all indicate that factor(s) which are only loosely associated with the

RNA polymerase are required for the highly specific box A-dependent transcription. The

Sulfolobus in vitro transcription assay was subsequently used in a detailed analysis of the Sulfolobus 16S-23S rRNA-encoding DNA promoter (Reiter et al., 1990). A dissection of the promoter by deletion and linker substitution mutagenesis revealed that a core promoter region between positions -38 and -2 contains all the information neccesary for specific and efficient transcription. Two sequence elements were found to be important for promoter function; a distal promoter element (between positions -38 and -25) encompassing the box A sequence, and a proximal promoter element (between -11 and -2) that includes and extends the previously designated box B element. All mutations within the box A sequence virtually eliminated promoter function, whereas mutations within the proximal promoter sequence had little effect on transcription efficiency but did alter initiation site selection. Insertions or deletions between the distal and proximal promoter elements also did not have a large effect on transcription efficiency but resulted in shifts in the major initiation site, retaining an essentially fixed distance between the distal promoter element and the transcription start site.

Archaebacterial transcription termination sites have yet to be analyzed in detail, though a few common motifs have been identified. Many polypeptide-encoding and some stable RNA-encoding gene transcripts terminate within a stretch of T residues following a potential stem-loop structure; a structure similar to the rho-independent termination sites in

E. coM (Knaub and Klein, 1990; Cram et al., 1987; Mankin and Kagramanova, 1986;

Brown et al., 1989). Transcription termination downstream of the M- vannielii tRNAVal, tRNA^S, and 5S rRNA genes occurs at the beginning of a sequence, TTTTAATTTT, that resembles sequences at which RNA polymerase HI terminates transcription downstream of tRNA and 5S rRNA genes in eukaryotes (Frey et al., 1990; Wich et al., 1986b, Wich et al., 1986c; Cozzarelli et al., 1983). Pyrimidine-rich regions containing CTCCT or

CTCCCT sequences have been determined to be sites of transcription termination downstream of the rRNA operons of Desulfurococcus mobilis and T. tenax. and one of the two rRNA operons of M- thermoautotrophicum (Kjems and Garrett, 1987; Kjems et 25 al., 1987; Ostergaard et al., 1987). Putative terminator sequences downstream of ribosomal protein genes in H. marismortui and H. cutirubrum consist of G+C-rich sequences followed by a stretch of T residues (Bergmann and Arndt, 1990; Shimmin et al., 1989); such a structure is common to rho-dependent eubacterial transcription terminators (Alifano et al., 1991).

Archaebacterial plasmids and viruses:

Plasmid DNAs have been identified in all phylogenetic branches of the archaebacteria (Brown et al., 1989). The halobacteria contain the largest population of plasmids. H. halobium strain NRC-l harbors a 200 kb multicopy plasmid, named pNRClOO, and several minor plasmids related to pNRClOO (Weidinger et al., 1979; Ng et al., 1991). pNRClOO contains a cluster of genes for gas vacuole formation and is a resevoir for at least 17 IS elements (Ng et al., 1991). Ng et al. (1991) identified a large

(35 to 38 kb) inverted repeat (IR) sequence within pNRClOO which allows frequent inversion of the intervening single-copy regions to yield inversion isomers of the plasmid.

Large IRs resulting in inversion isomers have also been identified in chloroplast and mitochondrial genomes (Palmer, 1983; Shaw et al., 1989), but not in eubacterial plasmids. A related strain of H. halobium harbors the plasmid pHHl which also contains gas vacuole genes and a large number of IS elements, but appears to lack the large IRs

(Home and Pfeifer, 1989; Pfeifer and Blaseio, 1989). Integration of pHHl into the chromosome has been detected (Pfeifer et al., 1981). Several small plasmids from

Haloferax volcanii and related species have been characterized. pHV2, a 6,354 bp plasmid from H. volcanii DS2, has been sequenced and found to contain four large open reading frames (Charlebois et al., 1987). H. volcanii strains WR11, WR12, and WR13 each carry a different plasmid; pHVl 1 (3 kb), pHV12 (5 kb), and pHV13 (44 kb), respectively (Rosenshine and Mevarech, 1989). These four H. volcanii plasmids do not share homologous sequences and only pHV12 contains sequences, possibly IS element(s), that are homologous to chromosomal sequences (Charlebois et al., 1987;

Rosenshine and Mevarech, 1989). Haloferax strain Aa 2.2 contains a 10.5 kb plasmid, pHK2 (Holmes and Dyall-Smith, 1990). Both pHV2 and pHK2, which have compatible replicons, have been used in the construction of cloning vectors for introduction into

Haloferax spp. (Lam and Doolittle, 1989; Holmes et al., 1991). Plasmid pSB12, from the sulfur-dependent thermophile Sulfolobus solfataricus B12, exists either as an extrachromosomal element or integrated into the chromosome. U. V. irradiation results in amplification of the extrachromosomal form and its packaging into lemon-shaped particles that are released into the medium, suggesting that amplification results from induction of a prophage. Genes for the virus-like capsid proteins VP1, VP2, and VP3 reside on pSB12

(Martin etal., 1984).

Desulfurococcus ambivalens (=Sulfolobus ambivalensl. a sulfur-dependent thermophile capable of both aerobic and anaerobic chemolithotrophic growth, harbors a plasmid (pSLlO) which is amplified during anaerobic growth (Zillig et al., 1985). Like pSB12, pSLlO and a plasmid from the methanogen Methanolobus vulcani (pMPl) are most likely prophages (Brown et al., 1989). Plasmids have also been identified in the methanogens Methanococcus jannaschi (and related Methanococcus isolates) and

Methanobacterium thermoautotrophicum strains Marburg and AH (Meile et al., 1987;

Wood et al., 1985; Zhao et al., 1988). Shuttle vectors derived from a 4.5 kb plasmid

(pME2001) from M- thermoautotrophicum strain Marburg have been constructed to replicate in E. coh, Bacillus subtilis. Staphylococcus aureus and Saccharomvces cerivisiae

(Meile and Reeve, 1985).

Several viruses and virus-like particles (VLPs) have been identified in the archaebacteria. The most thoroughly studied is the temperate halophage H of H. halobium (Schnabel and Zillig, 1984; Schnabel et al., 1982; Schnabel et al., 1984; Zillig et 27 al., 1986). The structure of halophage

P22 (Zillig et al., 1986). The <|>H prophage exists as a plasmid (p<|>HL), as described earlier. As with bacteriophage gene expression, distinct early, middle, and late transcripts have been identified during lytic growth of <|>H (Zillig et al., 1986). Ken and Hackett

(1991) have identified and characterized a DNA binding protein encoded by <(>H lysogens that potentially prevents expression of the <}>H genes necessary for lytic development. This putative <}>H repressor is a homolog of coliphage repressors. The fully cytosine- methylated genome of halophage <|)N from H. halobium is also terminally redundant and circularly permuted (Vogelsang-Wenke and Oesterhelt, 1988).

The VLP SSV1 from Sulfolobus solfataricus B12 exists as a lemon-shaped particle with a short tail. While the particle does not adsorb to normal cell envelopes (hence its designation as a vims-like, non-infective, particle), it does adsorb to unknown structures which appear to be derived from cells (Zillig et al., 1986). The 15 kb genome from SSV1 is maintained either as cccDNA (pSB12) or site-specifically integrated in the chromosome

(Martin et al., 1984). The entire SSV1 genome has been sequenced and transcripts encoding the viral capsid and core proteins VP1, VP2, and VP3 have been identified in

U.V.-induced cells (Zillig et al., 1986).

Four different temperate viruses of the sulfur-dependent thermophile Thermoproteus ten ax have been described (Janekovic et al., 1983; Zillig et al., 1986). The viruses TTVT,

TTV2, TTV3, and TTV4 are all rod-shaped with an outer membrane and an inner envelope. The outer membrane consists of a lipid bilayer derived from the host cell membrane. The inner envelope is composed of two proteins which form a hollow filament with an apparently helical structure. Within the inner envelope is a core 28 consisting of the linear double-stranded DNA strongly bound to basic proteins. The

genomes from this family of viruses vary in length, being 16 kb for TTV1 and TTV2, 17

kb for TTV4, and 27 kb for TTV3, and are not similar enough in sequence to hybridize to

each other.

Genetic exchange systems in the archaebacteria:

Most of the progress in archaebacterial genetic exchange has been made with the

halophiles, in particular members of the genus Haloferax. This is predominantly because,

among the archaebacteria, these organisms are the easiest to grow and manipulate in the

laboratory and auxotrophic mutants are readily attainable. In addition, Haloferax volcanii

has a natural genetic transfer system by which chromosomal DNA can be transferred from

donor to recipient cells by a cell contact-dependent mechanism (Mevarech and

Werczberger, 1985; Rosenshine et al., 1989). Each parental type can serve equally as

donor or recipient. Cell contact is thought to induce differentiation of the unicellular cells

into a network of cells connected by intercellular cytoplasmic bridges. It appears that

chromosomal DNA is transferred from one cell to another via these bridges; the transfer of

plasmid DNA was not detected. This system, of course, does not provide a means of

introducing exogenous DNA into the cells.

For bacterial species in which no natural system of transformation is known, the

formation of spheroplasts susceptible to the uptake of DNA, followed by cell wall

regeneration, has often been useful for obtaining transformants and transfectants

(Hopwood, 1981). The gentle wall removal from bacteria to obtain viable protoplasts or

spheroplasts traditionally involves the hydrolysis of peptidoglycan with specific enzymes,

such as lysozyme or lysostaphin. However, since archaebacterial cell walls lack the

typical eubacterial murein structure, these established procedures are ineffective for producing archaebacterial spheroplasts. Fortunantly, It has long been known that rod­ 29 shaped extreme halophiles form unstable spherical bodies (spheroplasts) when exposed to a decrease in external salt concentration (Mohr and Larsen, 1963; Stoeckenius and

Rowen, 1967), and Halobacterium and Haloferax species form unstable spheres when grown in the presence of the antibiotic bacitracin (Mescher and Strominger, 1975). Jarell and Sprott (1984) were the first to demonstrate that halobacterial spheroplasts can be regenerated to walled cells. They formed spheroplasts of Halobacterium cutirubrum by suspending cell pellets in a low salt buffer. About 35% of the spheroplasts regenerated into rod-shaped bacteria when plated on a complex growth medium supplemented with

15% (w/v) sucrose and 4% (w/v) bovine serum albumin. These conditions for spheroplast formation and regeneration in H. cutirubrum were also effective for

Halobacterium salinarium but not for H. halobium.

Cline and Doolittle (1987) subsequently developed a more efficient means of preparing and regenerating H. halobium and H. volcanii spheroplasts, and demonstrated the uptake and expression of exogenous DNA for the first time in an archaebacterium.

Since scoreable genetic markers for use in detecting transformation events were not available for the archaebacteria at this time, they relied on a plaque assay to score for successful transfection of phage DNA. This plaque assay was used to determine optimal conditions for uptake of DNA by H. halobium. The high transfection frequencies obtained with this approach (2.5 X 107 transfectants/pg DNA) led these investigators to successful attempts at transforming the halophiles with plasmid and chromosomal DNA.

Charlebois et al. (1987) characterized the endogenous plasmid pHV2 from H. volcanii

DS2. The entire nucleotide sequence of this 6,354 bp plasmid was determined. For use as a recipient for this plasmid in transformation experiments, H. volcanii DS2 was cured of pHV2 by treatment of liquid cultures with ethidium bromide to yield H. volcanii

WFD11. They then demonstrated the efficient PEG-mediated transformation of this strain with intact pHV2 and with a form of pHV2 (pHV2A93) marked by a 93 bp deletion 30 generated in vitro. Consistent with the transfection results, the transformation

experiments yielded about 1 X 107 transformants per (Xg of plasmid DNA. pHV2 would

subsequently serve as the basis for H. volcanii-E. coli shuttle vectors. This plasmid was

not capable of replication in H. halobium.

Plasmid transformation of H. halobium was first demonstrated by Hackett and

DasSarma (1989). Using an approach similar to Charlebois et al. (1987), they

characterized the endogenous high copy number Halobacterium plasmid pHSB 1. The

complete 1,736 bp sequence of pHSBl was determined. After transformation of H.

halobium SD111 (lacks pHSBl) with pHSBl, transformants were identified among the

regenerated spheroplasts by colony hybridization using 32P-labeled pHSBl DNA as the

probe. They reported a transformation efficiency of 1 transformant per 100 regenerated

spheroplasts. This study was the first step towards a useful plasmid transformation

system for H. halobium.

A more detailed description of the techniques involved in the transformation of H.

halobium and H. volcanii was provided by Cline et al. (1989). They further demonstrated the usefulness of this procedure by showing that H. volcanii auxotrophs can be efficiently transformed to prototrophy with high molecular weight chromosomal DNA isolated from wild-type cells. In these experiments, 2-5 X 104 transformants were obtained per |xg of

70 kb size-fractionated DNA, with a frequency of 2-5 X 10’5 per spheroplast (extrapolated to 1 |Xg of DNA). Since a 70 kb fragment represents roughly 2% of the estimated H. volcanii genome size, they argue that the transformation efficiency of a pure species of 70 kb fragment would be about 50 times greater than the efficiency of random fragments, or about 2 X 106 transformants per [Xg of DNA. This efficiency compares well with that obtained for transfection with phage DNA or transformation with plasmid DNA. This indicates that genetic recombination in H. volcanii is fairly efficient (Cline et al., 1989).

Transformation success was sensitive to DNA fragment size. Above 12 kb, 31 transformation efficiency was proportional to increasing fragment size up to 70 kb (the largest size fraction tested). Background reversion frequencies were observed with size fractions below 12 kb.

The further development of plasmid-based genetic exchange systems for the halophiles was hindered by the lack of suitable selectable markers. As a group, the archaebacteria are resistant to most common antibiotics (Bonelo et al., 1984; Bock and

Kandler, 1985; Cammarano et al., 1985). Progress in this area came with the recent isolation of halobacterial strains which are resistant to mevinolin (Lam and Doolittle,

1989), a 3-hydroxy-3-methylglutaryl coenzyme A (HMGCoA) reductase inhibitor, and to novobiocin (Holmes and Dyall-Smith, 1990), a DNA gyrase inhibitor. As described below, the isolation of the genes conferring resistance to these antibiotics led to the development of plasmids with selectable markers for introduction into the halophiles.

In 1986, Cabrera et al. reported that mevinolin [ 1,2,6,7,8,8a-hexahydro-(3-8- dihydroxy-2,6-dimethyl-8-(2-methyl-1 -oxobutoxy)-l -naphthalene-heptanoic acid 5- lactone], an inhibitor of eukaryotic HMGCoA reductases, also strongly inhibits this enzyme in halobacteria. Lam and Doolittle (1989) found that growth of H. volcanii

WFD11 was completely inhibited at mevinolin concentrations of 1-2 |iM and 20-40 (iM on plates of minimal and rich agar, respectively. Spontaneously resistant mutant colonies appeared on such plates at a frequency of about 1 in 109 cells plated. Chromosomal DNA isolated from spontaneous mevinolin resistant mutants transformed H. volcanii WFD11 to mevinolin-resistance at a high frequency (1 X 10-6), suggesting that a single genetic locus was responsible for conferring resistance.

Towards the development of H. volcanii-E. coli shuttle vectors, partially Mlul- digested DNA isolated from a mevinolin resistant mutant was shotgun-cloned into a derivative (pHV51) of the endogenous H. volcanii plasmid pHV2. Following transformation of H. volcanii WFD11 with the ligated DNA preparation, transformants 32 resistant to mevinolin were isolated then screened for the presence of pHV2-related sequences. All pHV2-containing transformants carried plasmids with a common 7.9 kb

Mlul fragment. Plasmid DNA isolated from these transformants could transform H. volcanii WFD11 to mevinolin resistance at a high frequency (5-10 X 107/|ig DNA). To add an E. c q U replicon, one of the mevinolin-resistance conferring plasmids was ligated into the Hindlll site of the pBR322 derivative pAT153. pAT153 contains ampicillin- and teracycline-resistance determinants; however, cloning into the Hindlll site of this vector disrupted the tetracycline-resistance determinant. The resulting construct, pH455, was shown to successfully transform H. volcanii WFD11 and E. coh DH5a to mevinolin- and ampicillin-resistance, respectively, demonstrating its utility as a shuttle vector. To reduce the size and complexity of pH455, the 7.9 kb Mlul fragment containing the mevinolin resistance determinant was reduced to 3.5 kb, and portions of the pHV51 and pAT153 sequences were removed. Lam and Doolittle (personal communication) later sequenced the mevinolin resistance determinant and found that it was the HMGCoA reductase gene which, by virtue of an up-promoter mutation, overexpresses this protein. A resulting

10.5 kb vector, pWL102, was found to be an efficient vector for shuttling between E. coh and H. volcanii. pWL102 contains several unique restriction sites for the cloning of DNA without disrupting plasmid replication or the antibiotic resistance determinants. This vector was the starting material in the construction of the H. volcanii expression vector described in this dissertation (Nieuwlandt and Daniels, 1990).

Blaseio and Pfeifer (1990) also made use of the H. volcanii mevinolin-resistance determinant in the development of H. halobium-E. coli shutde vectors. To construct these vectors, they first cloned the 3.5 kb fragment containing the mutant HMGCoA reductase gene into the E. coh ampicillin-resistance conferring plasmid pIBI. Restriction fragments containing the replicon regions from the H. halobium plasmids p<|)HL and pHHl were then cloned into this vector. Resulting constructs included a vector (pUBPl, 17 kb) 33 containing a Clal fragment from p<|>HL, and three vectors containing pHHl-derived

fragments (pUBP2, 12.3 kb; pUBP4,15.4 kb; and pUBP8, 12.9 kb). H. halobium P

which lacks pHHl-type plasmids, was transformed with each vector; all yielded lOMO^ transformants per jug of DNA. Without selective pressure, about 30% of the transformants tested had lost the construct together with mevinolin resistance. The H. volcanii-E. coli shuttle vector pWL102 was also capable of transforming H. halobium P

All pUBP vectors mentioned above, propagated in E. coH DH5a, were also transformed into H. volcanii WFD11; in each case, they obtained resistant colonies with high efficiency. However, hybridization experiments indicated that greater than 90% of the mevinolin-resistant transformants had lost the E. coh and H. halobium portions of each vector. This phenomenon was subsequently shown to be the result of a restriction system in H. volcanii that recognizes and degrades DNA that is methylated at adenine residues (see below; Holmes and Dyall-Smith, 1991). As the first application of these shuttle vectors, the smallest H. halobium vector, pUBP2, and the H. volcanii vector pWL102 were successfully used to study the expression of Halobacterium and Haloferax gas vesicle-encoding genes ('vac') in H. halobium and H. volcanii (Blaseio and Pfeifer,

1990).

A second selectable marker for halophilic archaebacteria, a gene conferring resistance to novobiocin, was recently isolated from Haloferax strain Aa 2.2 by Holmes and Dyall-Smith (1990). Novobiocin is a potent inhibitor of cell growth and DNA synthesis in halobacteria (Sioud et al., 1988). The MIC of novobiocin for Haloferax strain Aa 2.2 was found to be 0.005 (ig/ml. Holmes and Dyall-Smith (1990) isolated a

Haloferax strain Aa 2.2 mutant with an MIC of novobiocin of 7 jig/ml. To develop a plasmid vector utilizing this resistance determinant as a selectable marker, they shotgun cloned chromosomal DNA isolated from the mutant into pHK2, a 10.5 kb cryptic plasmid 34 endogenous to this strain. Using the transformation procedure previously described for

H. volcanii. Haloferax strain Aa 2.2 was transformed with the ligation mixture with

selection for novobiocin resistance. The recombinant plasmid DNA isolated from a

novobiocin-resistant transformant was shown to transform Haloferax strain Aa 2.2 cells

with a very high efficiency (lOMO7 transformants/|!g DNA) and to be stably maintained

without selective pressure.

An analysis of the pHK2 novobiocin resistance plasmid indicated that pHK2 had

remained unchanged except for the insertion of a 6.7 kb Kpnl fragment derived from

chromosomal DNA of the mutant. The gene responsible for novobiocin resistance was

subsequendy located on this fragment and sequenced (Holmes and Dyall-Smith, 1991).

An open reading frame was identified that encodes a 640 a.a. protein with high homology

to the DNA gyrase B subunit (GyrB) of eubacteria. An open reading frame encoding the

DNA gyrase A subunit (GyrA) was found immediately downstream of gvrB. The GyrB

subunit is known to be the target of novobiocin in eubacteria (Sugino et al., 1978). By

comparison with the wild-type gvrB gene, three mutations were identified in the gvrB

gene of the resistant mutant.

To determine whether the pHK2 novobiocin resistance plasmid could function in other halobacteria, it was transformed into H. volcanii and H. halobium. H. volcanii

NCMB2012 was found to be transformed at the same efficiency as Haloferax strain Aa

2.2. In addition, both endogenous plasmids of this H. volcanii strain, pHVI and pHV2, were retained in the transformants, indicating that pHK2 and these plasmids carry compatible replicons. No transformants were recovered from transformation experiments with three H. halobium strains (RI, NCMB777, and DSM617). Since H. halobium strains RI and DSM617 are believed to lack restriction systems (Holmes and Dyall-Smith,

1990), they suggest that the pHK2 replicon may not function in H. halobium strain Aa

2 .2 . 35 Shortly after their initial description of the pHK2 novobiocin resistance plasmid, now designated pMDS2, Holmes and Dyall-Smith (1991) reported the development of halobacterial-E. coli shuttle vectors based on pMDS2 and the E. coh plasmid pBS(+). A

20.4 kb shuttle vector, pMDSl, was constructed by incorporating pBS(+), linearized with

Kpnl. into partially KpnI-digested pMDS2. To reduce the size of pMDSl, and to provide more unique restriction sites, nonessential portions of the pHK2 region and of the fragment containing the gvrB-gvrA genes were deleted. Two resulting constructs, pMDSlO (12.7 kb) and pMDSl 1 (9.5 kb), as well as pMDSl, were all shown to efficiently transform and to be stably maintained in both H. volcanii and E. coli.

As observed earlier by Blaseio and Pfeifer (1990), the E. coli-propagated shuttle vectors appeared to be restricted when transformed into H. volcanii cells. Holmes and

Dyall-Smith (1991) found that this restriction barrier operates via the recognition and degradation of DNA which is methylated at adenine residues, resulting in a 1000-fold drop in transformation efficiency and the loss of most vectors by incorporation of the resistance determinant into the chromosome. They suggest that propagating plasmids in

E. coh dam- strains such as JM110, which do not methylate adenine residues, should improve the utility of shuttle vectors by avoiding the H. volcanii restriction barrier.

While genetic exchange systems for the halophiles were successfully developed over a short period of time, the development of such systems for the methanogens has lagged behind; they are still non-existant for the sulfur-dependent thermophiles. Progress with the methanogens has been slowed by the difficulties in working with these strict anaerobes. Significant advances have been made however, and these are discussed below.

Evidence has been found for natural transformation systems in the methanogens

Meth an bacterium thermoautotrophicum Marburg (Worrell et al., 1988) and

Methanococcus voltae PS (Bertani and Baresi, 1987). Worrel et al. (1988) demonstrated that DNA isolated from a 5-Fluorouracil (FU)-resistant strain of M- thermoautotrophicum

(Nagle et al., 1987) is capable of transforming the wild-type strain to FU resistance.

Transformations were performed by placing DNA samples at the center of non-selective

mineral medium plates solidified with 0.8% gellan gum (GELRITE). An inocula

containing 100-200 cfu of M- thermoautotrophicum was then spread over the DNA-

containing region. Following incubation at 60°C for 2-4 days, the resulting colonies were

replica plated to the same media supplemented with FU (100 |ig/ml). When using 2 ng of

high molecular weight DNA, FU-resistant cells were found in 1.1% of the colonies.

When wild-type (FU-sensitive) strain Marburg was the source of DNA, only 0.13% of

the colonies contained FU-resistant cells. Interestingly, they noted that transformants

were almost always at the edges of the colonies, indicating that transformation rarely, if

ever, occurred during the early development of the colony. Attempts to transform M-

thermoautotrophicum on media solidified with Noble agar or in liquid media under a

variety of conditions were unsuccessfull. They postulated that the structure of the gellan

gum matrix may be involved in the transformation, perhaps by influencing the

conformation of the DNA or the cell wall to enhance competence.

Bertani and Baresi (1987) demonstrated that Methanococcus voltae strain PS is also

naturally susceptible to transformation. As sources of DNA containing genetic markers,

mutations resulting in requirements for histidine, purine, and vitamin B 12 were obtained in

this strain by UV- or gamma ray-irradiation. Transformations were performed by directly

adding chromosomal DNA isolated from wild-type M- voltae PS to 1-ml culture samples

(normal growth conditions) of each auxotrophic strain. Following an incubation period to

allow for expression of the transforming DNA, samples of the transformation suspension

were plated in selective agar medium. Colonies appeared in 7-14 days at 30°C. In all experiments using wild-type M- voltae DNA, the frequency of recovered prototrophs

(averaged 1.2 X 10'6) was significantly above the spontaneous reversion rate. They 37 obtained between 2 and 100 transformants per |ig of DNA in a series of transformation experiments. Based on the estimated genome size for M- voltae (1.8 X 109 Da; Klein and

Schnonr, 1984), this corresponds to between 6 X 10"9 and 3 X 10‘7 transformants per gene.

In a study aimed at identifying antibiotic resistance markers for the methanogens,

Possot et al. (1988) showed that puromycin and fuscidic acid inhibit growth of M- voltae at low concentrations. Both antibiotics were also shown to inhibit in vitro protein synthesis. Gemhardt et al. (1990) took advantage of this finding in the development of an integration vector for use in M- voltae. The vector is based on the E. cob plasmid pUCl 8 and carries an expression cassette comprising the Streptomvces alboniger puromycin transacetylase gene (pad flanked by the promoter, ribosome binding site, and terminator sequences from the M- voltae methyl coenzyme M (CoM) reductase (mcr) transcription unit (Klein et al., 1988). In addition, the expression cassette is surrounded by M- voltae hisA gene sequences. The expression cassette was cloned into the vector in both orientations, yielding two different 7.4 kb integration vectors (Mipl and Mip2). The pUC18 replicon permits the propagation of the vectors in E. coh. In S. alboniger. the pac gene product inactivates puromycin by acetylation. The placing of this gene under the transcriptional control of the mcr promoter, ribosome binding site, and terminator was expected to ensure that the foreign gene was expressed in M- voltae. Because plasmid replicons which function in M. voltae have yet to be found, a means of integrating the vector into the M- voltae chromosome was needed so that it would be stably maintained.

The hisA gene sequences were expected to mediate the integration of the vector into the chromosome by homologous recombination.

The method used to transform M- voltae with the integration vector was similar to that described by Bertani and Baresi (1987). Transformants were selected for resistance to 2.5-10 pg/ml of puromycin (1- to 4-fold MIC). Transformation efficiences were low; 38 typically, 44 resistant colonies per 109 cells were obtained when using 1 pmol of plasmid

DNA. Several types of integration into the chromosome were identified. In only one case

was integration due to nonhomologous recombination. Selective pressure was necessary

to ensure stable maintenance of the integrated vector. The expression of the eubacterial

pac gene in M- voltae allows for efficient selection for the integrated vector. With the use

of this system, and with the more efficient method of introducing DNA into M- voltae

described below, gene expression and genetic complementation studies in this

methanogen should proceed rapidly.

Micheletti et al. (1991) have recently demonstrated that electroporation can be used

to introduce DNA into M- voltae. Their results indicate that electroporation is at least one

order of magnitude more efficient than the previously described natural transformation

system for this organism (Bertani and Baresi, 1987). Auxotrophic mutants (coenzyme M,

histidine, or purine requiring) of M- voltae were electroporated with chromosomal DNA

isolated from wild-type M. voltae PS. The method of electroporation was similar to that

employed for eubacteria, except all manipulations of the cells were carried out under

anaerobic conditions. Transformed cells required a period of incubation at 30°C prior to plating on defined media. Immediate plating of cells yielded no transformants. Using electroporation experiments with the coenzyme M auxotroph (CoM') as an example, they routinely obtained an electroporation efficiency in the range of 250 to 800 CoM+ transformants per pg of added DNA. Taking into account the estimated genome size for

M. voltae (Klein and Schnorr, 1984), this corresponds to an efficiency of electroporation of approximately 3.8 X 10’5 to 1.0 X 10’6 per gene. 39

Ribonuclease P

An overview of ribonuclease P:

Virtually all tRNAs are synthesized as longer precursors which must be processed by a variety of enzymes to produce the mature functional molecules (Deutscher, 1984).

Ribonuclease P (RNase P) is an endoribonuclease that cleaves sequences from the 5' ends of tRNA precursors (pre-tRNAs) to generate their mature 5’ termini. An RNase P-like activity has been detected in cellular extracts of eubacteria, eukaryotes (nuclear and organellar) and archaebacteria. The enzyme from well-characterized eubacterial and eukaryotic sources has been found to consist of an RNA and a protein subunit (Altman,

1989). Indirect evidence suggests that this is true for RNase P from the archaebacteria as well (Lawrence et al., 1987; Darr et al., 1990; Nieuwlandt et al., 1991). It has been firmly established that the RNA subunit of the eubacterial RNase P enzyme functions as the catalytic component (Guerrier-Takada et al., 1983; Gardiner et al., 1985; Baer and

Altman, 1985). Under conditions of high ionic strength in vitro, these RNAs are catalytically active and behave as true enzymes in the absence of protein. In vivo, however, there is an absolute requirement for both subunits. Mutants which are temperature-sensitive for the synthesis of either subunit are incapable of growth at the non-permissive temperature (Guerrier-Takada et al., 1983). While evidence suggests that eukaryotic and archaebacterial RNase P complexes require RNA, there is no direct evidence that the RNAs are by themselves catalytically active.

A single RNase P species is responsible for the cleavage of all of the cells tRNA precursors (Altman et al., 1986), and the enzyme from one organism can process tRNA precursors isolated from any other organism that has been examined (Altman et al., 1988;

Lawrence et al., 1987). In addition, it has been demonstrated that the eubacterial RNase P 40 subunits are capable of complimentation across widely separated species lines. Enzymatic activity can be recovered when protein and RNA components from different organisms are combined in vitro under conditions were neither subunit alone shows any activity

(Lawrence et al., 1987; Gold and Altman, 1986; Gardiner and Pace, 1980). Despite the ability of subunits from different organisms to form hybrid molecules, and the highly conserved substrate specificity, there is surprisingly little sequence similarity between

RNase P RNAs from unrelated organisms (Altman, 1989). There also appears to be no complimentary interactions between any sequence in the RNA component of the enzyme and the pre-tRNA substrates (Baer et al., 1989). Moreover, little is known about the hydrolytic reaction catalyzed by RNase P. Detailed information about the structure of

RNase P RNA is being sought by several investigators to further understand the reaction mechanism. Using a phylogenetic comparative approach, a common core of primary and secondary structure in eubacterial RNase P RNAs has been identified, while several structural features remain unique to given phyla (Pace et al., 1989; Brown et al., 1991). It is likely that the primary and secondary structural features that are shared by these RNAs contain the regions required for pre-tRNA binding and for the interaction with the protein subunit (Pace et al., 1989). The characterized eukaryotic RNase P RNAs bear little sequence similarity to their eubacterial counterparts, and lack most of the proposed structural core characteristics of these RNAs. A review of the known physical, catalytic, structure-function, and substrate recognition properties of RNase P is provided below.

The majority of information regarding RNase P has been derived from research on the enzymes from E. coH and B. subtilis. Therefore, information available from work on the eukaryotic and archaebacterial enzymes is presented as a comparison to these eubacterial enzymes. 41

Discovery of RNase P:

An enzymatic activity that removes the 5' leader sequence from pre-tRNAs was first identified in crude extracts of E. coU (Altman and Smith, 1971). The enzyme activity was found to accurately cleave the phosphodiester bond between the first nucleotide of mature tRNA sequences and the 5' leader sequences to yield 5'-phosphate and 3'-hydroxyl end groups (Altman and Smith, 1971; Robertson et al., 1972). This endoribonuclease, designated RNase P, was unique among the ribonucleases known at the time. The enzyme did not digest its substrate to mononucleotides or oligonucleotides, nor was its cleavage site sequence-specific (Altman, 1989). While devising a method to further purify

RNase P by column chromatography, Ben Stark, a graduate student in Sidney Altman's laboratory, noticed that a high molecular weight RNA consistently copurified with the enzymatic activity (Altman, 1989). This RNA was subsequently shown to be an essential component of RNase P (Stark et al., 1978). The enzyme activity could be inactivated by pre-treatment of the holoenzyme with either micrococcal nuclease or immobilized RNase

A. The same results were soon obtained with RNase P from B. subtilis (Gardiner and

Pace, 1980). Further proof for an essential role of the RNA came when separated RNA and protein subunits were shown to be inactive by themselves in vitro, but were capable of reconstituting RNase P activity when mixed together under the appropriate conditions

(Kole and Altman, 1979). In addition, temperature-sensitive mutations in the individual subunit-encoding genes revealed that both are required for RNase P activity in vivo (Kole et al., 1982). Guerrier-Takada et al. (1983) then made the startling, and serendipitous

(Altman et al., 1989), discovery that the RNA subunit alone could carry out the RNase P reaction in vitro under conditions of high ionic strength. This discovery came only about a year after Kruger et al. (1982) discovered that a 26S rRNA precursor molecule from the protozoan Tetrahvmena thermophilus could catalyze the excision of its own intron then 42 ligate the two resulting fragments together to form the mature molecule. It was these discoveries that convinced the scientific community that proteins were not the only molecules capable of biological catalysis. While the Tetrahvmena rRNA can act like a catalyst, it does not remain unchanged following the reaction and can no longer catalyze splicing and is therefore not considered a true catalyst The same is true for other RNAs discovered over the last several years that are capable of cleaving nucleic acids. These include other self-excising introns and self-cleaving genomic RNAs of plant viroids, virusoids, and linear satellite RNAs (Cech and Bass, 1986; Cech, 1987). In.the sense that a single RNase P molecule is capable of catalyzing the cleavage of multiple substrates, it is the only catalytic RNA known to function as a true enzyme in vivo.

Physical properties of RNase P:

The characterized eubacterial RNase P holoenzymes are similar in their physical properties. Consistent with being ribonucleoprotein complexes, their buoyant densities in cesium sulfate are intermediate between that of protein (1.24 g/ml) and single-stranded

RNA (> 1.66 g/ml). The density of the E. coh holoenzyme, for example, is 1.55 g/ml

(Akaboshi et al., 1980). The RNA components of the E. coll (Ml RNA) and B. subtilis

(P RNA) enzymes are 377 and 401 nucleotides in length, respectively (Reed et al., 1982).

Nucleotide sequence analysis of RNase P RNA genes from numerous other eubacteria has shown that they potentially encode RNAs similar in size to M l RNA and P RNA (James et al., 1988; Brown et al., 1991). It is known that at least Ml RNA is derived from a precursor molecule (plOSb) that contains extra sequences at both ends (Gurevitz et al.,

1983; Motamedi et al., 1984). The enzymes responsible for removing these flanking sequences have not been identified. The genes for the protein subunits of the E. coh

(Hansen et al., 1985), B. subtilis (Ogasawara et al., 1985), and Streptomvces bikiniensis

(D. Morse and F. Schmidt, personal communication) RNase P enzymes have been cloned and sequenced. The E. coh (C5 protein) and B. subtilis (P protein) proteins each contain

119 amino acids, whereas the S. bikiniensis protein contains 123 amino acids. From the

amino acid sequences, the predicted pi values are 12.32 for C5 protein, 10.28 for P

protein, and 12.50 for the £. bikiniensis protein (D. Morse and F. Schmidt, personal

communication). The basic nature of the protein subunits is in agreement with their

postulated roles in countering ionic repulsion between the substrate and enzyme RNAs

(Pace et al., 1990). The two subunits of the E. coli holoenzyme are present at a

stoichiometry of 1:1 (Vioque et al., 1988). The C5 protein binds specifically, and non-

covalently, to M l RNA, but also shows a non-specific affinity for other RNAs, including

approximately equal affinities for 5S rRNA and pre-tRNA (Vioque et al., 1988; Pace and

Smith, 1990). The specific affinity of C5 protein for M l RNA (K

two orders of magnitude higher than typical protein-RNA interactions, such as ribosomal

protein-rRNA interactions (Vioque et al., 1988). This higher affinity may be required to

compensate for the concentration of RNase P in the cell (estimated at 200 copies/cell)

which is about two orders of magnitude lower than that of ribosomes (Vioque et al.,

1988).

In the eukaryotes, separate RNase P enzymes derived from the nuclease,

mitochondria, and chloroplasts have been characterized. The nuclear and organellar enzymes are very different from each other and from the eubacterial enzymes. Nuclear

RNase P from the yeasts Saccharomvces cerevisiae (Lee and Engelke, 1989; Lee et al.,

1991) and Schizosaccharomvces pombe (Krupp et al., 1986; Cherayil et al., 1987), from

Xenopus laevis oocytes (Castano et al., 1986; Doria et al., 1991), and from human tissue

(HeLa) culture (Gold and Altman, 1986; Bartkiewicz et al., 1989; Baer et al., 1990) have been the most thoroughly studied. The HeLa cell and yeast nuclear RNase P enzymes appear to be larger than their eubacterial counterparts, having a sedimentation constant of about 15, compared to 12 for RNase P from E. coli (Lawrence et al., 1987). These 44 enzymes also appear to have an essential RNA component; they are inactivated by treatment with micrococcal nuclease and RNAs have been prepared from the highly purified holoenzymes. However, none of these isolated RNAs have been shown to have catalytic activity in the absence of protein. The buoyant densities of these RNase P activities are only slightly greater than that of bulk protein in cesium sulfate gradients, suggesting that the RNA is a minor component of the enzyme (Lawrence et al., 1987;

Kline et al., 1981). It had been previously reported that the X. laevis nuclear RNase P might lack an RNA component (Castano et al., 1986). However, Doria et al. (1991) have recently demonstrated that the X. laevis enzyme is indeed and RNA-protein complex.

Sequence analysis of the genes for the putative nuclear RNase P RNA components from S. cerevisiae (Lee and Engelke, 1989), HeLa cell (Baer et al. 1990), and X. laevis

(Doria et al„ 1991) indicates that they encode RNAs of 369, 341, and 320 nucleotides, respectively. The S. pombe RNase P contains two RNA species of 285 (Kl-RNA) and

270 (K2-RNA) nucleotides in length; both RNAs are encoded in a single gene in the haploid cell (Krupp et al., 1986; Cherayil et al., 1987). Several sequence regions of the

Kl-RNA and the S. cerevisiae RNase P RNA are strongly conserved (Lee and Engelke,

1989). The X. laevis RNA sequence is 60% homologous to the RNA (HI RNA) from humans (Doria et al., 1991). These RNAs also share homology, although to a lesser degree, to the yeast RNase P RNAs (Doria et al., 1991; Bartkiewicz et al., 1989).

Mitochondria and Chloroplasts contain their own genomes, separate from that in the nucleus, that encode for polypeptides and RNAs required for translation . The tRNA genes are transcribed into large RNA precursors which, in addition to other processing steps, require the removal of the 5' leader sequence by an RNase P -like activity (Miller et al., 1983; Greenberg et al., 1984). Organellar RNase P activities from S. cerevisiae mitochondria (Hollingsworth and Martin, 1986; Morales et al., 1989). Candida glabrata mitochondria (Shu et al., 1991), HeLa cell mitochondria (Doersen et al., 1985), and spinach and tobacco chloroplasts (Yamaguchi-Shinozaki et al., 1987; Wang et al., 1988) have been characterized. There is evidence that all of the organellar RNase P activities require an RNA component, with the possible exception of the spinach chloroplast enzyme which is insensitive to micrococcal nuclease (Wang et al., 1988). However, it is becoming clear that treatment with micrococcal nuclease does not always render enzymes with required RNA components inactive. An RNA can be protected from digestion by other components of the enzyme (Darr et al., 1990; Morales et al., 1989). The mitochondrial genes for the RNA subunits from S. cerevisiae and C. glabrata have been cloned and sequenced and found to encode RNAs of about 490 and 227 nucleotides, respectively (Morales et al., 1989; Shu et al., 1991). The Q. glabrata RNA is the smallest

RNase P RNA known. These RNAs are unique among RNase P RNAs in having extremely AU-rich sequences. There are two short regions of sequence homology between the two RNAs that are very similar to conserved sequences found in eubacterial

RNase P RNAs (Shu et al., 1991). Similar to nuclear RNase P enzymes, the S. cerevisiae mitochondrial enzyme has a buoyant density of 1.28 g/ml in cesium sulfate, indicating that the complex is about 90% protein (Hollingsworth and Martin, 1986). In contrast, the E. coh holoenzyme is only about 10% protein (Altman, 1989). The protein component of yeast mitochondrial RNase P has yet to be investigated in any detail, but is known to be encoded in the nucleus (Hollingsworth and Martin, 1986).

It is still not clear that the eukaryotic and eubacterial RNase P RNAs are homologs.

There are no significant sequence similarities between the RNase P-associated RNAs of eukaryotes and eubacteria (Pace and Smith, 1990). In addition, no eukaryotic RNase P

RNAs have been shown to cleave pre-tRNAs in RNA-only reactions. It is possible that the eukaryotic RNAs lost the catalytic function typical of the eubacterial RNase P RNAs

(Doria et al., 1991). Some evidence for homology has been presented by Forster and

Altman (1990). As will be discussed in more detail below, they demonstrated that the 46 HeLa and yeast RNase P RNAs can be folded into secondary and tertiary structures that resemble the bacterial RNase P RNA consensus structure. In addition, an antigenic determinant of RNase P protein is conserved between the E. coli. HeLa nuclear, and X. laevis oocyte RNase P enzymes (Mamula et al., 1989; Doria et al., 1991).

Two reports have described the occurence of RNase P activity in the archaebacteria.

RNase P from the halophilic archaebacterium Haloferax volcanii has been reported to be sensitive to micrococcal nuclease and to have a buoyant density of 1.61 g/ml in cesium sulfate (Lawrence et al., 1987). These results suggest that the enzyme has a required

RNA component and, like the eubacterial RNase P complexes, it is composed of a large

RNA and a small protein. The sedimentation constant of H. volcanii RNase P (S20,w=18) suggest that this enzyme is somewhat larger than the enzymes from E. coh (S20,w=12) or

HeLa nuclei (S20,w=15) (Lawrence et al., 1987). In the second report, the RNase P activity from Sulfolobus solfataricus. a member of the sulfur-dependent thermophile branch of the archaebacteria, was shown not to be sensitive to micrococcal nuclease and to have a buoyant density of 1.27 g/ml in cesium sulfate (Darr et al., 1990). Although the enzyme is insensitive to micrococcal nuclease, it has recently been demonstrated to contain an approximately 310-nucleotide RNA component (T. La Grandeur, S. Darr, and N.

Pace, personal communication). The low density of the enzyme suggests that the complex has a high mass ratio of protein to RNA, similar to eukaryotic nuclear and organellar

RNase P activities.

Properties of the RNase P reaction:

RNase P cleaves a single phosphodiester bond in pre-tRNAs to remove the extra nucleotides from their 5' termini. Like most specific processing nucleases composed of protein, the enzyme yields 5-phosphate and 3'-hydroxyl termini (Paceet al., 1987).

Detailed analyses of the effects of ionic strength and of the protein subunit on catalysis by the eubacterial RNase P RNA have been performed to elucidate the mechanism by which

this catalytic RNA cleaves its substrates. All eubactertial RNase P enzymes investigated

have only moderate cation requirements. The E. coh holoenzyme functions optimally in

buffers with about 60 mM NH4 CI and 10 mM MgCh (Robertson et al., 1972), while the

B. subtilis enzyme has optimal concentrations of 100-200 mM NH 4 CI and 60-90 mM

MgCl 2 , and is strongly inhibited by higher Mg2+ concentrations (Mg2+ > 100 mM)

(Gardiner et al., 1985). High ionic strength conditions can substitute for the RNase P

protein, allowing the RNA component to accurately carry out the reaction. M l RNA-

alone reactions require at least 100 mM NH 4 CI and 60 mM MgCl 2 (Guerrier-Takada et

al., 1983), and P RNA functions optimally with about 800 mM NH 4 CI and 100 mM

MgCl 2 (Pace et al., 1987). The activity of both enzymes, with or without the protein

subunit, has an absolute requirement for divalent cations. Apparently, this divalent cation

must be Mg2+, although M l RNA can function, rather ineffectively, with Mn2+ in the

presence of a polyamine such as spermine or spermidine (Baer et al., 1989). For P RNA

activity, Mn2+ is effective but only in addition to Mg2+, and polyamines are ineffective

even if the reaction contains low levels (about 10 mM) of Mg2+ (Gardiner et al., 1985).

In the case of the P RNA-alone reaction, the requirement for Mg2+ decreases as the monovalent salt concentration increases. Gardiner et al. (1985) suggest that the ability of monovalent and divalent cations to compliment one another to some extent indicates that part of the effect of high cation concentration is simply to fulfill a requirement for ionic strength. The high cation concentration could shield the electrostatic repulsion between the negatively charged phosphate groups of the substrate RNA and catalytic RNA.

Similarly, in M l RNA alone reactions, Mg2+, Ca2+, Sr2+, and to a lesser extent, Mn2+, can function as the electrostatic shield and maintain the structure of the enzyme in solution

(Guerrier-Takada et al., 1986). However, the absolute requirement for Mg2+ (or Mn2+) in all of these reactions suggest that this cation is required to promote catalysis (Guerrier- 48 Takada et al,, 1986). Other findings also suggest that ionic screening may not be the only role of high salt concentration in the reaction. If ionic screening were the only effect, it would be anticipated that alkali metal cations with smaller radii, which bind to nucleic acids more tightly than larger ones (in the order Li+>Na+>K+>Rb+>Cs+), would be the most effective at low concentrations. However, Gardiner et al. (1985) observed that the order of effectiveness of the ions in promoting the RNase P reaction is essentially the reverse (Rb+, Cs+,K+, NH 4+ > Li+, Na+). Pace and Smith (1990) suggest that particular cations, monovalent or divalent, occupy specific sites on the RNA where they are involved in catalysis or have structural roles. These structural roles might include stabilization of the RNA through salt bridges or coordination cages (Pace and Smith,

1990).

Kinetic studies have indicated that high ionic strength substitutes for the RNase P protein in the reaction by facilitating the binding of the pre-tRNA substrate to the catalytic

RNA; both appear to function in the reaction by titrating anionic repulsion between the substrate and enzyme RNAs. The Km of the reactions catalyzed by the holoenzyme or the

RNA alone are about the same (10 ’8 to 10'7) at the optimal ionic strengths for each, suggesting that the RNA governs binding of the substrate to the enzyme (Reich et al.,

1988; McClain et al., 1987; Guerrier-Takada et al., 1988). However, more recent studies employing a variety of substrates have shown that the actual Km of the reaction catalyzed by the holoenzyme is consistently slightly lower than the Km of the reaction catalyzed by

M l RNA alone, suggesting that the protein subunit has a small effect on the binding of

M l RNA to pre-tRNA substrates (Baer et al., 1989). It should be noted that in addition to the postulated roles in stabilizing the correct conformation of the catalytic RNA and in assisting in the binding of substrate, the protein subunit might also function to anchor the

RNA subunit to the inner face of the cytoplasmic membrane or some other large entity.

Miczak et al. (1991) discovered that when E coh cells were fractionated into membrane 49 and cytoplasm, the RNase P activity was associated with the membrane fraction.

Moreover, Ml RNA is found in the cytosolic fraction of cells overproducing this RNA, while overproduced C5 protein fractionates with the membrane.

Although the RNase P RNA and holoenzyme bind substrate with similar efficiencies, the Vmax of the reaction in the absence of the protein is approximately 2 0 -fold lower than that observed with the holoenzyme. The turnover number (Kcat) of the RNA- alone reaction is also very low in comparison with the holoenzyme reaction (Reich et al.,

1988). However, using a substrate to enzyme ratio of only 2:1, Reich et al. (1988) have demonstrated that the first round of substrate cleavage is at least if not more rapid in the

RNA-alone reaction than in the holoenzyme reaction. From this information, it can be concluded that the RNase P protein enhances the overall catalytic rate of the reaction by promoting a more rapid dissociation of the enzyme-product complex following cleavage

(Reich et al., 1988; Pace et al., 1987).

Although the ionic requirements and kinetic properties of the reaction catalyzed by

RNase P from E. coli and B. subtilis are now well-defined, the actual mechanism of pre- tRNA cleavage remains elusive. It has been shown that Mg2+ is required for catalysis

(Guerrier-Takada et al., 1986), but it has yet to be proven that it is directly involved in the catalytic mechanism and does not just play a structural role. However, by comparison with the mechanisms of cleavage catalyzed by other RNases that generate 5-phosphate and 3'-hydroxyl end groups, which resemble the Sn 2 in-line displacement reaction

(Guerrier-Takada et al., 1986), a reasonable mechanism has been proposed (Altman,

1989; Guerrier-Takada et al., 1986). As shown in Figure 3, the hypothetical mechanism involves catalysis by a Mg-H 2 0 complex that is initially bound to a phosphate of M l

RNA. A water molecule, hydrogen-bonded to an O or N atom in M l RNA, binds to a phosphate of the pre-tRNA substrate (at the site of cleavage) which then passes through a transition state prior to cleavage of the leader sequence and replacement of OH to the 5' 50 terminal phosphate. A similar model, which lacks the direct involvment of Mg2+, has also been proposed (Marsh and Pace, 1985; Pace et al., 1987). The details of these proposed mechanisms remain to be elucidated.

