Hermansky-Pudlak Syndrome with a Novel Mutation

□ CASE REPORT □

Jun IWAKAWA, Wataru MATSUYAMA,Masaki WATANABE, Masuki YAMAMOTO, Ken-ichi OONAKAHARA,Kentarou MACHIDA, Ikkou HIGASHIMOTO, Takahito NIIYAMA, Mitsuhiro OSAME and Kimiyoshi ARIMURA

Abstract Research. Written informed consent was obtained from the present case investigated in this study. We report a case of Hermansky-Pudlak syndrome A 46-year-old woman was admitted to our hospital be- (HPS) with a novel mutation in the HPS1 gene. This case cause of dry cough and dyspnea on effort. She showed con- showed oculocutaneous albinism and lysosomal ceroid genital albinism. The patient’s family history revealed that accumulation, however platelet dysfunction was not ob- her parents were cousins, and her sibling also had congenital served. Histopathological findings of the biopsied lung albinism. She had a history of recurrent bacterial infection in tissue were compatible with HPS. Sequencing analysis her lungs during childhood. Twenty-two months prior to ad- showed the insertion of C in the codon 178 (739 bp) of the mission, she developed a non-productive cough and 6 HPS1 gene forming a stop codon at codon 181. To the months prior to admission, she developed dyspnea on effort. best of our knowledge, this is a novel HPS1 gene muta- Physical examination on admission revealed brown hair, tion. brown eyebrows, pale white skin, and ecchymosis on the (Internal Medicine 44: 733–738, 2005) upper and lower extremities (Fig. 1). Auscultation of her lungs revealed fine crackles in the lower regions bilaterally. Key words: HPS1, mutation, codon178, exon20 The results of the laboratory studies on admission are shown in Table 1. White blood cell and platelet counts were ele- vated. Bleeding time was slightly extended however, platelet aggregation was normal. Blood chemistry showed elevation Introduction of LDH, KL-6, and SP-D. Arterial blood gas analysis indi- cated hypoxemia, and pulmonary function test disclosed re- Hermansky-Pudlak syndrome (HPS) is a relatively rare strictive pattern and reduced diffusion capacity. Chest autosomal recessive disorder; its manifestations include radiography revealed reticulonodular pattern in the upper and oculocutaneous albinism, platelet dysfunction and lysosomal lower right lobes and in all the left lobes and chest computed ceroid accumulation (1). After the discovery of the location tomography (CT) showed bilateral diffuse scattered reticulo- of the HPS1 gene on band 10q23, the other five subtypes nodular pattern with slightly increased density (Fig. 2). [HPS2 (AP3B1), HPS3, HPS4, HPS5 and HPS6 (2–5)] have For histopathological diagnosis, lung biopsy under video- been reported. The incidence of HPS is frequent in Puerto assisted thoracic surgery (VATS) was performed. The Rico, however it is relatively rare in non-Puerto Rican coun- biopsied specimen showed thickening of the alveolar septal tries (6). Patients with the HPS1 gene disorder frequently wall along with fibrosis and infiltration of lymphocytes. present with pulmonary fibrosis (7). Here, we report a case Alveolar macrophages revealed ceroid substance that was of HPS who presented with interstitial pneumonia and had a positive for periodic acid Schiff (PAS) staining (Fig. 3). On novel HPS1 gene mutation. electronmicroscopy, not only alveolar macrophages but also alveolar epithelial cells were observed to contain ceroids in Case Report their cytoplasm (Fig. 3E, F).

This study was reviewed and approved by the Kagoshima Genetic studies University Faculty of Medicine Committee on Human The sequence of genomic DNA and cDNA of the HPS1

From the Division of Respiratory Medicine, Respiratory and Stress Care Center, Kagoshima University Hospital, Kagoshima Received for publication November 24, 2004; Accepted for publication March 4, 2005 Reprint requests should be addressed to Dr. Wataru Matsuyama, Division of Respiratory Medicine, Respiratory and Stress Care Center, Kagoshima University Hospital, 8-35-1 Sakuragaoka, Kagoshima 890-8520

Internal Medicine Vol. 44, No. 7 (July 2005) 733 IWAKAWA et al

of C was detected in the codon 178 (739 bp) forming a stop codon at codon 181. Further, the insertion of C was detected at the same site on one side of the base pair in the sample of patient’s mother (Fig. 4). Considering the histopathological findings and genetic findings together, Hermansky-Pudlak syndrome with a novel HPS1 gene frame shift was diag- nosed.