Structure of RNase P RNA:

A further understanding of the reaction catalyzed by RNase P RNA will require detailed information about its structure. Although secondary structures for M l RNA have been proposed on the basis of minimum energy calculations and on chemical and enzymatic structure probing data (Guerrier-Takada and Altman, 1984; Upson et al.,

1988), alternative structures are also consistent with the results (James et al., 1988; Pace et al., 1987). In addition, the proposed P RNA structure based on these methods is largely inconsistent with the proposed structures for M l RNA, despite the expectation that

RNAs which are homologous in function probably posses similar secondary structures

(Reich et al., 1988; James et al., 1988). The phylogenetic comparative approach is currrently the most reliable method for determining secondary structures of large RNAs

(Fox and Woese, 1975; Noller and Woese, 1981). With this approach, one looks for structural features that are conserved despite differences in the primary sequence of the

RNAs (i.e., covariance). If an equivalent base-pairing scheme in a putative helical region is not present in homologous regions from the RNA of a different organism, it is unlikely that the structure exists in vivo. James et al. (1988) used a phylogenetic comparative analysis of RNase P sequences from the proteobacteria (y-subdivision) E. coli.

Pseudomonas fluorescens. and Salmonella tvphimurium. and four gram positive species of the genera Bacillus to derive secondary structure models for M l RNA and P RNA.

Brown et al. (1991) have recently increased the resolution of the model by including additional RNase P RNA sequences in the comparison. These new RNA sequences were from a diverse sampling of additional proteobacteria: the a proteobacteria Agrobacterium Figure 3. Hypothetical mechanism of pre-tRNA hydrolysis by M l RNA of RNase P.

The reaction is catalyzed by a Mg-H 2 0 complex that is initially bound to a

phosphate of M l RNA. The parenthesis around the water ligands associated

with Mg2+ indicate that Mg2+ may be either hexacoordinated or

tetracoordinated. Starting from the top panel, a water molecule that is

hydrogen-bonded to an 0 or N atom in Ml RNA binds (middle panel) to the

phosphate located between the mature 5' end and the leader sequence

(oligonucleotide). The pre-tRNA then passes through a transition state prior to

cleavage (bottom panel) of the leader sequence and addition of OH to its 0 5 ’

phosphate. Taken from Altman (1989).

51 52

o r tRNA— o*

M l RNA

0

. H—1 o r

tRNA— or

Ml RNA

0

oMonweiMlM* ./* * \or — m - o

T < r \ ' y p c r , tRNA * (ohjT /y > M—O o r

------M1 RNA

Figure 3. 53 tumefaciens and Rhodospirillum rubrum. the J3 proteobacteria Alcali genes eutrophus and

Thiobacillus ferrooxidans. the y proteobacterium Chromatium vinosum. and the 5 proteobacterium Desulfovibrio desulfuricans. The refined M l RNA and P RNA models, shown in Figure 4, vary only slightly from the previous models (Brown et al., 1991).

These phylogenetic comparisons have shown that the analyzed RNAs share a common structural core, where conserved nucleotides are localized to similar structural regions

(Brown et al., 1991; James et al., 1988; Pace et al., 1989). The structure and sequences conserved within the proteobacteria and within the eubacteria as a whole are presented in

Figure 5. The reliability of the phylogenetic comparative approach was confirmed when

Waugh et al. (1989) constructed an abbreviated 263-nucleotide RNase P RNA, composed solely of the conserved structural elements, that functioned efficiently. As indicated in

Figure 5, the potential for the formation of a pseudoknot interaction in the eubacterial

RNAs is conserved. Pseudoknot interactions involve base pairing between single­ stranded loop regions and sequences outside this loop (Pleij, 1990). Due to the lack of extensive structural similarities between eubacterial and eukaryotic RNase P RNAs, and the small number of eukaryotic sequences available for analysis, structures that have been proposed for the eukaryotic RNAs are in question (Pace and Smith, 1990). However,

Forster and Altman (1990) have recently demonstrated that the eukaryotic nuclear and mitochondrial RNase P RNAs that have been sequenced can assume folded structures that resemble the eubacterial RNase P RNA core structures. All of these eukaryotic RNAs also have the potential for formation of a pseudoknot between regions homologous to those involved in the eubacterial RNase P RNA pseudoknot interaction. Interestingly, this putative universally conserved RNase P RNA interaction would bring together most of the universally conserved sequence elements that are present in distant regions of the molecule

(Forster and Altman, 1990; Nieuwlandt et al., 1991), suggesting that they might participate in formation of the active site. The pseudoknot structure is also consistent with Figure 4. Secondary structures of the RNase P RNAs from Escherichia coH (M l RNA)

and Bacillus subtilis (P RNA). Taken from Brown et al. (1991).

54 Escherichia Oc' n ? Bacillus coll subtilis A y *tm • n cV n a*

,°a*v Aou“cc*c *oUn o - .A* w0 U u ®0A oe I Q«* °c*u °V •Vc J* u a ** °0A e U C U ® ^ # » A We c ^ c° t “ AJ o c o a o A c 0 1-0 fffpOCtfoo A

u l)uc “ ", A 'Q0> AO ° £ / (J ij9 Co-ccUCA « c c c c a * a „«0 0„*M 1 V * Cc^ c -J »oc,'Oo<^?.a * , a»o« c ° u u°\„ c “ " * ° * * a c^'a-u*c,\,°*u O T A ||« .coo. c c u w cu u f t QQAAQA o < \ \ */C*<*A °oc*A ,uOu.Yl \ -U a e - o u i ' aucoe- 4 »»«* 0*u, v ‘>A A-U 3SE91 C-Q*M g » a I (to * A-U | o-el uOa ( * ° V OAAOCUOACCAO-CC a OVWCUUAACOUUCOO-COCC OUAC I II • I II I I I • • • ...... I • I II llll 11 CUUUOACVQOC AOAUUOCAAOA / OO,, nCAUO J “ e* / *CflU u / c y / a* °oCc«* ®u a e A

Figure 4. Figure 5. Conserved RNase P RNA structure and sequences within the proteobacteria

(A) and within the eubacteria (B). Nucleotides conserved in all or all but one of

the available sequences are shown. Invariant nucleotides are indicated in

uppercase letters and nucleotides which vary in only one known sequence are

shown in lower case letters. Nucleotides which vaiy in more than one known

sequence are indicated by open circles; variable nucleotides are indicated by

closed circles. Bars indicate pairing for which there is covariation evidence, as

follows: , canonical or G-U pairing; , conserved noncanonical GA or AC

pairing; , pairing in panel B which is canonical in the Bacillus structures but

noncanonical in the proteobacterial structures; , base pairing which contains

only G-C and G-U variants or A-C and A-G variants. Base pairings which lack

phylogenetic evidence but are included in the model because they represent the

continuation of a proven helix are indicated by lines. Arced lines and boxes

indicate sequences that can participate in pseudoknot interactions. Taken from

Brown et al. (1991).

56 5 7

B Proteobacteiial consensus Eubacterial consensus gjpo* 4#A«*A< ■4 v

o 0 A ••USA**• A hQ

: caa •T 1 • . C > . U *9* ■n *# °?£?c*c* • • • Q • 9, 1 I .Ca* ,•!£ • • *C • 11*00 \*

•c q c «o u a a

0* • • > n >

Figure 5. earlier mutagenesis data for P RNA, which indicated that active site formation involves the interaction between distant portions of the molecule (Waugh, 1989). Further evidence for such an interaction in both eubacteria and eukaryotes is revealed when the mitochondrial

RNase P RNA sequences from S. cerevisiae and C. glabrata are examined. These RNAs each share only two short stretches of sequence homology with M l RNA, which are the exact regions involved in the pseudoknot interaction. As mentioned earlier, these mitochondrial RNAs are extremely AU-rich. Of the seven G residues and three C residues in the C. glabrata sequence, four of the G's and all of the C's are confined to these short regions of homology with M l RNA (Shu et al., 1991).

RNase P RNA structure-function relationships:

The initial mutational analyses of the RNA subunit of RNase P revealed that the structure required for activity is formed by nucleotides distributed throughout the whole molecule, and there seems to be no single nucleotide absolutely essential for activity (Pace et al., 1990). Waugh (1989) created a set of P RNA deletion mutants that collectively lacked every nucleotide in the sequence. Each of these mutants exhibited RNase P activity. A large series of point mutations in M l RNA failed to reveal an absolutely essential nucleotide in this RNA as well (Lumelsky and Altman, 1988; Kirsebom et al.,

1988). Guerrier-Takada and Altman (1986) determined that M l RNA molecules missing as many as 122 nucleotides (roughly a third of the entire RNA) at the 3' terminus remained catalytically active, although at a much lower level than wild-type M l RNA.

However, activity was eliminated when 70 nucleotides were deleted from the 5' terminus, or when a small number of nucleotides were deleted from both termini. Although no point mutations have resulted in the elimination of activity, many did have a significant effect on catalysis. Interpretation of these results is difficult because it is not clear whether these mutations have direct effects on catalysis or cause improper folding of the RNA. Since 59 RNase P RNAs are assumed to have complex secondary and tertiary structures, mutations in one part of the molecule can have major long-range effects on other parts of the molecule.

The location of the RNase P RNA elements essential for binding of substrate and catalysis have been narrowed down to the phylogenetically conserved core structure. A

263-nucleotide synthetic RNase P RNA that consists only of this conserved structure has been shown to have a catalytic efficiency (kcat/Km) similar to that of the 377-nucleotide

M l RNA (Waugh et al., 1989). Enzyme-substrate cross-linking analyses have been used to more precisely map the active site of RNase P RNA. Guerrier-Takada et al. (1989) have found that U. V. irradiation of Ml RNA-tRNA complexes results in cross-linking of the -3 nucleotide of pre-tRNATyr (E. coli) substrate to residue C92 of M l RNA (see figure 4), suggesting that these substrate and enzyme residues are near each other in the complex. There is other indirect evidence that supports the involvement of residue C92 in substrate binding. This residue is conserved at homologous positions in almost all of the known eubacterial RNase P RNAs (Brown et al., 1991). In addition, deletion of C92 from M l RNA yields a molecule that cleaves pre-tRNA substrates at sites several nucleotides away from the normal cleavage site (Guerrier-Takada et al., 1989). In a study performed by Burgin and Pace (1990), photoaffmity cross-linking was used to identify residues in RNase P RNA that are adjacent to the substrate phosphodiester bond in pre- tRNA. Three RNase P RNAs were investigated; Ml RNA, P RNA, and the Chromatium vinosum RNase P RNA. The photoactivatible cross-linking agent, an azidophenacyl group, was attached to the 5’-phosphate of mature tRNA, the site of action by RNase P.

U.V. irradiation of an enzyme-substrate complex results in conversion of the azido group to a nitrene, which then inserts into nearby bonds. The main regions of crosslinking were the same in each of the three RNase P RNAs. In the Ml RNA (refer to Figure 4), these regions are residues A248-A249 and A330-A333. It is expected that these residues are in 60 the immediate proximity of the substrate bond during the reaction (Burgin and Pace,

1990). Although the two regions are separated from one another in sequence, they might be brought together by the pseudoknot interaction between residues A66-G74 and C353-

U360. Of relevance to this cross-linking study, Baer et al. (1988) have generated A333 to

C333 and A334 to U334 mutants of M l RNA. The C333 mutation had no effect on activity of M l RNA, but the U334 mutation, which is adjacent to the cross-linked A330-

A333 region, had a much lower activity than wild-type M l RNA. In a separate study,

Shiraishi and Shimura (1986) showed that a mutant M l RNA with a G to A substitution at nucleotide position 329 had extremely low activity. The Vmax of the reaction catalyzed by this mutant M l RNA is 1/400 of that observed with wild-type M l RNA, although the two

RNAs have the same Km. This suggest that the initial binding of substrate to the mutant

RNA takes place normally, but cleavage and/or release of substrate is impaired. This might indicate that substrate binding and cleavage are separate functions, as has been reported for Saccharomvces cerevisiae RNase P based on gel retardation studies (Nichols et al., 1988).

Knap et al. (1990) have taken a different approach at mapping the substrate-binding site of M l RNA. By comparing nucleotides in Ml RNA and in M l RNA-substrate complexes that are accessible to chemical modification by dimethyl sulfate or phenylglyoxal monohydrate, they determined which bases in the enzyme were specifically protected from modification by the bound substrate. These protected bases, which are presumably directly involved in substrate binding rather than just in close proximity to the substrate, include C85 and G259 (see Figure 4). M l RNA bases that were protected from modification both with and without bound substrate included A79, A136, A 182, and

U257. It is interesting that C85 has been proposed to be involved in a pseudoknot interaction between the sequence regions G82-C85 and G276-C279 (E. S. Haas and N.

R. Pace, personal communication). 61 The protein subunits of the E. coh and B. subtilis RNase P complexes are thought to interact with their RNA subunits at sequences in the uppermost loop and the helical region that separates this loop from the central loop (see Figure 4). For E. coli RNase P, deletion analysis and footprinting techniques were used to locate the regions of M l RNA that interact with C5 protein (Vioque et al., 1988; Altman, 1989). These interactions were localized primarily between nucleotides 82 to 96 and 170 to 270. Although these two regions are widely separated in the primary structure of M l RNA, the base pairing between the top and middle loops of the core structure, and the putative pseudoknot interaction between residues 82-85 and 276-279, would bring many of the residues into close proximity. The observation that there is a high degree of sequence similarity between two separated regions that are protected by C5 protein; region 82 to 96 (5-

GGGCAGGGUGCCAGG-3') and region 170 to 184 (5'-GGUAAGGGUGAAAGG-3') is intriguing (Vioque et al., 1988). It is not clear whether this simularity has any relevance, but these sequences might be recognition elements for C5 protein.

There is evidence that residue G89 of Ml RNA is critical for binding of C5 protein

(Shiraishi and Shimura, 1986). A thermosensitive mutant of the M l RNA gene (rnpB) from E. coh contains a G to A substitution at this position (designated A89 gene). The activity of RNase P in extracts of this strain is very low at 30°C and almost undetectable at

42°C. However, transcripts prepared in vitro from the isolated A89 gene display wild- type RNA-alone activity under conditions were the C5 protein is not required. Moreover, when in vitro transcripts of Ml RNA and A89-M1 RNA are added to crude extracts of wild-type E. coh in vitro, Ml RNA is stable, whereas A89-M1 RNA transcripts are rapidly degraded. These results suggest that this single point mutation leads to a serious defect in protein association and that C5 protein plays an important role in preventing degradation of M l RNA in vivo. A four base insertion into the analogous helical region separating the top and middle loops in the B. subtilis RNase P RNA (P RNA) also affects 62 protein interaction (Pace et al., 1987). Similar to the results obtained with A89-M1 RNA,

transcripts from this modified P RNA gene are as active as native P RNA in the RNA

alone reaction at high ionic strength, but its activity is not stimulated by the RNase P

protein under the holoenzyme reaction conditions.

Substrate recognition bv RNase P:

A single RNase P species is responsible for the 5* maturation of all of the cells

tRNAs and RNase P from one organism can accurately process pre-tRNAs from other

organisms regardless of their primary sequences. Therefore, it is expected that RNase P

recognizes universally present features of the higher order structure of tRNAs. The

primary sequence of tRNAs can be folded into a common secondary structure (cloverleaf

structure) which then assumes an L-shaped tertiary structure comprised of two helical

regions (see Figure 6 ). One helical region contains the acceptor stem and the T stem and

loop; the other contains the D stem and loop and the anticodon stem and loop. Two

universally present sequences are found in the former helical region: the trinucleotide CCA

at the 3' end of the mature tRNA, and GUUCG in the T loop. The GUUCG sequence is

modified to GT\|/CG in vivo, but it is known that base modifications in the precursor

substrates are not required for cleavage by RNase P (Baer et al., 1989; Leontis et al.,

1988). Since the sequences CCA, GUUCG, and the bond cleaved by RNase P all occur

on the same face of this coaxial helix, it was reasonable to postulate that this face of the helix is the part of tRNAs recognized by RNase P. McClain et al. (1987) verified that E. coli RNase P can accurately cleave a model substrate derived from pre-tRNAphe (pATl) which contains only this helix; the D stem and loop, anticodon stem and loop, and the variable loop were deleted. The Km and kcat values of cleavage of pATl by Ml RNA or the holoenzyme are virtually unchanged from those observed with wild-type pre- tRNAP*16, indicating that recognition of the model substrate depends only on the helical Figure 6 . Secondary (A) and tertiary (B) structure models of pre-tRNAAsP from E. coli.

Bases identified by Thurlow et al. (1991) as being important for interaction

with RNase P RNAs from E. coli and B. subtilis are shaded on the secondary

structure model and in black on the tertiary structure model. In the tertiary

structure model, the general regions implicated as being important for

interaction with RNase P RNA, along the top and back and at the comer of the

pre-tRNA, are shaded. The bases are numbered according to Sprinzl et al.

(1985). Taken from Thurlow et al. (1991).

63 64

A 3' RNase £| Cl G C C A G G C C

c |u |u |g | a <3c GIGl(jt g Ia ia iu [G ul G ED A C 40 G

Acceptor stem 64 76

T loop 72

0 loop 20 69

Variable loop

32 Anticodon

Figure 6. segment of the acceptor stem and the T stem and loop. Point mutations in, or the

elimination of, the CCA trinucleotide of pATl prevents cleavage by both M l RNA and

the holoenzyme. However, the absence of CCA from the 3' terminus of normal tRNA

precursors affects cleavage by M l RNA but not the holoenzyme (Guerrier-Takada et al.,

1984). This latter result might be because the holoenzyme reaction is not rate-limited by

product release, whereas the RNA-alone reaction is (Pace and Smith, 1990).

There is some evidence that RNase P uses a "measuring mechanism", involving the

3' CCA sequence, to locate the correct phosphodiester bond to cleave. Guerrier-Takada et

al. (1989) observed that aberrant cleavage of a pre-tRNATyf substrate occurred only if the

CCA terminus was absent. Also, using a series of yeast pre-tRNASer substrates varying

only at their 3' flanking sequences (GCCA versus G, CCCA versus C, or CGCCA versus

CG), Krupp et al. (1991) found that both M l RNA and the E. coh holoenzyme always

cleaved more efficiently at the correct (+1) bond for RNAs ending with NCCA than for

RNAs ending with N. In addition, cleavage of these substrates at the -1 position (one

nucleotide 5' of normal cleavage site) was the most efficient for RNAs with the CGCCA

3' flanking sequence; in this case, the acceptor stem is extended from the normal seven base pairs to eight base pairs. This latter result is analogous to the cleavage of the natural substrates pre-tRNAH*s and pre-tRNA^Cys, which yield acceptor stems extended by an eighth base pair (Carter et al., 1990; Burkard et al., 1988; Burkard and Soil, 1988). In contrast to the E. coli enzyme, the various flanking sequence mutations did not alter the cleavage specificity of RNase P from the yeast Schizosaccharomvces pombe: cleavage always occurred predominantly at the +1 position to generate the typical seven-base pair acceptor stem (Krupp et al., 1991). Similar results have been observed for the RNase P from Xenopus laevis (Carrara et al., 1989). It should be noted that eukaryotic tRNAHis molecules also contain an eight-base pair acceptor stem, but unlike in the eubacteria the extra base allowing this extra base pair is added post-transcriptionally (Cooley et al., 66 1982). The "measuring mechanism" might only apply to E. cob RNase P (or E. coli-like enzymes). While all tRNA genes in E. coh encode the 3’ CCA sequence, the CCA sequence is generally not found in transcripts of tRNA genes in eukaryotes or archaebacteria, or in some of the transcripts of B. subtilis and bacteriophage T4 tRNA genes (Altman, 1989; Green and Void, 1988).

The importance of the nucleotides exposed on the face of the coaxial helix mentioned above (top of the L-shaped three-dimensional structure; see Figure 6 ) were confirmed by

Thurlow et al. (1991). Using chemically modified pre-tRNAAsP substrates from E. coli. they characterized the content of chemically altered bases in the molecules that were and were not cleaved by Ml RNA and P RNA. Consistent with the accurate cleavage of the model pATl substrate, all of the bases that were required intact for optimal activity as substrate were in the acceptor stem and T stem and loop (see Figure 6 ). The most pronounced inhibition of cleavage occurred if one or more of the following nucleotides was chemically altered: purines at residues 1 and 2 adjacent to the site of cleavage, residue

57 in the T loop, and residue 64 in the T stem (see Figure 6 ). The Ml RNA and P RNA were similar in their requirements for unmodified bases in the precursor tRNAs. In similar studies, Kahle et al. (1990a, 1990b) chemically modified pre-tRNAs from S. pombe prior to cleavage by Ml RNA and by the RNase P holoenzyme from S. pombe.

Although their results were in agreement with those of Thurlow et al. (1991), they also detected a few modified bases in the anticodon stem and other regions of the pre-tRNAs that resulted in very minor processing inhibition.

Studies with mutant substrates have also indicated that the tertiary structure of the tRNA within the precursor molecule is important for binding and cleavage of the substrate by RNase P. Several point mutations in conserved T loop and D loop residues that are involved in tertiary folding interactions block both eubacterial and eukaryotic RNase P activities (Kirsebom and Altman, 1989; Drainas et al., 1989; Leontis et al., 1988; Reilly 67 and RajBhandaiy, 1986). Further evidence comes from the demonstration of RNase P inhibition by mutations in non-conserved sequences that result in tertiary structure disruptions. Mutations in pre-tRNA 1^ 11 from S. cerevisiae that eliminate base-pairing in the anticodon stem block cleavage by the S. cerevisiae nuclear enzyme (Leontis et al.,

1988). Also, for eukaryotic pre-tRNAs that contain introns, certain intron sequences are essential for RNase P cleavage even though the enzymes efficiently cleave pre-tRNAs that lack introns. These essential sequences are predominantly in the anticodon-intron stem region were the conservation of this structure is necessary for attaining or stabilizing the correct tRNA tertiary structure (Willis et al., 1986; Leontis et al„ 1988).

The sequence and length of the 5' leader sequence generally does not affect accurate cleavage by RNase P unless it permits an extension of the acceptor stem via base-pairing with the 3' trailing sequence (Krupp et al., 1991). Leader sequences consisting of as few as two (and possibly one) nucleotide can be accurately removed by Ml RNA or the E. coli holoenzyme (Altman et al., 1989). However, mitochondrial RNase P from S. cerevisiae appears to be uniquely sensitive to leader sequence or structure (Hollingsworth and

Martin, 1987). The mitochondrial RNase P cleaves a mitochondrial pre-tRNA^P with a

75% AU leader base composition (typical for mitochondrial pre-tRNAs) but not pre- tRNAAsP with a leader of the same length but with an only 39% AU base composition. E. coli RNase P efficiendy cleaved both substrates.

tRNA Intron Endonuclease

Overview of intron processing:

The coding sequences of many genes are interrupted by stretches of noncoding DNA termed intervening sequences or introns. Introns are frequently found in eukaryotic nuclear and organellar genes for proteins, rRNAs and tRNAs. Among the eubacteria, 68 they have only been discovered within tRNA 1-611 genes from various cyanobacteria and within a few bacteriophage protein genes (Chu et al., 1984; Sjoberg et al., 1986; Chu et al., 1987; Goodrich-Blair et al., 1990; Xu et al., 1990; Kuhsel et al., 1990). In the archaebacteria, introns have been discovered in several tRNA genes from the halophiles and sulfur-dependent thermophiles, and within the 23S rRNA genes of the sulfur- dependent thermophiles Desulfurococcus mobilis and Staphvlothermus marinus

(discussed in detail below).

Following transcription of intron-containing genes, the intron must be cleaved out and the coding sequences (exons) ligated together to produce the functional mRNA, rRNA or tRNA. This cleavage-ligation reaction is termed RNA splicing. Four major groups of introns have been recognized, each requiring a different RNA splicing mechanism for their removal: group I, group II, nuclear mRNA, and nuclear tRNA introns (see Figure 7).

Group I introns are most commonly found in plant and fungal organellar protein-encoding genes but have also been identified in the nuclear 26S rRNA genes of Tetrahvmena thermophila and Phvsarum polvcephalum. in the nuclear 16S rRNA gene of Pneumocystis carinii. in many chloroplast tRNA genes, and in some structural genes of the T-even bacteriophages (Cech, 1990; Cech and Bass, 1986; Muscarella and Vogt, 1989). These introns are characterized by a conserved core secondary structure consisting of nine helices (stems) and nine loops (Cech, 1988). They also have distinct exon-intron boundary sequences with the last base of the 5' exon always being a U, and the last base of the intron always being a G. Many group I introns are capable of self-excision, while others require an association with proteins. Those which require protein components for splicing may also be catalytic RNAs, but need assistance to fold into the active structure

(Cech and Bass, 1986). Important for splicing of group I introns is the universally present internal guide sequence. This sequence pairs with the 3' end of the upstream exon and the 5' end of the downstream exon to align the two exon boundaries for splicing. The Figure 7. Splicing mechanisms of the four major groups of intron-containing precursor

RNAs. Introns are shown as wavy lines; flanking exons are shown as smooth

lines. The spliceosome involved in splicing of nuclear pre-mRNA contains

many polypeptide and ribonucleoprotein components; only two, the U1 and U2

small nuclear ribonucleoproteins (snRNPs) are shown here. Taken from Cech

(1990).

69 70

a) Group I b ) Group If C) Nuclear mRNA d ) Nuclear tRNA Self-Splicing Self-Splicing Spliceoaomal Enzym atic

I ENOOMUCLtAJC Q — .OH . 3 ^ OH,. f no c* i KINASE t LlGASE PHOSPHATASE

«o 9

Figure 7. 71 self-splicing (or protein-assisted splicing) of the intron then proceeds via two consecutive

transesterification reactions (see Figure 7) initiated by a free guanosine or a guanosine

nucleotide cofactor which attacks the phosphorous atom at the 5' splice site to form a

3', 5'-phosphodiester bond to the first nucleotide of the intron. The free 3* hydroxyl

group of the 5' exon then attacks the phosphorous atom at the 3' splice site, resulting in

ligation of the exons and excision of the intron (Cech, 1990). Many group I introns also

contain open reading frames (ORFs) that encode proteins. Some of these intron ORFs

encode maturase proteins required for splicing, while others encode an endonucleases

involved in intron mobilization or a ribosomal protein (Perlman et al., 1990).

Group II introns are present in some fungal mitochondrial genes and chloroplast

tRNA genes (Cech, 1986; Neuhaus and Link, 1987). These introns are distinct from the

group I introns in both their conserved core secondary structure (Jacquier and Michel,

1987) and exon-intron boundary sequences. At the 5' end of group II introns is a conserved sequence with the concensus GUGCG, and always at the 3' end is the dinucleotide AU or AC. Also near the 3' end of the intron is a fairly well conserved sequence of about 34 nucleotides known as Domain 5 (Perlman et al., 1990). Like group

I introns, group II intron splicing involves two transesterification reactions and some can undergo self-splicing. Unlike group I introns, however, the splicing reaction does not require guanosine or any other free nucleotide. Instead, splicing is initiated by attack of a

2'-OH of an adenosine residue, located within the intron near the 3' end, on the phosphorous atom at the 5' splice junction to form a 2,,5'-phosphodiester bond (see

Figure 7). This reaction generates a lariat intron structure that is released by the second transesterification reaction which is analogous to that of the group I splicing reaction

(Cech and Bass, 1986; Perlman et al., 1990). As with group I introns, some group II introns have an ORF that can encode a protein. Of interest is that nearly all group II intron

ORFs contain a stretch of sequence with strong homology to retroviral reverse 72 transcriptases (Michel and Lang, 1985). Such group II intron-encoded proteins may be

involved in an intron transposition mechanism (Lambowitz, 1989) by converting the

excised intron to complementary DNA which would then be able to recombine with

genomic DNA (Grivell, 1990).

All introns discovered in nuclear protein-encoding genes have been classified as

nuclear pre-mRNA introns. These introns are typically 200-500 nucleotides long,

although some are veiy large; the largest intron known is the > 200 Kb intron within the

Duchenne muscular dystrophy gene (Monaco et al., 1986; Shapiro and Senapathy, 1987).

In contrast to group I and group II introns, none of the known pre-mRNA introns are

capable of self-splicing and the structure of the internal sequence appears to be

unimportant. The conserved sequence elements of these introns are short and located at

the 5' and 3' splice sites (Shapiro and Senapathy, 1987). The consensus sequence at the

5' end of the intron is GUa /g AGU, and at the 3' end is the dinucleotide AG. Yeast and

plant sequences differ slightly in these regions (Teem et al., 1984; Shapiro and Senapathy,

1987) and typically include an additional conserved sequence near the 3' end at the site of

branch formation during splicing (Langford and Gallwitz, 1983; Keller and Noon, 1984).

Splicing of pre-mRNA introns is similar to that of group II introns in that a lariat RNA

intermediate is formed (see Figure 7). However, unlike the self-splicing group I and

group II introns, trans-acting elements are required in addition to the conserved intron

sequences. These elements are small nuclear ribonucleoprotein particles (snRNPs) and other proteins that interact to form large complexes termed spliceosomes. After assembly of the spliceosome on the mRNA, the first of two transesterification reactions proceeds by an attack on the phosphorous atom at the 5' splice junction by the 2'-OH of an A residue located at the branch site to form a lariat intermediate closed by a 2',5-phosphodiester bond. As with the group I and group II splicing mechanisms, the second transesterification reaction proceeds by an attack on the phosphorous atom at the 3' splice 73 site by the now free 3'-OH of the 5' exon, resulting in ligation of the exons and excision

of the intron (Konarska et al., 1985; Perlman et al., 1990).

Introns within nuclear tRNA genes and archaebacterial tRNA and rRNA genes are

clearly different from the group I, group n, and nuclear mRNA introns. Since this

dissertation project includes a study of tRNA intron processing in the archaebacteria, a

more detailed review of the unique structural features and processing requirements of the

nuclear tRNA introns and archaebacterial introns is provided below.

Nuclear pre-tRNA introns:

Introns have been found in nuclear tRNA genes from a wide range of eukaryotic

organisms (Stange et al., 1988; Goodman et al., 1977; van Tol et 1., 1987; Stanching et

al., 1981; Filipowicz and Shatkin, 1983). In all cases, only a subset of an organisms

tRNA genes contain introns. For example, about 10% of the tRNA genes in the yeast

Saccharomvces cerevisiae contain introns (Ogden et al., 1984). The intron-containing tRNAs are restricted to nine tRNA gene families (Tyr, Trp, Phe, Lysuuu, ProuGC.

SercGA* LeuuGAi LeucAA> and Ile u A U ); all genes within each family contain an intron

(Ogden et al., 1984). In contrast to the other major intron groups, all nuclear pre-tRNA introns are small, ranging from 8 to 60 nucleotides (Perlman et al., 1990). The introns are always located at the same site, one nucleotide away from the 3' side of the anticodon.

While some archaebacterial and chloroplast tRNA introns are found at this site, others have been found at different sites within the tRNA as well (see Figure 8). To produce the mature functional tRNA, the pre-tRNA is spliced by two enzymes; an endonuclease that cleaves the precursor at the 5' and 3' splice sites, and a ligase that joins the exons (Peebles et al., 1979; Greer et al., 1983).

The splicing reaction catalyzed by the endonuclease and ligase enzymes of S. cerevisiae is the best characterized (Ogden et al., 1981; Greer et al., 1983b; Greer, 1986). Figure 8. Location of introns within pre-tRNAs encoded by eukaryotic nuclei,

chloroplasts, and archaebacteria.

74 o o o o o o 0 0 0 0 ?4 0 0 0I ^ •Archaebacteria 0-0 46 Chloroplast 0-0 290 - 0 Archaebacteria• 0 - 0 0-0 . Chloroplast 0 -'38 - Nuclear 0 0.37 Chloroplast Archaebacteria t Chloroplast Archaebacteria

Figure 8. The endonuclease and ligase are separable in crude extracts. Both enzymes have been

purified to homogeneity (Phizicky et al., 1986; Reyes and Abelson, 1988). Four

enzymatic activities are required for the splicing reaction (summarized in panel A of Figure

9). The endonuclease provides the cleavage activity and the ligase provides cyclic

phosphodiesterase, polynucleotide kinase, and RNA ligase activities (Greer et al., 1983b;

Peebles et al., 1983). The endonuclease cleaves the pre-tRNA at the 5' and 3' splice sites

to generate a 5' exon with a 2',3' cyclic phosphate terminus, a 3' exon with a 5'-OH

terminus, and the released intron with 2',3' cyclic phosphate and 5'-OH termini (Peebles

et al., 1983). The two exons remain associated following cleavage via the base-pairing of

the anticodon- and acceptor-stems. The cyclic phosphodiesterase activity of the ligase

then cleaves the 2',3' cyclic phosphate terminus of the 5' exon to yield a 2' phosphate and

a 3'-OH. The polynucleotide kinase activity then phosphorylates the 5'-OH of the 3' exon

utilizing the gamma phosphate of ATP. The RNA ligase activity requires prior adenylation of the ligase protein. The adenylate residue is transferred, with the release of pyrophosphate, to the 5’ phosphate termini of the 3' exon. The now activated 5' terminus of the 3' exon is joined to the 3'-OH of the 5' exon with the release of the adenylate moiety. In vitro, the 2' phosphate of the 5' exon terminus is retained following ligation.

In vivo, mature tRNAs lack these 2' phosphates, indicating that a phosphatase is normally present to remove them.

The nuclear tRNA intron endonucleases from sources other than yeast also generate

2',3' cyclic phosphate and 5’-OH cleavage termini, but differences exist in the mechanism of exon ligation. The RNA ligase activity from wheat germ utilizes the same mechanism as that from yeast, although the presence of a phosphate at the 5' exon termini does not appear to be essential (Schwartz et al., 1983). In HeLa and Xenopus laevis cell extracts, the exons are joined by an ATP-independent reaction (see panel B of Figure 9) in which Figure 9. Splicing mechanisms for intron-containing nuclear pre-tRNAs from yeast (A)

and animal cells (B). Exons of the end-matured pre-tRNAs are indicated by

thin lines and introns are indicated by thick lines. The order of splice site

cleavage by the endonuclease, indicated by the division of step one in panel A

into two independent cleavage reactions, is not known to be a general feature

of the yeast splicing mechanism. Abbreviations: OH, terminal hydroxyl; P,

monophosphate; PA, adenosine monophosphate; PO4, terminal 2',3' cyclic

phosphate; ATP, adenosine triphosphate. Taken from Perlman et al. (1990).

77 78

A.

STEP l« STEP 2* STEP 2h ATT

STUCJNl* sruciNG »RNA UCASE « »RNA UGASE ENDONUCLEASE ENtXWUCLEASE STUCINC ENIXINUC LEASE THOSrHOR Y LA TE5 CLEAVES ^JUNCTION CLEAVES V JU N C T IO N OTtNS CYCLIC mOSTHATE V. HYDROXYL

I STEP 2c I STEP2d I STEP J I —£► c = U = o — ► c==;t=o — ► c=^t=o HV) tRNA LIGASE .RNA LIGASE PV) PHOSPHATASE PV) J I ADENYLATES I I U l°'N S I ^ REMOVES II W ('.PHOSPHATE / S _ r. TERMINI / \ I'-PHOSPHATE ;r ax :r V-/

B.

STEP 2 % SPUC1NC tR N A LIGASE ENDONUCLEASE JCHNS CLEAVES JUNCTIONS TERMINI

OH

Figure 9. 79 the ligase catalyzes the direct attack of the 2’,3' cyclic phosphate of the 5' exon by the 5'-

OH of the 3' exon. This reaction utilizes the phosphate at the 5' exon termini in the

phosphodiester bond at the splice junction, so an extra 2'-phosphate in the product is not

generated (Filipowicz et al., 1983).

A common mechanism for coordinating sequential enzymatic reactions is the

formation of a multienzyme complex (Welch, 1977). The physical properties of the

endonuclease and ligase from S. cerevisiae indicate that the enzymes may not act

independently in vivo. The two enzymes do not copurify and the endonuclease behaves

as an integral membrane protein (Peebles et al., 1983) while the ligase appears to be either

a soluble matrix or peripheral membrane protein (Greer et al., 1983b). Despite their

distinct properties, there is good evidence that the two enzymes act conceitedly as a tRNA

splicing complex in vivo. It is known that the tRNA exons released by yeast

endonuclease can be joined by either yeast ligase or T4 RNA ligase plus T4 polynucleotide kinase (Greer et al., 1983a). Greer (1986) used a competition assay to test the ability of either yeast ligase or T4 ligase plus kinase to join the tRNA halves produced by the endonuclease. Yeast ligase products have a 2' phosphate (see above), while T4 ligase products do not. An analysis of the assay products demonstrated that they were predominantly those of the yeast ligase even when the T4 enzymes were present in excess.

These results indicate that the yeast ligase has a preferential access to the endonuclease such as would be provided if the two enzymes were assembled into a tRNA splicing complex. Further evidence for a tRNA splicing complex was presented by Clark and

Abelson (1987). By indirect immune fluorescence using antibodies specific for the S. cerevisiae ligase, they demonstrated that this enzyme was located in the nucleus at two sites: primarily at the inner membrane of the nuclear envelope near the nuclear pores, and a less distinct site in the nucleoplasm within 300 nM of the nuclear envelope. In a strain of yeast in which tRNA ligase is overexpressed, fluoresence staining of the nuclear envelope 80 remains constant while staining of the nucleoplasm is increased. This indicates that there

is a limited number of ligase sites at the nuclear envelope. Since the endonuclease is

believed to be an integral membrane protein, they hypothesize that the endonuclease is the

site for the interaction of ligase with the nuclear envelope. The predominant localization of

the ligase, and presumably endonuclease, near nuclear pores suggests there may be a

connection of the nuclear pore with processing and transport of tRNA to the cytoplasm

(Clark and Abelson, 1987). A relationship between tRNA splicing and nuclear transport

has been suggested by other studies. It has been demonstrated that in Xenopus oocytes,

tRNA splicing occurs in the nucleus and follows 5' and 3' end maturation and most of the

base modifications found in mature tRNA (Melton et al., 1980; Nishikura and DeRobertis,

1981). According to Greer (1986), these results suggest that intron processing in

Xenopus oocytes occurs late in the processing pathway, at or about the same time as nuclear transport. In addition, an S. cerevisiae mutant (rnaM ) with a proposed defect in

RNA transport accumulates intron-containing pre-tRNAs, suggesting a correlation between splicing and transport (Hopper et al., 1978; Hopper et al., 1980).

A single endonuclease can process all of its own as well as heterologous intron- containing pre-tRNAs, indicating that the enzyme interacts with features shared by all of the precursors. Since a comparison of nuclear intron-containing pre-tRNAs reveals very little sequence conservation at the splice junctions or within the introns, conserved bases or structures within the mature tRNA domain of the precursors must play the major role in splice site recognition (Reyes and Abelson, 1988). Point mutations and small deletions within the intron generally have little effect on splicing (Strobel and Abelson, 1986a,

1986b; Greer et al., 1987). Winey et al. (1989) have inserted a synthetic intron , unrelated in sequence to any known intron, into the naturally intron-less tRNAGln from S. cerevisiae. This pre-tRNA was accurately spliced in S. cerevisiae. indicating that the secondary structures within the intron are not important for substrate recognition and 81 splicing. The only conserved features of nuclear tRNA introns is the presence of a purine

proceeding the 5' splice junction and the localization of the splice sites within single­

stranded regions (Reyes and Abelson, 1988). This latter feature is important, since

mutations that result in base-pairing of the splice sites can block splicing entirely (Willis et

al., 1984; Greer et al., 1987; Szekely et al., 1988; Mattoccia et al., 1988). Base-pairing

between the intron and the anticodon occurs in many, but not all, pre-tRNAs. S.

cerevisiae extracts can splice pre-tRNAs with or without this base-pairing, so it is not a

required structure for the yeast system (Willis et al., 1984; Greer et al., 1987).

All tRNAs have a set of conserved bases that interact to stabilize the conserved L-

shaped tertiary structure. Except for the addition of the intron domain, the presence of the

intron does not appear to alter the secondary or tertiary structure found in mature tRNAs

(Lee and Knapp, 1985; Swerdlow and Guthrie, 1984). A model of substrate recognition has been proposed in which the recognition elements for the endonuclease are found among these conserved bases and the structural features they impose (Lee and Knapp,

1985; Reyes and Abelson, 1988). Such a recognition scheme is possible because the introns are in a conserved location; once the endonuclease interacts with conserved features of the mature tRNA domain, a measuring mechanism could be used to locate and cleave the splice sites because they are a fixed distance from the mature tRNA domain.

Mutagenesis experiments have verified that sequences within the mature tRNA domain can affect the recognition of pre-tRNAs by endonuclease (Nishikura et al., 1982; Willis et al.,

1984; Gandini-Attardi et al., 1985; Greer et al., 1987). However, these studies did not demonstrate whether the affect was due primarily to a change in structure or the change in sequence.

Reyes and Abelson (1988) have demonstrated that at least two sequence-specific elements are important for yeast pre-tRNA^e substrate recognition. Sequence-specific contact points for the endonuclease appear to include the conserved residues U8 and C56. 82 U8 is an invarient residue in the single-stranded region between the acceptor stem and D

stem that is involved in a triple base interaction with residues A 14 and A21. Any

nucleotide substitution at U8 blocks the yeast endonuclease activity whether it restores the

triple base interaction or not, suggesting that the affect is due to the change in sequence

and not the loss of the tertiary base pair. Residue C56 of the T loop forms a tertiary

Watson-Ciick base pair with G19 of the D loop. Changing C56 to G56 makes pre-

tRNAphe a very poor substrate for endonuclease. A double mutant, C19 and G56, which

should restore base pairing and thus the tertiary structure, is also an inactive substrate. In

addition, the single mutant C19 is a good substrate in both cleavage and ligation reactions.

Since this latter mutation should abolish base pairing with C56, this tertiary interaction

appears not to be necessary for recognition by endonuclease. Instead, residue C56 itself

is an important recognition element.

In a second set of mutagenesis experiments with yeast pre-tRNAP*16, Reyes and

Abelson (1988) demonstrated that the specificity of cutting is determined by the length of

the anticodon stem and the anticodon loop. In all nuclear pre-tRNA introns, the number

of bases between the 5' and 3' cleavage sites and the top base pair of the anticodon stem is

always eleven and six nucleotides, respectively (Ogden et al., 1984). Insertion of a base

pair into the anticodon stem did not block activity of the endonuclease, but did alter the

specificity of cutting. Consistent with the measuring mechanism model, the excised intron

was extended by one base at both its 5' and 3' ends. Similarly, cleavage of a mutant with

two base pairs inserted into the anticodon stem releases an intron extended by two bases at

both the 5' and 3' ends. These results provided strong support for the substrate recognition model in which the endonuclease interacts with conserved part(s) of the mature tRNA domain, then measures the distance to, and cuts, the two splice sites. Also consistent with the model, deletion of a residue (U33) from the anticodon loop sequence, located 5' of the 5' splice site, did not affect cleavage efficiency but did alter the 5' splice 83 site. Cleavage of this mutant produced an intron which lacked the 5' terminal nucleotide

of the wild-type intron. Since this mutation did not alter the distance from the top of the

anticodon stem to the 3' splice site, this splice site was not affected.

It is possible that the essential residues U8 and C56 serve as the reference points in

the measuring mechanism, but there may be others as well. To determine whether the 5'

and 3' ends of the pre-tRNA are reference points, Reyes and Abelson (1988) extended the

length of the acceptor stem by one base pair. This mutant was an excellent substrate and

produced an intron of the correct size. The residues which serve as reference points are

therefore located between the acceptor stem and the anticodon stem.

Mattoccia et al. (1988) have shown that the substrate recognition properties of the

Xenopus tRNA intron endonuclease generally parallel those of the yeast enzyme. Using

yeast pre-tRNALeu and pre-tRNAPhe derivatives constructed by in vitro mutagenesis,

they demonstrated that the conserved residues U8 and C56 are probable contact points

between the Xenopus endonuclease and substrate and that the cleavage sites are

determined by the length of the anticodon stem. The substrate recognition properties of

the yeast and Xenopus endonucleases are not universal, however. The splicing

endonuclease from wheat germ is highly specific for plant nuclear pre-tRNAs (Stange et

al., 1988). Wheat germ extracts will not splice intron-containing pre-tRNAs from yeast,

Xenopus. and humans, but will splice precursors from other plants such as Nicotiana

(tobacco). At least the vertebrate endonucleases are known to efficiently splice the plant

intron-containing pre-tRNAs (van Tol et al., 1987). Stange et al. (1988) compared plant

intron-containing pre-tRNAs from three different species and found no intron sequence

homology. However, the introns were all short (11 to 13 nucleotides), and the 5' and 3'

splice sites were separated by only four base pairs in the extended anticodon stems of the pre-tRNA structures. These features may be responsible for the differences in substrate recognition since yeast and vertebrate introns are more variable in length and the splice 84 sites are separated by a distance equivalent to five or six base pairs (Stange et al., 1988).

In addition, the yeast splicing ligase is specific for tRNAs, whereas the wheat germ ligase is highly unspecific (Filipowicz and Gross, 1984). In plants, splicing specificity may be governed by the endonuclease alone; in yeast, both enzymes may be involved.

Archaebacterial pre-tRNA introns:

Introns have been discovered in archaebacterial tRNA genes from the sulfur- dependent thermophiles Sulfolobus solfataricus (Kaine et al., 1983; Kaine, 1987),

Thermoproteus tenax (Wich et al., 1987), Thermophilum pendens (Kjems et al., 1989b) and Desulfurococcus mobilis (Kjems et al., 1989a), and from the halophiles Haloferax volcanii. Haloferax mediterranei. and Halobacterium cutirubrum (Daniels et al., 1985;

Daniels et al., 1986; Datta et al., 1989). Several properties of the archaebacterial tRNA introns (Table 1) are similar to those of eukaryotic nuclear tRNA introns. They are all small, ranging in size from 15 to 39 nucleotides for the sulfur-dependent thermophiles, and 75 to 106 nucleotides for the halophiles. They also lack the structural and sequence characteristics of group I, group II, and nuclear pre-mRNA introns, and they require exogenous endonuclease and ligase enzymes for splicing. An important difference between archaebacterial and nuclear tRNA introns, however, is their locations. All nuclear tRNA introns are located one nucleotide 3' to the anticodon. While most archaebacterial introns are located at this position, a few are not (see Table 1 and Figure

8 ). T. pendens contains an 18 nucleotide intron within the variable loop of tRNA^ly

(Kjems et al., 1989b). In T. tenax. an 18 nucleotide intron is located within the anticodon of tRNA 1^ 11 and a 16 nucleotide intron is located within the 5' side of the anticodon stem of tRNA A 13 (Wich et al., 1987). Since it has been demonstrated that the conserved position of nuclear tRNA introns is critical to their accurate removal (Reyes and Abelson,

1988), the variable intron positions within archaebacterial tRNAs suggests that splicing 85

Table 1. Introns in archaebacterial genes.

Organism Gene Intron Size Intron Location

Halobacterium cudrubmm tRNATlP 105 37

Haloferax mediterranei tRNATip 104 37

Haloferax volocanii tRNATlP 106 37 tRNAMcl 75 37

Desulfurococcus mobilis tRNAMe* 39 37 tRNACys 30 37 23S rRNA 622 2124

Staphvlothermus marinus 23S rRNA 56 2096 23S rRNA 54 2769

Sulfolobus solfataricus tRNAdy 15 37 tRNAMet 18 37 tRNALeu 15 37 tRNAPhe 18 37 tRNASer 25 37

Thermofilum pendens tRNAdy 18 46

Thermoproteus tenax tRNA^a 16 29 tRNALeu 18 34 tRNAiMet 20 37 86 involves a unique substrate recognition mechanism. A tRNA intron endonuclease activity has been detected in cell extracts of organisms from all three major branches of the archaebacteria, though that from H. volcanii has been the best characterized. An archaebacterial ligase activity that is capable of joining the tRNA 5' and 3' exon sequences following cleavage by the endonuclease in vitro has not been detected (Thompson, 1990).

The mechanism of tRNA intron processing in H. volcanii has been studied in detail.