Discussion

Here, we report a HPS case with a novel mutation that causes a frameshift in the HPS1 gene. HPS is an autosomal recessive disorder characterized by oculocutaneous albinism, atendency to bleed, and a ceroid-lipofuscin lysosomal storage disease (1). Life-threatening manifestations are frequent, and death typically results from restrictive lung disease (68%), hemorrhage (17%), or granulomatous colitis (15%), in patients aged 30–50 years (8). There is no specific therapy for HPS, and treatment is usually limited to supportive care. HPS is rare in most populations however, it is a frequent single-gene disorder found in Puerto Rico, where it occurs with an estimated frequency of 1/1,800 persons (8). HPS is also frequent in a long-isolated village in the Swiss Alps (9). The human HPS gene consists of 20 exons that span 30.5 kb (10), and it encodes a 700 amino acid polypeptide that con- tains two apparent transmembrane domains but that has no evident homology to any other known proteins (5). Codon 491–496 frameshift is common in the HPS cases found in Puerto Rico, and codon 322–324 frameshift is common in European HPS patients (6). In Japan, four mutation patterns have been reported (Table 3) (6, 11–13). All cases showed typical HPS symptoms that include albinism, bleeding diathesis and abnormal ceroid-lipofuscin lysosomal storage. One of them showed heterozygous HPS1 gene mutations with a typical HPS phenotype (11) and one case with 1bp duplication in codon 441 developed systemic lupus erythematosus and pulmonary fibrosis (12). The present case showed albinism, abnormal ceroid-lipofuscin lysosomal storage and pulmonary fibrosis however, the platelet function was almost normal. Thus, the present case has a novel mutation pattern and a unique phenotype. Figure 1. Clinical appearance of the present case. A. brown Pulmonary fibrosis is a typical clinical feature of HPS1 hair and albinism, B. pale white skin and ecchymosis. (1), and HPS1 gene mutations in general, rather than homozygosity for the 16-bp duplication in exon15 specifi- cally, constitute the risk factor for pulmonary fibrosis (7). gene on the 10q23.1–q23.3 band, which has been reported, Patients with HPS2 have mild pulmonary fibrosis and suffer were referred (#604982, BC000175). We developed a new from recurrent childhood infections due to neutropenia (14, 19 paired primer directed against sequences from exon2 to 15). The clinical features of HPS4 disease resemble those of exon20, which contained the open reading frame in the HPS1, and include granulomatous colitis and pulmonary fi- HPS1 gene (Table 2). The template of genomic DNA was brosis (2, 16). Pulmonary fibrosis is not seen in HPS3 (17), prepared from blood samples of the patient, her mother, and HPS5 (18) and HPS6 (19). Bleeding diathesis is a common a healthy control; it was then amplified by polymerase chain feature of HPS1 (1), HPS2 (14) and HPS6 (19). In HPS4 and reaction (PCR). The base pair sequence was identified by HPS5, platelet count is almost normal, however, platelet ag- Big Dye Terminator Ver 3.1 using amplified PCR (Perkin gregation is reduced, and bleeding time is moderately pro- Elmer Applied Biosystems Division, Foster City, CA). longed (18, 19). In HPS3, bleeding diathesis is very mild (4). As shown in Fig. 4, in the patient’s sample, the insertion Thus, the pulmonary fibrosis seen in the present case is

734 Internal Medicine Vol. 44, No. 7 (July 2005) HPS with a Novel Mutation

Table 1. Laboratory Findings on Admission

Blood analysis LDH 1,025 IU/l WBC 12,700 (×102/l) CRP 0.86 mg/dl Neu 72% KL-6 6,066 U/ml Lym 23% SP-D 260 ng/ml Eo 1% Blood gas analysis RBC 421 (×104/l) (room air) Ht 42.1% pH 7.406