Thompson and Daniels (1988) developed an in vitro assay for the tRNA intron endonuclease from H. volcanii. The enzyme was shown to precisely excise the 104 nucleotide intron from H. volcanii (or the closely related H. mediterranei’) pre-tRNATrP substrates. As occurs from cleavage of nuclear pre-tRNAs by the yeast and Xenopus endonucleases, cleavage of the phosphodiester bonds yielded products with 5'-OH and

2',3'-cyclic phosphate termini. The reaction requires divalent cations (Mg2+ or Ca2+) or spermidine and is inhibited by monovalent cations. Although the tRNATrP intron is located in the same position as the nuclear tRNA introns, the H. volcanii endonuclease was not capable of removing the intron from a yeast pre-tRNAPhe substrate (Thompson and Daniels, 1988), and the S. cerevisiae nuclear tRNA intron endonuclease could not remove the intron from pre-tRNATlP (Thompson and Daniels, 1990). This suggests that these enzymes require different structures or sequences for substrate recognition and cleavage. As discussed in the previous section, tRNA intron endonucleases from eukaryotes require the presence of mature tRNA structure and specific sequence elements in the tRNA domain of pre-tRNAs for recognition. Once the endonuclease interacts with the mature tRNA domain, it uses a measuring mechanism to sense the distance of the splice sites from the top of the anticodon stem. Thompson and Daniels (1988) determined that a mature tRNA-like structure and sequences above the anticodon stem are not required for substrate recognition and cleavage by the H. volcanii enzyme. A tRNATrP substrate

(A13115) that lacks all but the anticodon stem and loop regions of the mature tRNA was 87 accurately and efficiently cleaved. Intron deletion mutants have also been constructed to

investigate the possibility that the intron affects necessary structures in the precursor or is itself a site for recognition by the endonuclease. A tRNATlP substrate retaining only 22 nucleotides of the wild-type intron was accurately cleaved, though at a slightly lower efficiency (Thompson and Daniels, 1988). As in eukaryotic nuclear tRNA processing reactions, the archaebacterial intron appears to play only a passive role in splicing.

The ability of the H. volcanii endonuclease to process A13115 and A167 indicated that only those sequences and structures at the exon-intron boundaries are required for recognition and cleavage by the endonuclease. A comparison of the structural and sequence features of the known archaebacterial intron-containing pre-tRNAs revealed that the two cleavage sites were often located in two three-nucleotide bulge loops separated by four base pairs (Thompson et al., 1989). To examine the role of this proposed structure in cleavage by the H. volcanii intron endonuclease, Thompson and Daniels (1990) constructed a series of mutant tRNATrP RNAs with alterations in the exon-intron boundary regions. For use as the starting material for these mutant pre-tRNAs, the wild- type (016) and shortened intron (0167) genes were reconstructed so that in vitro transcription of these genes would yield end-matured substrates (see Figure 10). Four of these mutant pre-tRNAs lacked the ability to form the conserved bulge loop structure.

These included a deletion of the four nucleotides from the intron sequence that participate in the base pairing between the bulge loops (AGGAG), a deletion of the 3' cleavage site loop (AAUA), an insertion of three nucleotides into the intron which changes the 5' cleavage loop to a base-paired structure (+UCU), and an insertion of three nucleotides into the intron which places the 5' cleavage site within an internal loop structure (+AGA) (refer to Figure 10). Each of these altered structures eliminated cleavage, indicating that the endonuclease requires a structural element defined by the presence of the two bulge loops.

The insertion of a base pair into the anticodon stem above the two bulge-loop structures Figure 10. Proposed secondary structures of the 016,0167, and Trp-Model RNAs.

Cleavage sites for the H. volcanii endonuclease are indicated by arrows.

88 f?MaD M ? f < 016 c G A G-C G-C A G c

c > U ^ G-C ^ A U A-U G U C - / 0-C C S y A G-C G-C A y U AU c C-© c u A-U c UG G-C G Ac Ac GU —G-C '— 5 AG-U C C-G A I A C U U-A U II U pG-C G G-C G-C - A-U U-A C G G c G G C-G C-G G-C C G C-G C-G C-G g U-A U-A C-G C-G G-C U-A - U C U A-U G-C U-G A-U G-C G-U C-G - c-GA“ C-°# U-G - G-C C-G C-G C-G G-C G-C G-C - U A U C-G C-G C-G G-U C-G a - - a c CC A 7 6 1 0 A C AC u U-A A U / f « n n r ! * A * U r r r I! A iue 10. Figure p- el d o -M rp T r r 'G A , A U G U' 2 G A A C A C-G A G- -C pG C-G C-G V-k G-C G-C G-C G-C U-A G-C U-A C-G C-G G-C G-C G-C C-G G-C C A CC A A C U * 9 8 90 resulted in only a minor decrease in cleavage efficiency and no affect on cleavage accuracy. This confirms that, in contrast to the eukaryotic nuclear endonuclease, the

H. volcanii endonuclease does not sense the distance from the top of the anticodon stem to the 5' and 3' splice sites to identify the correct cleavage sites. To determine whether the distance (four base pairs) between the two bulge loops is important for accurate cleavage, an additional base pair was inserted between the loops. This substrate was accurately cleaved, but at a much lower efficiency. When a single nucleotide was added to the 5' bulge loop exon sequence, the major product was cleaved accurately, though a small amount of the released introns were extended by one nucleotide at the 5’ terminus. From these results, it appears that the halophilic endonuclease identifies its cleavage sites by a mechanism which senses the distance between the two cleavage site loops. However, the ability of the enzyme to find the correct cleavage sites within these latter insertion mutants suggests that nucleotide recognition or other factors may also be involved. The accurate cleavage of a 35-nucleotide model substrate (Trp-Model RNA; Figure 10) containing only those sequences and structures present at the exon-intron boundaries provided conclusive evidence that only these features are required for substrate recognition and cleavage by the

H. volcanii endonuclease (Thompson and Daniels, 1990).

Archaebacterial rRNA introns:

Although a large number of rRNA genes from a wide range of archaebacteria have been sequenced, introns have only been detected within the 23S rRNA genes of the sulfur-dependent extreme thermophiles Desulfurococcus mobilis and Staphvlothermus marinus (Tablel; Kjems and Garrett, 1985; 1991). The D. mobilis gene contains a single

622 bp intron, while the S. marinus gene contains two introns which are 56 bp and 54 bp long. All three introns interrupt highly conserved functionally important domains of the

23S rRNAs; the D. mobilis intron and the 56 nucleotide S. marinus intron are located within domain IV, and the 54 nucleotide intron is located within domain V (Kjems and

Garrett, 1985,1991). The D. mobilis intron has many properties that make it unique

among the archaebacterial introns. This intron is much larger than the others and it

includes two short sequences that are conserved within group I introns, although it lacks

the conserved core structure and other features of group I introns (Kjems and Garrett,

1985). Following excision of the 622 nucleotide intron, its ends are ligated to form a

stable circular RNA containing the entire intron sequence (Kjems and Garrett, 1988).

Finally, there is a large open reading frame within the intron that is translated through the

ligation site of the released circular form. The function of the encoded protein is unknown

(Kjems and Garrett, 1988).

The small S. marinus introns appear to be rapidly degraded after excision in vivo,

and there is no evidence for their circularization. Cleavage of the pre-rRNAs from both organisms by homologous cell extracts are protein-dependent and produce products with

3'-phosphate and 5'-hydroxyl termini (Kjems and Garrett, 1988; Kjems and Garrett,

1991). This is analogous to the nuclear pre-tRNA splicing mechanism of vertebrates, but in contrast to the yeast and archaebacterial pre-tRNA cleavage mechanisms which generate

2',3'-cyclic phosphate and 5'-hydroxyl termini (see Figure 7). The sequences at the exon-intron boundaries of the pre-rRNAs can assume a structure consisting of two three- nucleotide bulge loops separated by four base pairs, as is conserved among the archaebacterial intron-containing pre-tRNAs (Kjems and Garrett, 1991). Extracts from several sulfur-dependent thermophiles and methanogens which lack rRNA introns can accurately cleave the intron-containing pre-rRNAs (Kjems and Garrett, 1991). Similarly, extracts from a wide range of archaebacteria can accurately cleave Haloferax pre-tRNATlP substrates (Thompson, 1990). This might suggest that the archaebacterial splicing enzymes have multiple cellular functions, but this has yet to be demonstrated. MATERIALS AND METHODS

The enzymes DNA polymerase I large fragment (Klenow), SI nuclease, and all restriction enzymes, with the exception of BstNI and BstBI. were obtained from Bethesda

Research Laboratories (BRL; Gaithersburg, MD). BstNI. BstBI. and RNA ligase were purchased from New England Biolabs (NBL; Beverly, MA). T4 polynucleotide kinase,

AMV reverse transcriptase, T7 RNA polymerase, Sequenase^M (modified T7 DNA polymerase), 5-bromo-4-chloro-3-indolyl-B-D-galactoside (X-gal), isopropyl-B-D- thiogalactopyranoside (IPTG), phenol (ultrapure), Tris (ultrapure), and acrylamide

(molecular biology grade) were obtained from United States Biochemical (USB;

Cleveland, OH). Purified RNase P protein subunits from Escherichia coli and Bacillus subtilis were gifts from N. R. Pace (Indiana University, Bloomington, IN). The radionucleotides [oc-32p]ATP (3,000 Ci/mmol), [a-32p]dATP (3,000 ci/mmol), and [y-

32p] ATP (7,000 Ci/mmol) were obtained from ICN Radiochemicals (Irvine, CA).

The oligonucleotides used throughout this study were synthesized by The Ohio

State University Biochemical Instrument Center. The following materials were obtained from Sigma Chemical Company (St. Louis, MO): X-ray film (Kodak X-OMAT AR and

X-OMAT RP), developer (GBX), fixer (GBX) polyethylene glycol (PEG) MW 8000,

PEG MW 600, diethylpyrocarbonate (DEPC), zymolase, polymin P, ribonucleotides, deoxyribonucleotides, lysozyme, RNase A, Sephadex G50, Sephadex G25-80, and

Sephadex G200. All antibiotics except mevinolin were also purchased from Sigma.

Mevinolin was a gift from Merck & Co., Inc. (Rahway, NJ). The liquid column

92 93 chromatography mediums DEAE Sephacel, Sepharose 4B, and Sephacryl S-400 were

from Pharmacia LKB Biotechnology (Piscataway, NJ). Zeta Probe nylon blotting

membrane, colony hybridization membrane disks, and protein concentration assay dye

reagent were purchased from Bio-Rad Laboratories (Richmond, CA).

Bacterial Strains and Plasmids

The strains of Escherichia coli. Haloferax volcanii. Thermoplasma acidophilum. and

Saccharomvces cerevisiae used in this study, along with their genotypes and origins, are

listed in Table 4 (appendix). E. coli cultures were maintained on YT agar (8 g tryptone, 5

g yeast extract, 5 g NaCl, and 15 g agar per liter of distilled water) at 4 °C for periods up

to three months. When necessary for the selection of plasmid-containing strains, the

appropriate antibiotics were added at the following concentrations: ampicillin, 75 (ig/ml;

kanamycin, 30 pg/ml; chloramphenicol, 30 |ig/ml. H. volcanii cultures were maintained

on H. volcanii agar (125 g NaCl, 45 g MgCl 2-6 H2O, 10 g MgS04-7 H 2O, 10 g KC1,

1.34 g CaCl2-2 H 2 0 , 3 g yeast extract, 5 g tryptone, and 15 g agar per liter of distilled

water) at room temperature for periods up to three months. When necessary for the

selection of plasmid-containing strains, mevinolin was added at a concentration of 20 |iM.

T. acidophilum was maintained by ten-fold dilutions of cultures growing at 56°C in a

medium consisting of 3 g KH 2PO4 , 0.5 g MgS04-7 H 2O, 0.25 g CaCl2-2 H 2 0 , 0.2 g

(NH4)2S04,1 g yeast extract, and 10 g glucose per liter of distilled water at pH 1.5.

Saccharomvces cerivisiae was maintained at 4 °C on YPD medium (10 g yeast extract, 20 g peptone, 20 g glucose, and 15 g agar per liter of distilled water) for periods of up to three months. A second set of all cultures was maintained at -70 °C in the indicated medium (minus agar) supplemented with 15 % (v/v) glycerol. 94 Unless otherwise indicated, growth temperatures for these organisms were: E. coli.

37°C; H. volcanii. 37°C; T. acidophilum. 56°C; S. cerevisiae. 30°C. All broth cultures were grown with constant shaking, except for T. acidophilum which was grown stagnant with periodic agitation.

The plasmid vectors pT71, pT72, pIBI31, M13mpl8, and M13mpl9 were purchased from International Biotechnologies, Inc. (IBI; New Haven, CT). The plasmid pUC18 was obtained from BRL. W. F. Doolittle (Dalhousie University, Halifax, Nova

Scotia, Canada) generously provided the H. voIcanii-E. coli shuttle vector pWL102 and

H. volcanii cosmid clones. The Bacillus subtilis tRNAAsP gene clone pDW128, the S. cerevisiae tRNAPro gene clone pGKNl, and the 4.5S RNA gene clone p23-4.5S were gifts from N. Pace, G. Knapp (Utah State University, Logan, UT), and C. Guerrier-

Takada (Yale University, New Haven, CT), respectively.

Small Scale Isolation of Plasmid DNA from

E.. £0li and H.- volcanii

Plasmid DNA was isolated from small cultures of E. coh by a boiling-lysis procedure based on a method described by Maniatis et. al. (1982). A 5-ml volume of LB supplemented with the appropriate antibiotic was inoculated with a single colony and incubated overnight with shaking at 37°C. The cells were harvested then resuspended in

550 pi of STET buffer [8 % sucrose, 0.5 % Triton X-100,50 mM EDTA (pH 8.0), and

10 mM Tris-Cl (pH 8.0)] and transferred to an Eppendorf tube. A 50 pi volume of lysozyme (10 mg/ml in STET buffer) was added to the cell suspension, followed by vortexing for 5 sec. The tube was immediately placed in a boiling water bath for one min.

After boiling, the cellular debris was removed by centrifugation in a microcentrifuge for

10 min. The gelatinous pellet was removed with a sterile toothpick and discarded. The 95 cleared lysate was extracted with an equal volume of phenol, then the DNA was precipitated with 0.8 volumes of isopropanol at -20 °C for 30 min. The precipitate was pelleted by centrifugation for 10 min in a microcentrifuge. After discarding the supernatant, the pellet was dried under vacuum then resuspended in 40 (J.1 of sterile water and stored at -20 °C.

Plasmid DNA was isolated from 5-ml H. volcanii cultures as described above, except lysozyme was omitted and an equal volume of TE was added to the cleared lysate to decrease the salt concentration prior to phenol extraction.

Large Scale Isolation of Plasmid DNA from £.. coli

Plasmid DNA was isolated from large cultures of E. coh by an alkaline lysis procedure essentially as described by Maniatis et. al. (1982). A one-liter volume of LB broth contained in a two-liter flask was inoculated with a 5-ml overnight broth culture.

After the addition of the appropriate antibiotic, the culture was incubated overnight with shaking at 37°C. The cells were harvested by centrifugation in a Sorvall GSA rotor at

8,000 rpm for 10 min at 4°C. The supernatant was discarded and the bacterial pellet was resuspended in 10 ml of solution I (50 mM glucose, 25 mM Tris-Cl, pH 8.0, 10 mM

EDTA, and 5 mg/ml lysozyme). The suspension was evenly aliquoted among four 50-ml

Oakridge centrifuge tubes, then incubated at room temperature for 5 min. A 10-ml volume of solution II (0.2 N NaOH, 1 % SDS) was added to each tube and the contents were mixed by gentle inversion. The tubes were kept on ice for 10 min prior to adding 7.5 ml of an ice-cold solution of 3 M KOAc (pH 4.8). The suspensions were mixed by inverting the tubes sharply several times then were kept on ice for an additional 10 min. The bacterial debris was pelleted by centrifugation in a Sorval SS34 rotor at 17,000 rpm for 30 min at 4°C. The supernatants were transferred to 30-ml corex tubes and the plasmid DNA was precipitated by the addition of 0.6 volumes of isopropanol. After standing at room

temperature for 15 min, the precipitate was pelleted by centrifugation at 10,000 rpm for 30

min at room temperature. The supernatants were discarded and the pellets were washed

once with 70 % ethanol then dried under vacuum and resuspended in a combined volume

of 18 ml TE buffer. The plasmid DNA was then purified by centrifugation to equilibrium

in CsCl-ethidium bromide gradients (Maniatis et al., 1982).

Large Scale Isolation of Plasmid DNA from H.. volcanii

A 500-ml volume of H. volcanii medium contained in a one liter flask was

inoculated with 10 ml of a late log culture of H. volcanii strain WFD11 containing the

desired plasmid. The culture was incubated with shaking at 37°C until late log phase was

reached (2-3 days). Cells were harvested in a Sorval GSA rotor at 5,000 rpm for 15 min

at 4°C. The resulting pellet was washed once with 50 ml of 1 M NaCl, then resuspended

in 20 ml of a buffer containing 1 M NaCl and 0.1 M EDTA. To lyse the cells, 7 mM

sodium deoxycholate was added (final concentration) followed by incubation on ice for 30

min. The lysate was transferred to Ti60 ultracentrifuge tubes and cellular debris and chromosomal DNA was pelleted by centrifugation in a Beckman Ti60 rotor at 20,000 rpm for 30 min at 4°C. The cleared lysate was transferred to Oakridge tubes, and plasmid

DNA was precipitated by the addition of 10% (w/v) PEG 8,000 and incubation on ice for

1 hr. The DNA was pelleted by centrifugation in a Sorval SS34 rotor at 8,000 rpm for 15 min at 4°C. The supernatant was discarded and the pellet was resuspended in 9 ml of TE buffer. The plasmid DNA was purified by centrifugation to equilibrium in CsCl-ethidium bromide density gradients as described by Maniatis et al. (1982). 97 Isolation of U. volcanii Chromosomal DNA

H. volcanii total DNA was isolated from 5-ml late-log phase cultures. The cells

were harvested then resuspended in 0.7 ml of TE buffer (1 mM EDTA, 10 mM Tris-Cl,

pH 8.0) containing 1% Triton X-100. The cell lysate was transferred to an Eppendorf

tube and an equal volume of phenol was added followed by gentle mixing of the

suspension on a rocking platform at room temperature for 20 min. The organic and

aqueous phases were separated by centrifugation in a microcentrifuge for 5 min. The

aqueous phase was transferred to a new Eppendorf tube and extracted with an equal

volume of phenokchloroform (1:1) as described above. The DNA was precipitated from

the aqueous phase with the addition of 0.1 volume NaOAc (pH 5.4) and 2.5 volumes of

95% ethanol at -20°C for 1 hr. The precipitate was pelleted by centrifugation in a

microcentrifuge for 10 min, washed once with 70% ethanol, dried, then resuspended in

100 pi of TE buffer. Before digesting the DNA with restriction enzymes, the suspension

was kept at 4°C for at least 24 hr to allow the DNA to completely dissolve in the buffer.

Isolation of Double-Stranded, Replicative Form (RF)

Bacteriophage M13 DNA

A 50-ml volume of LB broth (10 g tryptone, 5 g yeast extract, and 5 g NaCl per liter distilled water) contained in a 250-ml flask was inoculated with a single colony of the E. coli strain MV1190. A second 50-ml volume of LB broth in a 250-ml flask was inoculated with a single phage plaque from an infected lawn of MV1190 cells. Both cultures were incubated with shaking at 37 °C overnight A 500-ml volume of 2X YT broth (16 g tryptone, 10 g yeast extract, 5 g NaCl per liter of distilled water) contained in a two-liter flask was inoculated with the overnight MV1190 culture. After incubation with 98 shaking at 37 °C for five hours, the overnight phage-infected culture was added. The

incubation was continued for an additional 15 min to allow for infection before 250 pi of

chloramphenicol (30 mg/ml in ethanol) was added to the culture. After an additional 90

min incubation, double-stranded phage DNA was isolated from the culture using the

alkaline lysis plasmid isolation procedure described above.

Isolation of Bacteriophage M13 Single-Stranded DNA

To prepare single-stranded M13 DNA for sequencing, a 2-ml volume of 2X YT

broth was inoculated with 20 pi of an overnight E. coli strain MV1190 culture and a single

plaque from a lawn of infected MV1190 cells. The culture was incubated with shaking at

37°C for 6-8 hours. A 1.4-ml volume of this culture was transferred to an Eppendorf tube

and the cells were pelleted by centrifugation in a microcentrifuge for 10 min. One ml of

the phage-containing supernatant was transferred to an Eppendorf tube. To precipitate the phage, 220 pi of PEG/NaCl solution (20 % PEG 8,000,2.5 M NaCl) was added to the

supernatant. The suspension was mixed by vortexing then incubated at 4°C for 15 min. before the phage were pelleted by centrifugation in a microcentrifuge for 10 min. The supernatant was discarded and the inside wall of the tube was wiped off using a paper wipe tightly wrapped around a toothpick to remove residual PEG and 2X YT medium.

The pellet was resuspended in 100 pi of TE then extracted with an equal volume of phenol. After an additional extraction with an equal volume of chloroform, the DNA was precipitated from the aqueous phase by adding 8 pi of 3 M NaOAc, pH 5.8, and 300 pi of ethanol. The solution was mixed by vortexing then kept at -70°C for 20 min. The DNA was pelleted by centrifugation in a microcentrifuge for 10 min and then dried under vacuum, resuspended in 15 pi of H 2O, and stored at -20°C. 99 Isolation ofH. volcanii and X- acidophilum RNA

To isolate total cellular RNA, cells harvested from a 25-ml H. volcanii. or 250-ml T. acidophilum. late log phase culture were gently suspended in 1.25 ml of lysis buffer consisting of 10 mM Tris-Cl, pH 8.0,10 mM NaCl, 1 mM trisodium citrate, and 1.5 % sodium dodecyl sulfate (SDS). After 35 pi of diethyl pyrocarbonate (DEPC) was added, the lysate was incubated at 37°C for 10 min and then on ice for 10 min. The addition of

DEPC was omitted if the RNA was to be used as template for reverse transcriptase.

NaCl-saturated water (625 pi) was added and mixed into solution by gently inverting the tube several times; this was followed by incubation on ice for 15 min. This suspension was transferred to Eppendorf tubes, and the SDS-protein-DNA precipitate was pelleted by centrifugation for 10 min in a microcentrifuge. The supernatants were transferred to clean

Eppendorf tubes and the RNA was precipitated with 2.5 volumes of ethanol at -70°C for

30 min. The precipitate was collected by centrifugation, washed once with 70 % ethanol, air-dried, and then resuspended in DEPC-treated water.

Oligonucleotide Preparation

Oligonucleotides received from the O.S.U. Biochemical Instrument Center were heated at 56°C overnight to remove blocking groups. After the oligonucleotide suspension was cooled to room temperature, a 200-pl volume was transferred to an Eppendorf tube and the buffer was removed in a Sorvall Speed Vac. The resulting DNA pellet was washed once with 100 pi H2O, dried in the Sorval Speed Vac, then resuspended in 100 pi

TE and stored at -20°C. 100 Determination of RNA, DNA, and Protein Concentrations

To quantitate and qualitate DNA or RNA in aqueous solutions, optical density

readings at A 26O and A 28 O were recorded. The A 26O reading allows the concentration of

nucleic acid in the sample to be calculated. An O.D. of 1.0 corresponds to approximately

50 (ig/ml of double-stranded DNA and 40 (ig/ml for single-stranded DNA or RNA

(Maniatis et al„ 1982). For oligonucleotides, an O.D. of 1.0 corresponds to a

concentration of approximately 33 |ig/ml, assuming equal amounts of the bases G, A, T,

and C (Boorstein and Craig, 1989). The ratio between the readings taken at 260nm and

280nm (A 260/A280 ) was used to estimate the purity of the nucleic acid suspension. Pure

preparations of DNA and RNA have A 260/A28 O ratios of 1.8 and 2.0, respectively

(Maniatis et al., 1982). Contamination with protein or phenol results in a lower ratio.

The concentration of protein in aqueous solutions was determined by use of a Bio-

Rad protein assay dye reagent according to the manufacturer's directions (Bio-Rad,

Richmond, CA). This dye-binding assay is based on the observation that the absorbance

maximum for an acidic solution of Coomassie Brilliant Blue G-250 (dye reagent) shifts

from 465nm to 595nm when binding to protein occurs. An increase in protein

concentration yields an increase in absorbance at 595nm. By extrapolation from a

standard curve derived from known concentrations of purified bovine serum albumin, the protein concentrations of unknown samples were determined.

Nucleic Acid Precipitation

Nucleic acids were precipitated from solution by the addition of 0.1 volume 3 M sodium acetate, pH 5.8, and 2.5 volumes 95% ethanol, followed by incubation at -70°C for 30 min. The precipitate was pelleted by centrifugation in a microcentrifuge for 10 min 101 at room temperature. The pellet was dried under vacuum then resuspended in the

appropriate buffer.

Electrophoresis and Visualization of Nucleic acids and Proteins

Agarose gel electrophoresis. Agarose gel electrophoresis was used to separate,

identify, and purify large DNA fragments (>500 bp). The procedure used was essentially

that described by Maniatis et al. (1982). Briefly, gels were prepared in IX TBE buffer

with an agarose concentration (0.6 to 1.5%) appropriate for the size of DNA fragments to

be separated. The DNA samples were suspended in IX DNA loading buffer (2% Ficoll

400,10 mM EDTA, pH 8.0,0.1% SDS, and 0.025% bromphenol blue) and loaded into

pre-formed sample wells. Gels were typically ran in IX TBE buffer at 8 V/cm of gel,

then stained by submerging the gel in a dilute solution of ethidium bromide (~0.5 |Xg/ml in

water). Following staining, the DNA was visualized by placing the gel on a UV

transilluminator for photographing.

Nondenaturing polyacrylamide gel electrophoresis. Small DNA fragments (<500

bp) were separated by electrophoresis through polyacrylamide gels. The gel apparatus

consisted of clean 20 X 20 cm glass plates assembled with 0.5 mm spacers on three sides.

A light coating of Vasaline was applied to the spacers to prevent leakage during gel polymerization. The polyacrylamide gel solution was prepared by combining 30 ml of 4.5

to 12% (depending on size of fragments to be separated) polyacrylamide solution in IX

TBE buffer [29:1 (w/w) ratio of acrylamide to bis-acrylamide) and 300 |il of 10% ammonium persulfate. The gel solution was degassed under vacuum then 30 |il of

TEMED was added. The solution was mixed by gentle swirling and poured between the glass plates. A well-forming comb was inserted into the solution between the glass plates and clamped into place. After the gel had polymerized, the comb and the bottom spacer 102 were removed; residual Vas aline and unpolymerized acrylamide was removed from the bottom of the gel with hot tap water. The gel assembly was placed into IX TBE buffer contained in the lower chamber of a vertical electrophoresis apparatus. The gel wells were rinsed and filled with buffer. DNA samples were suspended in IX DNA loading buffer and loaded into the gel wells. A wick of Whatmann 1M chromatography paper was inserted between the glass plates to rest on the surface of the gel; the other end of the paper was placed into IX TBE buffer contained in the upper chamber of the electrophoresis apparatus. Gels were typically run at 400 V. After electrophoresis, the gel assembly was removed from the electrophoresis apparatus and the glass plates were carefully pried apart, taking care to leave the gel attached to one of the plates. The gel, attached to the plate, was stained for 10 to 30 min in a solution containing ~0.5 |ig/ml ethidium bromide.

Excess stain was rinsed away with tap water, and the gel and plate were wrapped with

Saran wrap. The gel was placed inverted on a UV transilluminator for photographing.

Denaturing polyacrylamide gel electrophoresis. Denaturing polyacrylamide gels were used to separate RNAs and single-stranded DNAs. The gel was assembled as described above except the acrylamide solution included 8.3 M urea. In addition, large gels (32 X 40 cm) with 0.5 mm spacers were often prepared; these required 80 ml of acrylamide solution, 800 |il 10% ammonium persulfate, and 80 (il of TEMED. These gels were typically run at 1100 V. For the separation of DNA sequencing reaction products, large gels with 0.4 mm spacers and shark-tooth well-forming combs were used; these required 60 ml of acrylamide solution, 600 pi 10% ammonium persulfate, and 80 |il of

TEMED. Sequencing gels were run in a BRL Model S2 sequencing gel electrophoresis apparatus at 1600 V to give a gel temperature of about 50°C.

After electrophoresis, nucleic acids were visualized either by staining with ethidium bromide as described above or by autoradiography for radiolabeled nucleic acids. For autoradiography, the gel was transferred to a sheet of used, developed X-ray film, 103 covered with Saran wrap, then overlayed with a sheet of Kodak X-ray film (X-OMAT AR or X-OMAT RP) in a film cassette containing two intensifying screens (intensifying screens were omitted for sequencing gels). The film was allowed to expose at either -

70°C or at room temperature. The film was developed with Kodak developer and fixer as described by the manufacturer.

SDS-polvacrvlamide discontinuous gel electrophoresis (SDS-PAGE).

Polyacrylamide gel electrophoresis in the presence of SDS (denaturing condition) was used to separate proteins on the basis of molecular size. The method used was essentially that described by Laemmli (1970). Glass plates (20 X 20 cm) for gel casting were assembled with 1.5 mm spacers as described above. A 60- ml separating gel solution was prepared in Tris Cl/SDS pH 8.8 buffer (375 mM Tris-Cl, 0.1% SDS) with a quantity of

30%:0.8% (w/w) acrylamide to bisacrylamide stock solution to give the desired final concentration (8 to 15%), and 600 pi of 10% ammonium persulfate. The solution was degassed under vacuum for a few minutes prior to the addition of 60 pi TEMED. The solution was gently swirled then poured between the glass plates until the height of the solution was about 4 cm from the top of the vertically positioned plates. Isopropanol was carefully layered on top of the acrylamide solution, and the gel was allowed to polymerize for 30 min at room temperature. After polymerization, the isopropanol was poured off and the top of the gel was rinsed with water, then carefully dried by inserting paper towels between the glass plates. A 20-ml stacking gel solution consisting of 4% acrylamide

(from a 30% acrylamide/0.8% bisacrylamide stock solution) in TrisCl/SDS pH 6.8 buffer

(125 mM Tris-Cl, 0.1% SDS) was prepared. As above, 200 pi of 10% ammonium persulfate was added, the solution was degassed, then 20 pi of TEMED was added. The solution was gently swirled then poured on top of the separating gel. A well-forming comb was then inserted into the stacking gel solution. The stacking gel was allowed to polymerize for 1 hr at room temperature. The comb and bottom spacer were removed and 104 residual Vaseline was removed with hot tap water. The gel assembly was placed into a

vertical gel electrophoresis apparatus as described above for nondenaturing

polyacrylamide gels, except the buffer was IX SDS electrophoresis buffer (15.1 g Tris

base, 72.0 g glycine, and 5 g SDS per liter of distilled H 2O, pH 6.8 ). Protein samples

were prepared for electrophoresis by the addition of 4X SDS sample buffer (3.04 g Tris

base, 40 ml glycerol, 4 g SDS, 4 ml 2-mercaptoethanol, 1 mg bromphenol blue, and H 2O

to a final volume of 100 ml at pH 6 .8 ) to a final concentration of IX. The samples were

boiled for 5 min then loaded into the gel wells previously filled with SDS electrophoresis

buffer. One end of a wick of 3M Whatman paper was inserted between the plates to rest

on top of the sample wells. The other end of the wick was placed into the top buffer

chamber of the electrophoresis apparatus. The gel was run at 20 mA of constant current

until the tracking dye entered the separating gel at which time the current was increased to

30 mA. After electrophoresis, the gel assembly was removed from the electrophoresis

apparatus and the glass plates were carefully pried apart. For staining, the gel was

transferred to a dish containing 500 ml of Coomassie blue staining solution (50% v/v

methanol, 0.05% w/v Coomassie Brilliant Blue R, 10% v/v acetic acid, in H 2O) and

agitated slowly for 2 hr. The staining solution was poured out and replaced with 500 ml

of destaining solution (5% v/v methanol, 7% v/v acetic acid, 88 % H2O) with continued

agitation for 1 hr. To quicken the destaining process, Kimwipes were included in the destaining solution to bind eluted dye. The solution was poured out and replaced with a fresh 500 ml volume of destaining solution. Destaining was continued until blue protein bands and a clear background were obtained. Destained gels were stored either in water or tightly wrapped in Saran wrap. 105 UV Shadowing of Nucleic Acids

It was often desired to visualize and recover unlabeled RNA or DNA from polyacrylamide gels without staining with ethidium bromide. This was accomplished by

UV shadowing. After electrophoresis, the gel was sandwiched between two sheets of

Saran wrap and placed on a thin layer chromatography plate containing a fluorescent (254 nm) indicator. The gel then was illuminated with a long wave (300 nm) UV light source held a few inches above the gel. Nucleic acid bands were visualized as shadows on a green background. Identified nucleic acids were recovered from the gel as described below.

Recovery of RNA and DNA from Electrophoresis Gels

DNA was recovered from agarose gels by electrophoresis onto DEAE paper (NA45

DEAE membrane; Schleicher and Schuell, Keene, NH). DEAE paper was pre-treated as described by the manufacturer. After gel electrophoresis and ethidium bromide staining in

TBE buffer, the fragment band of interest was visualized with UV light. A horizontal slit was cut in the gel ahead of the band to be recovered. A strip of DEAE paper was inserted into the slit and electrophoresis was resumed until the DNA was attached to the paper (an additional piece of DEAE paper was often inserted behind the band to keep larger fragments from contaminating the band of interest). The paper strip was removed from the gel and washed in TE buffer to remove residual agarose and TBE buffer. The paper was then transferred to an Eppendorf tube containing 300 pi of TEN buffer (10 mM

Tris-Cl, pH 8.0,1 mM EDTA, and 1.2 M NaCl) and the DNA was eluted by incubation at

65°C for 30 min with occassional vortex mixing. After elution, the suspension was transferred to a new Eppendorf tube and the paper strip was washed with an additional 106 100 pi of NET buffer. The wash volume was added to the initial 300 pi volume, and the eluate was extracted with an equal volume of phenol. The DNA was precipitated by the addition of 2.5 volumes of 95% ethanol followed by incubation at -70°C for 30 min. The

DNA was pelleted by centrifugation in a microcentrifuge for 10 min, washed in 70% ethanol, dried, then resuspended in the desired volume of TE buffer.

DNA and RNA molecules were recovered from polyacrylamide gels by passive elution. The nucleic acid bands present in the gels were visualized by ethidium bromide staining, UV shadowing, or autoradiography. A gel slice containing the desired band was excised from the gel and placed in an Eppendorf tube containing 400 pi of gel elution buffer (0.5 M ammonium acetate, 10 mM magnesium acetate, 0.1 mM EDTA, and 0.1% w/v SDS) and 400 pi of phenol. The nucleic acids were eluted from the gel slice overnight at room temperature with gentle agitation. Following elution, the aqueous and organic phases were separated by centrifugation, and the aqueous phase was transferred to a new Eppendorf tube. The nucleic acids were precipitated and recovered as described above.

Restriction and Ligation of DNA

All DNA restriction digest and ligation reactions were performed essentially as specified by the enzyme supplier. A typical restriction digest reaction contained 1 pg

DNA, 2.5 pi of 10X restriction buffer, 1 pi enzyme (5-10 units) and water to give a final volume of 25 pi. The mixture was incubated at the appropriate temperature for 1-2 hr, then terminated by extraction with an equal volume of phenol. The DNA was ethanol precipitated then resuspended in the desired volume of TE buffer. DNA fragments were ligated in a 20 pi reaction consisting of the DNA, IX ligase buffer (50 mM Tris-Cl, pH

7.6,10 mM MgCl 2, 1 mM ATP, 1 mM DTT, and 5% w/v polyethylene glycol MW 107 8,000), and 1 unit of T4 DNA ligase. The mixture was incubated at 14°C overnight, or,

for blunt-end ligations, at room temperature for 2 hr. The molar ratio of vector DNA to

insert DNA present in the ligation reactions was typically 1:2 to 1:4.

In Vitro Transcription Reactions

RNA transcripts were synthesized in vitro with bacteriophage T7 RNA polymerase.

The DNA sequence to be transcribed was cloned into the multiple cloning site of a plasmid

(pT71, pT72, or pIBI31) containing a T7 RNA polymerase promoter upstream of the

insert DNA. The plasmid (2 pg) was first linearized with a restriction enzyme which

cleaves downstream of the insert The DNA was digested in a 25 pi reaction volume

under the appropriate conditions for the particular restriction enzyme. Run-off

transcription of the template DNA was initiated by the addition of the following in a total

reaction volume of 100 pi: 40 mM Tris-Cl, pH 8.0; 20 mM MgCl 2; 5 mM DTT; 50 pg/ml

BSA; 0.4 mM each of GTP, CTP, ATP, and UTP; and 100 units of T7 RNA polymerase. For the preparation of uniformly-labeled transcripts, the ATP in the above reaction was adjusted to 0.06 mM ATP plus 50 pCi of [a- 32P]ATP (3,000 Ci/mmole).

After incubation at 37°C for 1 hr, the RNA was recovered by ethanol precipitation then resuspended in 10 pi of RNA loading buffer (80% v/v formamide, 1 mM EDTA, pH 8.0,

0.1% w/v bromphenol blue, and 0.1% w/v xylene cyanol). The RNA was purified by electrophoresis through a denaturing polyacrylamide gel, then located by UV shadowing, ethidium bromide staining, or autoradiography (Maniatis et al., 1982). After excision from the gel, the RNA was eluted by soaking the gel slice overnight at room temperature in 400 pi of RNA elution buffer (0.5 M ammonium acetate, 10 mM magnesium acetate,

0.1 mM EDTA, and 0.1% w/v SDS) plus 400 pi of phenol. Following elution, the aqueous and organic phases were separated by centrifugation and the RNA was 108 precipitated from the aqueous phase by the addition of 2.5 volumes 95% ethanol. RNA pellets were resuspended in DEPC-treated water and stored at -20°C or -70°C. DEPC- treated water was prepared by adding 100 pi of DEPC to 100 ml of double-distilled deionized water, followed by vigorous agitation for 30 min. Prior to use, the DEPC was inactivated by autoclaving for 20 min at 121 °C.

Radiolabeling of RNA and DNA

Labeling the 3* ends of RNA. RNA molecules were labeled at their 3'-hydroxyl termini with a-32P-cytidine 3',5'-bisphosphate ([a- 32P]pCp) and T4 RNA ligase.

Labeling reactions were performed at 4°C for 16 hr in a 50 pi reaction consisting of 50 mM HEPES, pH 8.3,10 mM MgCl 2, 5 mM DTT, 2 mM ATP, 50 pg/ml BSA, 10 pi [a-

32P]pCp, and 1 unit of T4 RNA ligase. A stock solution of [a- 32P]pCp used in the above reaction was synthesized at 37°C for 16 hr in a 50 pi reaction consisting of 150 pM Cp,

60 pCi [y-32P]ATP (7,000Ci/mmole), 50 mM Tris-Cl pH 7.5,10 mM MgCl 2, 5 mM

DTT, 50 pg/ml BSA, and 20 units of T4 polynucleotide kinase. The RNA ligase reaction products were concentrated by ethanol precipitation, then separated by electrophoresis through denaturing 6 % polyacrylamide gels. Labeled RNAs were identified by autoradiography.

Labeling the 5' ends of oligonucleotides. Synthetic oligonucleotides were labeled by phosphorylation of their 5' termini in a reaction containing 50 mM Tris-Cl, pH 7.5, 10 mM MgCl 2, 5 mM DTT, 50 pg/ml BSA, 1-2 pmoles oligonucleotides, 20 pCi [y-

32P]ATP (7,000Ci/mmole), and 20 units T4 polynucleotide kinase. The reaction was incubated at 37°C for 30 min followed by inactivation of the kinase by heating at 65°C for

10 min. The labeled DNA was either recovered by ethanol precipitation, or, when to be 109 used as a hybridization probe, fractionated over a 2-ml Sephadex G-25 gel-filtration

column to remove unincorporated [y- 32P]ATP.

Labeling the 5' ends of RNA. The 5' end-labeling of RNA for use as a probe in

hybridization experiments was carried out as above except the RNA was first partially

hydrolyzed to increase the number of 5' termini. A partial alkaline hydrolysis was

performed by heating RNA suspended in 50 pi of 50 mM Tris-Cl, pH 9.5, at 85°C for 3

min (for RNAs < 200 nucleotides) to 5 min (for RNAs > 500 nucleotides). Immediately

following this incubation, 70 pi of TES buffer (10 mM Tris-Cl, pH 7.5,0.1 mM EDTA,

190 pg/ml spermidine) was added and incubation was continued at 50°C for 4 min. The

RNA then was recovered by ethanol precipitation and 5' end-labeled.

Uniform labeling of DNA by nick-translation. Double-stranded DNA was

radioactively labeled by nick-translation to produce probes for Southern and Northern

analyses. A 50 pi volume of 2X nick-translation buffer (100 mM Tris-Cl pH 7.5,10 mM

MgCl 2, 2 mM DTT, and 2 pM each of dGTP, dCTP, and dTTP) was added to 0.5-1.0 pg

of DNA suspended in 45 pi of 10 mM Tris-Cl, pH 7.5. To this suspension was added 5

pi of 3,000 Ci/mmole [

polymerase I (5 units). The reaction mixture was incubated at 37°C for 30 min. The

labeled DNA was separated from unincorporated radioactive precursors by

chromatography on a 2-ml Sephadex G-25 column. The column fractions containing

labeled DNA were boiled for 5 min then chilled on ice prior to use in hybridization experiments.

Uniform labeling of DNA bv random-oligonucleotide-primed synthesis. Random- oligonucleotide-primed synthesis was also used to produce uniformly radioactive DNA.

This procedure requires the DNA to be linearized prior to labeling. The DNA was digested with the appropriate restriction enzyme, then, when necessary, purified by gel electrophoresis by one of the methods described above. The DNA was ethanol 110 precipitated then resuspended in TE buffer to give a concentration of 50 ng/jLil. The

following labeling reaction mixture was prepared and stored on ice: 2.5 |il 0.5 mM

dNTPs (minus dATP), 2.5 pi 10X Klenow buffer (0.5 M Tris-Cl, pH 7.5,0.1 M MgCl 2,

10 mM DTT, and 0.5 mg/ml BSA), 5 pi 3,000 Ci/mmole [

pi Klenow fragment (6 units). Random hexanucleotides (3 pg) were added to 2 pi (100

ng) of the DNA to be labeled and H 2O in a final volume of 14 pi. The DNA mixture was

boiled for 3 min then placed on ice. The labeling reaction mixture was added to the

denatured DNA followed by incubation at room temperature for 2 hr. The reaction was

terminated by adding 1 pi of 0.5 M EDTA and 100 pi of TE buffer. The labeled DNA

was isolated and treated as described above for the nick-translation of DNA.

Synthesis of uniformly-labeled cDNA probes. Single-stranded uniformly-labeled

cDNA probes were synthesized from RNA by AMV reverse transcriptase for use as

probes in Southern and Northern analyses. The reverse transcription reaction mixture

consisted of: 2 pi 16 mM dNTPs (minus dATP), 2 pi random hexanucleotide primers (3

pg/pl), 10 pi (10 to 100 ng) of RNA to be reverse transcribed, 3 pi 10X reverse

transcriptase buffer (0.5 M Tris-Cl, pH 8.3 at 42°C, 80 mM MgCl 2, 0.3 M KC1, and 10

mM DTT), 10 pi 3,000 Ci/mmole [a - 32P]dATP (100 pCi), and 1 pi AMV reverse

transcriptase (10-20 units). The mixture was incubated at 42°C for 2 hr. The labeled

DNA was isolated and treated as described above for the nick-translation of DNA.

Preparation of Transformation- and Transfection-Competent coli.

A 50-ml volume of LB contained in a 125-ml flask was inoculated with 0.5 ml of an overnight E. coti culture. The culture was incubated with shaking at 37°C until an optical density at 550 nm of 0.5 was obtained (about 2-3 hours). The culture then was divided among two 50-ml Oakridge tubes and the cells were harvested in a Sorval SS34 rotor at 5,000 rpm for 10 min at 4°C. The supernatants were discarded and each pellet was gently resuspended in 25 ml of ice-cold 10 mM MgSC> 4. The tubes were placed on ice for 30 min, then the cells were pelleted as described above. After discarding the supernatants, each pellet was resuspended in 10 ml of ice-cold 50 mM CaCl 2 and again placed on ice for

30 min. The cells were pelleted a final time then resuspended in a combined volume of

2.5 ml ice-cold 50 mM CaCl 2- Glycerol was added to a concentration of 15% v/v and 100 pi aliquots of the competent cell suspension were dispensed into pre-chilled Eppendorf tubes and stored at -70°C.

Transformation and Transfection of coii

To transform E. coli (strain TB1, DH5a-F', or JM110) with plasmid DNA, 10 ng to 1 pg of DNA in up to 50 pi of TE buffer was added to 100 pi of ice-cold competent cells in an Eppendorf tube. The suspension was gently mixed then stored on ice for 30 min. After a heat shock at 37°C for 2 min, the suspension was transferred to 1 ml of LB medium contained in a 15-ml sterile tube and incubated with shaking at 37°C for 1 hr to allow for the expression of antibiotic resistance. To select for transformants, samples (10 to 150 pi) of this culture were spread onto LB agar plates supplemented with the appropriate antibiotic. When lac' cells were transformed with vectors carrying a multiple cloning site within a portion of the (3-galactosidase gene, transformants were screened for inserts within this site, resulting in the absence of a-complementation (Miller, 1972), by including 10 pM X-gal and 0.33 pM IPTG in the agar medium. Plates were incubated inverted at 37°C overnight.

Transfection of competent E. coli strain MV1190 cells with phage M13 vector DNA was performed as described for the transformation procedure with the following modifications. Following the heat shock at 37°C, aliquots of the transfected cells were 112 transfeired to 3 ml of molten top agar (LB medium plus 0.6% agar, 45°C) supplemented with 50 |il of 2% X-gal in dimethylformamide, 10 pi of 100 mM IPTG, and 200 pi of log phase MV1190 recipient cells. The top agar mixture then was overlayed onto a plate of

LB agar and allowed to harden. Plates were incubated inverted at 37°C overnight. The addition of X-gal and IPTG to the top agar permitted the screening of transfectants for a- complementation (Miller, 1972). White plaques represented clones containing a DNA fragment inserted into the multiple cloning site of the M13 vector. Blue plaques resulted from M13 DNA lacking inserts.

H. volcanii Expression Vector Construction

A shuttle-expresssion vector was constructed that can be selected for and maintained in either H. volcanii or E. coh, and permits the expression of cloned genes in H. volcanii.

The vector, pWL204, was constructed by incorporating an H. volcanii tRNALys gene promoter into a derivative of the H. volcanii-E. coh shuttle vector pWL102. Construction of pWL102 has been described previously (Lam and Doolittle, 1989). The procedure for cloning the promoter region of the H. volcanii tRNALys gene and a modified Haloferax mediterranei tRNATrP gene into a derivative (pWL201) of pWL102 is diagramed in Figure

24. The KpnI-NcoI restriction endonuclease-digested pWL102 plasmid was first treated with SI nuclease to remove the 3' overhang of the Kpnl site. This was followed by treatment with DNA polymerase large fragment (Klenow fragment) and the four dNTPs to ensure blunt-end formation (Maniatis et al., 1982). The resulting blunt-ended vector was religated to give the plasmid pWL201. This deletion destroyed both the Kpnl and Ncol sites and deleted sites for BamHI. Hindlll. and Xbal. The gene encoding the H. volcanii tRNALys was previously cloned and sequenced by Daniels et al. (1986). A Haelll fragment containing the promoter fragment of this gene was subcloned into the HincII site 113 of pUC18 to give the plasmid pUC18-LysP. A modified tRNATrP gene (tRNATrP-0167),

constructed from overlapping oligonucleotides (Thompson and Daniels, 1990), was used

as a promoter reporter gene. The tRNATlP-0167 gene, present as a 122-bp BamHI

fragment, was ligated into the BamHI site of pUC18-LysP, located downstream of the

tRNALys gene promoter, to give the plasmid pUC18-LysP-Ttp0167. The HindlH-EcoRI

multiple cloning region fragment of this pUC18 construct, which contained the tRNALys

gene promoter and the tRNATrP-0167 gene, was then ligated into the unique Hindlll and

EcoRI sites of pWL201. The resulting shuttle-expression vector was designated pWL202

(Figure 24). For use in control experiments, a derivative of pWL202 was prepared which

lacked the promoter sequences. This plasmid, pWL203, was constructed by excising the

HindUl-Xbal promoter fragment from pWL202, treating the digested vector with Klenow

fragment to generate blunt ends, and religating. The multiple cloning region of the

completed expression vector (pWL202), containing the tRNALys gene promoter and the

tRNATrP-0167 gene, was subcloned into M13mpl8 as an EcoRI-HindHI fragment, and the vector construction was verified by DNA sequence analysis.

To permit the cloning and expression of other genes under the transcriptional control of the tRNALys gene promoter, the BamHI fragment containing the tRNATrP-0167 gene was deleted from pWL202 to yield the promoter plasmid pWL204.