Hb 13.9 g/dl PaO2 61.9 mmHg 4 Plt 35.3 (×10 /l) PaCO2 42.5 mmHg PT 99% Pulmonary function test APTT 30.2 s VC 1.51 l Fibrinogen 461 mg/dl %VC 57.6%

bleeding time: 10 min FEV1.0 1.33 l

platelet aggregation: normal FEV1.0% 85.8% AST 18 IU/l DLco 6.11 ml/min/mmHg ALT 14 IU/l %DLco 34.3%

Figure 2. A. The chest radiography showing reticulonodular pattern in the upper and lower right lobes and in all left lobes. B. Chest computed tomography (CT) scan demonstrating bilateral diffusely scattered reticulonodular pattern with inner zone pre- dominance and peripheral infiltrative shadows in both lungs.

compatible with the clinical features of HPS1 however, re- results from a defect in a protein required for the biogenesis, sults regarding platelets are similar with those of HPS3, structure, or function of these various membrane-bound or- HPS4 and HPS5. ganelles. Idiopathic pulmonary fibrosis-like interstitial pneu- At the cellular level, HPS is associated with defects of monia has been known to be the most serious complication multiple cytoplasmic organelles, including melanosomes, of HPS (7), and possible association of pulmonary inflamma- platelet-dense granules, and lysosomes (1, 5). It possibly tory cell dysfunction, including alveolar macrophage, with

Internal Medicine Vol. 44, No. 7 (July 2005) 735 IWAKAWA et al

Figure 3. A to D: Biopsied tissue specimens of the lung showing septal fibrotic thickening and infiltration of lymphocytes. The lesions were found with irregular patchy patterns within normal original structures (A. HE stain, B. staining for elastic tissue ×80 original manifestation). Tissue staining with periodic acid Schiff (PAS) (C. ×200, D. ×1,000 original magnification) showed phagocytes including ceroid substance that are PAS-positive (arrows). E and F: Electron microscopy (×9,000) showing liner granules in alveolar macrophages (E) and in alveolar epithelial cell (F).

736 Internal Medicine Vol. 44, No. 7 (July 2005) HPS with a Novel Mutation

Table 2. Primer List

1F ATGGAAGTCCCTTGTGATGC 10F CAATGGGTGGGTCCAACTTA 1R CAGGTTTTCCTGCCTCTCTG 10R ATGGAGAAGCCATCCATCAG 2F TCTGGCCCACTCTAAGCTGT 11F AGGAAAGCTACTGCCCCCTA 2R CATCAAGCTGAGGGAAGAGG 11R GGAAAACAAGGATCGTAGGC 3F AAGGCAGAAACGGCATCTA 12F AGAAGGACTTTGGCCTGGAC 3R AAAATGGCAGCTTCACAGG 12R ATCAGGCAATGGGAAGGAG 4F GGGAGACCAGCTTTCTTGTG 13F AGGTTGGTCTGTCCTGGGTA 5F GAAGGTTTCAGGCTTCATGG 13R ACCAGCAAGAAGTCCTTCCA 5R GGGACCTGGTGGGTCTTAGT 14F CCATCTACCGGCTGAACTTT 6F GTATTTGTGCCTTGCCCATC 14R CCTTCAGAGAGGTGGTGAGC 6R CACCATCTTCAGGCAGGTTT 15F CTGGGGAGCTTGGAGGTAGT 7F ATCGAATCCCTGGGAAGTCT 16F GAGGGTAGTCCATCCATCCA 7R ACTCCTCAGGGAGGGAGAAG 16R TACAGAGCGGGAACTGTGTG 8F GTGTGTGCTGTGCACTTCGT 17F AACAAGGTCCAGCATTTTC 8R AGACAGCGTCCTGTGCTCTA 17R GGAACACAGATGTACCCTCCA 9F TTAGGATGAAGGGGTGTTGC 18F CCAGGATGCCACTGTTAGGT 9R TCAGAGCCCCCAATACTCAC 18R GGTGGTCTAGGTGGGGTTTT

Figure 4. Sequence results of the present case, mother and healthy control (the panel shows antisense sequence results). The insertion of C (arrow) was found in the 739 bp forming a stop codon at codon 181 in the patient’s sample. The insertion of C was also detected at the same site on the one side of base pair in the sample of patient’s mother and showed heterogeneous pattern.