Shuttle-Expression Vector Copy Number Determination

The number of plasmids per H. volcanii chromosome, or copy number, for the various shutde vector and shuttle-expression vector constructs (see Table 4) used throughout this study was determined. Total DNA was isolated from each H. volcanii transformant analyzed as described above. Approximately 5 |ig of the isolated DNA was digested to completion with the restriction enzymes EcoRI and Mlul: RNase A was 114 included in the reaction (80 pg/ml). The DNA samples were electrophoresed through a

1% gel then transferred by capillary action to a Zeta Probe nylon membrane. The

Southern blot was probed with 5' end-labeled oligonucleotide HMGCoA (appendix). The oligonucleotide is complimentary to a region of the HMGCoA reductase gene, a gene present as a single copy in each plasmid and in the chromosome. Following hybridization and washing of the blot (see Southern Blot Analysis), the extent of hybridization to the plasmid and chromosomal HMGCoA reductase genes was quantitated as counts per minute (cpm) using a Betagen Betascope 603 Blot Analyzer following the manufacturers instructions. After correcting for background counts, the number of plasmid copies per chromosome was determined by dividing the plasmid gene cpm value by the chromosomal gene cpm value. For each plasmid investigated, the copy number analysis was performed in triplicate and the average of the obtained values was recorded.

Reconstruction of Haloferax tRNATrP Genes Using

the Polymerase Chain Reaction

The wild-type and three modified forms of the Haloferax tRNATlP gene were reconstructed using the polymerase chain reaction (PCR) with mutagenic oligonucleotide primers. The mutant genes contained an altered acceptor stem sequence and 5' Xbal and

3' EcoRI restriction sites flanking the coding sequence. The sequences of the mutagenic oligonucleotide primers, WSTEM5P and WSTEM3P, are shown in appendix I. Each of the four genes to be reconstructed were previously cloned into pUC18. The PCR reaction mixture consisted of 1 |il (10 ng) of plasmid DNA containing a tRNATrP gene, 10 pi 10X

PCR buffer (100 mM Tris-Cl, pH 8.3,500 mM KC1, 15 mM MgCh, and 0.1% BSA), 8 pi 1.25 mM dNTPs, 5 pi 5’ primer (WSTEM5P; 130 pMol/pl), 5 pi 3' primer

(WSTEM3P; 130 pMol/pl), and H 2O to a final volume of 100 pi. The mixture was 115 incubated at 97°C for 5 min in a Perkin Elmer Cetus thermal cycler (model N801-0150) to denature the DNA, then 1 pi (5 units) of Taq DNA polymerase (AmpliTaq™; Perkin

Elmer Cetus) was added and the reaction mixture was overlayed with 50 pi of mineral oil.

The reaction mixture was heated at 95°C for 2 min to denature the DNA, cooled at 55°C for 2 min to allow annealing of primers to the template DNA, then heated at 72°C for 2 min to allow extension from the primers. This temperature cycle was repeated 30 times.

After the final cycle, the reaction was cooled to 4°C, then 20 pi of the mixture was purified by electrophoresis through an 8 % nondenaturing polyacrylamide gel; the remainder of the mixture was stored at -20°C. After electrophoresis and staining with ethidium bromide, the DNA fragments were visualized with UV light. The fragment band of interest was excised from the gel and the DNA was recovered from the gel slice as described above. A portion of the recovered DNA was digested with the restriction enzymes Xbal and EcoRI then cloned into the Xbal and EcoRI sites of the vectors pIBI31 and pWL204. All PCR product plasmid constructs were subjected to DNA sequence analysis to verify that the desired constructs were obtained.

Oligonucleotide-Directed Mutagenesis

The Altered Sites™ in vitro mutagenesis system (Promega Corp., Madison , WI) was used to introduce mutations in the Saccharomvces cerevisiae tRNAPro gene. The tRNAPr0 gene was first subcloned from the vector pGKNl (Knapp, Ogden et el., 1984) into the phagmid vector pSelect-1. E. coh strain JM110 was transformed with the resulting construct, pSelect-Pro. To produce single-stranded template for the mutagenesis reaction, 5 ml of TYP broth (16 g tryptone, 16 g yeast extract, 5 g NaCl, and 2.5 g

K2HPO4 per liter of distilled water) containing 15 pg/ml tetracycline was inoculated with

100 pi of an overnight culture of cells containing pSelect-Pro. The culture was shaken vigorously at 37°C for 30 min in a 50-ml tube. The culture then was infected with helper phage R408 at a multiplicity of infection of 10; the incubation with vigorous shaking was continued for 6 hr. The cells were pelleted by centrifugation in a Sorval SS34 rotor at

10,000 rpm for 15 min at 4°C. The supernatant was transferred to a new tube and spun a second time, with the resulting supernatant again transferred to a new tube. The phage were precipitated from the supernatant by adding 0.25 volume of precipitation solution

(3.75 M ammonium acetate, pH 7.5,20% PEG MW 8,000). The mixture was kept on ice for 30 min, then the phage were pelleted by centrifugation at 10,000 rpm for 15 min at

4°C. The supernatant was discarded and the phage pellet was resuspended in 400 pi of

TE buffer then transferred to an Eppendorf tube. A 400 pi volume of chloroform:isoamyl alcohol (24:1 v/v) was added followed by vortexing for 1 min to lyse the phage. The organic and aqueous phases were separated by centrifugation in a microcentrifuge for 5 min. The aqueous phase was transferred to a new tube and extracted twice with equal volumes of phenol:chloroform (1:1 v/v) as above. The aqueous phase was transferred to a new tube and 0.5 volumes of 7.5 M ammonium acetate and 2 volumes of ethanol were added and the suspension was mixed then kept at -20°C for 30 min to precipitate the phagmid DNA. The DNA was pelleted, washed in 70% ethanol, dried under vacuum, then resuspended in 20 pi of H 2O.

The mutagenesis reaction was initiated by combining 100 ng of pSelect-Pro ssDNA,

22.5 ng (1.25 pMol) of the mutagenic phosphorylated oligonucleotide PRO-MUT (see appendix), 2.2 ng (0.25 pMol) of an ampicillin repair phosphorylated oligonucleotide, 2 pi of 10X annealing buffer (0.2 M Tris Cl, pH 7.5,0.1 M MgCl2, and 0.5 M NaCl), and

H20 to a final volume of 20 pi. The ampicillin repair oligonucleotide is included because it confers ampicillin-resistance to the mutant DNA strand (pSelect-1 is Amps by virtue of a single base deletion in the p-lactamase gene), thus providing a positive selection for mutant plasmids. The oligonucleotides were allowed to anneal to the template by heating 117 the reaction to 70°C for 5 min followed by slow cooling to room temperature (15-20 min).

The annealing reaction was placed on ice and the following was added: 5 pi 1 OX synthesis buffer (100 mM Tris-Cl, pH 7.5,5 mM dNTPs, 10 mM ATP, and 20 mM DTT), 5 pi T4

DNA polymerase (5 units), 1 pi T4 DNA ligase (1 unit), and H 2O to a final volume of 70 pi. The reaction was incubated at 37°C for 90 min to perform mutant strand synthesis and ligation. The repair minus E. coh strain BMH 71-18 mutS was transformed with the heteroduplex DNA by adding the entire synthesis reaction to 300 pi of competent cells.

The cells were kept on ice for 30 min, heat-shocked at 37°C for 2 min, then transferred to

4 ml of LB medium and incubated at 37°C for 1 hr. Ampicillin was then added to the culture at a final concentration of 125 pg/ml and incubation was continued at 37°C with shaking overnight.

Plasmid DNA was isolated from the overnight culture by the boiling-lysis mini-prep procedure (described above). To ensure proper segregation of mutant and wild-type plasmids, competent E. coti strain JM110 cells were transformed with one-tenth of the recovered DNA. Cells containing mutant plasmids were selected by spreading the transformation suspension onto LB agar plates containing 125 pg/ml ampicillin. After incubation at 37°C overnight, ampicillin-resistant colonies were picked. To identify mutants, the tRNA1^0 genes from six of these colonies were subcloned into M13mpl8 and subjected to DNA sequence analysis (see below) by the dideoxytermination method.

A pSelect-Pro clone with the desired nucleotide deletions was obtained and designated pProm. 118 Reconstruction of S.. cerevisiae tRNAPro and tRNAPr°-m Genes

Using the Polymerase Chain Reaction.

The tRNA1^0 and tRNAPro‘m genes from the vectors pGKNl and pProm,

respectively, were reconstructed using the PCR and mutagenic oligonucleotide primers

(PROT75P and PROT73P; see Table 6, appendix) to place a T7 RNA polymerase

promoter directly upstream of the tRNA coding sequences and to reduce the length of the

3' trailing sequences. The PCR reaction and the recovery of the reaction products were

performed exactly as described for the reconstruction of tRNATlP genes (see above). The

pre-tRNA1^0 and pre-tRNAPro'm transcripts generated from the linear PCR gene products

by T7 RNA polymerase begin with the first nucleotide of the 5' exon and terminate at their

3' ends with a six nucleotide trailing sequence.

Transformation of H. volcanii

A 50-ml volume of H. volcanii medium (described above) contained in a 125-ml flask was inoculated with 0.5 ml of a log phase H. volcanii strain WFD11 culture and incubated with shaking at 37°C until a culture density of 0.45 to 0.55 A 550 was obtained.

The cells were pelleted in a Sorval SS34 rotor at 5,000 rpm for 10 min at room temperature. The supernatant was discarded and the pellet was gently resuspended in 2.5 ml of spheroplasting solution (0.8 M NaCl, 27 mM KC1,15% wA sucrose, and 50 mM

Tris-Cl, pH 8.2). For each transformation, 200 |il of this cell suspension was transferred to a 15-ml Falcon tube. A 20-pl volume of 0.5 M EDTA, pH 8.0, was applied to the inside wall of the tube just above the cell suspension, then mixed with the cells by gently swirling the suspension. Plasmid DNA (0.1 to 1.0 pg), in 10 |ll of spheroplasting solution, was gently mixed with the cell suspension, which was then kept at room 119 temperature for 5 min. An equal volume (230 pi) of 60% v/v PEG 600 (in spheroplasting solution) was placed on the inside lip of the horizontally-held tube. The tube was capped and the two solutions were mixed by slowly inverting the tube about twenty times, or until schlieren lines were no longer visable. The mixture was kept at room temperature for 15 min, then mixed with 10 ml of regeneration salts solution (3.5 M NaCl, 0.15 M MgSC> 4,

50 mM KC1,7 mM CaCl 2, 15% sucrose, and 50 mM Tris-Cl, pH 7.2). The cells were pelleted at 4,000 rpm for 10 min at room temperature. The supernatant was discarded and the pellet was resuspended in 0.2 to 1.0 ml of regeneration salts solution. Aliquots (200 pi) of the cell suspension were mixed with 3 ml volumes of molten (60°C) complex medium top agar and overlayed onto complex medium regeneration agar plates (see below) supplemented with 20 pM mevinolin. When the top agar had hardened, the plates were incubated inverted in a plastic bag at 42°C with a small wet paper to increase humidity. Colonies started to appear after about 6-7 days and were ready to pick after 10-

12 days.

Complex medium regeneration agar contained the following per liter of distilled water: 188 g NaCl, 43 g MgS04-7 H 20 ,2.5 g KC1,0.7 g CaCl2-2 H20 ,50 ml 1 M

Tris-Cl pH 7.2, 3.0 g yeast extract, 5.0 g tryptone, and 14 g agar. The yeast extract, tryptone and agar were autoclaved separate from the salts solution, then the two solutions were combined after cooling to 60°C. Complex medium top agar was the same as regeneration agar, except 6.5 g agar and 150 g sucrose was substituted for the 14 g agar.

Southern Blot Analysis

Southern blots were prepared by the capillary transfer method described by Maniatis et al. (1982), except Zeta Probe nylon membranes (Bio-Rad, Richmond, CA) were used in place of nitrocellulose membranes. After the denatured DNA fragments had been 120 transferred from the gel to the nylon membrane, the blot was air-dried then baked at 80°C under vacuum for 45 min. The baked blot was placed in a sealable plastic bag and prehybridization solution (approximately 100 pl/cm 2 of membrane) was added. If probes generated by nick-translation or random-oligonucleotide-primed synthesis were to be used, the blot was prehybridized at 37-42°C for 6hr to overnight in 50% deionized formamide, 4X SSC (3 M NaCl, 0.3 M trisodium citrate, pH 7.0), 1% SDS, 0.5% Blotto

(dehydrated milk), and 250 (ig/ml denatured salmon sperm DNA. If a cDNA probe or 5’ end-labeled oligonucleotide or partially-hydrolyzed RNA probes were to be used, the blot was prehybridized at 50-65°C for 6 hr to overnight in 2X SSC, 1% SDS, 0.5% Blotto, and 250 pg/ml denatured salmon sperm DNA. Incubation temperatures used depended upon the length of the probe and its expected percent homology to the target DNA (Beltz et al., 1983). After prehybridization, the solution was removed from the bag and replaced with the same buffer minus the salmon sperm DNA. The32 P-labeled probe was added and the bag was sealed taking care to leave as few bubbles as possible in the bag. Blots were hybridized at the temperature of prehybridization for 12 to 16 hr, then removed from the bag and washed in 500 ml of 4X SSC and 1% SDS (for blots hybridized in the presence of formamide) or 2X SSC and 1% SDS (for blots hybridized without formamide) contained in a tray at room temperature. After gentle agitation for 5-10 min, the wash buffer was discarded and replaced with a fresh 500-ml volume of the same buffer. After an additional 10-20 min at room temperature, the blot was removed from the buffer, drained, then sandwiched between two sheets of Saran wrap and subjected to autoradiography. When necessary due to a high level of background signals, the blots were re-washed under more stringent conditions (i.e., lower SSC concentration or higher temperature). 121 Northern Blot Analysis

RNAs to be subjected to Northern blot analysis were separated by electrophoresis through a denaturing polyacrylamide gel. After electrophoresis, the RNA was transferred to a Zeta Probe nylon membrane with an electrophoretic blotter (Idea Scientific, Corvallis,

OR) following the manufacturer’s instructions. The transfer was performed in 0.5X TAE buffer (1.21 g Tris base, 0.68 g sodium acetate, and 0.18 g EDTA per liter of distilled water; pH7.8) at 400 mA for 3 hr or at 125 mA overnight. The membrane was air-dried then baked at 80°C for 45 min. Prehybridizations and hybridizations were performed as described above for Southern blot analysis.

Primer Extension Analysis

Primer extension analysis was used to map the 5' termini of RNA transcripts. This method involves the hybridization of a specific radioactively labeled primer to the complimentary region of RNAs (the template), extension of the primer by reverse transcriptase, then separation of the labeled cDNA products on a denaturing polyacrylamide gel. Oligonucleotide primers were typically 20 to 24 nucleotides in length.

The oligonucleotides (16 ng) were 5' end-labeled with T4 polynucleotide kinase and [y-

32P] ATP as described above, then the kinase was inactivated by heating at 65°C for 5 min.

The oligonucleotides were precipitated with 0.66 volumes of 5 M ammonium acetate and 2 volumes of 95% ethanol at -70°C for 20 min. The precipitate was pelleted, dried, then resuspended in 16 |il of RNA solution (25 to 50 |ig of total cellular RNA suspended in

H2O). This suspension was transferred to a new Eppendorf tube and 4 |il of 5X hybridization buffer (1.5 M NaCl, 10 mM EDTA, and 50 mM Tris-Cl, pH 7.5) was added. The suspension was heated at 80°C for 4 min, then incubated at 50°C for 2-3 hr to 122 allow the primer and RNA to anneal. The hybridization reaction was diluted with 80 j l l I of

1.25X reverse transcriptase buffer (625 mM Tris-Cl, pH 8.3 at 42°C, 100 mM MgCl 2,

375 mM K C1,12.5 mM DTT, and 1.6 mM dNTPs), then 25 units of AMV reverse transcriptase was added. This extension reaction was incubated at 42°C for 30 min then stopped by adding 1 (il of 0.5 M EDTA, pH 8.0. To decrease the viscosity of the solution, non-replicated RNAs were degraded by adding 3 |il of 2.5 mg/ml RNase A followed by incubation at 37°C for 25 min. The nucleic acids were recovered by ethanol precipitation, washed with 70% ethanol, then allowed to air-dry. The dried pellet was resuspended in 10 fil of formamide loading buffer (80% deionized formamide, 0.03% bromphenol blue, 0.03% xylene cyanol, and 20 mM EDTA) then incubated at 80°C for 2 min prior to loading a 4 pi sample onto a 6% denaturing polyacrylamide sequencing gel.

For the preparation of size markers, the same oligonucleotide used for reverse transcription was used to prime a DNA sequencing reaction using the complimentary

RNA-encoding gene cloned into M Bmp 19 as the template DNA. The sequencing reaction products were loaded onto the gel alongside the primer extension reaction products. Following electrophoresis and autoradiography, the 5' termini were determined by comparison with the adjacent DNA sequence ladder.

SI Nuclease Analysis

SI analysis was used to determine the 5' termini of in vivo-transcribed RNAs. The gene encoding the RNA of interest was cloned into M Bmp 19 or M Bm p 18 so that single­ stranded (sense strand) template DNA could be prepared. End-labeled SI probes were generated from the single-stranded template DNA with the appropriate 5' end-labeled oligonucleotide primer and the Klenow fragment of DNA polymerase I, followed by digestion of the Klenow extension reaction with the appropriate restriction enzyme to give the probe a defined 3 'end, as described by Berk (1989). The single-stranded DNA probe was purified by electrophoresis through a 5% denaturing polyacrylamide gel then eluted from the gel and recovered by ethanol precipitation in an Eppendorf tube as described above. The DNA pellet was resuspended in 15 pi of H 2O followed by the addition of 25 pi total cellular RNA (25-50 pg) and 10 pi 5X hybridization buffer (1.5 M

NaCl, 10 mM EDTA, and 50 mM Tris-Cl, pH 7.5). The nucleic acids were denatured by heating at 80°C for 4 min then the reaction tube was immediately transferred to a 50°C water bath and allowed to cool slowly (15-20 min) to 30°C. Incubation was continued at

30°C overnight to allow hybridization of the SI probe to the complimentary RNA. After the overnight incubation, 150 pi of 2X SI nuclease buffer (560 mM NaCl, 100 mM sodium acetate, pH 4.5, and 9 mM ZnSC> 4), 3 pi of 2 mg/ml denatured salmon sperm

DNA, 92 pi H2O, and 300 units (5 pi) of S1 nuclease were added to the hybridization reaction. The non-hybridized probe was digested at 30°C for 60 min, then the reaction was terminated by adding 80 pi of SI stop solution (4 mM ammonium acetate, 40 pg/ml yeast tRNA, and 20 mM EDTA, pH 8.0). The nucleic acids were recovered by ethanol precipitation, washed with 70% ethanol, then allowed to air-dry. The dried pellet was resuspended in 10 pi of formamide loading buffer and a 4 pi sample was separated by electrophoresis through a 6 % denaturing polyacrylamide sequencing gel. To serve as size markers, DNA sequencing reaction products, prepared with the same template DNA and oligonucleotide primer used to produce the SI probe, were electrophoresed through the gel alongside the S1 nuclease reaction products. Following electrophoresis and autoradiography, the length of the labeled DNA fragment(s) remaining after digestion with

SI nuclease was determined by comparison with the adjacent DNA sequence ladder. 124 ft. volcanii Intron Endonuclease Cleavage Assay

Crude extracts of H. volcanii were prepared for use as the source of tRNA intron

endonuclease in cleavage assays. Cell pellets (2 g) were resuspended in 5 ml of TMGK

buffer (40 mM Tris-Cl, pH 7.5,20 mM MgCl 2, 10% glycerol, and 50 mM KC1). A 50-

|il volume of 2.5 U/|xl RNase-free DNase I was mixed with the suspended cells followed by incubation on ice for 45 min. The cell suspension then was passed twice through a

French pressure cell at 10,000 psi. The resulting cell lysate was transferred to a 50-ml

Oakridge tube and centrifuged in a Sorval SS34 rotor at 10,000 rpm for 15 min at 4°C.

The cleared lysate was transferred to a Ti60 ultracentrifuge tube and centrifuged in a

Beckman Ti60 rotor at 38,000 rpm for 1 hr at 4°C. The S100 supernatant was transferred to an Oakridge tube and 40% PEG 8,000 (in TMGK buffer) was added to give a final concentration of 10%. The mixture was kept on ice for 30 min then centrifuged at 10,000 rpm for 20 min at 4°C. The supernatant, containing the intron endonuclease, was aliquoted to Eppendorf tubes and stored at -70°C.

A typical intron endonuclease cleavage assay contained 5 |j.l of cell extract, 10,000 cpm of uniformly [a- 32P]ATP-labeled tRNA substrate, 4.5 (il of 10X TMG buffer (400 mM Tris-Cl, pH 7.5,200 mM MgCl2, and 20% glycerol) or 10X TSG buffer (400 mM

Tris-Cl, pH 7.5, 50 mM spermidine, and 20% glycerol), and H20 in a final volume of 50

Hi. Reaction mixtures were incubated at 37°C for 1 hr, then terminated by extraction with an equal volume of phenol. The two phases were separated by centrifugation and the

RNA was recovered from the aqueous phase by ethanol precipitation. The RNA pellet was resuspended in RNA loading buffer and the reaction products were separated by electrophoresis through a 6 % denaturing polyacrylamide gel. The reaction products were visualized by autoradiography. 125 Yeast Intron Endonuclease Cleavage Assay

Crude extracts for use in intron endonuclease assays were prepared from

Saccharomvces cerevisiae strain EJ101. A 50-ml volume of YPD medium (2% w/v

glucose, 2% w/v peptone, and 1% w/v yeast extract) contained in a 125-ml flask was

inoculated with 100 (xl of a fresh S. cerevisiae culture and incubated with gentle shaking at

30°C overnight. The culture was divided among two 50-ml Oakridge tubes and the cells

were pelleted by centrifugation in a Sorval SS34 rotor at 5,000 rpm for 5 min at 4°C. The

supernatants were discarded and each pellet was resuspended in 20 ml of H 2O. The cells

then were pelleted at 10,000 rpm for 5 min at 4°C. The supernatants were discarded and

the pellets were combined in 0.5 ml of Tris-DTT buffer (100 mM Tris-Cl, pH 7.4; 10 mM

DTT) then transferred to an Eppendorf tube. After a 15 min incubation at room

temperature, the cells were pelleted by centrifugation in a microcentrifuge for 20 sec. The

supernatant was discarded and the pellet was resuspended in 1 ml of zymolase buffer ( 1.2

M sorbitol, 20 mM KPO 4, pH 7.5). The cells were pelleted in a microcentrifuge as above

and the supernatant was discarded. The pellet was resuspended in 200 pi of zymolase

buffer containing 2 mg/ml zymolase ("lyticase"). The cell suspension was incubated at

room temperature for 5 min to allow for spheroplast formation, then the spheroplasts were

pelleted as above. The supernatant was discarded and the pellet was washed twice with 1-

ml volumes of zymolase buffer. After the final wash, the pellet was resuspended in 75 pi

of lysis buffer (0.2 M NaCl, 2 mM EDTA, 10 mM DTT, 1 mM phenylmethylsulfonyl

fluoride, 10% glycerol, 0.5% Triton X-100, and 20 mM KPO 4, pH 7.5) and stored at -

20°C.

Yeast endonuclease cleavage assays typically consisted of 20 mM Hepes pH 7.5,5 mM MgCl 2, 2.5 mM spermidine, 0.1 mM DTT, 0.4% Triton X-100,10% glycerol,

10,000 cpm of uniformly-labeled tRNA substrate, yeast endonuclease (2 pi extract), and 126 H2O in a final volume of 20 fil. If tRNA ligase activity was also to be assayed, 1 mM

ATP was included in the above reaction mixture. Reactions were incubated at 30°C for 15

min then terminated by adding 2 |J.l of stop solution (2% SDS, 100 mM EDTA, 2 mg/ml

proteinase K). After an additional incubation at 50°C for 10 min, 200 |il TE was added

and the mixture was extracted with an equal volume of phenol. Nucleic acids were

recovered from the aqueous phase by ethanol precipitation, resuspended in 15 pi of RNA

loading buffer, then separated by electrophoresis through a 6% denaturing polyacrylamide

gel. After electrophoresis, the labeled reaction products were detected by

autoradiography.

Identification of the H. volcanii RNase P RNA

In separate experiments, RNAs present in H. volcanii strain DS2 S100 supernatant preparations fractionated through Sepharose 4B (high salt and low salt cell extracts),

Sephadex G-200 (high salt extract) and DEAE-Sephacel (low salt extract) were 3' end- labeled with 5'[32P]pCp and T4 RNA ligase. High salt extracts were prepared in TMG buffer (40 mM Tris-Cl, pH 7.5,20 mM MgCl 2, 10% glycerol) plus 2 M KC1; low salt extracts were prepared in TMG buffer plus 50 mM KC1 (as described below). Labeled

RNAs were separated by electrophoresis through a 6% denaturing polyacrylamide gel and detected by autoradiography. In each case, an approximately 435 nucleotide RNA species copurified with RNase P activity. For the purpose of preparing a cDNA probe using this putative RNase P RNA as template, the RNA was isolated as follows. H. volcanii frozen cells (130 g wet weight) were resuspended in buffer A (40 mM Tris-Cl, pH 7.5, 20 mM MgCl 2, 10% glycerol, and 2.0 M KC1) to a final volume of 290 ml then passed twice through a French pressure cell at 10,000 psi. Cell debris was removed from this high salt extract by centrifugation in a Sorval SS34 rotor at 10,000 rpm for 20 min at 127 4°C. The 245 ml supernatant remaining after this spin was divided among Ti60 ultracentrifuge tubes and centrifuged in a Beckman Ti60 rotor at 38,000 rpm (100,000 X g) for 2 hr at 4°C. A 4-ml volume of the resulting S100 supernatant, corresponding to 1.7 g of cell weight or 1.3% of initial cell weight, was applied to a 1.5 X 100 cm Sepharose

4B column and 4 ml fractions were collected during elution with buffer A. A second 4 ml volume of S100 supernatant was applied to the Sepharose 4B column and the elution was repeated. The remainder of the above supernatants were stored at -70°C. Under these conditions, RNase P retains activity for at least 1 year. Active fractions, 16 ml from each column run, were pooled and diluted with three volumes of buffer A minus KC1. The

RNase P suspension was then concentrated by precipitation with an equal volume of acetone at -20°C for 3 hr followed by centrifugation at 10,000 ipm in an SS34 rotor for 20 min at 4°C. The resulting pellet was resuspended in 0.6 ml of buffer A and applied to a 1

X 40 cm Sephadex G-200 column. Two ml fractions were collected during elution with buffer A. The peak activity eluted just after the void volume.

The 435 nucleotide RNA copurifying with the RNase P activity through the

Sephadex G-200 column was identified by 3' end-labeling RNAs isolated from 100 pi volumes of each fraction. The end-labeled 435 nucleotide RNAs were recovered from gel slices (as described above) then, for use as a size marker, combined with RNA recovered from half (2 ml) of the remaining pooled active fractions. The combined RNAs were then separated by electrophoresis through a 6% denaturing polyacrylamide gel. The labeled marker RNA, and comigrating unlabeled RNAs, were recovered from the gel as described above then resuspended in 10 pi of H2O. A cDNA probe was then prepared using the isolated RNA as template for AMV reverse transcriptase as described above.

To identify DNA fragments encoding this RNA, a Southern blot was prepared from genomic digests of H. volcanii DNA cleaved with the restriction enzymes Xhol. Mlul.

Sail, HmdM, and Pstl. The membrane was probed with the [a-32P]-labeled cDNA (5 X 128 106 cpm) at 65°C for 7 hr in the following hybridization solution: 2X SSC, 1% SDS,

0.5% Blotto, and 500 (ig/ml denatured salmon sperm DNA. The blot was then washed at

room temperature for 10 min in 2X SSC, 1.0% SDS followed by 0.2X SSC, 1.0% SDS.

Restriction fragments hybridizing to the probe were detected by autoradiography. Sail

and Mlul fragments corresponding in size to those known to hybridize to 16S and 23 S

rRNAs (Daniels et al., 1985; Charlebois et al., 1989), in addition to other bands were

observed. This indicated that a mixed population of cDNAs were produced from the

isolated RNA. To determine which hybridizing fragments were non-rRNA in origin, the

same blot was stripped (0.2X SSC, 0.5% SDS; 95°C for 30 min) then prehybridized

under the conditions described above with 10 |ig of Mlul-restricted pHVrRNAl plasmid.

This plasmid is a subclone of the H. volcanii rRNA operon-containing cosmid, cos313,

and canies a 5.6 Kb Mlul fragment encompassing one of the two H. volcanii rRNA

operons (Daniels et al., 1985; Charlebois et al., 1989). After prehybridization, the cDNA probe was added directly to the prehybridization mixture and hybridization was continued for an additional 14 hr. The blot was then washed as above and the hybridizing bands identified by autoradiography. Under these conditions, unique non-rRNA Mlul and Sail restriction fragments were identified. Dot blots containing an H. volcanii DNA cosmid library, obtained from W. F. Doolittle (Dalhousie University, Halifax, Nova Scotia,

Canada), were also hybridized with the cDNA probe under the conditions described above.

Partial Purification of X- acidophilum RNase P

Thermoplasma acidophilum cells (13.9 g) were resuspended in TMKT buffer (40 mM Tris-Cl, pH 7.5, 20 mM MgCh, 50 mM KC1, and 0.5% Triton X-100) to a final volume of 32 ml. RNase-ffee DNase I (100 units) was added, then the cell suspension was passed twice through a French pressure cell at 10,000 psi. Cell debris was removed from the resulting 26 ml cell lysate by centrifugation in a Sorval SS34 rotor at 8,500 rpm for 15 min at 4°C. After an additional 50 units of RNase-free DNase I was added, the cleared lysate was stored on ice for 45 min then centrifuged a second time as above. The supernatant was transferred to a Ti60 ultracentrifuge tube and centrifuged in a Beckman

Ti60 rotor at 38,000 rpm (100,000 X g) for 1 hr at 4°C. All but 300 jj.1 of the resulting 21 ml S100 supernatant was applied to a 5 X 30 cm DEAE-Sephacel column, previously equilibrated in TMGK buffer (40 mM Tris-Cl, pH 7.5,20 mM MgCl2,10%_v/v glycerol, and 50 mM KC1). The column was washed with two column volumes of TMGK, then 12 ml fractions were collected during elution at 65 ml/hr with a linear, 200-500 mM KC1, gradient in TMG buffer. Individual fractions were assayed for RNase P activity as described below. To concentrate the active fractions, they were pooled, diluted with an equal volume of TMG buffer, then applied to a 9 ml DEAE column. RNase P was eluted from this column with TMG buffer plus 600 mM KC1; 1-ml fractions were collected and assayed for RNase P activity. The peak active fractions were pooled (2 ml total volume) and 1 ml of this was applied to a 1 X 40 cm Sephacryl S-400 gel filtration column, previously equilibrated in TMGK buffer. One-ml fractions were collected during elution with TMGK buffer at 7 ml/hr. Fractions with RNase P activity were stored at -70°C.

Towards identifying the RNA component of T. acidophilum RNase P, RNAs copurifying with RNase P activity were detected by 3' end-labeling RNAs present in 100 pi volumes of each Sephacryl S-400 column fraction with 5'[^2P]pCp and T4 RNA ligase as described above. Reaction products were separated by electrophoresis through a 6% denaturing polyacrylamide gel, then detected by autoradiography. 130 J±. volcanii and X. acidophilum RNase P Cleavage Assays

Uniformly [a-32P]ATP-labeled H. volcanii pretRNAVal substrate for RNase P

assays was prepared in vitro by run-off transcription (described above) using T7 RNA

polymerase and the plasmid pT7tRNAVal linearized with EcoRI. This vector was

constructed by subcloning a HinPI-Haein restriction fragment, containing the first of two

tandemly repeated H. volcanii tRNAVaI genes from pVT2 (Daniels et al., 1986), into the

expression vector pT72 under the transcriptional control of a T7 RNA polymerase

promoter (Figure 2). Transcripts from this gene produce a tRNA with 71 and 54

nucleotides of 5' and 3' flanking sequences, respectively, and lack the 3' terminal CCA

residues.

Assays for RNase P activity in crude cell extracts typically consisted of 5 pi of

extract, 5 pi 10X TMGK buffer (40 mM Tris-Cl, pH 7.5,20 mM MgCl2, 10% v/v

glycerol, and 50 mM KC1), 10,000 cpm of uniformly [a-32P]ATP-labeled pretRNAVal

substrate, and H2O to a final volume of 50 pi. To assay for activity in column chromatography fractions, 10,000 cpm of pretRNAVal substrate was added directly to 100 pi of each fraction. Assays were incubated at 37°C (for H. volcanii) or 56°C (for T. acidophilum) for 45 min, then terminated by extraction with an equal volume of phenol.

The reaction products were recovered from the aqueous phase by ethanol precipitation, resuspended in RNA loading buffer, then separated by electrophoresis through a 6% denaturing polyacrylamide gel. Reaction products were detected by autoradiography.

Assay for Catalytic Activity by the H.. volcanii RNase P RNA

For RNA catalysis and heterologous reconstitution reactions, the gene encoding the

H. volcanii RNase P RNA was subcloned as a Mael-BstBI restriction fragment into the 131 Hindlll and AccI restriction sites of the vector pEBI31 to give the plasmid pDN3 (see

Figure 18). This placed the RNase P RNA gene under the transcriptional control of a T7

RNA polymerase promoter. The BstBI and AccI digestions left complimentary 5' overhang sequences, whereas ligation of the Mael site to the Hindlll site required filling in the 5' overhangs with klenow fragment and dNTPs prior to blunt-end ligation (this results in restoration of the Hindin site). T7 RNA polymerase run-off transcripts were prepared from Xbal-restricted pDN3 as described above. The resulting 463 nucleotide transcript, containing a 20-base 5' flanking sequence and a 9-base 3' flanking sequence, was purified on a 5% denaturing polyacrylamide gel and recovered as described above.

Assays of H. volcanii RNase P RNA catalysis were performed with the pretRNAVal substrate and Bacillus subtilis pretRNAAsP substrate. The procedure for preparing uniformly-labeled in vitro transcripts of pretRNAAsP has been described (Reich et al.,

1988). A standard RNA catalysis reaction contained 50 mM Tris-Cl, pH 8.0,0.1% SDS,

0.05% NP-40,7,000 cpm (-2.5 ng) of pretRNAVal or pretRNAAsP, 20 ng H. volcanii

RNase P RNA (from pDN3 transcription) and varying concentrations of MgCh and

NH4CI in a total volume of 10 (i.1. Heterologous reconstitution reactions with varying quantities of H. volcanii RNase P RNA and B. subtilis RNase P protein were in 10 |il of the following buffer: 50 mM Tris-Cl, pH 8.0, 30 mM MgCl2,0.05% NP-40, and 100 mM NH4CI. These reactions were performed with 7,000 cpm of either pretRNAVal or pretRNAAsP substrate. All reactions were incubated at 37°C for 45 min then terminated by extraction with an equal volume of phenol. The reaction products were recovered by ethanol precipitation then separated by electrophoresis through a 6% denaturing polyacrylamide gel. Reaction products were detected by autoradiography. 132 DNA Sequence Analysis

Sequencing of DNA was done by the dideoxynucleotide chain termination method

(Sanger, 1977) using a Sequenase™ DNA sequencing kit purchased from United States

Biochemicals (Cleveland, OH). Sequencing reactions were performed as described by the manufacturer. Sequencing reaction products were separated by electrophoresis through

6% denaturing polyacrylamide gels as described above. Following electrophoresis, reaction products were visualized by autoradiography. RESULTS

Archaebacterial Ribonuclease P

The RNA subunit of the eubacterial RNase P ribonucleoprotein complex is known to function as the catalytic component (Guerrier-Takada et al., 1983; Gardiner et al., 1985).

While evidence suggests that some eukaryotic RNase P complexes require RNA, there is no direct evidence that the RNA itself is capable of cleaving tRNA precursors (Gold and

Altman, 1986; Lee and Engelke, 1989; Krupp et al., 1986; Hollingsworth and Martin,

1986). The eukaryotic RNAs bear little sequence similarity to their eubacterial counterparts and lack the structural core characteristics that have been assigned to these

RNAs (James et al., 1988; Pace et al., 1989; Brown et al., 1991). The archaebacteria are a third lineage of life and are known to exhibit both eubacterial- and eukaryotic-like characteristics. The goal of this study was to isolate an RNase P RNA gene from an archaebacterium and to determine the structure and catalytic capabilities of the RNA it encodes. To this end, a preliminary characterization of the RNase P activities from two archaebacteria was undertaken; the halophile Haloferax volcanii. and the "sulfur- dependent" thermophile Thermoplasma acidophilum. Once the RNase P RNA gene was isolated from H. volcanii. further studies were focused on the RNase P from this organism.

133 134 Development of an assay for RNase P activity:

Assays for RNase P activity require pre-tRNAs containing 5' flanking sequences as

substrate. For H. volcanii and T. acidophilum RNase P assays, uniformly [a-32P] ATP-

labeled H. volcanii pre-tRNAVal substrate was prepared in vitro by run-off transcription

using T7 RNA polymerase and the plasmid pT7tRNAVal linearized with EcoRI. As

shown in Figure 11, this vector was constructed by subcloning a HinPI-HaelH restriction

fragment containing the first of two tandemly repeated H. volcanii tRNAVal genes

(Daniels et al., 1986). The fragment was subsequently subcloned into the expression

vector pT72 under the transcriptional control of a T7 RNA polymerase promoter.

tRNAVal transcripts generated from this gene have 71 and 46 nucleotides of 5' and 3'

flanking sequences, respectively, and lack the 3' terminal CCA residues.

A preliminary characterization of the RNase P activity found in crude extracts of H.

volcanii was performed previously by Lawrence et al. (1987). Using E. coli pre-tRNATyr

as substrate at 37°C, they observed that the activity is inhibited by monovalent cations (>

200 mM) and has an optimal Mg2+ concentration of about 50 mM. The initial RNase P

assay conditions with the H. volcanii pre-tRNAVal substrate were based on this analysis.

H. volcanii cell extracts containing RNase P were prepared by suspending cells in TMG

buffer (40 mM Tris-Cl, pH 7.5, 50 mM MgCh, 10% glycerol) containing 50 mM KC1,

then passing the suspension twice through a French pressure cell, followed by a 100,000

X g spin. When pre-tRNAVal was incubated at 37°C in the presence of the S100

supernatant in the same buffer, the pre-tRNA was cleaved to produce mature tRNA plus

3' flanking sequence, and 5' flanking sequence products (Figure 12). T. acidophilum cell extracts prepared the same way yielded similar products. Figure 11. Construction of the Haloferax volcanii pre-tRNAVal substrate clone. Left

panel, subcloning the H. volcanii tRNAVal gene from pVT2 into the T7 RNA

polymerase expression vector pT72. Restriction sites are: A, AccI: Ha, Haelll:

Hd, Hindlll: Hp, Hinpl: T, TaqI: and Xb, Xbal. The in vitro transcript and the

expected RNase P cleavage products are indicated. Right panel, sequence of

the noncoding strand for the gene region of the pT7-tRNAVal construct. The

mature tRNA sequence is underlined.

135 136

Val tRNA tRNAVal

HP T Hd Ha Ha Ha pVT2 L l .L- J subclone Taql fragment into pUC 9 T/A Hd T/A T78tarl I L -L * Hindi 11 30 }fc> GGGAGACCCAAGCTTAAATTGTACCCCGGA Subclone 60 Hd-Xb CAACGGAGAGATGCGTCCGAACGGCAGGAA into pT72 00 J GCACCGTAACCGGGTTGGTGGTCTAGTCTG__ T/A Hd T/A 120 T7 GTTATGACAC C TCC T TGACATGGAGGAGGC I I I 150 T CGGCAGTTCAAATCTGCCCCAACCCACTCC Linearize and Xbal 180 transcribe TCTTCCCGCGTTTCGACTCTAGAGGATCCC Sail EcoRI Val CGGGCGAGCTCGAATTC pretRNAI PPP- 71 nt ^ 120 nt

RNaeeP cleavage

Figure 11. Figure 12. Structure and cleavage assay of H. volcanii pre-tRNAVal. Panel A, line

drawing of the T7 RNA polymerase transcript produced from the

pT7-tRNAVal plasmid linearized with EcoRI. The cleavage site for RNase P is

indicated by an arrow. Panel B, typical cleavage reaction of uniformly 32P-

labeled pre-tRNAVal substrate by H. volcanii RNase P. Reaction products

were separated by electrophoresis in a 6% denaturing polyacrylamide gel, then

detected by autoradiography. Lane 1, pre-tRNAVal only; Lane 2, pre-tRNAVal

plus H. volcanii RNase P.

137 138 RNaseP

5’

Val H. volcanii pretRNA (191 nt)

B B nt

val ptRNA 191

120

71

Figure 12. 139 Effect of cations and temperature on the H. volcanii and T. acidophilum RNase P activities:

The effect of monovalent cations on the H. volcanii RNase P activity with pre- tRNAVal as substrate was further analyzed with the goal of developing an assay in buffers approximating physiological ionic strength (> 2 M KC1). Extracts were prepared as described above, except in TMG buffer containing 2 M KC1. RNase P then was partially purified by fractionating the S100 high salt supernatant on a Sepharose 4B gel-filtration column in the same buffer. Fractions with peak activity were pooled and dialyzed against

TMG buffer containing a 50 mM concentration of either KC1, KOAc, NH4CI, or

NH4OAC. Each dialysate was then assayed for RNase P activity in increasing concentrations (12.5 mM to 3.0 M) of each salt at 37°C. The results obtained using

NH4CI are presented in Figure 13; essentially the same results were obtained with the other three enzyme preparations. Under these conditions, the enzyme remained active over the entire range of salt conditions tested. In addition, the degree of degradation or non-specific ribonuclease digestion of the substrate decreased with increasing concentration of each salt.

The effect of monovalent cations on the RNase P activity from T. acidophilum was also investigated. The internal cation concentration has not been determined, but this wall-less organism can grow in the presence of up to at least 2% salt (half concentrated artificial sea water) (Segerer et al., 1988). The enzyme used in these assays was partially purified from an S100 supernatant preparation by fractionation over a DEAE-Sephacel anion exchange column, followed by fractionation of the pooled and concentrated peak fractions over a Sephacryl S-400 gel-filtration column. Samples from an active fraction were assayed for RNase P activity in TMG buffer with increasing concentrations of

NH4CI (12.5 mM to 3.0 M) at 56°C. As shown in Figure 13, T. acidophilum RNase P activity is completely inhibited at NH4CI concentrations greater than 200 mM. Substrate Figure 13. Effect of monovalent cations on the H. volcanii and T. acidophilum RNase P

activities. Autoradiograms of cleavage assays for H. volcanii (Panel A) and T.

acidophilum (Panel B) RNase P in increasing concentrations of NH4CI.

Assays were performed with H. volcanii pre-tRNAVal substrate under the

conditions described in the text For each autoradiogram, lane 1 contains pre-

tRNAVal only. Lanes 2-16 contain RNase P, pre-tRNAVal, and the following

concentrations of NH4CI: lane 2,12.5 mM; lane 3,25 mM; lane 4, 50 mM;

lane 5,100 mM; lane 6,200 mM; lane 7,400 mM; lane 8 ,600mM, lane 9,

900 mM; lane 10,1.2 M; lane 11,1.5 M; lane 12,1.8 M; lane 13,2.1 M; lane

14, 2.4 M; lane 15,2.7 M; lane 16,3.0 M. The identities of the reaction

products are indicated.

140 141

A

! 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

p r e tR N A Wm ------

tRNA+3’ *■* mm * " * * " *

B

! 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

p**™— — —

Figure 13. 142 cleavage products not defined in the left margin are assumed to be non-specific

degradation products.

The optimal growth temperatures for H. volcanii (Kushner, 1985) and T.

acidophilum (Smith et al., 1973) are approximately 42°C and 59°C, respectively. To

determine whether the temperature optima of the H. volcanii and T. acidophilum RNase P

activities also reflect their natural environments, the partially purified enzyme preparations

described above were assayed at temperatures ranging from 23 to 75°C. H. volcanii

RNase P, assayed in TMG buffer plus 2 M KC1, showed optimal activity between 37 and

45°C, though it remained active at 23°C and up to 56°C. T. acidophilum RNase P,

assayed in TMG buffer plus 50 mM KC1, showed optimal activity between 56 and 65°C;

enzyme activity remained at 23°C and declined sharply above 65°C (data not shown).

H. volcanii RNase P substrate specificity:

The sequence CCA at the 3' terminus of mature tRNAs is encoded by all E. coli

tRNA genes. The presence of the CCA sequence in pre-tRNAs is important for cleavage

by the RNA component (Ml RNA) of E. goti RNase P, while the holoenzyme is insensitive to the presence or absence of this sequence (McClain et al., 1987). However, point mutations in the CCA sequence completely abolish cleavage by both Ml RNA and the holoenzyme (McClain et al., 1987). H. volcanii tRNA genes do not encode the 3' terminal CCA sequence, rather it is added posttranscriptionally. To determine whether the presence or absence of a 3' terminal CCA sequence affects processing by the H. volcanii

RNase P holoenzyme, assays were performed with the H. volcanii pre-tRNAVal substrate and the B. subtilis pre-tRNAAsP substrate. The pre-tRNAVal substrate used in this study has a 46-nucleotide 3' trailing sequence and the sequence CTC at the position where CCA is located in mature tRNAVal (see figure 11). The pre-tRNAAsP substrate has the mature

3' CCA terminus with no trailing sequences (B. Pace and N. Pace, personal 143 communication). Although the Km's for these RNAs were not determined, they appeared

to be cleaved equally well, indicating that the H. volcanii RNase P activity is not

influenced by the presence or absence of the 3' terminal CCA sequence in pre-tRNA

substrates (data not shown).

In addition to cleaving tRNA precursors, E. coti RNase P is responsible for

generating the mature 5' terminus of 4.5S RNA, a stable RNA with an essential role in

translation (see Literature Review). Cleavage of pre-4.5S RNA requires the holoenzyme;

M l RNA alone is essentially ineffective (Guerrier-Takada et al., 1983; Baer et al., 1989).

Neither the B. subtilis holoenzyme nor the RNA component (P RNA) alone can cleave

pre-4.5S RNA. In this study, it was determined that the H. volcanii holoenzyme is also

incapable of cleaving pre-4.5S RNA. Run-off uniformly-labeled transcripts of the pre-

4.5S RNA, consisting of the mature 114-nucleotide RNA plus a 23-nucleotide 5' leader

region, were prepared in vitro with T7 RNA polymerase and the vector p23-4.5S (Table

7) linearized with Smal as described for the in vitro transcription of tRNA genes. No

cleavage products were detected when pre-4.5S RNA was incubated (37 °C for 45 min)

with an H. volcanii cell extract in TMG buffer plus either 0.4 or 2.0 M KC1.

Identification of the RNA component of H. volcanii RNase P:

Lawrence et al. (1987) provided strong evidence for the presence of an RNA component in the RNase P of H. volcanii prepared from low salt cell extracts. The RNase

P activity is sensitive to rnicrococcal nuclease and has a high buoyant density in cesium sulfate (1.61 g/ml). In this study, we sought to identify RNAs that consistently copurify with RNase P activity through various liquid chromatography mediums. In separate experiments, RNAs present in S 100 supernatant preparations fractionated through the gel- filtration mediums Sepharose 4B (high salt and low salt cell extracts) and Sephadex G-200

(high salt extract), and the ion-exchange medium DEAE-Sephacel (low salt extract) were 144 3' end-labeled with 5'[32P]pCp and T4 RNA ligase. Labeled RNAs from individual column fractions were then separated by electrophoresis through 6% denaturing polyacrylamide gels and detected by autoradiography. In each case, an approximately

435-nucleotide RNA was found to copurify with RNase P activity. For the Sephadex G-

200 gel-filtration experiment, the elution profile and 3' end-labeled RNAs that copurified with RNase P activity are shown in Figure 14.

A 435-nucleotide RNA would have a molecular weight of about 143,600 daltons.

By comparison with standard molecular weight proteins, the RNase P holoenzyme eluted from a Sepharose 4B gel-filtration column with an apparent molecular weight of 168,000 daltons. A requirement for a protein component in the RNase P reaction was demonstrated by the elimination of activity by treatment of the enzyme with Proteinase K

(data not shown). The apparent size of the holoenzyme indicates that the protein component of the enzyme is relatively small. This is consistent with the high buoyant density of the enzyme and the relative molecular weights of the eubacterial holoenzyme subunits (i.e., the E. coti holoenzyme consists of a 124,000 dalton RNA and a 13,800 dalton protein). Also, SDS-PAGE analyses revealed that a 21,000 dalton protein copurifies with RNase P activity through glycerol gradients, gel-filtration columns, and anion-exchange columns (data not shown).

Identification of the RNA component of T. acidophilum RNase P:

The approach taken to identify the RNA component of H. volcanii RNase P was followed in an attempt to identify the RNA component of the T. acidophilum enzyme. T. acidophilum RNase P was partially purified by fractionating a cell extract (SI00 supernatant fraction) on DEAE-Sephacel anion exchange columns followed by gel- filtration on Sephacryl S-400 (see Materials and Methods). RNAs copurifying with

RNase P activity through these columns were detected by 3' end-labeling fraction samples 145 with 5'[32P]pCp and T4 RNA ligase. The end-labeled RNAs were separated by

electrophoresis through 6% denaturing polyacrylamide gels. The RNase P elution profile

and copurifying RNAs from the Sephacryl S-400 experiment are shown in Figure 15. An

RNA of 320-350 nucleotides consistently copurified with RNase P activity. In a Northern

blot analysis, the consensus RNase P RNA oligonucleotide RPRNA2 (appendix)

hybridized to two RNAs of approximately 320 and 340 nucleotides (Figure 16).