Table 3. Reported HPS Mutations in Japan the pathogenesis of interstitial pneumonia in HPS has been suggested (20, 21). However, its detailed molecular patho- Mutation Phenotye genesis remains unknown. According to a previous report, Codon441insA Typical HPS symptoms fibroblasts derived from a HPS1 gene-deficient patient did +PF+SLE like symptoms not change the expression pattern of lysosome-associated Codon322delC Typical HPS symptoms membrane protein (LAMP)-1 and LAMP-3 which are impor- Codon321insG Typical HPS symptoms tant for antigen presenting cell functions (22). Furthermore, and IVS5+5G→A in culture cells derived from patients with HPS2 gene muta- IVS5+5G→A Typical HPS symptoms tion, CD1b failed to efficiently gain access to lysosomes, re- Codon178insC* Albinism+abnormal ceroid-lipofuscin sulting in a profound defect in antigen presentation (23) lysosomal storage+PF while another human fibroblast with HPS2 mutation caused *: the present case. Typical HPS symptoms include albinism, bleed- complete deficiency of adaptor complex-3 protein and in- ing diathesis and abnormal ceroid-lipofuscin lysosomal storage. PF: creased protein trafficking through LAMP-3 with up- pulmonary fibrosis, SLE: systemic lupus erythematosus, IVS: inter- regulation of antigen-presenting capacity (14, 22). Thus, the vening sequence. HPS gene is likely to affect immunological mechanisms. The present case had a new pattern of HPS1 mutation and