Uniformly 32P-labeled cDNAs prepared from a narrow window of RNAs, containing the

copurifying RNA, isolated from RNase P-active Sephacryl S-400 fractions hybridized to

the same RNAs on this Northern blot. The gene encoding the 320-nucleotide RNA was

subcloned from a T. acidophilum cosmid bank into the vector pIBI31. On the same

Northern blot (stripped of the previous probe), a probe prepared from this gene hybridizes

to the T. acidophilum 320-nucleotide RNA and an H. volcanii RNA of the same size;

neither the 340-nucleotide T. acidophilum RNA or the 435-nucleotide H. volcanii RNase

P RNA (see below) hybridized to the probe (data not shown). It is likely that the 340-

nucleotide RNA represents the RNase P RNA, while the 320-nucleotide species represents another stable RNA, possibly the 7S RNA, that is highly conserved between T. acidophilum and H. volcanii. A gene encoding the 340-nucleotide species has not been identified.

Isolation and characterization of the gene encoding the RNase P RNA from H. volcanii:

To determine if the ca. 435-nucleotide RNA found to copurify with H. volcanii

RNase P activity was a component of the enzyme, the gene encoding the RNA was cloned. Uniformly 32P-labeled cDNAs were prepared from a narrow window of RNAs, containing the 435-nucleotide RNA, which had been isolated from RNase P-active

Sephadex G-200 fractions. To identify DNA fragments encoding this RNA, the cDNAs were used to probe a Southern blot containing H. volcanii genomic DNA digested in Figure 14. Gel-filtration chromatography of H. volcanii RNase P; identification of

copurifying RNAs. In Panel A, graph showing elution profile from

fractionation of partially purified (see text) H. volcanii RNase P on Sephadex

G-200 in a high salt buffer (2.0 M KC1, 20 mM M gCh, 10% glycerol, 40 mM

Tris-Cl, pH 7.5). Two-ml column fractions were collected and samples from

each were assayed for the RNase P holoenzyme in the same buffer with pre-

tRNAVal substrate. Fractions containing the RNase P holoenzyme are

indicated by the bar above the elution profile. In Panel B, RNA was extracted

from 100 |J.l samples of the fractions indicated above the autoradiogram (A=

sample applied to column), 3' end-labeled using 5'[32P]pCp and T4 RNA

ligase, then resolved by denaturing polyacrylamide gel electrophoresis. The

putative RNase P RNA is indicated by the arrow.

146 147 0.2

o CO CM <

0.0 0 5 10 15 20 25 30 35 Fraction Number

B

A 1 23456789 10 11

-ssiM

Figure 14. Figure 15. Gel-filtration chromatography of T. acidophilum RNase P; identification of

copurifying RNAs. In Panel A, graph showing elution profile from

fractionation of partially purified (see text) T. acidophilum RNase P on

Sephacryl S-400 in a low salt buffer (50 mM KC1,20 mM MgCl2, 10%

glycerol, 40 mM Tris-Cl, pH 7.5). One-ml column fractions were collected

and samples from each were assayed for the RNase P holoenzyme in the same

buffer with pre-tRNAVal substrate. Fractions containing the RNase P

holoenzyme are indicated by the bar above the elution profile. In Panel B,

RNA was extracted from 100 |xl samples of the fractions indicated above the

autoradiogram (A= sample applied to column), 3' end-labeled using

5’[32P]pCp and T4 RNA ligase, then resolved by denaturing polyacrylamide

gel electrophoresis. The putative RNase P RNA is indicated by the arrow.

148 149

0.3

0.2 - o 00 CM <

0.0 0 5 1 0 1 5 20 25 30 35 40 45 50 55 Fraction Number B

A 3 10 13 14 15 16 17 18 19 20 21 22

I t Figure 15. It Figure 16. Northern blot analysis of T. acidophilum total RNA using a probe specific for

a consensus RNase P RNA sequence. In lane 1, total RNA (20 |ig) isolated

from T. acidophilum. Lane 2 is a positive control and contains total RNA

(20 pg) isolated from H. volcanii DS2. Lane 3 contains uniformly

32P-labeled RNA markers of the indicated sizes ( in nucleotides). The

oligonucleotide RPRNA2 (appendix), 5' end-labeled, was used as the probe.

RPRNA2 contains sequences complimentary to a highly conserved eubacterial

RNase P RNA sequence that is also present in the H. volcanii RNase P RNA.

The sizes of the hybridizing RNAs are given as nucleotides (nt).

150 151

1 2 3

733 nt

435 nt 462 nt

340 nt 320 nt

191 nt

Figure 16 152 separate reactions with the restriction enzymes Xhol. Mlul. Sail. Hindin . and Pstl. The

cDNAs hybridized to a number of restriction fragments, including several containing the

genes for rRNAs. Based on previous hybridization information for the rRNA operons of

H. volcanii (Daniels et al., 1985; Charlebois et al., 1989) and by blocking the Southern

blot with isolated H. volcanii rDNA, single non-rRNA gene-containing Mlul (2.6 kb) and

Sail (1.0 kb) restriction fragments that hybridized to the cDNAs were identified (Figure

17). In parallel, a cosmid bank from H. volcanii was screened for hybridization with the

cDNAs. Again, after eliminating rRNA-containing cosmids, a single cosmid was

identified that hybridized to the cDNAs. This cosmid, cos228, was found to contain both

the 2.6 kb Mlul and 1.0 kb Sail fragments. A 985 bp Mlul-Sall fragment containing the

hybridizing region was subcloned into the vectors M13mpl8 and M13mpl9 and subjected

to DNA sequence analysis. The sequence of this fragment is presented in Figure 18.

Universal primer and two internal primers, RPRNA1 and FPRNA3, were used in the

sequence analysis (see appendix). Sequence was also obtained from an internal Alul restriction site. Complete sequence was obtained for both strands.

To verify that this region encoded an RNA, a Northern analysis was performed using as probes the 2.6 kb Mlul and 985 bp Mlul-Sall fragments from the cosmid (data not shown). The oligonucleotide RPRNA2 (5'-NNNGGACrn cCTCNNC-3'; where N is any nucleotide), which contains sequences complimentary to the highly conserved eubacterial RNase P RNA sequence 5'-GAGGAAAGUCC-3', was also used as a probe.

In each case, the DNAs hybridized to a single RNA species of 435 nucleotides. Figure 19 illustrates the hybridization obtained with the oligonucleotide probe. The 5' end of this

RNA was localized by primer extension and SI nuclease protection mapping to one of two

G residues located immediately downstream from a region containing four archaebacterial promoter-like sequences (Figures 18 and 19). Although the 3' terminus of this RNA was not directly mapped, the Northern data and localization of the 5' terminus suggest that the 153 transcript ends in a short stretch of U residues, similar to other archaebacterial transcripts.

Although no transcripts other than the 435-nucleotide species were identified in the

Northern analysis, the presence of multiple promoter-like sequences and a potential

hairpin structure upstream of the RNase P RNA coding sequence, and a potential hairpin

structure downstream of the coding sequence, might suggest that the RNA is transcribed

as a longer precursor molecule. To investigate this possibility, the 985 bp Mlul-Sall fragment was cloned into the T7 RNA polymerase expression vector pIBI31. Based on the proposed gene structure (Figures 18 and 19), run-off transcripts from this clone are

1020 nucleotides long and have 300-nucleotide 5' leader and 265-nucleotide 3' trailer sequences. No cleavage was observed when uniformly-labeled transcripts were incubated at 37°C for 30 min with an H. volcanii DS2 crude cell extract. The reactions included 50 mM Tris-Cl, pH 8.0, and either 30 mM MgCl2 and 600 mM NH4CI, or 30 mM MgCl2 and 2.5 M NH4CI. If H. volcanii RNase P RNA is transcribed as a precursor molecule, the results indicate that substrate turnover is very rapid (Northern analysis) and the RNA processing enzyme(s) are not functional in vitro under the above conditions.

Structure of the H. volcanii RNase P RNA:

Using the criteria established from phylogenetic comparisons of eubacterial RNase P

RNAs (James et al.,1988; Pace et al., 1989; Brown et al., 1991), the H. volcanii RNA can be folded into a structure that is similar to the proposed eubacterial structure (Figure

20). The H. volcanii RNA can assume a three-loop core structure with base-pairing interactions between the 5' and 3' ends; it also has several of the conserved helical structures that protrude from these loops. This similarity extends beyond structural features. The halobacterial RNA contains many of the universally conserved sequence elements of the eubacterial RNase P RNAs, including the largest conserved block, 5’-

GAGGAAAGUCC-3' (nucleotides 39-49 in Figure 20). Figure 17. Southern analysis of H. volcanii genomic DNA using RNase P RNA-derived

cDNA as probe. Lanel, Mlul and Lane 2, Sail digested genomic DNA.

Hybridizing fragments identified as being of non-ribosomal RNA gene origin

are indicated in the right margin. Fragments are given in kilobasepairs (kbp).

154 Figure 17. Figure 18. Sequence of the H. volcanii RNase P RNA gene region. Underlined

sequences represent the RNase P RNA, and arrows indicate possible hairpins.

Potential box A and box B transcription signals are indicated. Plasmid pDN3,

used in the synthesis of RNA for in vitro RNA catalysis assays, was

constructed from the indicated Mael-BstBI fragment. An oligonucleotide

(RPRNA5; see appendix) complimentary to the sequences indicated by the

heavy bar was used in primer extension analysis and for the synthesis of DNA

probes for SI mapping.

156 60 600 ACGCGTCGCGCATGCTGCCCGGTTGTTCTCTCTGCCCGTGRAGAACGTACGATTCGACCG GflGBflCGGBTGGBBCGGCGBBTCCTCBCCGGTGCBflGTCCGCGCCGCGBBGGGTBGTTCG TGCGCfiGCGCGTRCGACGGGCCAACRRCRGftGBCGGGCRCTTCnGCBTGCTRAGCTGGC CTCTTGCCTRCCTTGCCGCTTRGGRGTGGCCBCGTTCRGGCGCGGCGCTTCCCBTCflflGC Mlul 120 660 ATTCCCGCGCTAGTTGGHCCGCCCGCGCCCCATCATCGTAGGTGRGGTGTRCGGTCTGCG GBCGGCGCGTCGGGTTCGCCCGTCGCGCCCTCGGGGGGCTCGCCCCGBGBBGGflCGCGGB TABGGGCGCGATCAAGCTGCCGGGCGCGGGGTRGTflGCATCCACTCCnCATGCCBGACGC CTGCCGCGCRGCCCBRGCGGGCBGCGCGGGRGCCCCCCGBGCGGGGCTCTTCCTGCGCCT BoxA4 720 CCTCCGflCfllfllTfiCCHITCHflGTTCTGIGGTGflCITCflflCGCTTCCCTCGGHljGTTBTC CGCTGBGCCGBBTGCTGGGBCGBBCBGBflGGGGGCnflCTCCTCTCBGCCGCTTTCGBflC GGRGCCTGTATARTGGTAAGTTCRRGACACCRCTGBRGTTGCGRAGGGAGCCTACRRTRG GCGBCTCGGCTTRCGRCCCTGCTTGTCTTCCCCCGAflTGRGGRGRGTCGGCGBBRGCTTG BoxA3 luM Int3 240 BstBI 780 C^GTTlGTTRTGTfiGTTTCG^TG^MCBTBflt^TGiSiGCTBHflCCCCGGrflGGflCCCC^fT CGCCGAGCGRCCGCTTTGTCGGTCGRGCCGTTTTCGCGCCGTCGGGBBRCGCTCTTGBCC GGCRRCRATRCBTCRflflGCRRCGTTGTRTTGCRCGCCGRTTTGGGGCCRTCCTGGGGCRR GCGGCTCGCTGGCGRRBCRGCCBGCTCGGCBRRBGCGCGGCRGCCCTTTGCGRGRBCTGG --- BaxA2 BonAI BuB2 IniBI 30o 840 flflTCGjflflCCcfcTTRTCCGhcCGBCfcTGffcTflGGOTBGGfrcGdCflGBGBGBGCCCBGTTCC GTTCGCCGCCGCHGTCTCGG1BTGCGCGGCTTGACTCTCCTCGTGGCGGTGCTCRTCGTC TTflGCTTGGCGBflTflGGCTGGCTGGBCTIjBTCpCBICCBGCCGTCTCTCTCGGGTCBflGG CRRGCGGCGGCGTCRGRGCCBTRCGCGCCGBBCIGRGBGGRGCRCCGCCflCGBGTRGCBG 360 900 CGTGCCCGBGBCGGGCBTGRGGRBflGTCCCCCCRCCGTCCGBBCGGGTGBCCGGGCGCfifl CTCGCCGGCTGTGCCGCGCCGGTGTCGCCGGGBBCCGRCGGGBCGRCBGCGBCGBCTGCC GCBCGGGCTCTGCCCGTBCTCCTTTCBGGGGGGTGGCBGGCTTGCCCBCTGGCCCGCGTT GRGCGGCCGRCBCGGCGCGGCCRCRGCGGCCCITGGCTGCCCTGCTGTCGCTGGTGRCGG 420 960 GCCCGGRGTCGGBORCGGCTGGCGCTGORBCBGRflBCGflGBCCGCTCGBCCCGBCCGBTG RCGTCTGCGGCTTCGCCGCCGACCBCCGRCTCGGCRBCCGRGTCGCCCGCGGCGACCGCG CGGGCCTCRGCCTCTGCCGBCCGCGBCCTTGTCTTTGGTCTGGCGRGCTGGGCTGGCTBC TGCRGRCGGCGRBGCGGCGGCTGGTGGCTGRGCCGTTGGCTCflGCGGGCGCCGCTGGCGC 480 BTGCGCGCGCGBCGGCTCCGCCGTCGCCGGCGCGOCCGTCBCGGCCGCGTGCGRBCCGBC BCCCCGBCGRCTTCGCCICCGTCGBC TRCGCGCGCGCTGCCGRGGCGGCRGCGGCCGCGCCGGCBGTGCCGGCGCRCGCTTGGCTG TGGGGCTGCTGBBGCGGBGGCBGCTG 540 Sail CCGTBRGGGflflGGGflGCTRBCCCGCflGBGGGBTGBGGTGGCGTCGCCBTCTCCGBCGGTC GGCBTTCCCTTCCCTCGBTTGGGCGTCTCCCTBCTCCBCCGCBGCGGTBGflGGCTGCCflG

u re 18. 157 Figure 19. Transcript analysis of the H. volcanii RNase P RNA gene. Left panel,

Northern analysis of H. volcanii total RNA using the oligonucleotide probe

RPRNA2. This probe contains sequences complimentary to a highly

conserved eubacterial RNase P RNA sequence that is also present in the 985 bp

Mlul-Sall clone. For Center (primer extension (PE) analysis) and Right (SI

analysis) panels, sequence lanes are presented as the compliment of the DNA-

coding sequence. Italic sequences indicate potential transcription start sites.

The same DNA primer (oligonucleotide RPRNA5) was used for primer

extension synthesis, synthesis of the single strand SI probe, and as primer for

DNA sequence markers (see Materials and Methods and Figure 18). Sizes are

given as nucleotides (nt).

158 T C 0 A F * T C G A S I

I C I-

F ig u re 19 159 160 There is little sequence and structure similarity between eubacterial and eukaiyotic

RNase P RNAs. A small set of conserved nucleotides have been identified in several

eukaryotic RNase P RNAs (Bartkiewicz et al., 1989; Doria et al., 1991). Many of these

conserved nucleotides are also present in the H. volcanii RNase P RNA (Figure 20). One

tertiary structure feature that may be conserved between the eubacterial and eukaryotic

RNase P RNAs is the formation of a pseudoknot involving two regions of high sequence

conservation (Pace et al., 1989; Forster and Altman, 1990). The potential for a second

pseudoknot interaction is conserved among the eubacterial RNAs (E. S. Haas and N. R.

Pace, personal communication). The H. volcanii RNase P RNA retains the ability to form

both pseudoknot structures (Figure 20).

Catalytic capabilities of in vitro-transcribed H. volcanii RNase P RNA:

A fundamental difference between the eubacterial and eukaryotic RNase P RNAs is

the ability of the eubacterial RNA to catalyze the cleavage of pre-tRNAs in the absence of protein (Guerrier-Takada et al., 1983; Gardiner et al., 1985). To examine whether the halophilic RNA could act as a catalytic RNA, a Mael-BstBI restriction fragment containing the RNase P RNA gene region was subcloned into the T7 RNA polymerase expression vector pIBI31 (see Figure 18). Transcripts from this clone produce an RNA that, based on the proposed gene structure (Figure 18), has 20 and 9 nucleotides of 5' and 3' flanking sequence, respectively. This RNA was assayed with both the H. volcanii pre-tRNAVal substrate and the CCA-containing B. subtilis pre-tRNA^P substrate under a variety of solution conditions. Ionic conditions optimal for catalysis by E. coh RNaseP RNA (100 mM MgCl2 amd 100 mM NH4CI; Guerrier-Takada et al., 1986) and B. subtilis RNase P

RNA (30 mM MgCl2 and 1.2 M NH4CI; Gardiner et al., 1985) were tested. Also examined were NH4CI concentrations from 0.1 to 3.0 M in the presence of 30 mM

MgCh, MgCl2 concentrations from 10 to 250 mM in the presence of 600 mM NH4CI, 161 and KC1 concentrations up to 2 M. Other solution conditions tested were polyethylene glycol 8000, ethanol, and glycerol from 2.5 to 10%, and temperatures from 16 to 70°C in buffer containing 30 mM MgCl2 and 1.2 M NH4CI. The H. volcanii RNA lacked catalytic activity under all conditions tested. As a further test for catalytic activity, the halophilic RNA was combined with the protein component of B. subtilis RNase P in a heterologous reconstitution experiment Incubation conditions were optimized for the activity of the B. subtilis RNase P RNA plus its protein. Under these conditions, the halophilic RNA exhibited cleavage activity with the tRNAVal substrate (Figure 21). Full recovery of the activity was not possible with the heterologous complex. Approximately

10% of the cleavage activity was recovered when compared to the halophilic holoenzyme.

Similar results were obtained with the B. subtilis tRNAAsP substrate (data not shown).

Catalytic capabilities of in vivo-transcribed H. volcanii RNase P RNA:

The inability of in vitro-transcribed H. volcanii RNase P RNA to function catalytically in the absence of protein may be due to a structural defect in the RNA induced by 5' and 3' flanking sequences, a possible requirement for modified bases, or improper folding in the low salt transcription buffer. These problems might be avoided if the

RNase P RNA could be over-expressed in vivo, then fractionated away from the holoenzyme complex by gel-filtration chromotography under physiological salt conditions. To investigate this possibility, a 1.0 Kb HindlH-EcoRI fragment from pDN3 containing the entire RNase P RNA gene (see Figure 18) was subcloned into the H. volcanii-E. coli shuttle vector pWL201 (described below) and H. volcanii W FP 11 was transformed with the resulting construct (pWL230). Transformants were verified by

Southern analysis using the H. volcanii RNase P RNA-specific oligonucleotide RPRNA5

(appendix) as the probe (data not shown). Figure 20. Structure of the E. coH and H. volcanii RNase P RNAs. In the upper panel are

structures of the RNase P RNAs derived from phylogenetic comparisons of

eubacterial RNase P RNAs (Brown et al., 1991; J. Brown, E. Haas,

and N. Pace, personal communications). Circled nucleotides represent

nucleotides that are present in similar locations in all eubacterial RNase P

RNAs. Arrows in the H. volcanii structure indicate nucleotides that have been

identified as conserved in eukaryotic RNase P RNAs (see text). Arced lines

and boxes indicate sequences that can participate in pseudoknot interactions.

Lower panel, potential structures resulting from the pseudoknot interaction

between the lower and middle core structure loops. Helix designations are

those described by Forster and Altman, 1990. Nucleotides indicated by circles

and arrows are as indicated above; boxed nucleotides are sequences that are

conserved in several eukaryotic RNase P RNAs (see text).

162 163 A

c 'c 0 0 'V

V-V in a „ c * V A CC0

c - 0 eccAAaocAOjsec c c

Esherichia coli Haloferax volcanii

Figure 20. 164

Figure 20 (continued). B

III

aA.AaCUQA.CCA 00 c III I I I II I O C 0 CC 0 _ CO CO C CUUDOAC o©o c I

Cr 0 0 OCtJC C CCCAC 40 S4 IV IV E. coli Hf. volcanii

A OwO c 0 CA CO C 0 OC CC 00 0 JriiJjdH — 11II I 1 •! I I 01173 0 21) 000 A 0 COO 00 C U 0 C u c ’u 0AC d A ” O C A 0-0 I I °A OC III ft — ft * *

i • X A* o AD 0 a OC 0 a AO Q a ' r rrit i u i i • «rm?PffFf8c IUjcocca aooo A c c c a c c D C c a r GT TO V 1 6 Q c

-QaEEJao

HeLa Figure 21. Heterologous reconstitution of the H. volcanii RNase P RNA activity. Lane 1,

pre-tRNAVal only; lane 2, pre-tRNAVaI plus H. volcanii RNase P holoenzyme

(1 |il of 100,000 X g supernatant fraction of cell extract); lane 3, pre-tRNAVal

plus B. subtilis RNase P protein (13.4 nM); lane 4, pre-tRNAVal, B. subtilis

RNase P protein (6.7 nM), and H. volcanii RNase P RNA (108 nM); lane 6,

as in lane 5, except B. subtilis RNase P protein was increased to 13.4 nM; lane

7, as in lane 5, except B. subtilis RNase P protein was increased to 27 nM.

Each reaction contained approximately 2.5 ng (7,000 cpm) of pre-tRNAVal.

Reaction products are indicated.

165 166

1 2 3 4 5 6 7 pretRNAVaL

tRNA + 3’

5’ leader

Figure 21. 167 A Northern blot containing total cellular RNA from a pWL230 transformant and from non-transformed WFD11 was probed with oligonucleotide RPRNA5 and hybridizing RNAs were detected by autoradiography (Figure 22, Panel B). This Northern analysis indicated that the ratio of RNase P RNA expressed from the plasmid to that expressed from the chromosome was about 10:1. This is in agreement with the estimated copy number (ten) of pWL230 in this transformant (see below). No RNase P RNA precursors or degradation products were observed. RNase P assays were performed to compare the activities of WFD11 and transformant extracts (Figure 22, Panel A). The increased copy number of RNase P RNA did not affect total RNase P activity, suggesting that the RNase P protein is not over-expressed in response to the higher concentration of

RNase P RNA (verified by SDS-PAGE analysis; data not shown), and the presence of excess "naked" RNA does not inhibit nor enhance activity under these conditions. These results suggest that the RNase P RNA alone is not catalytically active in the absence of protein in vivo. An attempt was made to separate the naked RNase P RNA from the holoenzyme complex. Cells of H. volcanii transformed with p\VL230 were suspended in a high ionic strength buffer (2.2 M KC1,50 mM MgCl2, 5% glycerol, 50 mM Tris-Cl, pH

7.5) and French-pressed to produce a cell extract. The extract was treated with RNase- free DNase I, then spun at 10,000 X g to remove cellular debris. The cleared extract was fractionated over a Sephacryl S-400 gel-filtration column (2.5 X 150 cm, 500 ml column) in the same buffer. To determine if the naked RNA was separated from the holoenzyme, the individual column fractions were screened for the presence of RNase P RNA by dot- blot analysis and for the holoenzyme by RNase P activity assays (Figure 23). Although the elution profile shows that the holoenzyme elutes before the naked RNase P RNA, all fractions containing naked RNA also had detectable RNase P activity. Therefore, the

RNase P RNA could not be isolated in its native state by this method. Figure 22. H. volcanii transformed with pWL230; RNase P activity assays and Northern

blot analysis. Panel A, RNase P activity assays of crude cell extracts from H.

volcanii WFD11 and H. volcanii WFD11 transformed with pWL230.

Reactions in lanes 2-5 each contained 10 pg of total soluble protein. All

reactions contained approximately 2.5 ng (7,000 cpm) of pre-tRNAVal, 40 mM

Tris-Cl, pH 7.6,100 mM KC1,20 mM MgC12, and 10% glycerol. Lane 1,

pre-tRNAVal only; lane 2, H. volcanii WFP 11 extract; lane 3, pWL230

transformant #1 extract; lane 4 pWL230 transformant #2 extract; lane 5,

pWL230 transformant #3 extract. Reaction products are indicated. Panel B,

Northern blot analysis of in vivo RNase P RNA transcripts from H. volcanii

WFD11 and H. volcanii WFD11 transformed with pWL230. Lane 1, 25 |ig of

total RNA from H. volcanii: lane 2,25 pg of total RNA from H. volcanii

pWL230 transformant #1. The H. volcanii RNase P RNA-specific

oligonucleotide RPRNA5 (appendix), 5' end-labeled, was used as the

probe.

168 169 A

5 4 3 2 1

pretRNA Val

jaa^.wMf4» 4 tRNA + 3'

5' leader

B

1 2

RNase P RNA

Figure 22. Figure 23. Gel-filtration chromatography of the RNase P RNA and holoenzyme from

pWL230-transformed H. volcanii WFD11. The graph shows the elution

profile from fractionation of a cell extract on Sephacryl S-400 in a high salt

buffer (2.2 M KC1, 50 mM MgCl2, 5% glycerol, 50 mM Tris-Cl, pH7.5; see

text). Two-ml column fractions were collected and samples from each were

assayed for the RNase P holoenzyme in the same buffer with pre-tRNAVal

substrate, and for the presence of the RNase P RNA by dot blot analysis with

oligonucleotide RPRNA5,5' end-labeled, as the probe. Fractions containing

detectable RNase P holoenzyme and the RNase P RNA are indicated by bars

above the elution profile.

170 A280 0.0 0.1 0.2 0.3 0.3 0.5 0.5 0.4 0.4 0.6

10 0 30 0 500 400 300 200 100 0 lto Vlm (ml) Volume Elution Figure 23. Figure lezme oloenzym H RNA 600 172 In a separate experiment, approximately 200 pg of RNA isolated from the pWL230

transformant was separated on a 6% denaturing polyacrylamide gel. The RNA was

visualized by U.V. shadowing and the RNase P RNA (a visible band among the RNA

from this transformant) was recovered from the gel as described in the Materials and

Methods. The isolated RNA was assayed for catalytic activity with pre-tRNAVal substrate

under a variety of solution conditions. Ionic conditions tested included 0.1 to 2.0 M

NH4CI in the presence of 30 mM MgCl2, 0.1 to 2.0 M NH4CI in the presence of 100 mM

MgCh, and 0.1 to 2.0 M NH4CI in the presence of 300 mM MgCh. All reactions

included 65 ng of RNase P RNA (and co-migrating RNA), 0.1% SDS, 0.05% NP-40,

and 50 mM Tris.Cl, pH 8.0. The in vivo-transcribed RNA lacked catalytic activity under

all conditions tested (data not shown).

In Vivo Analysis of tRNA Intron Processing

in Haloferax volcanii

Construction of an H. volcanii-E. coli shuttle-expression vector:

A shutde-expression vector was constructed that can be selected for and maintained

in either H. volcanii or E. coli and permits the expression of cloned genes in H. volcanii.

A derivative of the previously described E. coli-H. volcanii shutde vector pWL102 (Lam and Doolittle, 1989) was utilized as a vehicle and the H. volcanii tRNALys gene 5' leader region was used as a promoter module. The leader region of the tRNALys gene was chosen as a potential promoter since it contained the conserved box A and box B sequence elements which have been inferred from in vitro and in vivo studies to constitute an archaebacterial promoter (see literature Review). This region also contains the purine-rich sequence elements (Figure 25) characteristic of halobacterial stable RNA promoter regions 173 (Daniels et al., 1986; Datta et al., 1989; Dennis, 1987; Larsen et al., 1989; Moritz and

Goebel, 1985).

Construction of the shuttle-expression vector (Figure 24) was initiated by cloning

the promoter region of the H. volcanii tRNALys gene and the tRNATlP-0167 reporter gene

into the multiple cloning region of pUC18. This multiple cloning region, containing the

tRNATrP-0167 gene 3' to the promoter was subcloned into the unique HindM and EcoRI

sites of the pWL102 derivative pWL201 to give the plasmid pWL202. Sequencing of the

Hindlll-EcoRI fragment verified that the expected construct was obtained (Figure 25).

For use in control experiments, the HindQI-Xbal promoter fragment was deleted from

pWL202 to produce pWL203. The BamHI fragment containing the tRNATrP-0167 gene

was deleted from pWL202 to produce pWL204 (data not shown). This plasmid has

unique BamHI. Xbal. Smal. Xmal. KpnI. and EcoRI restriction sites located 3' to the

promoter, which provide sites for cloning foreign DNA under the transcriptional control

of the Haloferax tRNALys promoter. Like pWL102, each of these new plasmid constructs

transform H. volcanii to mevinolin resistance.

H. volcanii restriction barrier:

In the initial transformation of H. volcanii WFD11 with pWL202 DNA, isolated

from E. coli DH5a-F', only about 5% of the recovered mevinolin-resistant colonies

contained plasmid DNA. A Southern analysis of total genomic DNA from these

transformants revealed that those cells which carried plasmids contained pWL202. No

evidence was obtained for integration of the plasmid into the chromosome. Those cells

which lacked plasmid DNA but were mevinolin-resistant were likely to be the result of recombination between the chromosomal and plasmid HMGCoA reductase gene regions

since they appeared at a frequency 100-fold higher than the spontaneous reversion frequency. In subsequent experiments where pWL204-based expression vector Figure 24. Construction of the E. coli-H. volcanii shuttle-expression vector pWL202.

The expression vector was constructed from the H. volcanii-E. coli shuttle

vector p\VL102 and contains the H. volcanii tRNALys gene promoter region

and a synthetic gene encoding an H. mediterranei modified tRNATlP gene. In

addition to the unique BamHI site into which the H. mediterranei tRNATrP

gene is cloned, unique restriction sites for Xbal. Smal. Xmal. KpnI. and

EcoRI are located immediately downstream of the promoter. AmpR, ampicillin

resistance; MevR, mevinohn resistance.

174 175

Ecofl I

ill- 'J01 eon 1‘

I (112 bo) Ha* 111 Ha* III

Orol Hincl1

pUClo-LusP

•0167 tlco) , 9o*HI Hindi 11 Kpnl-Hcol Qelelion 8o*Ht Olunl end ) igation pUCI8-Ly*P-Trp 016? CI o I HlftdM I Hindi II-EcoRI So* I

Orel Flap iU. vQlcani i PU I201 •Sphl 10.1 Kb °r s * o te r tfUron i r ~l—i H in d lll Sphl Hbal OaiHI ( EcoRI S ill

Hind) 11 -Ecofll

frp HI. volconl i -0167 tftMfl t,y* Proaotf

H in d lll Sort I I tenl I EeoRt S.ol SiH J

Oral

Pill •Sphl

Figure 24. Figure 25. Sequence of the pWL202 multiple cloning region and secondary structure of

tRNATlP-0167 RNA. Panel A, sequence of the p\VL202 multiple cloning

region containing the H. volcanii tRNALys gene promoter and the tRNATrP-

0167 gene. The sequences which represent the putative archaebacterial

promoter are shown as box A and box B. Also shown are purine-rich

sequences which precede the box A and box B sequences of other halobacterial

stable RNA genes. The primary transcript for this gene is shown below the

DNA sequence, and the region which represents mature tRNATlP-0167 RNA

sequence is indicated by the solid line. The synthetic oligonucleotide 0167INT

(appendix), used as the probe for Northern analysis and as a primer for primer

extension and DNA sequencing, is complimentary to the RNA region indicated.

Panel B, secondary structure of end-matured H. mediterranei tRNATlP-0167

RNA. Cleavage sites for the H. volcanii intron endonuclease are indicated by

arrows, and numbering of the tRNA nucleotides follows that of panel A.

176 177

Q ■ ■ • • • i • • *80 AflGCTTGCflTGCCTGCflGGTCCCGCCflCTTRCflCCCflCCGTTTGTTCGTTGTTTCTTGCGTGTGCGTCCCTGCCGTCGTC

Purine _ . Purine n Q rich Bo* rich 0OX 0 160 GTGCRGfififiGOfififiGTCRTlTTTRCCCRbCGGCfiGTTfiCGfiGfiGfilrTOClRfiGGGGRCTCTRGflGGflTCCTnRTfiCGRCTCfl 5 ‘ -GCRRGGGGRCUCURGRGGRUCCURfiUfiCGflCUCfl 240 CTRTflGGGGCTGTGGCCflflGCCCGGCflTGGCGRCTGRCTCCRGRGGCTTGGCCCRCRCCGGRGRTRTCRGTCGflTCGGGG CURURGGGGCUGUGGCCRRGCCCGGCRUGGCGRCUGRCUCCRpRGGCUUGGCGCRCRCCGGRGpURUCRGUCGRUCGGGG fRNaseP cleauage 0167INT GTTCRRRTCRRRTCCCTCCGGCCCCRCCRGGRTCCCCGGGTRCCGRGCTCGRRTTCG GUUCRRRUCRRRUCCCUCCGGCCCCRCCR ------3 ‘

B H I. w e d lte r r o n a l ACC A tRNRTrp-0167 G-C G-C C-G U-G .. o C G fl n.r r .. r r r R c n c c G o u 9 V 9 f f i C *111 GGGGG r 6„ . nUC0C G fl-UcCu U G C-G CGn U-R G-C V R-U flI -“ C-G HR 225 U-fl C-G C-G 1 G-C / l \ ' G-C C fl U C I « C G C GC

Figure 25. 178 constructs containing other genes under the transcriptional control of the tRNALys gene

promoter were introduced into H. volcanii. the incidence of plasmid-containing mevinolin-

resistant colonies was similar or much lower. Similar results with other Haloferax-E. coli

shuttle vectors have been reported and been attributed to a restriction system in Haloferax

sp. (Holmes et al., 1991; Blaseio and Pfeifer, 1990). H. volcanii has been demonstrated

to possess a restriction system similar to the E. cofi restriction system which recognizes

and degrades DNA that is methylated at adenine residues (Holmes et al., 1991; Lodwick et

al., 1986).

To determine whether those transformants which allowed stable maintenance of

pWL202 were restriction deficient mutants, a pWL202 transformant was grown in the

presence of 20 fiM ethidium bromide to cure it of its plasmid DNA. When the cured strain

was compared to the wild-type H. volcanii WFP 11 strain in transformation experiments,

no difference in the frequency of plasmid-containing mevinolin-resistant transformants

was observed (data not shown). Therefore, plasmid DNA introduced into these

transformants appears to have merely evaded the restriction system. It has recently been

reported that propagation of plasmid DNA in E. coh strain JM110, which appears to have

a DNA methylation pattern (dam) similar to that of H. volcanii. helps eliminate restriction

problems (Holmes and Dyall-Smith, 1991). In this study, the effect of DNA methylation

on plasmid transformation efficiency was determined. H. volcanii was transformed with

pWL202 DNA originating from three sources: E. coli DH5a-F (dam+), E. coli JM110

(dam), and H. volcanii. In addition, to determine whether stable H. volcanii pWL202

transformants obtained with E. coli DH5a-F'-propagated plasmid DNA contained plasmid

mutations which permited the vector to be tolerated, pWL202 DNA isolated from H. volcanii was re-introduced into E. cofi DH5a-F' and E. cofi JM110. Plasmid DNA isolated from these E. coh transformants was then transformed back into H. volcanii. and the transformation efficiencies obtained with the two sets of transformation experiments 179

Table 2. Effect of DNA methylation on the transformation of H. volcanii by plasmid pWL202

Plasmid Source3 cfu per mlb MevR transformants Transformation Plasmid-containing per mlc Frequency*1 MevR transformants per 100 screened6

D H 5a-F 8.5 X 108 5.6 X 102 6.6 X 10-7 3

JM110 7.8 X 108 2.4 X 104 3.1 X lO'5 95

H. volcanii to DH5a-F' 8.7 X 108 5.9 X 102 6.8 X lO’7 45

H. volcanii to JM110 7.2 X 108 2.7 X 104 3.8 X lO'5 100

H. volcanii 8.2 X 108 1.6 X 105 2.0 X 10-4 100

a Plasmid DNA used to transform H. volcanii was isolated from the indicated sources. E. coh strains DH5a-F' and JM110 are Dam+ and Dam-, respectively. Dam+ strains have methylated adenine residues in the sequence GAmTC. "H. volcanii to DH5a- F", for instance, indicates that pWL202 was isolated from H. volcanii then propagated in DH5a-F before re-transforming H. volcanii. The same initial competent cell suspension and quantity of plasmid DNA (0.5 pg) was used for all transformations. b Colony forming units per ml assayed on complex regeneration agar (see Materials and Methods). c Mevinolin-resistant transformants per ml assayed on complex regeneration agar containing 20 pM mevinolin. d Mevinolin-resistant transformants per ml divided by the colony forming units per ml. e Number of mevinolin-resistant transformants out of 100 colonies screened that contain plasmid pWL202 DNA as determined by colony hybridization using oligonucleotide 0167INT, 5' end-labeled, as the probe. were compared. Finally, colony hybridizations with a pWL202-specific oligonucleotide

probe (0167INT) were used to determine the percentage of mevinolin-resistant

transformants that stably maintained pWL202. The results from the above experiments

are presented in Table 2. pWL202 DNA with methylated A residues (i.e., propagated in

E. coli DH5a-F) showed a 50-fold drop in transformation efficiency compared to

unmethylated plasmid DNA (i.e., propagated in E. coh JM110). The unmethylated

pWL202 DNA isolated from E. coli JM 110 transformed at frequencies only 6-fold lower

than that of pWL202 DNA isolated from H. volcanii. When pWL202 DNA isolated from

H. volcanii was first propagated in E. coh strain DH5a-F or JM110 before being used to

re-transform H. volcanii. the transformation frequencies were essentially the same as with

plasmid DNA originating from DH5a-F' or JM110 (i. e., not previously exposed to H.

yolcanh). These results are in agreement with those obtained by Holmes et al. (1991)

using a different shuttle vector, and indicate that H. volcanii has a restriction system that

operates via adenine methylation. The colony hybridization experiments indicated that

when methylated pWL202 DNA was used in the transformations, > 90% of the

transformants lost at least the multiple cloning region of the vector (the probe used,

0167INT, is complimentary to the intron sequence of tRNATrP-0167). When adenine residues within pWL202 were not methylated, > 90% of the transformants stably

maintained the vector. Some adenine methylation sites, or other restriction sites, might be eliminated by processes in H. volcanii. When pWL202 DNA isolated from E. coli

DH5a-F' was previously maintained in H. volcanii. as opposed to originating in DH5a-

F', there was a > 10-fold increase in the percentage of mevinolin-resistant transformants

which stably maintained the vector (Table 2). Those MevR transformants without the vector sequences presumably resulted from linearization of the vector by a restriction endonuclease followed by homologous recombination between the mevinolin-resistance 181 gene (HMGCoA reductase gene with an up-promoter mutation) and the wild-type copy of

this gene in the chromosome

Shuttle-expression vector copy number determination:

For the various shuttle vector and shuttle-expression vector constructs used

throughout this study, the number of plasmids per H. volcanii chromosome was

determined by Southern analysis using an oligonucleotide probe (HMGCoA; appendix)

that is complimentary to the HMGCoA reductase encoding gene. This gene is present as a

single copy in each plasmid and in the chromosome. The Southern blot contained

electrophoretically separated restriction fragments resulting from EcoRl-MluI double­

digests of total DNA isolated from each plasmid transformant analyzed. The EcoRI-MluI

d igest linearizes the plasmids and releases the chromosomal HMGCoA reductase gene on

a 3.5 kb Mlul fragment. Following hybridization of the Southern blot with the 5' end-

labeled oligonucleotide HMGCoA probe, the extent of hybridization to the plasmid and

chromosomal HMGCoA reductase genes was quantitated as counts per minute (cpm)

using a Betagen Betascope 603 Blot Analyzer (see Materials and Methods). The number

of plasmid copies per chromosome was determined by dividing the plasmid gene cpm

value by the chromosomal gene cpm value. The Southern blot analysis was performed in

triplicate; the average values obtained are presented in Table 3. Vectors without the

tRNALys gene promoter were found to be present in H. volcanii at 7 to 9 copies per

chromosome, while vectors with this promoter sequence, with the exception of pWL212

(12 copies), are present in 19 to 22 copies per chromosome. The presence of a consensus

H. volcanii tRNA gene terminator downstream of cloned tRNA genes appears to have no affect on copy number. 182

Table 3. Copy number of plasmids in H. volcanii.

Plasmid3 tRNALys Gene tRNA Gene Relevant Genec Copy Numbed Promoter ? Terminator^ ?

pWL102 No No None 8.6 pWL201 No No None 7.2 pWL230 No No RNase P RNA 8.8 pWL202 Yes No tRNATlP-0167 21.1 pWL207 Yes Yes tRNATrP-0167 22.2 pWL208 Yes Yes tRNATrP-0167m 19.7 pWL210 Yes Yes tRNATlP -0167o+rm 21.0

pWL211 Yes Yes tRNATrP-016m 18.9 pWL212 Yes Yes tRNATlP-016-AGGAGm 11.9 pWL220 Yes Yes tRNAPro 19.4

a Plasmids pWL102, pWL201, and pWL202 are illustrated in Figure 24. The other plasmids are described in the text and appendix. consensus H. volcanii tRNA gene terminator sequence was constructed with complimentary oligonucleotides and cloned downstream of the indicated tRNA genes (see text). CThe indicated genes were cloned into the vector pWL201 (for the RNase P RNA gene) or pWL204 (for all tRNA genes). The superscript "m" indicates that these tRNA genes were constructed to contain an altered acceptor stem sequence (see text). dThe number of plasmid copies per chromosome as determined by Southern analysis using an oligonucleotide probe specific for the HMGCoA reductase gene (see text). The experiment was performed in triplicate; the copy numbers indicated are average values from the three experiments. Figure 26. Northern blot analysis of in vivo tRNATrP-0167 transcripts. In lane 1, sizes

of the indicated markers are as follows: 7S, 300 nucleotides (nt); 5S, 122 nt;

0167 primary transcript (5' and 3' end-matured), 98 nt; exon 2, 39 nt; exon 1,

38 nt; intron, 22 nt. Lane 2 contains total RNA (20 fig) isolated from pWL202-

transformed H. volcanii WFD11. Lane 3 contains total RNA (20 p.g) isolated

from pWL203-transformed H. volcanii WFD11. This plasmid lacks the

HindlH-to -Xbal fragment which contains the tRNALys promoter sequences.

The intron-specific oligonucleotide 0167INT (appendix), 5' end-labeled, was

used as the probe.

183 184

'7S"—

Primary Transcript • W - T . A i . "5S" —

0167 — — End Matured Precursor

* v

Exon 2 __ Exon 1 —

Intron —

Figure 26. Figure 27. Mapping of the 5' end of tRNATrP-0167 primary transcripts by primer

extension. The autoradiogram shows dideoxy-terminated DNA sequencing

reaction products (lanes A, G, C, T) and primer extension reaction products

(lane PE) after separation on a denaturing polyacrylamide gel. Sequences

shown are the noncoding strand. The transcription start site is indicated by the

box B arrow. An M13mpl8 clone containing the Hindlll-EcoRI multiple

cloning region of pWL202 was used as the template for DNA sequencing.

Total H. volcanii RNA used as template for avian myeloblastosis virus reverse

transcriptase in the primer extension reaction was isolated from a pWL202

transformant. The synthetic oligonucleotide 0167INT (appendix) was used as

the primer for both DNA sequencing and primer extension.

185 RNase P Cleavage 187 Expression of a modified tRNAJXB gene in H. volcanii:

Northern analysis was used to determine whether transcripts from the tRNATrP-

0167 promoter reporter gene were among the RNAs of the pWL202 transformant (Figure

26). Using the intron-specific probe 0167INT (appendix), two major intron-containing

RNAs of 155 and 98 nucleotides were apparent. The larger RNA species most probably represents the primary transcript from the gene (see below). The smaller, 98 nucleotide species is identical in size to the synthetic H. mediterranei tRNATrP-0167 in vitro transcript; the in vitro-produced RNA begins with the first nucleotide of the mature tRNA and ends with a CCA 3' terminus. A fragment corresponding to the excised intron (22 nucleotides) was not detected in the hybridization.

The dependence of transcription on the tRNALys gene promoter was demonstrated when RNAs isolated from a transformant carrying the plasmid pWL203 (see above) failed to hybridize to the 0167INT probe (Figure 26). Further evidence of specific transcription was provided by locating the 5' end of the primary transcript. Primer extension analysis using a unique intron-specific primer indicated the presence of two major RNA species (Figure 27). The larger RNA corresponds in size to the 155- nucleotide species observed in the Northern analysis and represents a discrete RNA species beginning at G-128 (Figure 25). This residue lies within the box B sequence TTGC, the expected location for transcription initiation. The most predominant extension product, 98 nucleotides, corresponds in size to an intron-containing species in which the 5' leader sequence has been removed by RNase P. This is consistent with the

Northern analysis in which the 98-nucleotide species comigrated with the in vitro- produced tRNATrP-0167 RNA, which lacks the 5' leader sequences.

Although the site of transcription termination was not formally defined, the length of the tRNATrP-0167 apparent primary transcript (155 nucleotides) is consistent with termination occurring within a few nucleotides of the mature 3' terminus of the tRNA. 188 However, the possibility that the 3' end of longer precursors is rapidly processed to

produce the 155-nucleotide transcript cannot be excluded.

In vivo analysis of tRNA intron endonuclease activity on modified pre-tRNA3iB

substrates:

To determine whether the in vitro substrate recognition properties of the H. volcanii

tRNA intron endonuclease (Thompson and Daniels, 1988; 1990; Thompson et al., 1989)

hold true in vivo, in vivo transcripts from expression vector constructs containing the

wild-type (016) and three specifically modified (016-AGGAG, 0167, and 0167o+r)

tRNATrP genes were analyzed. 016-AGGAG was analyzed to test the requirement for an

exon-intron boundary structure which includes two three-nucleotide bulge loops separated

by four base pairs. 0167 was analyzed to investigate the role of the large intron in

processing. O167o+r was included in the study to determine whether alterations in the

anticodon, while maintaining the exon-intron boundary structures, effect cleavage. The

properties of these mutant pre-tRNATlP RNAs, along with their suitabilities as substrates

for the intron endonuclease in vitro, are discussed in more detail below. To facilitate

subcloning into the shuttle-expression vector pWL204, each of the modified tRNATlP

genes was reconstructed using the polymerase chain reaction and mutagenic

oligonucleotide primers to contain 5’ Xbal and 3* EcoRI restriction sites within 10 bp of

the coding region. These mutagenic oligonucleotides also altered the sequences of the

acceptor stem (see Materials and Methods). These changes permited the cloning of the

genes into pWL204 under the transcriptional control of the tRNALys gene promoter and,

by virtue of the altered acceptor stem sequences, provided a means to distinguish the

plasmid encoded tRNATrP transcripts from those encoded by the chromosomal tRNATrP

gene. The expression vector constructs pWL211, pWL212, pWL208, and pWL210 contain the exon-modified 016m, 016-AGGAGm, 0167m, and 0167o+rm tRNATrP Figure 28. Secondary structures of pre-tRNATrP substrates with modified acceptor stem

sequences. The altered acceptor stem sequences are enclosed within the large

boxes. In Panel A, the nucleotides 5'-GGAG-3' deleted from 016m to produce

016-AGGAGm are indicated by the vertical line. In Panel D, the location of the

C-G base pair to U-A base pair mutation introduced into 0167m to produce

01670+1™ is indicated by the small box. Potential cleavage sites for the

H. volcanii tRNA intron endonuclease are indicated by arrows.

189 b C-C 016m B. 016-AGGAGm M o d ifie d X xods M o d ifie d Kzoqs

C G , °'c » A A C <5 A C ‘xccoou^nfff A C A C C G GU HffY c I I I I o o a o o c C I I I I C C G C G U G G C G u u G U C GC G A-U, ru G c A A-U , U C-G G A C-CCG* U-A U-A G-C o-c y ,U c A-U A r A-U A ✓ C U C-G ' A U-A A G-C C-G C-C A C-G c G-C u U-A / C‘CA G-C U U-A C-G G-C g ' c a c-c C-G c-c C-C A G-C C-G C-G G-C C-G C-C A C-G CAC*U G-C G G-C A C A-U C-G CA<=-U U-A G C-C A C A-U C-G C-G A-U U-A kG UCG-C C-C

U A 6 U C oS 0 = = A u A-U G A A G-U U C-G A r G C U G A-U q A C-U G-tf C-G C-G C-G G G-C C-U A-U C-G C-Q C-G U-G G-C C-C A-U A-U C-G U-G C-C A-U U A C

ACC A A CC A Ol67m PG-C B- 0167 o+r171 C-0 c-o C-0 c-o M odified tXOM tfodlfltd Kxooi C-0 c-o a-ci o-c G-C o-c losa ,CCA CJll: y c c c C A C CG GU fYfff ACCCCU T i m C C G C C C M i l II I I U G GC G U G GC G A-U ■ CU “ U kmUci*< C-G ' c-c Cc# U-A U-A C-C G-C M y A-U A “

C-G c-c " U-A op«l «uppr*»»or C-C ■ut«tlon C-C i C-G

C-C * G-C / C-C / C-C u u 0 .

Figure 28. 191 genes, respectively. The secondary structures of these modified pre-tRNATrP substrates

are presented in Figure 28. Each vector also contains a consensus Haloferax tRNA gene

terminator sequence (5'-TTCCTCATCTTT-3'). This terminator was constructed by

cloning the annealed complimentary oligonucleotides TERM-R and TERM-AR (appendix)

into the EcoRI site downstream of each modified tRNATrP gene. The annealed

oligonucleotides were cloned into the EcoRI site downstream of each modified tRNATlP

gene. To verify that the desired clones were obtained, plasmid DNA was isolated from

the transformants and the Hindni-EcoRI multiple cloning region fragment (see Figure 24)

from each construct was subcloned into M13mpl9 and subjected to DNA sequence

analysis. The plasmids containing the modified tRNATrP genes were then propagated in

E. coll JM110, then transformed into H. volcanii WFD11.

To demonstrate that the modified acceptor stem sequences have no affect on in vitro

substrate recognition and cleavage by the H. volcanii tRNA intron endonuclease, each of the four modified tRNATlP genes were also cloned (as Xbal-EcoRI fragments) into the T7

RNA polymerase expression vector pIBI31. T7 RNA polymerase Run-off [a- 32P]ATP- labeled transcripts from each gene were prepared. Transcripts from these clones, linearized with EcoRI. have 56 and 5 nucleotides of 5' and 3’ flanking sequence, respectively. The analogous tRNATrP genes with the wild-type acceptor stem sequences were transcribed in vitro as controls (Thompson and Daniels, 1990). The uniformly- labeled transcripts from these genes contain the mature tRNA 5’ and 3' termini.

All substrates were assayed with partially purified H. volcanii tRNA intron endonuclease

(lacks RNase P activity) in TSG buffer (40 mM Tris-Cl, pH 7.5, 5 mM spemidine, 2% glycerol) as described in the Materials and Methods. The reaction products were separated by electrophoresis through a 6 % denaturing polyacrylamide gel and visualized by autoradiography. As shown in Figure 29, both wild-type and modified acceptor stem- containing pre-tRNATlP transcripts appear to serve equally well as substrates for the tRNA 192 intron endonuclease (results described below). These assays also demonstrate that the

presence of 5' and 3' flanking sequences have no affect on the endonuclease activity.

The fate of transcripts expressed from the modified tRNATlP genes in vivo were

analyzed for excision of the intron and ligation of the exon sequences by Northern blot

analysis using oligonucleotide probes specific for the 5' and 3' exon sequences, intron

sequences, and the 5' leader sequence. Oligonucleotides TRPMEI and STEMPE are

complimentary to the altered acceptor stem sequence regions of the 5' and 3' exons,

respectively. Oligonucleotides TRPENT and 0167INT are specific for the wild-type

intron sequence of 016 and 016-AGGAG, and for the shortened 22-nucleotide intron of

0167 and O167o+r, respectively. The oligonucleotide PFLANK is complimentary to the

5' leader sequence of the primary transcripts (the sequences of the above oligonucleotides

are listed in the appendix). The Northern blots were hybridized with a single

oligonucleotide probe at a time. Following detection of the hybridizing RNAs by

autoradiography, the probe was stripped from the blot (by heating at 95°C in 0.2 X SSC,

0.5% SDS for 40 min), then the blot was re-hybridized with the next probe. The results

from the hybridization experiments are shown in Figure 30. Transcripts from the 016

gene serve as a control for the other three modified tRNATlP genes. 016 has the complete

wild-type 104-nucleotide intron and exon-intron boundary structures. H. volcanii tRNA

intron endonuclease precisely excises the intron from 016 transcripts prepared in vitro

(Thompson and Daniels, 1990; see Figure 29). As shown in Figure 30, accurate cleavage

of 016m occurs in vivo as well. In addition, the exon sequences were ligated following

excision of the intron. The Northern blot autoradiogram in Figure 30 shows those RNAs

which hybridized to the 5' exon probe TRPMEI. Together with results obtained from

probing the same blot with the STEMPE, TRPINT, and PFLANK oligonucleotides (data

not shown), it was concluded that the three major 016m transcript RNA processing products observed in Figure 30 represent the mature 77-nucleotide tRNA, a 5' exon plus Figure 29. Cleavage assays of 0 1 6 ,016-AGGAG, 0167, and O1670+r pre-tRNATlP

substrates containing either the wild-type or modified acceptor stem sequences.

The substrates were assayed with partially purified H. volcanii tRNA intron

endonuclease in TSG buffer (40 mM Tris-Cl, pH 7.5,5 mM spermidine, 2%

glycerol) as described in the Materials and Methods. Panel A shows an

autoradiogram of cleavage assays with the 0 1 6 ,016m (modified acceptor

stem), 016-AGGAG, and 016-AGGAGm (modified acceptor stem) pre-

tRNATrP substrates. Lane 1,016 only; lane 2 ,016m only; lane 3,016 plus

endonuclease; lane 4 ,016m plus endonuclease; lane 5 ,016-AGGAG only; lane

6 ,016-AGGAGm only; lane 7, 016-AGGAG plus endonuclease; and lane 8 ,

016-AGGAGm plus endonuclease. Panel B shows an autoradiogram of

cleavage assays with the 0167,0167m (modified acceptor stem), O167o+r,

and 01670+1™ (modified acceptor stem) pre-tRNATrP substrates. Lane 1,

0167 only; lane 2,0167 plus endonuclease; lane 3 ,0167m only; lane 4,

0167m plus endonuclease; lane 5 ,0167o+r only; lane 6 ,0167o+r plus

endonuclease; lane 7, 01670+1™ only; and lane 8 , 01670+1™ plus

endonulease. The reaction products are indicated; asterisks denote reaction

products from substrates with modified acceptor stem sequences.

193 pretRNA

pretRNA

# Intron *5' exon

*3'exon 3' exon 5’ exon

‘pretRNA

pretRNA *5’ exon

*3' exon 3' exon 5’ exon Intron Figure 30. Northern blot analysis of in vivo transcripts from modified tRNATrP genes.

The autoradiogram shows RNAs that hybridized to the 5' end-labeled 5' exon-

specific oligonucleotide TRPMEI (appendix). Size markers to the left of the

autoradiogram indicate uniformly-labeled RNAs (for sizes 77 to 181) or 5'

end-labeled oligonucleotides (for sizes 27 to 54) that were separated and

transferred to the blot alongside the cellular RNAs. Lane 1 contains total RNA

(25 pg), including 016m RNA, isolated from pWL211 -transformed

H. volcanii WFD11. Lane 2 contains total RNA (25 pg), including 016-

AGGAG111 RNA, isolated from pWL212-transformed H. volcanii WFD11.

Lane 3 represents a negative control and contains total RNA (25 pg) isolated

from H. volcanii WFD11. Lane 4 contains total RNA (25 pg), including

0167m RNA, isolated from pWL208-transformed H. volcanii WFD11. The

identity of the cleavage products indicated by the arrows are shown to the right

of the autoradiogram. Left-hand and right hand boxes represent the 5' exon

and 3’ exon, respectively. Lines between the boxes represent the intron.

Lines extending to the left and right of the boxes represent 5’ leader sequence

and 3' trailing sequence, respectively. The Hybridization Profile graphic

provides a summary of the hybridization data using exon I, intron, exon II,

and 5' leader probes. The regions of the tRNATlP precursors that are

complimentary to the oligonucleotide probes are shown. Oligonucleotide

probe abbreviations: 5', PFLANK; El, TRPMEI; E2, STEMPE; I, TRPINT

(for 016 and 016-AGGAG) or 0167INT (for 0167).

195 196

5' Exon Probe Hybridization Identity Profile 5’ E1 E2 I

_ □ □ _ 181 — •

112 — r~i r~i 99 — r~i i~ i

77 — i—i—i JZ] 54 —

4 4 —

.. Exonl Exon2 31 — 5 Leader^— | intron |— gg 2 7 - 5 IT E2 I* (0167)

Figure 30. 5' leader sequence species, and a 5' end-matured tRNA species which contains a ca. 18-

nucleotide 3' trailing sequence. An additional major 64-nucleotide 016m RNA processing

product hybridized only to the 3' exon-specific oligonucleotide STEMPE (data not

shown). This product appears to consist of the 3' exon sequence plus a 25-nucleotide 3'

trailing sequence. The intron-specific oligonucleotide TRPINT hybridized to several large

016 precursor RNAs, but most predominantly to the free 104-nucleotide intron and to a

181-nucleotide species that is identical in size to end-matured intron-containing 016

transcripts. The 181-nucleotide species also hybridized to the 5' exon- and 3' exon-

specific probes. To a lesser degree, oligonucleotide TRPINT also hybridized to the 104-

and 181-nucleotide RNA species, but no other RNAs, among the total RNAs isolated

from non-transformed H. volcanii WFD11 (data not shown). Although TRPINT cannot distinguish between the introns of the plasmid- and chromosomal- encoded tRNATrP

genes, we assume that the increased signal in transformed cells represents plasmid- encoded RNAs.

A comparative analysis of archaebacterial intron-containing tRNAs suggests that a conserved structure, in which the cleavage sites are located in two, three-nucleotide loops separated by four base-pairs (as present in 016; see Figure 28), could serve as a recognition element for archaebacterial tRNA intron endonuclease (Thompson et al.,

1989). To test whether this was a required structure, the intron sequence (5'-GGAG-3') involved in the four base pairs between the two loops was removed from 016 (Thompson and Daniels, 1990). The resulting substrate, 016-AGGAG, has intact cleavage sites but they are located in an asymetric internal loop (see Figure 28). This substrate was not cleaved by the endonuclease in vitro, suggesting that the wild-type structure at the exon- intron boundaries is required (Thompson and Daniels, 1990; see Figure 29). The

Northern blot analysis of in vivo 016-AGGAGm transcripts (Figure 30) provided no 198 evidence for excision of the intron, and therefore support the proposal that this structural element is required for in vivo processing.

To determine whether the large intron of pre-tRNATlP affects processing in vivo, an intron deletion derivative of 016, designated 0167, that retains only 22 nucleotides of the wild-type intron was analyzed. While 0167 is a substrate for the endonuclease in vitro, cleavage is less efficient than with 016 (Thompson and Daniels, 1990; see Figure 29). As shown in Figure 30, a similar situation exists in vivo; 0167m was processed by the endonuclease but, compared to 016m, fewer of the 0167m precursor RN A w ere converted to mature RNAs. As with 016m, the mature 77-nucleotide tRNA and 5' end- matured tRNA plus 18-nucleotide 3' flanking sequence products were observed (Figure

30). The 64-nucleotide 3' exon plus 3' flanking sequence product was also observed when the Northern blot was probed with the 3' exon-specific oligonucleotide STEMPE

(data not shown). However, a free 5' exon plus 5' leader sequence product was not detected with oligonucleotide TRPMEI (Figure 30), and the intron-specific oligonucleotide

0167INT did not hybridize to a product corresponding to the excised intron. The analysis of 0167m demonstrated that the large wild-type intron is not absolutely required for processing in vivo.

The final modified tRNATrP substrate analyzed in vivo was 0167o+rm. To investigate whether specific sequence contacts were also required for substrate recognition by the endonuclease, an opal suppressor mutation and a compensatory base change in the intron to maintain wild-type structure, was introduced into 0167 to produce 0167o+r

(Thompson, 1990). Transcripts from this gene have a U-A base pair in place of a C-G base pair between the two three-nucleotide bulge loops (see Figure 28). In vitro, the efficiency of cleavage of this substrate is less than 10% of the cleavage observed with

0167 (Thompson, 1990; see Figure 29). In vivo, however, 0167o+rm was processed as efficiently as 0167m. The reaction products detected in the Northern analysis (data not 199 shown) were identical to those observed with 0167m (Figure 30) with one exception; the

95-nucleotide 5' end-matured tRNA plus 3' flanking sequence product was absent among

the RNAs of the 0167o+rm clone transformant.

Yeast pre-tRNAEtfl as a substrate for H. volcanii tRNA intron endonuclease:

In vitro studies indicate that the H. volcanii tRNA intron endonuclease has a strict

requirement for a defined structure at the exon-intron boundaries, but does not require an

intact mature tRNA-like structure (Thompson and Daniels, 1988; 1990; Thompson et al.,

1989). The in vivo study presented above also indicates that a defined exon-intron

boundary structure is required for substrate recognition. In contrast, the Saccharomvces

cerevisiae nuclear tRNA intron endonuclease has an absolute requirement for a mature

tRNA-like structure because it recognizes its cleavage sites via a measurement mechanism

that senses the distance from the top of the anticodon stem to the 5' and 3' cleavage sites

by contacting specific sites within the mature tRNA domain (Lee and Knapp, 1985; Reyes and Abelson, 1988). Exon-intron boundary structure is thought to play a more passive role in substrate recognition and cleavage by eukaryotic nuclear tRNA endonucleases.

To further analyze the substrate recognition properties of the halophilic tRNA intron endonuclease, it was determined whether transcripts from the S. cerevisiae intron- containing tRNA 1*10 gene could serve as a substrate in vivo. Yeast pre-tRNAPro was chosen because, as shown in Figure 31, it has an exon-intron boundary structure closely resembling that of the Haloferax pre-tRNATrP. To clone the tRNAF 1"0 gene into the shuttle-expression vector pWL204, the gene was initially excised from the vector pGKNl

(Ogden et al., 1984) as an Rsal fragment. This fragment has 2 and 42 base pairs of sequence 5' and 3' to the mature tRNA coding sequence, respectively. The fragment was then blunt-ended by filling in the ends with Klenow and dNTPs and ligated into the Smal 200 site of pWL204, placing the gene under the transcriptional control of the tRNALys gene promoter (Figure 31). The tRNA 1* 0 gene contains a stretch of nine T residues located six nucleotides from the mature 3' end of the tRNA sequence (Ogden et al., 1984). This T- rich sequence was expected to function as a transcription terminator in H. volcanii. tRNA1*110 primary transcripts initiating from the box B sequence of the tRNALys gene promoter of this construct, pWL220, would have a 25-nucleotide 5' leader sequence with the potential to form a stable stem-loop structure. Primer extension analyses of total RNA from pWL220-transformed cells using oligonucleotide primers complimentary to the 5' exon, intron, and 3' exon sequences of tRNA 1*10 all indicated that the transcription start site lies within the box B sequence (data not shown). Preliminary Northern blot analyses of total RNA isolated from an H. volcanii pWL220 transformant indicated that these transcripts were not a substrate for either tRNA intron endonuclease nor RNase P (data not shown). It was possible that, although the endonuclease does not require mature tRNA structure in vitro, the potential for a stem-loop structure in the 5' leader sequence of pre-tRNA1* 0 transcripts might alter the tRNA structure and thereby prevent cleavage. To eliminate the potential for this structure, pWL220 was digested with BamHI. a restriction site within the stem-encoding sequence, treated with SI nuclease to remove the resulting two two-nucleotide single-strand overhangs, then blunt-end ligated to produce pWL221.

After propagation of pWL221 in H. volcanii. the HindUI-EcoRI multiple cloning region fragment of the plasmid, containing the tRNALys gene promoter and the tRNA1*0 gene, was subcloned into M13mpl9 and subjected to DNA sequence analysis. This analysis verified that only the expected four nucleotides were removed by S 1 nuclease and that no mutations within the tRNALys gene promoter or the tRNA1*0 gene were introduced by H. volcanii. The multiple cloning region of p\VL221 is illustrated in Figure 31. Preliminary results from a Northern blot analysis of total RNA from an H. volcanii pWL221 transformant indicated that pre-tRNA 1*0 transcripts from this vector are also not a Figure 31. Multiple cloning region of pWL221 and pWL222 and a comparison of the

exon-intron boundary structures of S. cerevisiae pre-tRNA1*1^ and H. volcanii

pre-tRNATrP. Panel A, location of the tRNA1^ or tRNAP 1,0' ”1 genes that were

cloned downstream of the tRNALys gene promoter within the multiple cloning

region of pWL204 to produce the vectors pWL221 and pWL222 (see text).

Panel B, secondary structures of S. cerevisiae pre-tRNA P r0 and H. volcanii

pre-tRNATrP-0167. Cleavage sites for tRNA intron endonuclease are

indicated by arrows.

201 202

fl. volcanii Saccharomvces cerevisiae tRNA^0 tRNALys Promoter El Intron E2

HindlllSphl Xbal I Rsal/Smal Rsal/Snlal Kpnl | Ec'oRl Pstl (BamHl) Sstl

B £. cerevisiae B. VQlc»nli pretRNAPro tRNATrp-0167

A C C A p O-C o -c o -c o -c C-0 0-0 • , C 0 A O-C C 0 C C C A A C C 0 0 ° I I I I I A I I I I O 0 O O G c oooco*. CD 0 0 c C-O °A 0-A O-C ^ A-0 A r o C - 0 A 0-A ® -o a

Figure 31. 203 substrate for tRNA intron endonuclease or RNase P (data not shown).

From the experiments described above, it was concluded that the exon-intron

boundary structures of yeast pre-tRNAPro are not recognized by the H. volcanii tRNA

intron endonuclease. As in archaebacterial intron-containing tRNAs, the intron of pre-

tRNAPro is small (31 nucleotides) and the exon-intron boundary structures consists of two

bulge loops separated by four base pairs (see Figure 31). However, the bulge loops in

pre-tRNAPro are larger than the three-nucleotide loops typical of archaebacterial

substrates, consisting of five and four nucleotides in the 5' and 3' exon-intron boundary

loops, respectively. In addition, an unpaired A residue opposing the 5' exon-intron

boundary loop can possibly extend the helix between the two bulge loops to a length

equivalent to five base pairs. If sequence plays only a passsive role in substrate

recognition and cleavage by the H. volcanii tRNA intron endonuclease, then the deletion

of specific nucleotides within pre-tRNAP 10 to make the exon-intron boundary structure

mimic that of Haloferax pre-tRNATrP should produce a suitable substrate for the

endonuclease. To investigate whether this is the case, specific nucleotides were removed

from the intron-encoding region of the tRNAPro gene, isolated from pWL221, by

oligonucleotide-directed mutagenesis as described in the Materials and Methods. The deleted nucleotides and the proposed secondary structure of transcripts from the resulting

mutant tRNA 1510 gene, designated tRNAPro‘m, are presented in Figure 32. The tRNAPr°-m gene was cloned into the shuttle-expression vector pWL204 as an Xbal-EcoRI fragment, and H. volcanii was transformed with the resulting vector, pWL222. Panel A of Figure 31 also serves to illustrate the placement of the tRNA P r° - |T1 gene within the multiple cloning region of pWL204.

To analyze the fate of pre-tRNA Pr0 and pre-tRNAPn>m transcripts in vivo, a

Northern blot containing total RNA from the pWL221 and pWL222 H. volcanii transformants, respectively, was prepared and probed with four oligonucleotides: 204 TRNAPRO (specific for the tRNA1*10 3' exon sequence), PROINT (specific for the wild- type tRNA 1*0 intron sequence), PMUTINT (specific for the mutant tRNA 1* 0 intron sequence having the halophile structure), and PFLANK (specific for the 5' leader sequence). The sequences of these oligonucleotides are listed in the appendix. The blot was initially probed with TRNAPRO, then following autoradiography, the blot was stripped of TRNAPRO and probed with a mixture of the two intron-specific oligonucleotides. After autoradiography, the blot was stripped of these oligonucleotides and probed a final time with PFLANK. The Northern blot hybridization results are presented in Panel A of Figure 33. All probes hybridized to single pre-tRNA 1*0 and pre­ tRNA1* 0 -" 1 RNA species of approximately 148 and 144 nucleotides, respectively.

Hybridization of the same RNA with 3' exon-, intron-, and 5' leader-specific oligonucleotides indicates that these RNAs represent the primary transcripts from the tRNA1* 0 and tRNA 1* 0-" 1 genes. If any RNA processing had occurred, it must have involved removal of 3' terminal nucleotides by an exonuclease activity. However, since no longer precursor RNAs are present, and since the size of the primary transcripts place the 3' terminus within the stretch of nine T residues that constitute a transcription termination sequence, the hybridizing RNAs most likely represent the full primary transcripts. These experiments demonstrated that neither wild-type yeast pre-tRNA 1*0 nor a mutant pre-tRNA 1* 0 with exon-intron boundary structures mimicking that of archaebacterial intron-containing tRNAs, are substrates for the H. volcanii tRNA intron endonuclease in vivo. For some unprecedented reason, the primary transcripts also are not substrates for H. volcanii RNase P.

It was also determined whether pre-tRNA 1* 0 and pre-tRNA 1*0 *"1 are substrates for the S. cerevisiae and the H. volcanii tRNA intron endonucleases in vitro. As described in the Materials and Methods, the two tRNA 1*-0 genes were also reconstructed using the polymerase chain reaction (PCR) and oligonucleotide primers to place these genes under Figure 32. Secondary structures of S. cerevisiae pre-tRNA 1*10 and pre-tRNAPro'm. In

Panel A, the circled nucleotides within the pre-tRNAPro structure were deleted

by oligonucleotide-directed mutagenesis to produce pre-tRNAPro'm. In Panel

B, the exon-intron boundary region structure of H. volcanii pre-tRNATrP is

shown for comparison. Arrows indicate potential cleavage sites for tRNA

intron endonuclease.

205 A pre-tRNAPro pre-tRNAPro-m C C A A C C A pG-C pG-C G-C G-C C-G G-C U U - U"U C A n 0 a „ „ 0-C O A C C 1 A n c TJ o I I I I 0 C 0 M F ? C t J G G g a u 0 U 0 n AU G A U U c-G ACGG C U-A C-G G-C ^ C-G u A U-A c U-A

3 7 ®-A ® ®-C G C-G / U-A U-A C-G C-G U-A G-C A A U A U A

B — O-c— 3' G-C U-A G-C A-U U C-G A U-A IS-G S-G

G-C G-C

Figure 32. Figure 33. Northern blot analysis of in vivo and in vitro tRNA 1* 0 and tRNA 1*1-0"111 gene

transcripts. Panel A, Northern blot autoradiograms showing the fate of

tRNA1* 0 and tRNA 1* 0-111 gene transcripts in H. volcanii. Size markers (given

in nucleotides) to the left of the autoradiograms indicate uniformly-labeled

RNAs of known sizes that were separated and transferred to the blot alongside

the cellular RNAs. Lane designations: Pro, total RNA (25 |ig), including pre­

tRNA1*0, isolated from pWL221-transformed H. volcanii WFD11; Prom, total

RNA (25 |Xg), including pre-tRNAPro'm, isolated from pWL222-transformed

H. volcanii WFD11. Sizes of the indicated hybridizing RNAs are: prePro

(pre-tRNAPro), 148 nucleotides; prePro 01 (pre-tRNAP10*01), 144 nucleotides.

Probes used for each of the three autoradiograms are indicated below the

autoradiogram. These oligonucleotide probes were: TRNAPRO for exon 2,

PROINT and PMUTINT for intron, and PFLANK for 5' leader. Panel B,

Northern blot autoradiogram showing in vitro cleavage assays of S. cerevisiae

(yeast extract) and H. volcanii (H. volcanii extract) tRNA intron endonucleases

using unlabeled pre-tRNA 1* 0 and pre-tRNAPro'm as substrates. Reaction

conditions are described in the text. Size markers to the left of the

autoradiogram indicate uniformly-labeled RNAs (for sizes 77 to 181) or 5'

end-labeled oligonucleotides (for sizes 27 to 54) that were separated and

transferred to the blot alongside the in vitro processing products. Lane

designations: Pro, pre-tRNA 1*0 plus cell extract; Prom, pre-tRNA 1* 0-111 plus

cell extract; Ext., cell extract only.

207 208

Northern Analysis Northern Analysis (H- yalgflflii Expression) (In vitro Processing: Intron Probe)

Pro Prom Pro Prom Pro Pro™1 Pro Prom E xt Pro Prom Ext. 240 —

181 prePro prePro

104 — 99 —

38 — 37 — J Exon 2 Intron 5' Leader Yeast Extract H.volcanll Extract

Figure 33. 209 the transcriptional control of a T7 RNA polymerase promoter. Transcripts generated from

the PCR gene products begin with the first nucleotide of the 5' exon and terminate at their

3' ends with a six nucleotide trailing sequence. In separate reactions, 2 fig of each

unlabeled substrate were assayed with cell extracts from either S. cerevisiae or H.

volcanii. The reaction conditions were as described in the Materials and Methdds. The

reaction products were separated by electrophoresis through a 6 % denaturing

polyacrylamide gel, then transferred to a Zeta Probe (Bio-Rad, Richmond, CA) nylon

membrane. The Northern blot was probed with the wild-type and mutant intron-specific

5’ end-labeled oligonucleotides PROINT and PMUTINT. Northern blot analysis of a

relatively large quantity of unlabeled substrate was the method chosen, rather than the

typical use of radioactively-labeled substrate, because it was expected to be a more

sensitive assay that would allow the specific detection of reaction products present in very

small amounts. Panel B of Figure 33 shows the results from this experiment. The 31-

nucleotide intron of wild-type pre-tRNA 1510 transcripts was excised by the S. cerevisiae.

but not the H. volcanii. tRNA intron endonuclease. Mutant pre-tRNAPro"m transcripts

were not a substrate for the endonuclease from either organism. The H. volcanii extract

appears to non-specifically cleave the two substrates at the same locations, with the pre-

tRNAPro_m transcripts being smaller than the corresponding pre-tRNA 1510 fragments by

approximately four nucleotides, the size of the intron-deletion introduced into the tRNA 151-0 gene to produce the tRNAPro_m gene.

The inability of pre-tRNAPro'm to function as a substrate for the S. cerevisiae tRNA intron endonuclease was unexpected, however, some intron mutations do affect cleavage by this enzyme (Strobel and Abelson, 1986a; 1986b). The inability of these RNAs to function as substrates for the H. volcanii tRNA intron endonuclease is consistent with a requirement for both structure and sequence elements at the exon-intron boundaries. DISCUSSION

Ribonuclease P

The differences in the structure and catalytic capabilities of RNase P RNAs from the

eubacteria and eukaryotes brought to question the nature of archaebacterial RNase P

enzymes. The archaebacteria contain a mosaic of molecular characteristics, some

eubacterial-like, and others eukaryotic-like. An increased understanding of the

fundamental properties of RNase P was expected to be gained by studying the RNase P

from an archaebacterium. This study was concerned with determining the structure and

catalytic capabilities of an archaebacterial RNase P RNA. The RNase P activities from

two organisms, Haloferax volcanii and Thermoplasma acidophilum. were initially

examined. H- volcanii was one of the archaebacteria chosen because a preliminary study

of its RNase P activity (Lawrence et al., 1987) provided evidence for a required RNA component. The "sulfur-dependent" thermophile T. acidophilum was investigated in parallel in case the identification of the halophilic RNase P RNA proved especially difficult. Studies on the X acidophilum RNase P were terminated when the RNase P

RNA gene was isolated from H- volcanii.

Properties of RNase P from H. volcanii and T. acidophilum:

An assay for RNase P activity was developed so that the enzymes from H. volcanii and X- acidophilum could be studied in vitro. RNase P activity assays require pre-tRNAs containing 5' leader sequences as substrate. An H- volcanii tRNAVal gene was cloned

210 211 into the expression vector pT72 under the transcriptional control of a T7 RNA polymerase

promoter (Figure 11). Uniformly-labeled pre-tRNAVal transcripts prepared from this

clone in vitro with '17 RNA polymerase have 71 and 46 nucleotides of 5' and 3' flanking

sequences, respectively. The RNase P assay was based on the ability of RNase P to

remove the 71-nucleotide 5' leader sequence from these transcripts (Figure 12). The

initial RNase P assay conditions (40 mM Tris-Cl, pH 7.5,50 mM MgCl2, 50 mM KC1,

10% glycerol, 37°C) were based on the optimal conditions determined for the RNase P

activity from H. volcanii by Lawrence et al. (1987). Under these conditions, S100

supernatant fractions of H. volcanii and T. acidophilum crude extracts efficiently cleaved

pre-tRNAVal to produce the expected tRNA plus 3' trailing sequence, and 5' leader

sequence products.

The effect of monovalent ions on RNase P activity was further analyzed in view of

the report by Lawrence et al. (1987) that H. volcanii RNase P is strongly inhibited by

monovalent cations at concentrations above 200 mM, even though the cation concentration

in H. volcanii is above 2 M (Christian and Waltho, 1962). In contrast to this report, H.

volcanii RNase P was observed to remain highly active over a broad range of monovalent

ion concentrations (12.5 mM to 3.0 M of either KC1, KOAc, NH4CI, or NH4OAC; see

Figure 13). This discrepency might be due to differences in our enzyme preparation procedures or substrates. Lawrence et al. (1987) used RNase P partially purified through

DEAE-Sephadex A50 in a low salt buffer and E. coli pre-tRNATyr as substrate, while an

RNase P preparation partially purified by gel filtration through Sepharose 4B in a high salt buffer and H. volcanii pre-tRNAVal were used in this study. However, when low salt crude cell extracts were fractionated on a DEAE column, the RNase P-containing fractions retained high activity when assayed in high salt (data not shown). Therefore, it is possible that the inhibitory effect of monovalent ions observed by Lawrence et al. (1987) reflects the instability of the E. cob tRNA and not an inhibition of the enzyme. The effect of 212 monovalent ions on the RNase P activity from T. acidophilum. a non-halophile, was also

investigated. The partially purified RNase P was assayed with increasing concentrations

of NH4CI (12.5 mM to 3.0 M). As shown in Figure 13, the T. acidophilum RNase P

activity was completely inhibited at NH4CI concentrations greater than 200 mM. The

temperature optima of the H. volcanii and T. acidophilum RNase P activities were found

to parallel their optimal growth temperatures. The H. volcanii enzyme showed optimal

activity between 37 and 45 °C, while the T. acidophilum enzyme was most active at 56 to

65°C.

The presence of a 3' terminal CCA sequence in pre-tRNAs is required for efficient

cleavage by the RNA component (Ml RNA) of E. £oli RNase P (McClain et al., 1987).

Although cleavage by the E. coli holoenzyme is not affected by the presence or absence of

a 3' CCA terminus, point mutations in the CCA sequence can completely abolish cleavage

(McClain et al., 1987). The assay for H. volcanii RNase P activity was based on the

ability to cleave pre-tRNAVal. This substrate has a 46-nucleotide 3' trailing sequence and

the nucleotides CTC at the position where CCA is located in mature tRNAVal (see Figure

11). To determine whether pre-tRNAs with a mature 3' CCA terminus would be more

efficiently cleaved by H. volcanii RNase P, the enzyme was assayed with B. subtilis pre-

tRNAAsP. The two substrates were apparently cleaved with equal efficiencies, indicating

that the H. volcanii RNase P activity is not influenced by the presence or absence of the 3'

terminal CCA sequence in pre-tRNA substrates. It is known that cleavage by the RNase P

enzymes from the eukaryotes Schizosaccharomvces pombe and Xenopus laevis are also

not affected by the sequence at the 3' terminus of pre-tRNAs (Krupp et al., 1991; Carrara

et al., 1989). These different substrate recognition properties probably reflect the nature

of the respective in vivo tRNA gene transcripts. While all tRNA genes in E. coli encode

the 3' CCA sequence, this sequence is not found in primary transcripts of tRNA genes in eukaryotes nor in the majority of transcripts from archaebacterial tRNA genes (Sprinzl et 213 al., 1989). Another substrate recognition property that appears to be restricted to the E.

coli holoenzyme, and that of closely related eubacteria, is the ability to generate the mature

5' terminus of E. coli 4.5S RNA, a stable RNA with an essential role in translation.

Neither the H. volcanii (this study) or B. subtilis (Guerrier-Takada et al., 1983; Baer et

al., 1989) enzymes cleave pre-4.5S transcripts.

The RNA component of H. volcanii RNase P:

The gene that encodes the RNA component of H. volcanii RNase P was isolated

using cDNAs prepared against RNAs that copurified with this enzyme activity.

Identification of this RNA as a component of the RNase P complex stems from three

observations. Previous studies on the physical properties and nuclease sensitivity of this

enzyme strongly suggested that this activity had a required RNA component (Lawrence et

al., 1987). Second, sequence data indicate that this RNA can assume a structure similar to

the core structure proposed for eubacterial RNase P RNAs, and it contains many of the

conserved sequence elements (Figure 20). And finally, in vitro transcripts from this gene,

when combined with the RNase P protein from B. subtilis. exhibit catalytic activity

(Discussed below).

A comparison of the structure and sequence features of the H. volcanii. eubacterial,

and eukaryotic RNase P RNAs indicates that the halophilic RNA is most similar to the

eubacterial RNase P RNA. Its overall structure closely resembles the eubacterial core

structure, and it contains 37 of the 52 conserved eubacterial RNase P nucleotides. Some

structural features and specific nucleotides of the RNase P RNA, which have been

ascribed to a particular function, have correlates in the halophilic RNA. For example, the protein components of the E. coli and B. subtilis RNase P RNAs are thought to interact

with sequences in the uppermost loop and the helical region that separates this loop from the central loop (see Figure 20). In E. coli. the C5 protein protects regions 82 to 96 and 214 170 to 270 (Vioque et al., 1988; Altman, 1989). A point mutation in one of these regions of M l RNA, G89 to A89, leads to a defect in protein association (Shiraishi and Shimura,

1986). A four base insertion into the analogous helical region separating the central and uppermost loops in the B. subtilis RNase P RNA also affects protein interaction (Pace et al., 1987). The H. volcanii RNA contains similar helical structures and related sequences in this region. Therefore, this region of the halophilic RNA may play a role in protein interaction.

The diversity of structures among the eukaryotic nuclear and organellar RNase P

RNAs makes comparisons between these and the other RNAs difficult. One common structural feature that may be shared between the halobacterial, eubacterial, and eukaryotic nuclear and mitochondrial RNase P RNAs is the formation of a pseudoknot between regions of the lower and central loops of the core structure (Pace et al., 1989; Forster and

Altman, 1990; Shu et al., 1991) (see Figure 20). Interestingly, these interactions bring together most of the universally conserved sequence elements that are present in distant regions of the molecule. Located in this region of the H. volcanii RNase P RNA are 12 of the 19 nucleotides conserved between this RNA and the eukaryotic nuclear RNase P

RNAs (Bartkiewicz et al., 1989). Sequence homology between the halobacterial and eukaryotic RNase P RNAs can be extended further if sequences conserved in the pseudoknot interaction are also included. Each eukaryotic RNase P RNA contains the conserved sequence element 5'-GNAANNUCNGNG-3', which pairs with the sequences of the 3' terminal loop (Forster and Altman, 1990; Doria et al., 1991) (see Figure 20).

Five of these nucleotides are conserved in the H. volcanii RNase P RNA. If all of these nucleotides are considered, then 13 nucleotides are conserved in the RNase P RNAs from all three kingdoms. This pseudoknot structure model is also consistent with earlier mutagenesis data for B. subtilis RNase P RNA, which indicated that active site formation involves interactions between distant portions of the molecule (Waugh, 1989). A second 215 pseudoknot interaction that is conserved among the eubacterial RNase P RNAs, involving

the sequence regions G82-C85 and G276-C279 of M l RNA (Figure 20), has recently

been identified (E. S. Haas and N. R. Pace, personal communication). The potential for

this interaction is also conserved in the H. volcanii RNase P RNA (see Figure 20). A

similar tertiary structure has not been identified within the eukaryotic RNase P RNAs.

The gene that encodes the RNase P RNA has many of the characteristics of

archaebacterial genes. In the 5' leader region of the gene are four sequences that are

similar to the consensus archaebacterial promoter sequences: box A, TTTA t/a ATA, and

box B, ATGC, the transcription start site (Gropp et al., 1989; Thomm and Wich, 1988;

Thomm et al., 1989). Primer extension and SI mapping studies suggest that the transcript

from this gene begins at one of the two G residues present in the promoter element closest

to the coding region (Figures 18 and 19). Neither analysis indicated starts in the other box

B regions. Although the 3' terminus of this RNA was not mapped, Northern data (Figure

19) and localization of the 5' terminus indicate that the 435-nucleotide transcript ends in a

short stretch of U residues, similar to other archaebacterial transcripts. No transcripts

other than the mature 435-nucleotide species were identified in Northern analyses (Figures

19 and 22). It is possible that the other box A elements function as RNA polymerase

binding sites, priming the gene for transcription. Multiple promoters have been noted for

the genes of other stable RNAs in the archaebacteria (Dennis, 1985; Kjems and Garrett,

1987). Alternatively, transcripts may originate from these multiple sites followed by rapid

RNA processing. Related to this, there is the potential for the formation of a stem-loop

structure immediately ahead of the start of the RNA (nucleotides 260-266 pairing with

276-282; see Figure 18). Formation of this stem-loop would place the proposed 5' terminus of the RNA at the base of the stem, possibly acting as a processing queue.

However, the inability of H. volcanii cell extracts to cleave in vitro-transcribed H. volcanii 216 RNase P RNA with large 5' and 3' flanking sequences argues against an RNA processing

mechanism that is responsible for generating the mature 5* terminus.

An RNA associated with the RNase P activity from Thermoplasma acidophilum was

also identified. An RNA of 320-350 nucleotides consistently copurified with the enzyme

through gel-filtration and anion exchange columns. In a Northern analysis, cDNAs

prepared from the copurifying RNAs hybridized to two RNAs of approximately 320 and

340 nucleotides. An oligonucleotide (RPRNA2) complimentary to a consensus RNase P

RNA sequence also hybridized to these two RNAs (see Figure 16). The gene that

encodes the 320-nucleotide RNA was isolated from a T. acidophilum cosmid bank. In a

Northern analysis, this gene also hybridized to an H. volcanii RNA of the same size

(possibly the 7S RNA), but not to the H. volcanii 435-nucleotide RNase P RNA or the T.

acidophilum 340-nucleotide RNA (data not shown). Therefore, it is likely that the

identified 340-nucleotide species represents the T. acidophilum RNase P RNA; this RNA

was not further characterized. Although this RNA is significandy smaller than the H.

volcanii RNase P RNA, it is similar in size to the recently identified 313-nucleotide RNase

P RNA from Sulfolobus solfataricus: also a sulfur-dependent thermophilic

archaebacterium (T. LaGrandeur, S. Darr, and N. Pace, personal communication).

Catalytic capabilities of the H. volcanii RNase P RNA:

A fundamental difference between the eubacterial and eukaryotic RNase P RNAs is the ability of the eubacterial RNA to catalyze the cleavage of pre-tRNAs in the absence of protein (Guerrier-Takada et al., 1983; Gardiner et al., 1985). To examine whether the H. volcanii RNase P RNA could function as a catalytic RNA, the gene region was subcloned into a T7 RNA polymerase expression vector. Transcripts prepared from this gene in vitro had 20 and 9 nucleotides of 5' and 3' flanking sequences, respectively. This RNA was assayed with the H. volcanii pre-tRNAVal substrate (lacks 3' CCA terminus) and the 217 B. subtilis pre-tRNAAsP substrate (contains 3' CCA terminus) under a variety of solution

conditions, including those optimal for catalysis by the E. coli and B. subtilis RNase P

RNAs. Like eukaryotic RNase P RNAs, the halophilic RNA lacked activity under all

conditions tested. Catalytic activity was observed, however, when the RNA was

combined with the protein subunit of the B. subtilis RNase P complex under incubation

conditions optimized for the B. subtilis RNA plus its protein (see Figure 22). Since the

B. subtilis RNase P protein alone is known not to exhibit catalytic activity or to be

essential for the activity of the B. subtilis RNase P RNA (Gardiner et al., 1985), this

observation argues against the possibility that the halophilic RNase P protein plays a more

active role in catalysis.

The inability of the in vitro-transcribed RNA to function catalytically in the absence

of protein might be due to a structural defect in the RNA induced by the 5' and 3' flanking

sequences, a possible requirement for modified bases, or improper folding in the low salt

transcription buffer. These problems could be eliminated if the RNase P RNA were

overexpressed in vivo then fractionated away from the holoenzyme complex by gel-

filtration chromatography under physiological ionic strength conditions. To investigate this possibility, the RNase P RNA gene was subcloned into the H. volcanii-E. coli shuttle vector pWL201 (see Figure 24) and H. volcanii WFD11 was transformed with the resulting construct (pWL230). A Northern analysis verified that the RNase P RNA was expressed from the plasmid and indicated that the copy number of RNase P RNA in the pWL230 transformant was about 10-fold higher than in non-transformed H. volcanii

WFD11 (Figure 22). A comparison of the RNase P activities present in crude cell extracts of the pWL230 transformant and WFD11 indicated that the increased expression of RNase

P RNA did not affect RNase P activity (Figure 22). This suggests that the RNase P protein is not overexpressed in response to an increase in the concentration of the RNA subunit, and that the RNA is not catalytically active in the absence of the protein subunit in 218 vivo. In an SDS-PAGE analysis, the overexpressed RNA had no detectable influence on the expression of any proteins. Unfortunately, when a crude cell extract of the pWL230 transformant was fractionated over a Sephacryl S-400 gel-filtration column, the "naked"

RNA copurified with the holoenzyme complex and could not be isolated in its native state by this method (Figure 23). The possibility remains that in vitro conditions can be found where the wild-type RNA is catalytically active in the absence of protein. This was further investigated by separating total cellular RNA from the pWL230 transformant on a denaturing polyacrylamide gel. The mature wild-type RNase P RNA was isolated from the gel and assayed for catalytic activity in vitro under a wide range of solution conditions.

Catalytic activity was not observed under any of the conditions tested (data not shown).

In view of the similarities between the eubacterial and H. volcanii RNase P RNAs, the inability of the H. volcanii RNA to act catalytically in the absence of protein is puzzling. In the eubacterial system, the protein component appears to act as a cofactor that shields the ionic repulsion forces between the substrate and catalytic RNAs (Guerrier-

Takada et al., 1986; Gardiner et al., 1985). Its presence affects the V m ax of the reaction, but not the binding of substrate. It is unlikely that the protein component of the halophilic

RNase P plays this role since the internal monovalent cation concentration in these cells is greater than 2 M (Christian and Waltho, 1962). Ionic repulsion should be low under these conditions. It is possible that the halophilic protein functions to induce or stabilize a catalytically competent conformation of the RNA, and the lack of activity in the absence of the protein reflects the inability of the RNA to assume this conformation. In the reconstitution assay (Figure 21), the interaction with the B. subtilis protein may partially overcome this barrier. In addition to functioning as a charge shield, the eubacterial RNase

P protein may also play some role in stabilizing the active conformation of the RNA. In the case of the E. coli RNase P RNA, many mutations that decrease or block activity in

RNase P RNA-only reactions are not apparent when both RNA and protein are present 219 (Lumelsky and Altman, 1988). In these cases, the protein must overcome or correct some structural defect in the RNA.

The protein component of RNase P from eubacterial sources accounts for only about

10% of the holoenzyme's molecular weight. For example, the E. coli holoenzyme consists of a 124,000 dalton RNA and a 13,800 dalton protein (Altman, 1989). There is evidence that the relative sizes of the H. volcanii RNase P subunits is similar. The enzyme eluted from a gel-filtration column with an apparent molecular weight of 168,000 daltons. Since the 435-nucleotide RNA subunit has a molecular weight of 143,600 daltons, the size of the protein subunit can be estimated at 24,000 daltons. This is only a rough estimate since the use of protein molecular size standards may overestimate the actual size of globular RNA molecules (Darr et al., 1990). However, a 21,000 dalton protein consistently copurified with the RNase P activity through several fractionation procedures. The size of the protein can also be estimated from the density of the holoenzyme. Lawrence et al. (1987) have determined that the enzyme has a density of

1.61 g/ml in CS2SO4. Using values for the partial specific volumes (v) of RNA and protein in CS2SO4 solution of 0.608 and 0.797 ml/g, respectively (Hamilton, 1971), a ribonucleoprotein of this density would consist of approximately 93% RNA and 7% protein. This would place the molecular size of the holoenzyme at 154,400 daltons and of the protein at 10,800 daltons. The accuracy of this later value depends on the reliability of the reported density of the complex. An association of the enzyme with other RNAs might increase its apparent density, while an association with other proteins or lipids would decrease its apparent density. Nonetheless, there is no evidence for the protein subunit being larger than 24,000 daltons. In contrast to H. volcanii RNase P, the size of the holoenzyme from the archaebacterium Sulfolobus solfataricus was determined by gel- filtration chromotography to be about 400,000 daltons (Darr et al., 1990). This is similar in size to yeast RNase P (Krupp et al., 1986). The density of the S. solfataricus RNase P 220 (1.27 g/ml; Darr et al., 1990) is also eukaryotic-like; eukaryotic nuclear and mitochondrial

RNase P have a reported density of 1.28 g/ml (Lawrence et al., 1987; Morales et al.,

1989; Wang et al., 1988), while eubacterial RNase P has a density of 1.55 g/ml

(Lawrence et al., 1987). The low densities of the S. solfataricus and eukaryotic RNase P

enzymes indicates that they have a much higher protein:RNA ratio than the eubacterial and

H. volcanii complexes and suggests that the archaebacteria as a group may contain both

eukaryotic-like and eubacterial-like RNase P complexes.

tRNA Intron Endonuclease

One of the main objectives of this study was to determine whether the substrate

recognition properties of the H. volcanii tRNA intron endonuclease that were observed in

vitro hold true in vivo. The presence of additional protein components, tRNA base

modifications, and a high ionic strength environment may have a significant effect on

substrate recognition properties in vivo. In addition, the RNA ligase activity responsible for joining the exons following removal of the intron, which has not been detected in vitro, may also be assayed. At the time this study was initiated, a means of expressing cloned genes in the archaebacteria was not available. Therefore, a significant step in this project was the construction and characterization of a vector that would permit the expression of mutant tRNA genes in H. volcanii.

Construction of an H. voIcanii-E. coli shuttle-expression vector:

Comparative sequence analysis, transcript mapping, and RNA polymerase footprinting (Brown et al., 1989; Brown et al., 1988; Frey et al., 1990; Thomm et al.,

1988; Thomm and Wich, 1988; Thomm et al., 1989) have led to a proposal that all archaebacterial promoters are related and composed of two short sequence elements: box 221 A (TTTAa/tATA) at position -25, and box B (ATGC), which contains or defines the

transcription start site. Functional support for this proposal has come from the

observations that purified RNA polymerase from Methanococcus vannielii (Frey et al.,

1990), Methanobacterium thermoautotrophicum (Knaub and Klein, 1990), and

Sulfolobus sp. B12 (Hudepohl et al., 1990; Reiter et al., 1990) direct transcription in vitro

from DNA fragments carrying these sequences and that partial removal of the box A

sequence strongly reduces transcription (Knaub and Klein, 1990; Reiter et al., 1990). In

this study, an H. volcanii tRNALys gene promoter fragment, which contains sequences

related to the proposed box A and box B sequences, was introduced into a derivative of

the H. volcanii-E. coli shuttle vector pWL102 (see Figure 24). As a reporter gene for

transcription activity, a modified H. mediterranei tRNATrP gene (tRNATrP-0167) was

introduced downstream from the promoter element to yield the vector pWL202.

Dependence of transcription on the tRNALys gene promoter was demonstrated by

Northern analysis and by the absence of transcription when the promoter fragment was deleted from the vector (see Figure 26). In addition, primer extension analysis mapped

the site of transcription initiation to residue G-127 within the box B sequence of the tRNALys promoter fragment (see Figure 27). These data provided the first support for the proposal that the box A and B sequences are required for transcription by the halophiles in vivo.

As well as the primary box A and B sequences, the tRNALys promoter fragment contains a second, upstream, box A and B-like sequence located at positions 29-60 in the tRNALys element (Figure 25). While primer extension analysis provided no evidence of transcription from this region (data not shown), this sequence may serve as an additional

RNA polymerase binding site in the promoter region. As discussed above for the H. volcanii RNase P RNA gene, multiple promoters may serve as RNA polymerase queues, priming the gene for transcription (Travers, 1987). The tRNALys promoter fragment also 222 contains two purine-rich sequence regions which precede the primary box A and B sequences. Conservation of these sequences in the promoter regions of other halophilic stable RNA promoters (Daniels et al., 1986; Datta et al., 1989; Dennis, 1987; Larsen et al., 1989; Moritz and Goebel, 1985) suggests a role for these sequences in transcription.

These sequences may function in growth-rate dependent expression, similar to the eubacterial discriminator sequences (Travers, 1980), affect the structure or bendability of the promoter region (Travers, 1987), or act as sites for the binding of specific transcription factors. Related to this later possibility, accurate in vitro transcription of tRNA genes and rRNA genes by the Methanococcus vannielii and Sulfolobus sp. B 12

RNA polymerases, respectively, have been shown to require the presence of transcription factors (Frey et al., 1990; Hudepohl et al., 1990).