Internal Medicine Vol. 44, No. 7 (July 2005) 737 IWAKAWA et al had a history of recurrent bacterial infection in the lungs. It a case of Hermansky-Pudlak syndrome with giant melanosomes. Br J is apparent that the proteins encoded by the HPS gene have Dermatol 143: 635–640, 2000. multiple effects on the immune system (14, 22, 24). Harmon 12) Mitsui H, Komine M, Watanabe T, Kikuchi K, Okoci H, Tamaki K. Does Hermansky-Pudlak syndrome predispose to systemic lupus et al reported that macrophage-derived peptides are impor- erythematosus? Br J Dermatol 146: 908–911, 2002. tant candidate molecules in the initiation of alveolar remod- 13) Suzuki T, Ito S, Inagaki K, et al. Investigation on the IVS5 +5G→A eling in fibrotic lung disorders (25). Our next aim is to splice site mutation of HPS1 gene found in Japanese patients with clarify the immunological aspects of the present case. Hermansky-Pudlak syndrome. J Dermatol Sci 36: 106–108, 2004. 14) Huizing M, Scher CD, Strovel E, et al. Nonsense mutations in ADTB3A cause complete deficiency of the beta3A subunit of adaptor Acknowledgements :Wewish special thanks to Mrs. Rumi Matsuyama complex-3 and severe Hermansky-Pudlak syndrome type 2. Pediatr Res (Third Department of Internal Medicine, Kagoshima University Faculty of 51:150–158, 2002. Medicine) for her excellent help. 15) Shotelersuk V, Dell’Angelica EC, Hartnell L, Bonifacino JS, Gahl WA. A new variant of Hermansky-Pudlak syndrome due to mutations in a References gene responsible for vesicle formation. Am J Med 108: 423–427, 2000. 16) Bachli EB, Brack T, Eppler E, et al. Hermansky-Pudlak syndrome type 1) Hermansky F, Pudlak P. Albinism associated with hemorrhagic diathe- 4inapatient from Sri Lanka with pulmonary fibrosis. Am J Med Genet sis and unusual pigmented reticular cells in the bone marrow: report of 127A: 201–207, 2004. two cases with histochemical studies. Blood 14: 162–169, 1959. 17) Huizing M, Anikster Y, Fitzpatrick DL, et al. Hermansky-Pudlak syn- 2) Anderson PD, Huizing M, Claassen DA, White J, Gahl WA. drome type 3 in Ashkenazi Jews and other non-Puerto Rican patients Hermansky-Pudlak syndrome type 4 (HPS-4): clinical and molecular with hypopigmentation and platelet storage-pool deficiency. Am J Hum characteristics. Hum Genet 113: 10–17, 2003. Genet 69: 1022–1032, 2001. 3) Anikster Y, Huizing M, White J, et al. Mutation of a new gene causes 18) Huizing M, Hess R, Dorward H. et al. Cellular, molecular and clinical a unique form of Hermansky-Pudlak syndrome in a genetic isolate of characterization of patients with Hermansky-Pudlak syndrome type 5. 28 central Puerto Rico. Nat Genet : 376–380, 2001. Traffic 5: 711–722, 2004. 4) Huizing M, Anikster Y, Fitzpatrick DL, et al. Hermansky-Pudlak syn- 19) Zhang Q, Zhao B, Li W, et al. Ru2 and Ru encode mouse orthologs of drome type 3 in Ashkenazi Jews and other non-Puerto Rican patients the genes mutated in human Hermansky-Pudlak syndrome types 5 and with hypopigmentation and platelet storage-pool deficiency. Am J Hum 6. Nat Genet 33: 145–153, 2003. 69 Genet : 1022–1032, 2001. 20) Yoshioka Y, Kumasaka T, Ishidoh K, et al. Inflammatory response and 5) Oh J, Bailin T, Fukai K, et al. Positional cloning of a gene for cathepsins in silica-exposed Hermansky-Pudlak syndrome model pale Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles. ear mice. Pathol Int 54: 322–331, 2004. 14 Nat Genet : 300–306, 1996. 21) Nakatani Y, Nakamura N, Sano J, et al. Interstitial pneumonia in 6) Oh J, Ho L, Ala-Mello S, et al. Mutation analysis of patients with Hermansky-Pudlak syndrome: significance of florid foamy swelling/ Hermansky-Pudlak syndrome: a frameshift hot spot in the HPS gene degeneration (giant lamellar body degeneration) of type-2 and apparent locus heterogeneity. Am J Hum Genet 62: 593–598, 1998. pneumocytes. Virchows Arch 437: 304–313, 2000. 7) Brantly M, Avila NA, Shotelersuk V, Lucero C, Huizuig M, Gahl WA. 22) Dell’Angelica EC, Aguilar RC, Wolins N, Hazelwood S, Gahl WA, Pulmonary function and high-resolution CT findings in patients with an Bonifacino JS. Molecular characterization of the protein encoded by inherited form of pulmonary fibrosis, Hermansky-Pudlak syndrome, the Hermansky-Pudlak syndrome type 1 gene. J Biol Chem 275: 1300– due to mutations in HPS-1. Chest 117: 129–136, 2000. 1306, 2000. 8) Witkop CJ, Nunez Babcock M, Rao GH, et al. Albinism and 23) Sugita M, Cao X, Watts GF, Rogers RA, Bonifacino JS, Brenner MB. 82 Hermansky-Pudlak syndrome in Puerto Rico. Bol Asoc Med P R : Failure of trafficking and antigen presentation by CD1 in AP-3- 333–339, 1990. deficient cells. Immunity 16: 697–706, 2002. 9) Schallreuter KU, Frenk E, Wolfe LS, Witkop CJ, Wood JM. 24) Martina JA, Moriyama K, Bonifacino JS. BLOC-3, a protein complex Hermansky-Pudlak syndrome in a Swiss population. Dermatology containing the Hermansky-Pudlak syndrome gene products HPS1 and 187 : 248–256, 1993. HPS4. J Biol Chem 278: 29376–29384, 2003. 10) Bailin T, Oh J, Feng GH, Jukai K, Spritz RA. Organization and nucleo- 25) Harmon KR, Witkop CJ, White JG, et al. Pathogenesis of pulmonary tide sequence of the human Hermansky-Pudlak syndrome (HPS) gene. fibrosis: platelet-derived growth factor precedes structural alterations in 108 J Invest Dermatol : 923–927, 1997. the Hermansky-Pudlak syndrome. J Lab Clin Med 123: 617–627, 1994. 11) Horikawa T, Araki K, Fukai K, et al. Heterozygous HPS1 mutations in

738 Internal Medicine Vol. 44, No. 7 (July 2005)