The utility of this vector for studying the fate of transcripts from cloned tRNA genes was confirmed by the observation that in vivo transcripts from the tRNATrP-0167 gene entered into the cellular pool of pre-tRNAs for maturation. The 98-nucleotide species detected in the Northern analysis and the major product of primer extension (see Figures

26 and 27) correspond to the 5' end-matured pre-tRNA, indicating that RNase P can act on this intron-containing substrate in vivo. It was not possible to determine whether tRNATrP-0167 RNA was a substrate for in vivo intron-processing enzymes. Ligated exons from the plasmid encoded tRNATlP-0167 gene could not be distinguished from those originating from the chromosomal tRNATrP gene since both genes have identical exon sequences.

The shuttle-expression vector DNAs used in the initial H. volcanii plasmid transformation experiments were propagated in E. coli DH5oc-F. In these experiments, only about 5% or less of the recovered mevinolin-resistant colonies contained plasmid

DNA. No evidence was obtained for integration of the plasmids into the chromosome.

Since the frequency of transformation was about 100-fold higher than the spontaneous 223 reversion frequency, the mevinolin-resistant transformants which lacked plasmid DNA most likely resulted from cleavage of the plasmid by a restriction endonuclease, followed by recombination between the mevinolin-resistance gene of the plasmid and the wild-type copy of this gene in the chromosome. Holmes et al. (1991) have recently demonstrated that H. volcanii possesses a restriction system similar to an E. coli restriction system which degrades DNA that is methylated at adenine residues (Heitman and Model, 1987).

Therefore, plasmid DNA propagated in E. coli dam* strains (dam+ strains methylate adenine residues), such as DH5

In this study, the propagation of pWL202 in the dam strain JM110 (does not methylate adenine residues) virtually eliminated the restriction problem. A 50-fold increase in the transformation frequency was observed when the pWL202 DNA used in the transformations was isolated from E. coli JM110 rather than E. coh DH5a-F' (Table 2).

In addition, colony hybridization experiments revealed that when JM110-propagated pWL202 DNA was used, > 90% of the mevinolin-resistant transformants stably maintained the vector (Table 2). When DH5oc-F-propagated pWL202 DNA was used,

< 5% of the mevinolin-resistant transformants contained the vector. Interestingly, when pWL202 DNA isolated from one of these later H. volcanii transformants was passed through DH5a-F' before being used to re-transform H. volcanii. there was a 10-fold increase in the number of mevinolin-resistant transformants that contained plasmid DNA

(Table 2). This might suggest that some adenine methylation sites, or other restriction sites, are eliminated by processes in H. volcanii. and provides an explanation for why some DH5a-F'-propagated plasmids escape degradation in H. volcanii.

The copy number in H. volcanii of the various shuttle vector and shuttle-expression vectors used throughout this study was determined by Southern analysis using an oligonucleotide probe (HMGCoA) that is complimentary to the HMGCoA reductase encoding gene (see Table 3). Since this gene is present as a single copy in each plasmid 224 and in the chromosome, the number of plasmids per chromosome was equivalent to the

ratio between the plasmid and chromosome hybridization signals. Vectors without the

tRNALys gene promoter fragment, including pWL230 which contains the H. volcanii

RNase P RNA gene with its own promoter, were present in H. volcanii at 7 to 9 copies

per chromosome. This is similar to the estimated copy number of pHV2 (about 6.4

plasmids per chromosome; Charlebois et al., 1987), the H. volcanii replicon upon which

all of these vectors are based. However, with the exception of pWL212, vectors with the

tRNALys promoter region were present at 19 to 22 copies per chromosome. The

increased copy number may be due to the increased transcription activity on the plasmids,

perhaps by increasing the availability of RNA polymerase to a promoter for a plasmid-

encoded replication initiation protein. Alternatively, run-through transcription from the

tRNALys promoter might decrease transcription from a gene that encodes for a replication

inhibitor. However, the presence of a consensus H. volcanii tRNA gene terminator

(described below) downstream of cloned tRNA genes appeared to have no affect on copy

number.

In vivo analysis of tRNA intron endonuclease activity on mutant pre-tRNAlffi substrates:

An important difference between eukaryotic nuclear and archaebacterial intron- containing pre-tRNAs is intron location. In nuclear pre-tRNAs, all introns are located one

nucleotide 3' to the anticodon, and the distance between the top of the anticodon stem and the 5' and 3' splice sites is always 11 and 6 nucleotides, respectively. The conserved location of nuclear pre-tRNA introns is the basis for the substrate recognition mechanism of the nuclear intron endonuclease. The endonuclease interacts with conserved bases and structural features of the mature tRNA domain, then uses a measuring mechanism to identify the cleavage sites (Reyes and Abelson, 1988; Mattoccia et al., 1988). While many archaebacterial introns are located at the same location, including the intron of 225 Haloferax pre-tRNATrP, others have been identified within the variable loop (Kjems et al.,

1989b), anticodon stem (Wich et al., 1987), and anticodon (Wich et al., 1987). The variable intron locations within archaebacterial tRNAs indicates that splicing involves a unique substrate recognition mechanism. The mechanism of tRNA intron processing in

H. volcanii has been analyzed in vitro (Thompson and Daniels, 1988; 1990; Thompson et al., 1989). A partially purified tRNA intron endonuclease from this archaebacterium was shown to precisely excise a 104-nucleotide intron from Haloferax pre-tRNATlP, but was incapable of processing yeast pre-tRNAPhe. It was also determined that the intron endonuclease does not require a mature tRNA-like structure in the pre-tRNA or the complete intron, indicating that the required recognition element is composed of only those sequences and structures at the exon-intron boundaries (Thompson and Daniels, 1988). A comparative analysis of the known archaebacterial intron-containing tRNAs suggested that conserved exon-intron boundary structures, in which the cleavage sites are located in two three-nucleotide bulge loops separated by four base pairs, could serve as a recognition element for the archaebacterial endonuclease (Thompson et al., 1989).

The unique substrate recognition properties of H. volcanii tRNA intron endonuclease were further investigated in vitro using modified substrates generated by reconstruction and mutagenesis of the H. mediterranei tRNATrP gene (Thompson and

Daniels, 1990). These experiments demonstrated that the halophilic tRNA intron endonuclease identifies its cleavage sites by a mechanism which senses the distance between the two cleavage site bulge loops, rather than the distance from the top of the anticodon stem to the cleavage sites. A requirement for only the exon-intron boundary regions for substrate recognition and cleavage was verified by the ability of the endonuclease to excise a shortened intron from the a 35-nucleotide model minimal substrate which contained only these structures. 226 In this study, transcripts from shuttle-expression vector constructs containing the

wild-type (016) and three mutant (016-AGGAG, 0167, and 0167o+r) tRNATrP genes,

each previously investigated in vitro, were analyzed as substrates for the intron

endonuclease in vivo. To allow the plasmid-encoded tRNATlP transcripts to be

distinguished from those encoded by the chromosomal tRNAT,P gene, each gene was

reconstructed to contain altered acceptor stem sequences (see Figure 28). The altered

acceptor stem sequences were shown to have no affect on substrate recognition and

cleavage by the intron endonuclease in vitro (Figure 29).

The fate of transcripts expressed from the modified tRNATrP genes in vivo was

determined by Northern analyses using oligonucleotide probes specific for the 5' and 3'

exon sequences, the intron sequences, and the 5' leader sequence. Transcripts from the

016m gene served as a positive control for the three mutant tRNATrP genes. The wild-

type 104-nucleotide intron was efficiently cleaved from the 016m pre-tRNATrP

transcripts, and the exon sequences were ligated to produce the mature 77-nucleotide tRNA (Figure 30). An abundance of an RNA corresponding in size to the excised intron was detected with the intron-specific probe TRPINT, consistent with its removal. Three other major products were identified: a 5' exon plus 5' leader sequence species, a 5' end matured tRNA species with an 18-nucleotide 3' trailing sequence, and a 64-nucleotide 3* exon-containing species that presumably contains a 25-nucleotide 3' trailing sequence.

The identification of a major product with an 18-nucleotide 3' trailing sequence places the predominant site of transcription termination at the triplet of T residues within the consensus Haloferax tRNA gene terminator sequence (5'-TTCCTCATCTTT-3'). Similar pyrimidine-rich sequences have been determined to be the sites of transcription termination downstream of the rRNA operons of Desulfurococcus mobilis. Thermoproteus tenax, and

Methanobacterium thermoautotrophicum (Kjems and Garrett, 1987; Kjems et al., 1987;

Ostergaard et al., 1987). If imprecise cleavage occurred at the 3' exon-intron boundary, 227 the 64-nucleotide species could represent the 3' exon plus up to 25 nucleotides of the 3' end of the intron. Whether intron and/or 3' flanking sequences were present in the 64- nucleotide product could not be determined in this experiment since the intron-specific probe (TRPINT) is not complimentary to this region of the intron, and a trailing sequence- specific probe was not included in the study.

The 016-AGGAG mutant pre-tRNATlP RNA was analyzed in vitro by Thompson and Daniels (1990) to determine whether a defined structure was required at the exon- intron boundary regions. This substrate lacks the four nucleotides of the intron which are involved in the base-pairing between the two bulge loops. The deletion of these four nucleotides did not alter the sequences at the cleavage sites, but placed them in an assymetric internal loop (see Figure 28). If only sequences at the cleavage sites, or sequence or structures above and below the cleavage sites, were required for substrate recognition and cleavage, this mutant pre-tRNATrP should be a suitable substrate for the intron endonuclease. However, 016-AGGAGm was not a substrate for the intron endonuclease in vitro (Thompson and Daniels, 1990; see Figure 29) or in vivo (see Figure

30), indicating a structural requirement at the exon-intron boundaries. Computer modeling of the conserved exon-intron boundary regions of 016 predicts that the two cleavage site loops are on the same face of the helical molecule (B. Cedergren and C.

Daniels, personal communication). In 016-AGGAG, the potential for base-pairing, and thus the extended helix, between the two cleavage sites is eliminated. It is likely that the cleavage sites of this RNA are not in the proper alignment for interaction with the active site of the intron endonuclease.

To determine whether the highly structured intron of pre-tRNATrP was a recognition element for the endonuclease, or if it influenced the required exon-intron boundary structures, Thompson and Daniels constructed an intron-deletion derivative of 016. This substrate, 0167, retains only 22 nucleotides of the 104-nucleotide wild-type intron (see Figure 28). 0167 was accurately cleaved by the intron endonuclease in vitro, but the efficiency of cleavage was lower than with 016 (Thompson and Daniels, 1990; see Figure

29). This is consistent with the observed Km values for 0167 and 016 of 85-115 and 25-

40 nM, respectively (Thompson and Daniels, 1990). Similar results were observed in vivo. In vivo 0167m transcripts were cleaved by the intron endonuclease, but compared to 016m, fewer of the precursors were processed to the mature tRNATrP (see Figure 30).

It is possible that the lack of a structured intron in 0167 increases the Km by decreasing the binding energy; this leads to a relative decrease in processing efficiency. With the exception of products corresponding to the excised intron and the free 5' exon plus 5' leader sequence, the same cleavage and ligation products detected with 016m were detected with 0167m. The absence of the free 5' exon product from 0167m might indicate that, in comparison with the 5' exon of 016m, it is more loosely associated with the endonuclease following cleavage at the 5' splice site. If the free exon were released from the enzyme before it was acted upon by the RNA ligase, it would be susceptible to degradation by general ribonucleases. Perhaps the lack of the large structured intron decreases the stability of the enzyme-substrate complex. The inability to detect the excised

22-nucleotide intron is not surprising. Unlike the wild-type intron, the 0167m intron cannot assume any significant secondary structure and is most likely rapidly degraded.

Thus, the detection of the mature 77-nucleotide tRNA among the products of 0167m processing in vivo demonstrated that the wild-type intron is not required for RNA ligase activity.

The mutant tRNATlP substrate 0167o+r has a U-A base-pair in place of a C-G base- pair between the two three-nucleotide bulge loops of 0167 (see Figure 28). This substrate was selected for study in vivo because the efficiency of its cleavage in vitro was less than

10% of that observed with 0167, indicating that the wild-type nucleotides might serve as sequence-specific recognition elements for the intron endonuclease (Thompson, 1990; see 229 Figure 29). However, the 0167o+rm substrate was processed as efficiently as 0167 in vivo. The detected cleavage products were identical to those observed with 0167, except a 5' end-matured tRNA plus 3' flanking sequence product was absent. One interpretation of the discrepancy between the in vitro and in vivo results is that the C-G to U-A base-pair change destabilizes the exon-intron boundary structures under the low salt in vitro reaction conditions, but not under the high ionic strength conditions in vivo. However, Thompson

(1990) observed that a substrate in which the U-A base pair was replaced with a G-C base pair was also inefficiently cleaved in vitro. Since the G-C base pair should have restored the substrate to its original stability, structure alone was not responsible for poor substrate recognition and cleavage. Perhaps a more likely explanation is that sequence-specific interactions at this location are more relaxed under high ionic strength conditions or in the presence of the RNA ligase. Nontheless, the in vivo studies confirmed that the tRNA intron endonuclease requires a defined structure at the exon-intron boundaries and does not require the large structured wild-type intron for substrate recognition and cleavage.

Analysis of veast pre-tRNA&u as a substrate for H. volcanii tRNA intron endonuclease:

The requirement by the H. volcanii tRNA intron endonuclease for a defined structure at the exon-intron boundaries was further analyzed by testing the ability of the enzyme to process S. cerevisiae pre-tRNAPr0 substrates in vivo and in vitro. S. cerevisiae pre-tRNA15™ was chosen because it has an exon-intron boundary structure resembling the conserved structure of archaebacterial intron-containing pre-tRNAs (see Figure 31).

However, neither in vitro or in vivo transcripts from the wild-type tRNA 151"0 gene were recognized as substrates by the H. volcanii intron endonuclease (Figure 33). The 31- nucleotide intron of in vitro pre-tRNAPro transcripts was excised by a yeast extract, indicating that the RNA folded into a tRNA-like structure. 230 As in archaebacterial intron-containing pre-tRNAs, the two cleavage sites in pre- tRNA1*0 are located in bulge loops that are separated by four canonical base pairs.

However, in contrast to the three-nucleotide cleavage loops of archaebacterial pre-tRNAs, the 5' and 3' cleavage loops of pre-tRNAPro consist of five and four nucleotides, respectively. In addition, an unpaired A residue opposing the 5' cleavage loop can possibly stack into the helix between the two cleavage loops to extend it to a length equivalent to five base pairs. Relatively small changes in the exon-intron boundary structures of pre-tRNATrP have been shown to have a significant affect on cleavage by the

H. volcanii intron endonuclease. Of relevance to pre-tRNA1*0, Thompson and Daniels

(1990) constructed derivatives of the 016 tRNATlP substrate containing either an additional nucleotide in the 5' cleavage loop or a fifth base pair between the two bulge loops. Both mutant substrates were cleaved, but with reduced efficiency when compared to 016 RNA. Cleavage of the mutant substrate with the four-nucleotide 5' cleavage loop was also less specific; a small percentage of the products resulted from cleavage at the wrong phosphodiester bond, but at the correct distance from the 3' splice site. If sequence plays only a passive role in substrate recognition and cleavage by the H. volcanii intron endonuclease, then the deletion of specific nucleotides within pre-tRNAPro to make the exon-intron boundary structures mimic that of Haloferax pre-tRNATrP should produce a suitable substrate for the intron endonuclease. Such a substrate, tRNAPr°-m, was constructed from tRNA 1*0 using oligonucleotide-directed mutagenesis. Like pre- tRNATlP, the exon-intron boundary structures of pre-tRNA 1* 0 ' 111 consists of two three- nucleotide bulge loops separated by four base pairs, with the cleavage sites located in the bulge loops (see Figure 32). However, in vivo and in vitro analyses demonstrated that pre-tRNAPr°-m is not a substrate for the H. volcanii intron endonuclease (see Figure 33).

This suggests that, although the enzyme requires a defined structure at the exon-intron boundaries, sequence plays more than a passive role in substrate recognition and/or 231 cleavage. A detailed analysis of the sequences in the exon-intron boundary regions will be required to determine whether specific nucleotide binding is involved in substrate recognition.

It was noted that pre-tRNAPro and pre-tRNAPro'm were also not substrates for

RNase P. All in vivo transcripts detected in the Northern analysis contained the 19- nucleotide 5' leader sequence (Figure 33). In a primer extension analysis, only a very small percentage of the in vivo pre-tRNAPro transcripts contained the mature 5' end (data not shown). Although H. volcanii RNase P has only been assayed with H. volcanii pre- tRNAVaI and B. subtilis pre-tRNAAsP substrates, the activity of eubacterial and eukaryotic nuclear RNase P enzymes are not affected by the sequence of the 5' leader. It is possible that the in vivo pre-tRNA ^ 0 transcripts are not substrates for the intron endonuclease and

RNase P because they do not enter into the cellular pool for RNA processing. The

Haloferax pre-tRNAs may contain a unique structure or sequence, lacking in yeast pre- tRNApro, that is required for recognition of the RNA as a substrate (Sivaram and

Deutscher, 1990).

All of the nucleotides deleted from tRNApro to produce tRNAPro*m were located in the intron sequence. Since the mature tRNA domain and the distance from the top of the anticodon stem to the 5' and 3* cleavage sites remained unchanged, pre-tRNA p r0 contains all of the elements that have been identified as being important for substrate recognition and cleavage by the S. cerevisiae nuclear tRNA intron endonuclease (Reyes and Abelson,

1988). Nonetheless, pre-tRNAPro'm appears not to be a substrate for the yeast enzyme

(see Figure 33). These data indicate that features other than the mechanism that measures the distance from the top of the anticodon stem to the cleavage sites affect substrate recognition and/or cleavage by the yeast processing complex. The changes in the pre- tRNAPro intron sequence may be responsible for the inability of the S. cerevisiae enzyme to recognize pre-tRNA 1* 0-111 as a substrate. Although there is substantial data that 232 suggests a negligable role for tRNA introns in their removal by the ±£. cerevisiae enzyme

(Greer et al., 1987), there is also evidence that intron structure and sequence can have profound effects on pre-tRNA splicing (Strobel and Abelson, 1986b). In addition, an inspection of the intron-containing pre-tRNAs from S. cerevisiae reveals that in all cases there is the potential for five or six base pairs between the splice sites (Ogden et al.,

1984). The S. cerevisiae intron endonuclease may not recognize pre-tRNAPr0'm as a substrate because the distance between the splice sites has been reduced to four base pairs.

Although intron-containing precursors without a tRNA domain have not been analyzed as substrates in vivo, the results presented in this study suggest that the H. volcanii tRNA intron endonuclease and ligase activities could effectively splice non-tRNA molecules as long as they contain the conserved exon-intron boundary structures.

Interestingly, the sequences at the exon-intron boundaries of the pre-23S rRNAs from the sulfur-dependent thermophiles Desulfurococcus mobilis and Staphvlothermus marinus can also assume a structure consisting of two three-nucleotide bulge loops, separated by four base pairs. In addition, the halophiles have RNase ID-like cleavage sites in large hairpin structures that flank the 16S and 23S rRNAs in polycistronic transcripts; these sites also have this structure (L. Thompson and C. Daniels, personal communication). Extracts from sulfur-dependent thermophiles and methanogens which lack rRNA introns can accurately cleave intron-containing pre-rRNAs (Kjems and Garrett, 1991), and extracts from a wide variety of archaebacteria can accurately cleave the H. volcanii tRNATlP substrate (Thompson, 1990). These observations might suggest that the tRNA intron endonuclease and ligase enzymes are actually general RNA maturases with multiple roles in cellular RNA metabolism. t

APPENDIX

Table 4. List of Escherichia Haloferax volcanii. Thermoplasma acidophilum. and

Saccharomvces cerevisiae strains and their genotypes.

Strain Genotype Source

E. £fiUMV1190 Aflac-proABl. thi. supE BioRad A(sr 1 -recA~)306: :Tn 10 (tet1), [F: ttaD36, pmAB, la£WZAM15]

E. coli TB1 F*> araAflac-proABl. rpsL. BRL

E. coli JM110 FTtraD36. proAB+. lacR lacZAM151. Stratagene dam, dcm, supE44. hsdR17. thi, leu, thr. rspL. lacY. galK. galT. ara. tonA. tsx. AOac-proAB')

E. coli BMH71-18 Aflac-proABl. rmutS::Tnl01. thi. Stratagene [F’, 2 mA+B+, laciaZAM15], sufiE

E. Qi2li DH5a-F' F’, <|)80d, lacZAM15. endAl.recAl BRL M R 17 (rk‘ mk+), supE44. thi-1 X- gyrA96, relAl, A(lacZYA-grgF)U 169

H. volcanii DS2 ATCC 29605, type strain W. F. Doolittle

H. volcanii WFD11 H. volcanii DS2 cured of the W. F. Doolittle endogenous plasmid pHV2

T. acidophilum 122-1B2 ATCC 25905, type strain T. Langworthy

S. cerevisiae EJ101 trpl. prol-126, prbl-112 J. Abelson pep4-3. ocrl-126

233 234

Table 5. List of H. volcanii-E. coli shuttle vectors

Plasmid Relevant Features

pWL102 H. volcanii-E. coli shuttle vector obtained from W. F. Doolitde (see Figure 24).

pWL201 Deletion of Kpnl to Ncol fragment from pWL102 (see Figure 24). pWL202 Multiple cloning region EcoRI to Hindin fragment from pUC18- LysP-Trp0167, containing the tRNALys gene promoter and the tRNATrP-0167 promoter reporter gene, cloned into the EcoRI and Hindlll sites of pWL201 (see Figure 24). pWL203 Deletion of Hindin to Xbal tRNALys gene promoter fragment from pWL202 (see Figure 24). p\VL204 Deletion of BamHI tRNATrP-0167 fragment from pWL202 (see Figure 24). pWL205 Consensus H. volcanii tRNA gene terminator sequence cloned into the EcoRI site of pWL204. pWL207 BamHI fragment containing the tRNATrP-0167 gene from pWL202 cloned into the BamHI site of pWL205. pWL208 BamHI fragment containing the tRNATlP-0167m gene (see Figure 28) cloned into the BamHI site of pWL205. pWL210 BamHI fragment containing the tRNATrP-O1670+rm gene (see Figure 28) cloned into the BamHI site of pWL205. pWL211 BamHI fragment containing the tRNATrP-016m gene (see Figure 28) cloned into the BamHI site of pWL205. pWL212 BamHI fragment containing the tRNATrP-016-AGGAGm gene (see Figure 28) cloned into the BamHI site of pWL205. pWL220 Rsal fragment containing the £. cerevisiae tRNAPro gene from pGKNl blunt-end ligated into the Smal site of pWL205. 235 Table 5. Continued.

pWL221 Deletion of the sequence 5-GATC-3' from the BamHI site immediately upstream of the tRNA 1*110 gene from pWL220 (see Figures 31 and 32). pWL222 Reconstruction of the tRNA 1’1'0 gene from pWL221 by oligonucleotide-directed mutagenesis to produce the tRNA ^ 0-111 gene (see Figures 31 and 32). pWL230 Hindlll to EcoRI fragment containing the Mlul to Sail RNase P RNA gene region (see Figure 18) subcloned from pIBI31 into pWL201 (see Figure 24). 236 Table 6. List of oligonucleotides.

Name Sequence 5' to 3'a

PRNA1 CGT6CGGCTAAACCCCGG RPRNA2 NNNGGACTTTCCTCNNC FPRNA3 CCGCAGAGGGATGAGGTG RPRNA4 CTCGTTTCTGTTCCGCG RPRNA5 GGTCACCCGTTCGGACGGTG HMGCoA GCTGTTGATGACCGAGCAACC TERM-R AATTCCTCATCTTTACGCGT TERM-AR AATTACGCGTAAAGATGAGG WSTEM3P GCACGAATTCTGGTGCCCGGCGAGGGATTTGAACCC WSTEM5P GCTGTCTAGACAAGCCCGGCTGGCCAAGCCCGGC PFLANK CTCTAGAGTCCCCTTGC TRPMEI GGGCTTGGCCAGCCGGGC TRPINT CGGCCGCTCAGTATATCAGCTGG 0167INT CTCCGGTGTGCGCCAAGCCTC STEMPE TGCCCGGCGAGGGATTTG PROT73P GGATCCTGGGGGGCGAGCTGGGAATTGAACC

PROT75P GATCCTAATACGACTCACTATAGGGCGTGTGGTCTAGT GGTATG PROEXI CCCAAAGCGAGAATCATACCAC PROINT GCTTTGTCTTCCTGTTTAATCAGG PMUTINT GTTTGCTTCCTGTTTAATC TRNAPRO CGAGCTGGGAATTGAACCCAGG

PROMUT GGGCCTCTCGCATGTTTGCTTCCTGTTTAATCAGGAAG TCCCAAAGCGAGAATC

a An "N" nucleotide indicates the random placement of A, G, C, and T at that position in the oligonucleotide. Within the population of synthesized oligonucleotides, each of the four nucleotides possible at this position are expected to be equally represented. 237 Table 7. List of Plasmids.

Plasmid Relavent Features Source pUC18 Contains a multiple cloning site and BRL a gene that confers ampicillin resistance. Produces the a-peptide of (3-galactosidase which complements the lac deletion mutation in E. coli strains.

M13mpl8 RFDNA Double-stranded, circular form of the DNA IBI ofphageM13mpl8. Contains a multiple cloning site and produces the a-peptide of P-galactosidase.

M13mpl9RFDNA Same as M13mpl8 RF DNA, except the IBI multiple cloning site is in the opposite orientation. pIBI31 Contains a multiple cloning site flanked by IBI phage T7 and T3 RNA polymerase promoters. Carries the phage FI origin of replication. Produces the a-peptide of P-galactosidase. pT72 Contains a phage T7 RNA polymerase USB promoter upstream of a multiple cloning site. Produces the a-peptide of (3-galactosidase. pVT2 Contains two identical, directly repeated Daniels et al., H- volcanii tRNAVal genes cloned into the 1986 multiple cloning site of plasmid pUC9 (see Figure 11). pT7-tRNAVal tRNAVal gene from pVT2 cloned into This study the multiple cloning site of pT72 (see Figure 11). pDN2 1 kb Mlul-Sall fragment containing the This study H. volcanii RNase P RNA gene region cloned into pIBI31 under the transcriptional control of a T7 RNA polymerase promoter (see Figure 18). 238 Table 7. Continued.

pDN3 Mael-BstBI fragment containing the This study H. volcanii RNase P RNA gene subcloned from pDN2 into pIBI31 under the transcriptional control of a T7 RNA polymerase promoter (see Figure 18).

pDN4 tRNATrP-016m gene cloned into pIBI31 This study under the transcriptional control of a T7 RNA polymerase promoter (see Figure 28).

pDN5 tRNATrP-016-AGGAGm gene cloned into This study pIBI31 under the transcriptional control of a T7 RNA polymerase promoter (see Figure 28).

pDN6 tRNATrP-0167m gene cloned into pIBI31 This study under the transcriptional control of a T7 RNA polymerase promoter (see Figure 28).

pDN7 tRNATrP-0167o+rm gene cloned into This study pIBI31 under the transcriptional control of a T7 RNA polymerase promoter (see Figure 28).

pDW128 £. subtilis tRNAAsP gene cloned into N. R. Pace pTZ19 under the transcriptional control of a T7 RNA polymerase promoter. pG K N l S. cerevisiae tRNA1^ gene cloned into G. Knapp pBR322. p23-4.5S E. coli 4.5S RNA gene cloned into C. Guerrier-Takada pUC19 under the transcriptional control of a T7 RNA polymerase promoter. LITERATURE CITED

Akaboshi, E., C. Guerrier-Takada, and S. Altman. 1980. Veal heart ribonuclease P has an essential RNA component. Biochem. Biophys. Res. Commun. 96: 831-837.

Alifano, P., F. Rivellini, D. Limauro, C. B. Bruni, and M. S. Carlomagno. 1991. A consensus motif common to all rho-dependent prokaryotic transcription terminators. Cell 64: 553-563.

Altman, S. 1989. Ribonuclease P: an enzyme with a catalytic RNA subunit. Adv. Enzymol. Relat. Areas Mol. Biol. 62: 1-36.

Altman, S., M. F. Baer, M. Bartkiewicz, H. Gold, C. Guerrier-Takada, L. A. Krsebom, N. Lumelsky, and K. Peck. 1989. Catalysis by the RNA subunit of RNase P- a minireview. Gene 82: 63-64.

Altman, S., M. Baer, C. Guerrier-Takada, and A. Vioque. 1986. Enzymatic cleavage of RNA by RNA. Trends Biochem. Sci. 11: 515-518.

Altman, S., H. Gold, and M. Bartkiewicz. 1988. Ribonuclease P as a snRNP. In_Structure and function of major and minor small nuclear ribonucleoprotein particles (Bimsteil, ed.). Springer, Berlin Heidelberg.

Altman, S., and J. D. Smith. 1971. Tyrosine tRNA formed in vitro by specific nucleolytic cleavage of a precursor molecule. Nature New Biology 233: 35-37.

Arndt, E., and C. Weigel. 1990. Nucleotide sequence of the genes encoding the LI 1, LI, L10, and L12 equivelant ribosomal proteins from the archaebacterium Halobacterium marismortui. Nucleic Acids Res. 18: 1285.

Baer, M., and S. Altman. 1985. A catalytic RNA and its gene from £. tvphimurium. Science 228: 99-102.

Baer, M., N. Lumelsky, C. Guerrier-Takada, and S. Altman. 1989. Structure and function of bacterial RNase P. In Nucleic acids and molecular biology (F. Eckstein and D. M. J. Lilley, eds.), Vol 3, Springer-Verlag, Berlin Heidelberg.

Baer, M., T. W. Nilsen, C. Costigan, and S. Altman. 1990. Structure and transcription of a human gene for HI RNA, the RNA component of human RNase P. Nucleic Acids Res. 18: 97-103.

239 240 Baer, M. F., R. M. Reilly, G. M. McCorkle, T.-Y. Hai, S. Altman, and U. L. RajBhandary. 1988. The recognition by RNase P of precursor tRNAs. J. Biol. Chem. 263: 2344-2351.

Baier, G., W . Piendl, B. Redl, and G. Stoffler. 1990. Structure, organization, and evolution of the LI equivalent ribosomal protein gene of the archaebacterium Methanococcus vanielii. Nucleic Acids Res. 18:719-724.

Balch, W. E., L. J. Magrum, G. E. Fox, R. S. Wolfe, and C. R. Woese. 1977. An ancient divergence among the bacteria. J. Mol. Evol. 9: 305-311.

Bartkiewicz, M., H. Gold, and S. Altman. 1989. Identification and chracterization of an RNA molecule that copurifies with RNase P activity from HeLa cells. Genes and Development 3:488-499.

Beltz, G. A., K. A. Jacobs, T. H. Eickbush, P. T. Cherbas, and F. C. Kafatos. 1983. Isolation of multigene families and determination of homologies by filter hybridization methods. Meth. Enzymol. 100: 266-285.

Bergmann, U., and E. Arndt. 1990. Evidence for an additional archaebacterial gene cluster in Halobacterium marismortui encoding ribosomal proteins HL46e and HL30. Biochim. Biophys. Acta 1050: 56-60.

Berk, A. J. 1989. Characterization of RNA molecules by SI nuclease analysis. Methods Enzymol. 180: 334-347.

Bertani, G., and L. Baresi. 1987. Genetic transformation in the methanogen Methanococcus voltae PS. J. Bacteriol. 169:2730-2738.

Blaseio, U., and F. Pfeifer. 1990. Transformation of Halobacterium halobium: development and investigation of gas vesicle synthesis. Proc. Natl. Acad Sci. USA 87: 6772-6776.

Bock, A., and O. Kandler. 1985. Antibiotic sensitivity of archaebacteria, p. 525- 544. In The bacteria, archaebacteria (C. R. Woese and R. S. Wolfe, eds.), Vol. 8, Academic Press, Inc., Orlando, FI.

Bollschweiler, C., R. Kuhn, and A. Klein. 1985. Non-repetitive AT-rich sequences are found in intergenic regions of Methanococcus voltae DNA. EMBO J. 4: 805-809.

Bonelo, G., M. Ventosa, M. Megias, and F. Ruiz-Berraquero. 1984. The sensitivity of halobacteria to antibiotics. FEMS Microbiol. Lett. 21: 341-345.

Boorstein, W. R., and E. A. Craig. 1989. Primer extension analysis of RNA. Methods Enzymol. 180: 347-369.

Bouthier de la Tour, C., C. Portemer, M. Nadal, K. O. Stetter, P. Forterre, and M. Duguet. 1990. Reverse gyrase, a hallmark of the hyperthermophilic archaebacteria. J. Bacteriol. 172: 6803-6808. 241 Brown, J. W., C. J. Daniels, and J. N. Reeve. 1989. Gene structure, organization, and expression in archaebacteria. Crit. Rev. Microbiol. 16: 287-338.

Brown, J. W., E. S. Haas, B. D. Janies, D. A. Hunt, and N. R. Pace. 1991. Phylogenetic analysis and evolution of RNase P RNA in proteobacteria. J. Bacteriol. 173: 3855-3863.

Brown, J. W., M. Thomm, G. S. Beckler, G. Frey, K. O. Stetter, and J. N. Reeve. 1988. An archaebacterial RNA polymerase binding site and transcription initiation of the hisA gene of Methanococcus vanielii. Nucleic Acids Res. 16: 135-150.

Brown, S. 1987. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of Escherichia, coli. Cell 49: 825-833.

Brown, S. 1991. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli. J. Bacteriol. 173: 1835-1837.

Burgin, A. B., and N. R. Pace. 1990. Mapping the active site of ribonuclease P RNA using a substrate containing a photoaffinity agent. EMBO J. 9: 4111-4118.

Burkard, U., and D. Soil. 1988. The unusually long amino acid acceptor stem of Escherichia coli selenocysteine tRNA results from abnormal cleavage by RNase P. Nucleic Acids Res. 16:11617-11624.

Burkard, U., I. Willis, and D. Soli. 1988. Processing of histidine transfer RNA precursors. J. Biol. Chem. 263: 2447-2451.

Cabrera, J. A., J. Bolds, P. E. Shields, C. M. Havel, and J. A. Watson. 1986. Isoprenoid synthesis in Halobacterium halobium. J. Biol. Chem. 261: 3578- 3583.

Cammarano, P., A. Teichner, P. Londei, M. Acca, B. Nicolaus, J. L. Sanz, and R. Amils. 1985. Insensitivity of archaebacterial ribosomes to protein synthesis inhibitors. Evolutionary implications. EMBOJ. 4:811-816.

Carrara, G., P. Calandra, P. Fruscolino, M. Doria, and G. P. Tocchini- Valentini. 1989. Site selection bv Xenopus laevis RNase P. Cell 58:37-45.

Carter, B. J., B. S. Void, and S. M. Hecht. 1990. Control of the position of RNase P-mediated transfer RNA precursor processing. J. Biol. Chem. 265: 7100- 7103.

Castano, J. G., R. Ornberg, J. G. Koster, J. A. Tobian, and M. Zasloff. 1986. Eukaryotic pre-tRNA 5' processing nuclease: copurification with a complex cylindrical particle. Cell 46: 377-387.

Cech, T. R. 1987. The chemistry of self-splicing RNA and RNA enzymes. Science 236: 1532-1539.

Cech, T. R. 1988. Conserved sequences and structures of group I introns: building an active site for RNA catalysis-a review. Gene 73:259-271. 242 Cech, T. R. 1990. Self-splicing of group I introns. Ann. Rev. Biochem. 59: 543- 568.

Cech, T. R., and B. L. Bass. 1986. Biological catalysis by RNA. Ann. Rev. Biochem. 55: 599-629.

Charlebois, R. L., J. D. Hofman, L. C. Schalkwyk, W. L. Lam, and W. F. Doolittle. 1989. Genome mapping in halobacteria. Can J. Microbiol. 35: 21-29.

Cherayil, B., G. Krupp, P. Schuchert, S. Char, and D. Soli. 1987. The RNA components of Schizosaccharomvces pombe RNase P are essential for cell viability. Gene 60: 157-161.

Chu, F. K., G. F. Maley, and M. Belfort. 1984. An intervening sequence in the thymidylate synthase gene of bacteriophage T4. Proc. Natl. Acad. Sci. USA 81: 3049- 3053.

Chu, F. K., F. Maley, J. Martinez, and G. F. Maley. 1987. Interrupted thymidylate synthase gene in bacteriophage T2 and T6 and other potential self-splicing introns in the T-even bacteriophages. J. Bacteriol. 169: 4368-4375.

Christian, J. H. B., and J. A. Waltho. 1962. Biochim. Biophys. Acta 65: 506- 508.

Clark, M. W., and J. Abelson. 1987. The subnuclear localization of tRNA ligase in yeast. J. Cell. Biol. 105: 1515-1526.

Cline, S. W., and W. F. Doolittle. 1987. Efficient transfection of the archaebacterium Halobacterium halobium. J. Bacteriol. 169: 1341-1344.

Cline, S. W., W. L. Lam, R. L. Charlebois, L. C. Schalkwyk, and W. F. Doolittle. 1989. Transformation methods for halophilic archaebacteria. Can. J. Microbiol. 35: 148-152.

Conover, R. K., and W. F. Doolittle.1990. Characterization of a gene involved in histidine biosynthesis in Halobacterium (Haloferax) volcanii: isolation and rapid mapping by transformation of an auxotroph with cosmid DNA. J. Bacteriol. 172: 3244- 3249.

Cooley,L., B. Appel, and D. Soil. 1982. Post-transcriptional nucleotide addition is responsible for the formation of the 5’ terminus of histidine tRNA. Proc. Natl. Acad. Sci. USA 79: 6475-6479.

Cozzarelli, N. R., S. P. Gerrard, M. Schlissel, D. D. Brown, and D. F. Bogenhagen. 1983. Purified RNA polymerase III accurately and efficiently terminates transcription of 5S rRNA genes. Cell 34: 829-835.

Cram, D. S., B. A. Sherf, R. T. Libby, R. J. Mattaliano, K. L. Ramachandran, and J. N. Reeve. 1987. Structure and expression of the genes, mcrBDCGA. which encode the subunits of methyl coenzyme M reductase in Methanococcus vanielii. Proc. Natl. Acad. Sci. USA 84: 3992-3996. 243 Daniels, C. J., S. E. Douglas, and W. F. Doolittle. 1986. Genes for transfer RNAs in Halobacterium volcanii. System. Appl. Microbiol. 7: 26-29

Daniels, C. J., S. E. Douglas, A. H. Z. McKee, and W. F. Doolittle. 1986. Archaebacterial tRNA genes: structure and intron processing. In Microbiology, 1986 (L. Leive, ed.), p. 349-355, ASM Press, Washington D. C.

Daniels, C. J., R. Gupta, and W. F. Doolittle. 1985. Transcription and excision of a large intron in the tRNATrP gene of an archaebacterium, Halobacterium volcanii. J. Biol. Chem. 260: 3132-3134.

Daniels, C. J., J. D. Hofman, J. G. MacWilliams, W. F. Doolittle, C. R. Woese, K. R. Leuhrsen, and G. E. Fox. 1985. Sequence of 5S ribosomal RNA gene regions and their products in the archaebacterium Halobacterium volcanii. Mol. Gen. Genet. 198: 270-274.

Darr, S. C., B. Pace, and N. R. Pace. 1990. Characterization of ribonuclease P from the archaebacterium Sulfolobus solfataricus. J. Biol. Chem. 265: 12927-12932.

DasSarma, S. 1989. Mechanisms of genetic variability in Halobacterium halobium: the purple membrane and gas vesicle mutations. Can. J. Microbiol. 35:65-72.

Datta, P. K., L. K. Hawkins, and R. Gupta. 1989. Presence of an intron in eloneator methionine tRNA of Halobacterium volcanii. Can J. Microbiol. 35:189-194.

Denda, K., J. Konishi, K. Hajiro, T. Oshima, T. Date, and M. Yoshida. 1990. Structures of an ATPase operon of an acidothermophilic archaebacterium, Sulfolobus acidocaldarius. J. Biol. Chem. 265: 21509-21513.

Dennis, P. P. 1987. Multiple promoter for the transcription of the ribosomal RNA gene cluster of Halobacterium halobium. J. Mol. Biol. 186: 457-461.

Deutscher, M. P. 1984. Processing of tRNA in prokaryotes and eukaryotes. CRC Crit. Rev. Biochem. 17: 45-71.

Doersen, C. -J., C. Guerrier-Takada, S. Altman, and G. Attardi. 1985. Characterization of an RNase P activity from HeLa cell mitochondria. J. Biol. Chem. 260: 5942-5949.

Doolittle, W. F. 1985. Genome structure in archaebacteria. In The bacteria (C. R. Woese and R. S. Wolfe, eds.), Vol. 8, pp 545-560, Academic Press, London.

Doria, M., G. Carrara, P. Calandra, and G. P. Tocchini-Valentini. 1991. An RNA molecule copurifies with RNase P activity from Xenopus laevis oocytes. Nucleic Acids Res. 19: 2315-2320.

Drainas, D., S. Zimmerly, I. Willis, and D. Soil. 1989. Substrate structural requirements of Schizosaccharomvces pombe RNase P. FEBS Lett. 251:84-88. 244 Duschl, A., J. K. Lanyi, and L. Zimanyi. 1990. Properties and photochemistry of a halorhodopsin from the haloalkalophile, Natronobacterium pharaonis. J. Biol. Chem. 265: 1261-1267.

Ebert, K., W. Goebel, A. Moritz, U. Rdest, and B. Surek. 1986. Genome and Gene structures in halobacteria. Syst. Appl. Microbiol. 7: 30-35.

Edmonds, C. G., P. F. Crain, R. Gupta, T. Hashizume, C. H. Hocart, J. A. Kowalak, S. C. Pomerantz, K. O. Stetter, and J. McClosky. 1991. Posttranscriptional modification of tRNA in thermophilic Archaea (archaebacteria). J. Bacteriol. 173: 3138-3148.

Filipowicz, W., M. Konarka, H. J. Gross, and A. J. Shatkin. 1983. RNA 3’ terminal phosphate cyclase activity and tRNA ligation in HeLa cell extracts. Nucleic Acids Res. 11: 1405-1418.

Filipowicz, W., and A. J. Shatkin. 1983. Origin of splice junction phosphate in tRNAs processed by HeLa cell extract. Cell 32: 547-557.

Fitch, W. M., and E. Margoliash. 1967. Construction of phylogenetic trees. Science 155: 279-284.

Forster, A. C., and S. Altman. 1990. Similar cage-shaped structures for the RNA components of all ribonuclease P and ribonuclease MRP enzymes. Cell 62: 407-409.

Fox, G. E., L. J. Magrum, W. E. Balch, R. S. Wolfe, and C. R. Woese. 1977a. Classification of methanogenic bacteria by 16S ribosomal RNA characterization. Proc. Natl. Acad. Sci. USA 74: 4537-4541.

Fox,G. E., K. R. Pechman, and C. R. Woese. 1977b. Comparative cataloging of 16S ribosomal ribonucleic acid: molecular approach to procaryotic systematics. Int. J. Syst. Bacteriol. 27: 44-57.

Fox, G. E., and E. Stackenbrandt. 1987. The application of 16S rRNA cataloging and 5S rRNA sequencing in bacterial systematics. Meth. Microbiol. 19: 405- 458.

Fox, G. E., E. Stackenbrandt, R. B. Hespell, J. Gibson, J. Maniloff, T. A. Dyer, R. S. Wolfe, W. E. Batch, R. S. Tanner, L. J. Magrum, L. V. Zablen, R. Blakemore, R. Gupta, L. Bonen, B. J. Lewis, D. A. Stahl, K. R. Luehrsen, K. N. Chen, and C. R. Woese. 1980. The phylogeney of prokaryotes. Science 209: 457-463.

Fox, G., and C. Woese. 1975. 5S RNA secondary structure. Nature 256: 505- 507

Frey, G., M. Thomm, B. Brudigam, H. P. Gohl, and W. Hausner. 1990. An archaebacterial cell-free transcription system. The expression of tRNA genes from Methanococcus vannielii is mediated by a transcription factor. Nucleic Acids Res. 18: 1361-1367. 245 Gandini-Attardi, D., I. Margarit, and G. P. Tocchini-Valentini. 1985. Structural alterations in mutant precursors of the yeast tRNA1-611 gene which behave as defective substrates for a highly purified endoribonuclease. EMBO J. 4: 3289-3297.

Gardiner, K. J., T. L. Marsh, and N. R. Pace. 1985. Ion dependence of the Bacillus subtilis RNase P reaction. J. Biol. Chem. 260: 5415-5419.

Gardiner, K., and N. R. Pace. 1980. RNase P from Bacillus subtilis has a RNA component. J. Biol. Chem. 255: 7507-7509.

Gernhardt, P., O. Possot, M. Foglino, L. Sibold, and A. Klein. 1990. Construction of an integration vector for use in the archaebacterium Methanococcus voltae and expression of a eubacterial resistance gene. Mol. Gen. Genet. 221: 273-279.

Gold, H. A., and S. Altman. 1986. Reconstitution of RNase P activity using inactive subunits from Escherichia coli and HeLa cells. Cell 44: 243-249.

Goodman, H. M., M. V. Olson, and B. D. Hall. 1977. Nucleotide sequence of a mutant eukaryotic gene: the yeast tyrosine-inserting ochre suppressor SUP4-0. Proc. Natl. Acad. Sci. USA 74: 5453-5457.

Goodrich-Blair, H., V. Scarlato, J. M. Gott, M.-Q. Xu, and D. A. Shub. 1990. A self-splicing group I intron in the DNA polymerase gene of Bacillus subtilis bacteriophage SPOl. Cell 63:417-424

Green, C. J., and B. S. Void. 1988. Structural requirements for processing of synthetic tRNAHis precursors by the catalytic RNA component of RNase P. J. Biol. Chem. 263: 652-657.

Greer, C. L. 1986. Assembly of a tRNA splicing complex: evidence for concerted excision and joining steps in splicing in vitro. Mol. Cell. Biol. 6: 635-644.

Greer, C. L., B. Jauor, and J. Abelson. 1983. RNA ligase in bacteria: formation of a 2', 5' linkage by an £. eqH extract. Cell 33: 899-906.

Greer, C. L., C. L. Peebles, P. Gegenheimer, and J. Abelson. 1983b. Mechanism of action of a yeast RNA ligase in tRNA splicing. Cell 32: 537-546.

Greer, C. L., D. Soli, and I. Willis. 1987. Substrate recognition and identification of splice sites by the tRNA-splicing endonuclease and ligase from Saccharomvces cerevisiae. Mol. Cell. Biol. 7:76-84.

Grivell, L. A. 1990. Trailing the itinerant intron. Science 344: 110-111. Gropp, F., P. Palm, and W. Zillig. 1989. Expression and regulation of H genes. Can. J. Microbiol. 35: 182-188.

Gropp, F., W. D., Reiter, A. Sentenac, W. Zillig, R. Schnabel, M. Thomm, and K. O. Stetter. 1986. Homologies of components of DNA-dependent RNA polymerases of archaebacteria, eukaryotes, and eubacteria. Syst. Appl. Microbiol. 7: 95-101. 246 Grote, M., J. Dijk, and R. Reinhardt. 1986. Ribosomal and DNA-binding proteins of the thermophilic archaebacterium Sulfolobus acidocaldarius. Biochim. Biophys. Acta. 873: 405-413.

Guerrier-Takada, C., and S. Altman. 1984. Structure in solution of Ml RNA, the catalytic subunit of ribonuclease P from Escherichia coli. Biochemistry 23: 6327- 6334.

Guerrier-Takada, C., and S. Altman. 1986. Ml RNA with large terminal deletions retains its catalytic activity. Cell 45: 177-183.

Guerrier-Takada, C., K. Gardiner, T. Marsh, N. Pace, and S. Altman. 1983. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell 35: 849-857.

Guerrier-Takada, C., N. Lumelsky, and S. Altman. 1989. Specific interactions in RNA enzyme-substrate complexes. Science 246: 1578-1583.

Guerrier-Takada, C., W. H. McClain, and S. Altman. 1984. Cleavage of tRNA precursors by the RNA subunit of E. coli ribonuclease P (Ml RNA) is influenced by 3'-proximal CCA in the substrates. Cell 38: 219-224.

Gupta, R. 1985. Transfer ribonucleic acids of archaebacteria. In The bacteria (C. R. Woese and R. S. Wolfe, eds.), vol. 8, pp 311-343. Academic Press, London.

Gurevitz, M., S. K. Jain, and D. Apirion. 1983. Identification of a precursor molecule for the tRNA moiety of the processing enzyme RNase P. Proc. Natl. Acad. Sci. USA 80: 4450-4454.

Haas, E. S., J. W. Brown, C. J . Daniels, and J. N. Reeve. 1990. Genes encoding the 7S RNA and tRNASer are linked to one of the two rRNA operons in the genome of the extremely thermophilic archaebacterium Methanothermus fervidus. Gene 90: 51-59.

Hackett, N. R., ans S. DasSarma. 1989. Characterization of the small endogenous plasmid of Halobacterium strain SB3 and its use in transformation of H. halobium. Can. J. Microbiol. 35: 86-91.

Hamilton, M. G. 1971. Isodensity equilibrium centrifugation of ribosomal particles; the calculation of the protein content of ribosomes and other ribonucleoproteins from buoyant density measurements. Meth. Enzymol. 20:512-521.

Hansen, F. G., E. B. Hansen, and T. Atlung. 1985. Physical mapping and nucleotide sequence of the mpA gene that encodes the protein component of ribonuclease P in Escherichia coli. Gene 38: 85-93.

Henderson, E ., M. Oakes, M. W . Clark, J. A. Lake, T. A. Matheson, and W . Zillig. 1984. A new ribosome structure. Science 225: 510-512. 247 Hofman, J. D., L. C. Schalkwyk, and W. F. Doolittle. 1986. ISH51: a large, degenerate family of insertion sequence-like elements in the genome of the archaebacterium Halobacterium volcanii. Nucleic Acids Res. 14: 6983-7000.

Hollingsworth, M. J., and N. C. Martin. 1986. RNase P activity in the mitochondria of Saccharomvces cerevisiae depends on both mitochondrial and nucleus- encoded components. Mol. Cell. Biol. 6: 1058-1064.

Hollingsworth, M. J., and N. C. Martin. 1987. Alteration of a mitochondrial tRNA precursor 5, leader abolishes its cleavage by yeast mitochondrial RNase P. Nucleic Acid Res. 15: 8845-8860.

Holmes, M. L., and M. L. Dyall-Smith. 1990. A plasmid vector with a selectable marker for halophilic archaebacteria. J. Bacteriol. 172:756-761.

Holmes, M. L., and M. L. Dyall-Smith. 1991. Mutations in DNA gyrase result in novobiocin resistance in halophilic archaebacteria. J. Bacteriol. 173: 642-648.

Holmes, M. L., S. D. Nuttall, and M. L. Dyall-Smith. 1991. Construction and use of halobacterial shuttle vectors and further studies on Haloferax DNA gyrase. J. Bacteriol. 173: 3807-3813.

Hopper, A. K., F. Banks, and V. Evangelidis. 1978. A yeast mutant which accumulates precursor tRNAs. Cell 14:211-219.

Hopper, A. K., L. D. Schultz, and R. A. Shapiro. 1980. Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from pre-tRNAs. Cell 19:741-751.

Hopwood, D.A. 1981. Genetic studies with bacterial protoplasts. Ann. Rev. Microbiol. 35: 237-272.

Horne, M ., and F. Pfeifer. 1989. Expression of two gas vacuole protein genes in Halobacterium halobium and other related species. Mol. Gen. Genet. 218:437-444.

Huber, R., M. Kurr, H. W. Jannasch, and K. O. Stetter. 1989. A novel group of abyssal methanogenic archaebacteria ('Methanopvrus') growing at 110°C. Nature 342: 833-834.

Hudepohl, U., W.-D. Reiter, and W. Zillig. 1990. In vitro transcription of two rRNA genes of the archaebacterium Sulfolobus sp. B12 indicates a factor requirement for specific initiation. Proc. Natl. Acad. Sci. USA 87: 5851-5855.

Huet, J., R. Schnabel, A. Sentenac, and W. Zillig. 1983. Archaebacteria and eukaryotes posses DNA-dependent RNA polymerases of a common type. EMBO J. 2: 1291-1294.

Hartmann, R. K., H. Y. Toschka, and V. A. Erdmann. 1991. Processing and termination of 23S rRNA-5S rRNA-tRNA^ly primary transcripts in Thermus thermophilus HB8. J. Bacteriol. 173:2681-2690. 248 Imbert, M., L. Bernard, N. Helbecque, J. P Mornon, J. P. Henichart, and P. Sautiete. 1990. Conformational study of the chromosomal protein MCI from the archaebacterium Methanosarcina barkeri. Biochim. Biophys. Acta. 1038: 346-354.

Ingram, M. 1957. Microorganisms resisting high concentrations of sugars or salt. Symp. Soc. Gen. Microbiol. 7: 90-133.

Jacquier, A., and F. Michel. 1987. Multiple exon-binding sites in class II self­ splicing introns. Cell 50: 17-29.

James, B. D., G. J. Olsen, J. Liu, and N. R. Pace. 1988. The secondary structure of ribonuclease P RNA, the catalytic element of a ribonucleoprotein enzyme. Cell 52: 19-26.

Janekovic, D., S. Wunderl, I. Holz, W. Zillig, A. Gierl, and H. Neumann. 1983. TTV1,TTV2, and TTV3, a family of viruses of the extremely thermophilic, anaerobic, sulfur reducing archaebacterium Thermoproteus tenax. Mol. Gen. Genet. 192: 39-45.

Jarrell, K. F., and G. D. Sprott. 1984. Formation and regeneration of Halobacterium spheroplasts. Curr. Microbiol. 10:147-152.

Johnson, J. D., R. Ogden, P. Johnson, J. Abelson, P. Dembeck, and K. Itakura. 1980. Transcription and processing of a yeast tRNA gene containing a modified intervening sequence. Proc. Natl. Acad. Sci. USA 77: 2564-2568.

Jones, W. J., D. P. Nagle Jr., and W. B. Whitman. 1987. Methanogens and the diversity of archaebacteria. Microbiol. Rev. 51:135-177.

Juez, G., F. Rodriguez-Valera, N. Herrero, and F. J. M. Mojica. 1990. Evidence for salt-associated restriction pattern modifications in Haloferax mediterranei. J. Bacteriol. 172: 7278-7281.

Kahle, D., U. Wehmeyer, S. Char, and G. Krupp. 1990a. The methylation of one specific guanosine in a pre-tRNA prevents cleavage by RNase P and by the catalytic Ml RNA. Nucleic Acids Res. 18: 837-844.

Kahle, D., U. Whemeyer, and G. Krupp. 1990b. Substrate recognition by RNase P and by the catalytic Ml RNA: identification of possible contact points in pre- tRNAs. EMBOJ. 9: 1929-1937.

Kaine, B. P. 1987. Intron-containing tRNA genes of Sulfolobus solfataricus. J. Mol. Evol. 25: 248-254.

Kaine, B. P. 1990. Structure of the archaebacterial 7S RNA molecule. Mol. Gen. Genet. 221: 315-321.

Kaine, B. P., R. Gupta, and C. R. Woese. 1983. Putative introns in tRNA genes of prokaryotes. Proc. Natl. Acad. Sci. USA 80: 3309-3312. 249 Kandler, O. 1988. Comparative chemistry of the rigid cell wall component and its phylogenetic implications. In Crystalline bacterial cell surface layers (V. B. Sleytr, P. Messner, D. Pum, and M. Sara, eds.), pp 1-6. Springer-Verlag, Berlin.

Keller, E. B., and W. A. Noon. 1984. Intron splicing: a conserved internal signal in introns of animal pre-mRNAs. Proc. Natl. Acad. Sci. USA 81:7417-7420.

Ken, R., N. R. Hackett. 1991. Halobacterium halobium strains lvsogenic for phage <|>H contain a protein resembling coliphage repressors. J. Bacteriol. 173: 955-960.

Kirsebom, L. A., and S. Altman. 1989. Reaction in vitro of some mutants of RNase P with wild-type and temperature-sensitive substrates. J. Mol. Biol. 207: 837- 840.

Kirsebom, L. A., M. F. Baer, and S. Altman. 1988. Differential effescts of mutations in the protein and RNA moieties of RNase P on the efficiency of suppression by various tRNA suppressors. J. Mol. Biol. 204: 879-888.

Kjems, J., and R. A. Garrett. 1985. An intron in the 23S ribosomal RNA gene of the archaebacterium Desulfurococcus mobilis. Nature 318: 675-677.

Kjems, J., and R. A. Garrett. 1987. Novel expression of the ribosomal RNA genes in the extreme thermophile and archaebacterium Desulfurococcus mobilis. EMBO J. 6: 3521-3530.

Kjems, J., and R. A. Garrett. 1988. Novel splicing mechanism for the ribosomal RNA intron in the archaebacterium Desulfurococcus mobilis. Cell 54: 693-703.

Kjems, J., and R. A. Garrett. 1991. Ribosomal RNA introns in archaea and evidence for RNA conformational changes associated with splicing. Proc. Natl. Acad. Sci. USA 88: 439-443.

Kjems, J., J. Jensen, T. Olesen, and R. A. Garrett. 1989a. Comparison of transfer RNA and ribosomal RNA intron splicing in the extreme thermophile and archaebacterium Desulfurococcus mobilis. Can. J. Microbiol. 35:210-214.

Kjems, J., H. Leffers, R. A. Garrett, G. Wich, W. Leinfelder, and A. Bock. 1987. Gene organization, transcription signals and processing of the single ribosomal RNA operon of the archaebacterium Thermoproteus tenax. Nucleic Acids Res. 15: 4821- 4835.

Kjems, J., H. Leffers, T. Olesen, and R. A. Garrett. 1989b. A unique tRNA intron in the variable loop of the extreme thermophile Thermofilum pendens and its possible evolutionary implications. J. Biol. Chem. 264: 17834-17837.

Klein, A., R. Allmansberger, M. Bokranz, S. Knaub, B. Muller, and E. Muth. 1988. Comparative analysis of genes encoding methyl coenzyme M reductase in methanogenic bacteria. Mol. Gen. Genet. 213: 409-420.

Klein, A., and M. Schnorr. 1984. Genome complexity of methanogenic bacteria. J. Bacteriol. 158: 628-631. 250 Kline, L., S. Nishikawa, and D. Soil. 1981. Partial purification of RNase P from £. pombe. J. Biol. Chem. 256: 5058-5063.

Klink, F. 1985. Elongation factors. In The bacteria (C. R. Woese and R. S. Wolfe, eds.), vol 8, pp 379-410. Academic Press, London.

Knap, A. K., D. Wesolowski, and S. Altman. 1990. Protection from chemical modification of nucleotides in complexes of M l RNA, the catalytic subunit of RNase P from E. coli. and tRNA precursors. Biochimie. 72: 779-790.

Kole, R., and S. Altman. 1979. Reconstitution of RNase P activity from inactive RNA and protein. Proc. Natl. Acad. Sci. USA 76: 3795-3799.

Kole, R. M. F. Baer, B. C. Stark, and S. Altman. 1982. Escherichia coli RNase P has a required RNA component in vivo. Cell 19: 881-887.

Konarska, M. M., R. A. Padget, and P. A. Sharp. 1985. Trans splicing of mRNA precursors in vitro. Cell 42: 165-171.

Konig, H., and O. Kandler. 1979. N-acetyltalosaminuronic acid, a constituent of the pseudomurein of the genus Methanobacterium. Arch. Microbiol. 123: 295-299.

Kruger, K., P. Grabowski, A. Zaug, J. Sands, D. Gottschling, and T. R. Cech. 1982. Self-splicing RNA: autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahvmena. Cell 31: 147-157.

Krupp, G., B. Cher ay il, D. Frendewey, S. Nishikawa, and D. Soil. 1986. Two RNA species co-purify with RNase P from the fission yeast Schizosaccharomyces pombe. EMBOJ. 5: 1697-1703.

Krupp, G., D. Kahle, and T. Vogt. 1991. Sequence changes in both flanking sequences of a pre-tRNA influence the cleavage specificity of RNase P. J. Mol. Biol. 217: 637-648.

Kuhsel, M. A., R. Strickland, J. D. Palmer. 1990. An ancient group I intron shared by eubacteria and chloroplasts. Science 250: 1570-1573.

Kushner, D. J. 1985. The halobacteriaceae. In The bacteria (C. R. Woese and R. F. Wolfe, eds.), vol. 8, pp. 171-214. Academic Press, London.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.

Lai, M.-C., K. R. Sowers, D. E. Robertson, M. F. Roberts, and R. P. Gunsalus. 1991. Distribution of compatible solutes in the halophilic methanogenic archaebacteria. J. Bacteriol. 173: 5352-5358.

Lake, J. A., E. Henderson, M. W. Clark, and A. T. Matheson. 1982. Mapping evolution with ribosome structure: intralineage constancy and interlineage variation. Proc. Natl. Acad. Sci. USA 79: 5948-5952. 251 Lam, W. L., A. Cohen, D. Tsouluhas, and W. F. Doolittle. 1990. Genes for tryptophan biosynthesis in the archaebacterium H. volcanii. Proc. Natl. Acad. Sci. USA 87: 6614-6618.

Lam, W. L., and W. F. Doolittle. 1989. Shuttle vectors for the archaebacterium Halobacterium volcanii. Proc. Natl. Acad. Sci. USA 86: 5478-5482.

Lambowitz, A. M. 1989. Infectious introns. Cell 56: 323-326.

Langford, C. J., and D. Gallwitz. 1983. Evidence for an intron-contained sequence required for the splicing of yeast RNA polymerase II transcripts. Cell 33: 519- 527.

Langworthy, T. A. 1985. Lipids of archaebacteria. In The bacteria (C. R. Woese and R. S. Wolfe, eds.), vol 8, pp 459-497. Academic Press, London.

Lanyi, J. K., W. Z. Placky, and M. Kates. 1974. Lipid interactions in membranes of extremely halophilic bacteria, n. Modification of the bilayer structure of squalene. Biochemistry 13: 4919-4920.

Larsen, N., H. Leffers, J. Kjems, and R. A. Garrett. 1986. Evolutionary divergence between the ribosomal RNA operons of Halococcus morrhuae and Desulfurococcus mobilis. Syst. Appl. Microbiol. 7:49-57.

Lawrence, N., D. Wesolowski, H. Gold, M. Bartkiewicz, C. Guerrier- Takada, W. H. McClain, and S. Altman. 1987. Characteristics of ribonuclease P from various organisms. Cold Spring Harbor Symp. Quant. Biol. 52: 233-238.

Lee, J.-Y., and D. R. Engelke. 1989. Partial characterization of an RNA component that copurifies with Saccharomvces cerevisiae RNase P. Mol. Cell. Biol. 9: 2536-2543.

Lee, J.-Y., C. E. Rohlman, L. A. Molony, and D. R. Engelke. 1991. Characterization of RPR1. an essential gene encoding the RNA component of Saccharomvces cerevisiae nuclear RNase P. Mol. Cell. Biol. 11: 721-730.

Lee, M. C. and G. Knapp. 1985. Transfer RNA splicing in Saccharomvces cerevisiae. Secondary and tertiary structures of the substrates. J. Biol. Chem. 260: 3108-3113.

Leonotis, N., A. DaLio, M. Strobel, and D. Engelke. 1988. Effects of tRNA- intron structure on cleavage of precursor tRNAs by RNase P from Saccharomvces cerevisiae. Nucleic Acids Res. 16: 2537-2552.

Liesack, W., and E. Stackebrandt. 1989. Evidence for unlinked rrn operons in the planctomvcete Pirellula marina. J. Bacteriol. 171: 5025-5030.

Lipson, S. E., G. D. Cimino, and J. E. Hearst. 1988. Structure of Ml RNA as determined by psoralen cross-linking. Biochemistry 27: 570-575. 252 Lodwick, D., H. N. M. Ross, J. E. Harris, J. W. Almond, and W. D. Grant. 1986. dam methylation in the archaebacteria. J. Gen. Microbiol. 132: 3055-3059.

Lumelsky, N., and S. Altman. 1988. Selection and characterization of randomly produced mutants in the gene coding for Ml RNA. J. Mol. Biol. 202:443-454.

Magrum, L. J., K. R. Luehrsen, and C. R. Woese. 1978. Are extreme halophiles actually bacteria? J. Mol. Evol. 11:1-8.

Mamula, M. J., M. Baer, J. Craft, and S. Altman. 1989. An immunological determinant of RNase P protein is conserved between Escherichia coli and humans. Proc. Natl. Acad. Sci. USA 86: 8717-8721.

Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Mankin, A. S., and V. K. Kagramanova. 1986. Complete nucleotide sequence of the single ribosomal RNA operon of Halobacterium halobium: secondary structure of the archaebacterial 23S rRNA. Mol. Gen. Genet. 202: 152-161.

Martin, A., S. Yeats, D. Janekovic, W. Reiter, W. Aicher, and W. Zillig. 1984. SAV 1, a temperate U.V.-inducible DNA virus-like particle from the archaebacterium Sulfolobus acidocaldarius isolate B12. EMBO J. 3: 2165-2168.

Matheson, A. T. 1985. Ribosomes of archaebacterium. In The bacteria (C. R. Woese and R. S. Wolfe, eds.), vol. 8, pp 345-377. Academic Press, London.

Mattoccia, E., I. M. Baldi, D. Gandini-Attardi, S. Ciafre, and G. P. Tocchini-Valentini. 1988. Site selection by the tRNA splicing endonuclease of Xenopus laevis. Cell 55: 731-738.

McClain, W. H., C. Guerrier-Takada, and S. Altman. 1987. Model substrates for an RNA enzyme. Science 238: 527-530.

McCIoskey, J. A. 1986. Nucleoside modification in archaebacterial transfer RNA. Syst. Appl. Microbiol. 7: 246-252.

McClure, W. R. 1985. Mechanism and control of transcription in prokaryotes. Ann. Rev. Biochem. 54: 171-204.

Meile, L., J. Madon, and T. Leisinger. 1987. Identification of a transcript and its promoter region on the archaebacterial plasmid pME2001. J. Bacteriol. 170: 478-481.

Meile, L., and J. N. Reeve. 1985. Potential shuttle vectors based on the methanogen plasmid pME2001. Biotechnology 3:69-72.

Meile, L., R. Stettler, R. Banholzer, M. Kotik, and T. Leisinger. 1991. Tryptophan gene cluster of Methanobacterium thermoautotrophicum Marburg: molecular cloning and nucleotide sequence of a putative trpEGCFBAD operon. J. Bacteriol. 173: 5017-5023. 253 Melton, D. A., E. M. DeRobertis, and R. Cortese. 1980. Order and intracellular location of the events involved in the maturation of a spliced tRNA. Nature 284: 143-148.

Mescher, M. F., and J. L. Strominger. 1975. Bacitracin induces sphere formation in Halobacterium species which lack a wall peptidoglycan. J. Gen. Microbiol. 89: 375-378.

Mevarech, M., S. Hirsch-Twizer, S. Goldman, E. Yakobson, H. Eisenberg, and P. P. Dennis. 1989. Isolation and characterization of the rRNA gene clusters of Halobacterium marismortui. J. Bacteriol. 171: 3479-3485.

Mevarech, M., and R. Werczberger. 1985. Genetic transfer in Halobacterium volcanii. J. Bacteriol. 162: 461-462.

Micheletti, P. A., K. A. Sment, and J. Konisky. 1991. Isolation of a coenzyme M auxotrophic mutant and transformation by electroporation in Methanococcus voltae. J. Bacteriol. 173: 3414-3418.

Miller, D. L., K. Underbrink-Lyon, D. R. Najarian, J. Krupp. and N. C. Martin. 1983. Transcription of yeast mitochondrial tRNA genes and processing of tRNA transcripts, p. 151-164. In Mitochondria (R. J. Schweyen, K. Wolf, and F. Kaudewitz, eds.). W. de Gruyter and Co., Berlin.

Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Miller, T. L., and M. J. Wolin. 1985. Methanosphaera stadtmaniae gen. nov., sp. nov.: a species that forms methane by reducing methanol with hydrogen. Arch Microbiol. 141: 116-122.

Mohr, V., and H. Larsen. 1963. On the structural transformation and lysis of Halobacterium salinarium in hypotonic and isotonic solutions. J. Gen. Microbiol. 31: 267-280.

Monaco, A. P., R. L. Neve, C. Colletti-Freener, C. J. Bertelson, D. M. Kurnit, and L. M. Kunkel. 1986. Isolation af candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature 323: 646-650.

Moore, R. L., and B. J. McCarthy. 1969a. Base sequence homology and renaturation studies of the deoxyribonucleic acid of extremely halophilic bacteria. J. Bacteriol. 99: 255-262.

Moore, R. L., and B. J. McCarthy. 1969b. Characterization of the deoxyribonucleic acid of various strains of halophilic bacteria. J. Bacteriol. 99: 248-254.

Morales, M. J., C. A. Wise, M. J. Hollingsworth, and N. C. Martin. 1989. Characterization of yeast mitochondrial RNase P: an intact RNA subunit is not essential for activity in vitro. Nucleic Acids Res. 17: 6865-6881. 254 Moritz, A., and W. Goebel. 1985. Characterization of the 7S RNA and its gene from halobacteria. Nucleic Acids Res. 13: 6969-6979.

Motamedi, H., Y. Lee, and F. J. Schmidt. 1984. Tandem promoters preceding the gene for the M l RNA component of Escherichia coli ribonuclease P. Proc. Natl. Acad. Sci. USA 81: 3959-3963.

Muscarella, D. E., and V. M. Vogt. 1989. A mobile group I intron in the nuclear rDNA of Phvsarum polvcephalum. Cell 56: 443-454.

Nagle, D. P., Jr., R. Teal, and A. Eisenbraun. 1987. 5-fluorouracil-resistant strain of Methanobacterium thermoautotrophicum. J. Bacteriol. 169:4119-4123.

Neuhaus, H., and G. Link. 1987. The chloroplast tRNALysuuu gene fr°m mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide. Curr. Genet. 11: 251-257.

Ng, W.-L., S. Kothakota, and S. DasSarma. 1991. Structure of the gas vesicle plasmid in Halobacterium halobium: inversion isomers, inverted repeats, and insertion sequences. J. Bacteriol. 173: 1958-1964.

Nichols, M., D. Soli, and I. Willis. 1988. Yeast RNase P: catalytic activity and substrate binding are separate functions. Proc. Natl. Acad. Sci. USA 85: 1379-1383.

Nieuwlandt, D. T., and C. J. Daniels. 1990. An expression vector for the archaebacterium Haloferax volcanii. J. Bacteriol. 172:7104-7110.

Nieuwlandt, D. T., E. S. Haas, and C. J. Daniels. 1991. The RNA component of RNase P from the archaebacterium Haloferax volcanii. J. Biol. Chem. 266: 5689-5695.

Nishikura, K., and E. M. DeRobertis. 1981. RNA processing in microinjected Xenopus oocytes. J. Mol. Biol. 145: 405-420.

Nishikura, K., J. Kurjan, B. D. Hall, and E. M. DeRobertis. 1982. Genetic analysis of the processing of a spliced tRNA. EMBO J. 1: 263-268.

Noller, H. F., and C. R. Woese. 1981. Secondary structure of 16S ribosomal RNA. Science 212: 403-410.

Nuber, E., E. Hartmann, H. Allmeier, H. Konig, G. Paul, and K. O. Stetter. 1988. A glycoprotein surface layer covers the pseudomurein sacculus of the extreme thermophile Methanothermus fervidus. In Crystalline bacterial cell surface layers (U. B. Sleytr, P. Messner, D. Pum, and M. Sara, eds.), pp21-25. Springer-Verlag, Berlin.

Ogasawara, N., S. Moriya, K. von Meyenburg, F. G. Hansen, and H. Yoshikawa. 1985. Conservation of genes and their organization in the chromosomal replication origin region of Bacillus subtilis and Escherichia coli. EMBO J. 4: 3345- 3350. 255 Ogden, R. C., G. Knapp, C. L. Peebles, J. Johnson, and J. Abelson. 1981. The mechanism of tRNA splicing. Trends Biochem. Sci. 42: 154-168.

Ogden, R. C., M. C. Lee, and G. Knapp. 1984. Transfer RNA splicing in Saccharomvces cerevisiae: defining the substrates. Nucleic Acids Res. 12: 9367-9382.

Ostergaard, L., N. Larsen, H. Leffers, J. Kjems, and R. A. Garrett. 1987. A ribosomal RNA operon and its flanking region from the archaebacterium Methanobacterium thermoautotrophicum. Marburg strain: transcription signals, RNA structure, and evolutionary implications. Syst. Appl. Microbiol. 9: 199-209.

Pace, N. R., and D. Smith. 1990. Ribonuclease P: function and variation. J. Biol. Chem. 265: 3587-3590.

Pace, N. R., C. Reich, B. D. James, G. J. Olsen, B. Pace, and D. S. Waugh. 1987. Structure and catalytic function in ribonuclease P. Cold Spring Harbor Symp. Quant. Biol. 52: 239-248.

Pace, N. R., D. K. Smith, G. J. Olsen, and B. D. James. 1989. Phylogenetic comparative analysis and the secondary structure of ribonuclease P RNA- a review. Gene 82: 65-75.

Palmer, J. D. 1983. Chloroplast DNA exists in two orientations. Nature 301: 92-93.

Patterson, N. H., and C. Pauling. 1985. Evidence for two restriction- modification systems in Halobacterium cutirubrum. J. Bacteriol. 163: 783-784.

Peebles, C. L., P. Gegenheimer, and J. Abelson. 1983. Precise excision of intervening sequences by a membrane associated yeast endonuclease. Cell 32: 525-536.

Peebles, C. L., R. C. Ogden, G. Knapp, and J. Abelson. 1979. Splicing of yeast tRNA precursors: a two-stage reaction. Cell 18: 27-35.

Perlman, P. S., C. L. Peebles, and C. Daniels. 1990. Different types of introns and splicing mechanisms. In Intervening sequences in evolution and development (E. M. Stone and R. J. Schwartz, eds.), pp 112-161. Oxford University Press, New York.

Pfeifer, F. 1986. Insertion elements and genome organization of Halobacterium halobium. System. Appl. Microbiol. 7: 36-40.

Pfeifer, F., and U. Blaseio. 1989. Insertion elements and deletion formation in a halophilic archaebacterium. J. Bacteriol. 171:5135-5140.

Pfeifer, F., and M . Betlach. 1985. Genome organization in Halobacterium halobium: a 70 kb island of more (AT) rich DNA in the chromosome. Mol. Gen. Genet. 198: 449-455.

Pfeifer, F., G. Weidinger, and W. Goebel. 1981. Characterization of plasmids in halobacteria. J. Bacteriol. 145: 369-374. 256 Phizicky, E. M., R. C. Schwartz, and J. Abelson. 1986. S. cerevisiae tRNA ligase: purification of the protein and isolation of the structural gene. J. Biol. Chem. 261: 2978-2986.

Plasterk, R. H. A., and P. van de Putte. 1984. Genetic switches by DNA inversions in prokaryotes. Biochim. Biophys. Acta 782: 111-119.

Pleij, C. W. A. 1990. Pseudoknots: a new motif in the RNA game. Trends Biochem. Science 15: 143-147.

Possot, O., P. Gernhardt, A. Klein, and L. Sibold. 1988. Analysis of drug resistance in the archaebacterium Methanococcus voltae with respect to potential use in genetic engineering. Appl. Environ. Microbiol. 54: 734-740.

Puhler, G., H. Leffers, F. Gropp, P. Palm, H.-P. Klenk, F. Lottspeich, R. A. Garrett, and W. Zillig. 1989. Archaebacterial DNA-dependent RNA polymerases testify to the evolution of the eukaryotic nuclear genome. Proc. Natl. Acad. Sci. USA 86: 4569-4573.

Ramirez, C., L. C. Shimmin, C. H. Newton, A. T. Matheson, and P. P. Dennis. 1989. Structure and evolution of the LI 1, LI, L10, and L12 equivalent proteins in eubacteria, archaebacteria, and eucaryotes. Can. J. Microbiol. 35: 234-244.

Raymond, G. J., and J. D. Johnson. 1983. The role of non-coding DNA sequences in transcription and processing of a yeast tRNA. Nucleic Acids Res. 11: 5969-5988.

Ree, H. K., and R. A. Zimmermann. 1990. Organization and expression of the 16S, 23S, and 5S ribosomal RNA genes from the archaebacterium Thermoplasma acidophilum. Nucleic Acids Res. 18:4471-4478.

Reed, R. E., M . F. Baer, C. Guerrier-Takada, and S. Altman. 1982. Nucleotide sequence of the gene encoding the RNA subunit (Ml RNA) of ribonuclease P from Escherichia coli. Cell 30: 627-636.

Reich, C., K. J. Gardiner, G. J. Olsen, B. Pace, T. L. Marsh, and N. R. Pace. 1986. The RNA component of the Bacillus subtilis RNase P: sequence, activity, and partial secondary structure. J. Biol. Chem. 261: 7888-7893.

Reich, C. I., G. J. Olsen, B. Pace, and N. R. Pace. 1988. The role of the protein moiety of ribonuclease P, a ribonucleoprotein enzyme. Science 239: 178-181.

Reilly, R. M., and U. L. RajBhandary. 1986. A single mutation in loop IV of Escherichia coli SuIII tRNA blocks processing at both 5'- and 3'-ends of the precursor tRNA. J. Biol. Chem. 261: 2928-2935.

Reiter, W.-D., U. Hudepohl, and W. Zillig. 1990. Mutational analysis of an archaebacterial promoter: essential role of a TATA box for transcription efficiency and start site selection in vitro. Proc. Natl. Acad. Sci. USA 87: 9509-9513. 257 Reyes, V. M., and J. Abelson. 1988. Substrate recognition and splice site determination in yeast tRNA splicing. Cell 55: 719-730.

Robertson, H. D., S. Altman, and J. D. Smith. 1972. Purification and properties of a specific Escherichia coli ribonuclease which cleaves a tyrosine transfer ribonucleic acid precursor. J. Biol. Chem. 247: 5243-5251.

Rosenshine, I., and M. Mevarech. 1989. Isolation and characterization of plasmids found in three Halobacterium volcanii isolates. Can J. Microbiol. 35: 92-95.

Rosenshine, I., R. Tchelet, and M. Mevarech. 1989. The mechanism of DNA transfer in the mating system of an archaebacterium. Science 245: 1387-1389.

Sandman, K., J. A. Krzycki, B. Dobrinski, R. Lurz, and J. N. Reeve. 1990. DNA binding protein HMf, isolated from the hyperthermophilic archaea Methanothermus fervidus. is most closely related to histones. Proc. Natl. Acad. Sci. USA 87: 5788-5791.

Sapienza, C., M. R. Rose, and W. F. Doolittle. 1982. High-frequency genomic rearrangements involving archaebacterial repeat sequence elements. Nature 299: 182-185.

Schnabel, H. 1984. An immune strain of Halobacterium halobium carries the invertible L segment of phage <|>H as a plasmid. Proc. Natl. Acad. Sci. USA 81: 1017-1020.

Schnabel, H., P. Palm, K. Dick, and B. Grampp. 1984. Sequence analysis of the insertion element ISH1.8 and of associated structural changes in the genome of phage

Schnabel, H., and W. Zillig. 1984. Circular structure of the genome of phage <|)H in a lysogenic Halobacterium halobium. Mol. Gen. Genet. 193: 422-426.

Schnabel, H., W. Zillig, M. Pfaffle, R. Schnabel, H. Michel, and H. Delius. 1982. Halobacterium halobium phase (j)H. EMBOJ. 1: 87-92.

Schwartz, R. C., C. L. Greer, P. Gegenheimer, and J. Abelson. 1983. Enzymatic mechanism of an RNA ligase from wheat germ. J. Biol. Chem. 258: 8374-8383.

Searcy, D. G. 1986. Some features of thermo-acidophilic archaebacteria preadaptive for the evolution of eukaryotic cells. System. Appl. Microbiol. 7: 198-201.

Searcy, D. G., and E. K. Doyle. 1975. Characterization of Thermoplasma acidophilum deoxyribonucleic acid. Int. J. Syst. Bacteriol. 25: 286-289.

Segerer, A., T. A. Langworthy, and K. O. Stetter. 1988. Thermoplasma acidophilum and Thermoplasma volcanium sp. nov. from solfatara fields. System. Appl. Microbiol. 10: 161-171. 258 Shapiro, M. B., and P. Senapathy. 1987. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 15: 7155-7174.

Shaw, J. A., W. B. Troutman, B. A. Lasker, M. M. Mason, and W. S. Riggsby. 1989. Characterization of the inverted duplication in the mitochondrial DNA of Candida albicans. J. Bacteriol. 171: 6353-6356.

Shimmin, L. C., and P. P. Dennis. 1989. Characterization of the LI 1, LI, LI0, and L12 equivalent ribosomal protein gene cluster of the halophilic archaebacterium Halobacteriumcutirubrum. EMBOJ. 8: 1225-1235.

Shimmin, L., C. H. Newton, C. Ramirez, J. Yee, W. L. Downing, A. Louie, A. T. Matheson, and P. P. Dennis. 1989. Organization of genes encoding the LI 1, LI, L10, and L12 equivalent ribosomal proteins in eubacteria, archaebacteria, and eucaryotes. Can. J. Microbiol. 35: 164-170.

Shine, J., and L. Dalgarno. 1974. The 3' terminal sequence of Escherichia coli 16S ribosomal RNA: complimentarity to nonsense triplets and ribosomal binding sites. Proc. Natl. Acad. Sci. USA 71: 1342-1346.

Shioda, M., K. Sugimori, T. Shiroya, and S. Takayanagi. 1989. Nucleosome-like structures associated with chromosomes of the archaebacterium Halobacterium salinarium. J. Bacteriol. 171:4514-4517.

Shiraishi, H., and Y. Shimura. 1986. Mutations affecting two distinct functions of the RNA component of RNase P. EMBO J. 5: 3673-3679.

Shu, H.-H., C. A. Wise, G. D. Clark-Walker, and N. C. Martin. 1991. A gene required for RNase P activity in Candida (Torulopsisl glabrata mitochondria codes for a 227-nucleotide RNA with homology to bacterial RNase P RNA. Mol. Cell. Biol. 11: 1661-1667.

Shuber, A. P., E. C. Orr, M. A. Recny, P. F. Schendel, H. D. May, N. L. Schaur, and J. G. Ferry. 1986. Cloning, expression, and nucleotide sequence of the formate dehydrogenase genes from Methanobacterium formicicum. J. Biol. Chem. 261: 12942-12947.

Sibold, L., and M. Henriquet. 1988. Cloning of the trj> genes from the archaebacterium Methanococcus voltae: nucleotide sequence of the trpBA genes. Mol. Gen. Genet. 214: 439-450.

Sioud, M., G. Baldacci, A. M. deRecondo, and P. Forterre. 1988. Novobiocin induces positive supercoiling of small plasmids from halophilic archaebacteria in vivo. Nucleic Acids Res. 16: 1379-1391.

Sivaram, P., and M. P. Deutscher. 1990. Existence of two forms of rat liver arginyl-tRNA synthetase suggests channeling of aminoacyl-tRNA for protein synthesis. Proc. Natl. Acad. Sci. USA 87: 3665-3669. 259 Sjoberg, B. M., S. Hahne, C. Z. Matthews, C. K. Matthews, K. N. Rand, and M. J. Gait. 1986. The bacteriophage T4 gene for the small subunit of ribonucleotide reductase contains an intron. EMBOJ. 5:2031-2036.

Smith, A., T. A. Langworthy, W. R. Mayberry, and A. E. Hougland. 1973. Characterization of the membranes of Thermoplasma acidophilum. J. Bacteriol. 116: 1019-1028.

Sollner-Webb, B. 1988. Surprises in polymerase III transcription. Cell 52: 153- 154.

Sprinzl, M. T. Hatmann, J. Weber, J. Blank, and R. Zeidler. 1989. Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 17(suppl.): rl-r67.

Sprinzl, M., J. Moll, F. Meissner, and T. Hartmann. 1985. Nucleic Acids Res. 13(suppl.): rl-r49.

Sprott, G. D., M. Meloche, and J. C. Richards. 1991. Proportions of diether, macrocyclic diether, and tetraether lipids in Methanococcus jannaschii grown at different temperatures. J. Bacteriol. 173: 3907-3910.

Stange, N., H. J. Gross, and H. Beier. 1988. Wheat germ splicing endonuclease is highly specific for plant pre-tRNAs. EMBO J. 7: 3823-3828.

Standring, D. N., A. Venegas, and W. J. Rutter. 1981. Yeast tRNALeu3 gene transcribed and spliced in a HeLa cell extract. Proc. Natl. Acad. Sci. USA 78: 5963- 5967.

Stanier, R. Y. 1970. Some aspects of the biology of cells and their possible evolutionary significance. In Organization and control in prokaryotic and eukaryotic cells (H. P. Charles and B. C. J. G. Knight, eds.), pp. 1-38. Cambridge University Press, Cambridge.

Stark, B., R. Kole, E. Bowman, and S. Altman. 1978. Ribonuclease P: an enzyme with an essential RNA component. Proc. Natl. Acad. Sci. USA 75: 3717-3721.

Stein, D. B., and D. G. Searcy. 1978. Physiologically important stabilization of DNA by a prokaryotic histone-like protein. Science 202:219-221.

Stenesh, J., B. A. Roe, and T. L. Snyder. 1968. Studies on the deoxyribonucleic acid from mesophilic and thermophilic bacteria. Biochim. Biophys. Acta 161:442-449.

Stetter, K. O., and W. Zillig. 1985. Thermoplasma and the thermophilic sulfur- dependent archaebacteria. In The bacteria (C. R. Woese and R. S. Wolfe, eds.), vol. 8, pp. 85-170. Academic Press, London.

Stoeckenius, W. 1985. The rhodopsin-like pigments of halobacteria: light energy and signal transducers in an archaebacterium. Trends Biochem. 10: 483-486. 260 Stoeckenius, W. and R. Rowen. 1967. A morphological study of Halobacterium halobium and its lysis in media of low salt concentration. J. Cell Biol. 34: 365-393.

Strobel, M. C., and J. Abelson. 1986a. Effect of intron mutations on the processing and function of Saccharomvces cerevisiae SUP53 tRNA in vitro and in vivo. Mol. Cell. Biol. 6: 2663-2673.

Strobel, M. C., and J. Abelson. 1986b. Intron mutations affect splicing of Saccharomvces cerevisiae SUP53 precursor tRNA. Mol. Cell. Biol. 6: 2674-2683.

Struck, J. C. R., H. Y. Toschka, T. Specht, and V. A. Erdmann. 1988. Common structural features between eukaryotic 7SL RNAs, eubacterial 4.5S RNA and scRNA, and archaebacterial 7S RNA. Nucleic Acids Res. 16: 7740.

Sugino, A., N. P. H. Higgins, P. O. Brown, C. L. Peebles, and N. R. Cozzarelli. 1978. Energy coupling in DNA gyrase and the mechanism of action of novobiocin. Proc. Natl. Acad. Sci. USA 75: 4838-4842.

Sumper, M., and G. Herrmann. 1978. Studies on the biosynthesis of bacterio- opsin: demonstration of the existence of protein species structurally related to bacterio- opsin. Eur. J. Biochem. 89: 229-235.

Swerdlow, H., and C. Guthrie. 1984. Structure of intron containing transfer RNA precursors: analysis of solution conformation using chemical and enzymatic probes. J. Biol. Chem. 259: 5197-5207.

Szekely, E., H. G. Belford, and C. L. Greer. 1988. Intron sequence and structure requirements for tRNA splicing in Saccharomvces cerevisiae. J. Biol. Chem. 263: 13839-13847.

Teem, J. L., N. Abovich, N. F. Kaufer, W. F. Schwindinger, J. R. W arner, et al. 1984. A comparison of yeast ribosomal protein gene DNA sequences. Nucleic Acids Res. 12: 8295-8312.

Thomm, M., B. A. Sherf, and J. N. Reeve. 1988. RNA polymerase and transcription initiation sites upstream of the methyl reductase operon of Methanococcus vannielii. J. Bacteriol. 170: 1958-1961.

Thomm, M., G. Wich, J. W. Brown, G. Frey, B. A. Sherf, and G. S. Beckler. 1989. An archaebacterial promoter sequence assigned by RNA polymerase binding experiments. Can. J. Microbiol. 35: 30-35.

Thompson, L. D. 1990. Substrate recognition properties of the tRNATrP intron endonuclease from the archaebacterium Halobacterium volcanii. 231 pages. Ph.D. thesis, Ohio State University, Columbus, Ohio.

Thompson, L. D., L. D. Brandon, D. T. Nieuwlandt, and C. J. Daniels. 1989. Transfer RNA intron processing in the halophilic archaebacteria. CanJ. Microbiol. 35: 36-42. 261 Thompson, L. D., and C. J. Daniels. 1988. A tRNATrP intron endonuclease from Halobacterium volcanii. J. Biol. Chem. 263: 17951-17959.

Thompson, L. D., and C. J. Daiels. 1990. Recognition of exon-intron boundaries bv the Halobacterium volcanii tRNA intron endonuclease. J. Biol. Chem. 265:18104- 18111.

Thurlow, D. L., D. Shilowski, and T. L. Marsh. 1991. Nucleotides in precursor tRNAs that are required intact for catalysis by RNase P RNAs. Nucleic Acids Res. 19: 885-891.

Tindall, B. J., H. N. M. Ross, and W. D. Grant. 1984. Natronobacterium gen. nov. and Natronococcus gen. nov., genera of haloalkalophilic archaebacteria. Syst. Appl. Microbiol. 5: 41-57.

Torreblanca, M., F. Rodriguez-Valera, G. Juez, A. Ventosa, M. Kamekura, and M. Kates. 1986. Classification of non-alkaliphilic halobacteria based on numerical taxonomy and polar lipid composistion, and description of Haloarcula gen. nov. and Haloferax gen. nov. Syst. Appl. Microbiol. 8: 89-99.

Travers, A. A. 1980. Promoter sequence for the stringent control of bacterial ribonucleic acid synthesis. J. Bacteriol. 141: 973-975.

Travers, A. A. 1987. Structure and function of E. coli promoter DNA. Crit. Rev. Biochem. 22: 181-219.

Uchida, T., L. Bonen, H. W. Schaup, B. J. Lewis, L. Zablen, and C. R. Woese. 1974. The use of ribonuclease U 2 in RNA sequence determination. J. Mol. Evol. 3: 63-77.

Uhlenbeck, O. C., and R. 1. Gumport. 1982. T4 RNA ligase. In The enzymes (P. D. Boyer, ed.), vol. 15B, pp. 31-60. Academic Press, New York. van Tol, H., N. Strange., H. J. Gross, and H. A. Beier. 1987. Human and a plant intron-containing tRNAT>T gene are both transcribed in a HeLa cell extract but spliced along different pathways. EMBOJ. 6:35-41.

Vioque, A., J. Arnez, and S. Altman. 1988. Protein-RNA interactions in the RNase P holoenzyme from Escherichia coli. J. Mol. Biol. 202: 835-848.

Visentin, L. P., C. Chow, A. T. Matheson, M. Yaguchi, and F. Rollin. 1972. Halobacterium cutirubrum ribosomes. Properties of the ribosomal proteins and ribonucleic acid. Biochem. J. 130: 103-110.

Vogelsang-Wenke, H., and D. Oesterhelt. 1988. Isolation of a halobacterial phage with a fully cytosine-methylated genome. Mol. Gen. Genet. 211: 407-414.

Walter, P., and G. Blobel. 1983. Disassembly and reconstitution of signal recognition particle. Cell 34: 525-533. 262 Wang, M. J., N. W. Davis, and P. gegenheimer. 1988. Novel mechanisms for maturation of chloroplast transfer RNA precursors. EMBOJ. 7: 1567-1574.

Wasylyk, B. 1988. Transcription elements and factors of RNA polymerase B promoters of higher eukaryotes. CRC Crit. Rev. Biochem. 23: 77-120.

Waugh, D. S. 1989. Mutational analysis of catalytic function in ribonuclease P RNA. Ph.D. thesis, Indiana University, Bloomington, Indiana.

Waugh, D. S., C. J. Green, and N. R. Pace. 1989. The design and catalytic properties of a simplified ribonuclease P RNA. Science 244: 1569-1571.

Weidinger, G ., G. Klotz, and W. Goebel. 1979. A large plasmid from Halobacterium halobium carrying genetic information for gas vacuole formation. Plasmid 2: 377-386.

Welch, G. R. 1977. On the role of organized multienzyme complexes in cellular metabolism: a general synthesis. Prog. Biophys. Mol. Biol. 32: 103-191.

Whitman, W. B. 1985. Methanogenic bacteria. In The bacteria (C. R. Woese and R. F. Wolfe, eds.), vol. 8, pp. 3-84. Academic Press, London.

Wich, G., H. Hummel, M. Jarsch, U. Bar, and A. Bock. 1986c. Transcription signals for stable RNA genes in Methanococcus. Nucleic Acids Res. 14: 2459-2465.

Wich, G., G. Jarsch, and A. Boch. 1984. Apparent operon for a 5S ribosomal RNA gene and for tRNA genes in the archaebacterium Methanococcus vanielii. Mol. Gen. Genet. 196: 146-151.

Wich, G., W. Leinfelder, and A. Bock. 1987. Genes for stable RNA in the extreme thermophile Thermoproteus tenax: introns and transcription signals. EMBO J. 6: 523-528.

Wich, G., L. Sibold, and A. Bock. 1986a. Divergent evolution of 5S rRNA genes in Methanococcus. Z. Naturforsch. 2: 373-380.

Wich, G., L. Sibold, and A. Bock. 1986b. Genes for tRNA and their putative expression signals in methanogens. Syst. Appl. Microbiol. 7: 18-25.

Willis, I., D. Frendewey, M. Nichols, A. Hottinger-Werlen, J. Schaack, and D. Soil. 1986. A single base change in the intron of a serine tRNA affects the rate of RNase P cleavage in vitro and suppressor activity in vivo in Saccharomvces cerevisiae. J. Biol. Chem. 261: 5878-5885.

Willis, I., H. Hottinger, D. Pearson, V. Chisholm, U. Leupold, and D. Soil. 1984. Mutations affecting excision of the intron from a eukaryotic dimeric tRNA precursor. EMBOJ. 3: 1573-1580. 263 Winey, ML, I. Edelman, and M. R. Culbertson. 1989. A synthetic intron in a naturally intronless yeast pre-tRNA is spliced efficiently in vivo. Mol. Cell. Biol. 9: 329-331.

Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51: 221-271.

Woese, C. R. 1991. The use of ribosomal RNA in reconstructing evolutionary relationships among bacteria. In Evolution at the molecular level (R. K. Selander, A. G. Clark, and T. S. Whittam, eds.), pp. 1-24. Sinauer Associates, Inc., Sunderland, MA.

Woese, C. R., and G. E. Fox. 1977. Phylogenetic structure of the prokaryotic domains: the primary kingdoms. Proc. Natl. Acad. Sci. USA 74: 5088-5090.

Woese, C. R., O. Kandler, and M. L. Wheelis. 1990. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. USA 87: 4576-4579.

Woese, C. R., and G. J. Olsen. 1986. Archaebacterial phylogeny: perspectives on the urkingdoms. Syst. Appl. Microbiol. 7: 161-177.

Woese, C., M. Sogin, D. Stahl, B. J. Lewis, and L. Bonen. 1976. A comparison of the 16S rRNAs from mesophilic and thermophilic bacilli: some modifications in the Sanger method for RNA sequencing. J. Mol. Evol. 7: 197-213.

Wood, A. G., W. B. Whitman, and J. Konisky. 1985. A newly-isolated marine methanogen harbors a small cryptic plasmid. Arch. Microbiol. 142: 259-261.

Worrell, V. E., D. P. Nagle, Jr., D. McCarthy, and A. E. Eisenbraun. 1988. Genetic transformation system in the archaebacterium Methanobacterium thermoautotrophicum Marburg. J. Bacteriol. 170: 653-656.

Xu, M.-Q., S. D. Kathe, H. Goodrich-Blair, S. A. Nierzwicki-Bauer, and D. A. Shub. 1990. Bacterial origin of a chloroplast intron: conserved self-splicing group I introns in cyanobacteria. Science 250: 1570-1573.

Yamagishi, A., and T. Oshima. 1990. Circular chromosomal DNA in the sulfur- dependent archaebacterium Suhfoiobus aeidocaWarius. Nucleic Acids Res. 18:1133- 1136.

Yamaguchi-Shinozaki, K., K. Shinozaki, and M. Sugiura. 1987. Processing of precursor tRNAs in chloroplast lysate. FEBS Lett. 215: 132-136.

Zillig, W., F. Gropp, A. Henschen, H. Neumann, P. Palm, W.-D. Reiter, M. Rettenberger, H. Schnabel, and S. Yeats. 1986. Archaebacterial virus host systems. Syst. Appl. Microbiol. 7: 58-66.

Zillig, W., I. Holz, D. Janekovic, H. P. Klenk, E. Imsel, J. Trent, S. Wunderl, V. H. Forjaz, R. Coutinho, and T. Ferreira. 1990. Hvperthermus butylicus, a hyperthermophilic sulfur-reducing archaebacterium that ferments peptides. J. Bacteriol. 172: 3959-3965. 264 Zillig, W., H. P. Klenk, P. Palm, G. Puhler, F. Gropp, R. A. Garrett, and H. Letters. 1989. The phylogenetic relations of DNA-dependent RNA polymerases of archaebacteria, eukaryotes, and eubacteria. Can. J. Microbiol. 35: 73-80.

Zillig, W., S. Yeats, I. Holz, A. Bock, F. Gropp, M. Rettenberger, and S. Lutz. 1985. Plasmid-related anaerobic autotrophy of the novel archaebacteriun Sulfolobus ambivalens. Nature 313: 789-791.

Zhao, H., A. G. Wood, F. Widdel, and M. P. Brandt. 1988. An extremely thermophilic Methanococcus from a deep sea hydrothermal vent and its plasmids. Arch. Microbiol. 150: 178-183.

Zuckerkandl, E., and L. Pauling. 1965. Molecules as documents of evolutionary history. J. Theor. Biol. 8: 357-366.