Enrichment and Physiological Characterization of a Novel Comammox Nitrospira Indicates Ammonium Inhibition of Complete Nitrifica

1 Supplementary Information for:

3 Enrichment and physiological characterization of a novel comammox

4 Nitrospira indicates ammonium inhibition of complete nitrification.

6 Author names:

7 Dimitra Sakoula1,#,*, Hanna Koch1, Jeroen Frank1,2, Mike SM Jetten1,2, Maartje AHJ van Kessel1, Sebastian

8 Lücker1,*.

10 Author affiliations:

11 1Department of Microbiology, IWWR, Radboud University, Heyendaalseweg 135, 6525 AJ Nijmegen, the

12 Netherlands.

13 2Soehngen Institute of Anaerobic Microbiology, Radboud University, Heyendaalseweg 135, 6525 AJ

14 Nijmegen, the Netherlands.

15 #Present address: Division of Microbial Ecology, Center for Microbiology and Environmental Systems

16 Science, University of Vienna, Althanstraße 14, 1090, Vienna, Austria.

18 Corresponding authors:

19 Dimitra Sakoula, Division of Microbial Ecology, Center for Microbiology and Environmental Systems

20 Science, University of Vienna, Althanstraße 14, 1090, Vienna, Austria; phone: +43 1 4277 91201; mail:

21 [email protected]

23 Sebastian Lücker, Department of Microbiology, IWWR, Radboud University, Heyendaalseweg 135, 6525

24 AJ Nijmegen, the Netherlands; phone: +31 24 3652618; mail: [email protected]. 25 Supplemental figures and tables 26 27 A B 4 4 ammonium nitrite nitrate 3 3

2 2

1 1 Load (mmol/day) Concentration (mM)

0 0

0 200 400 600 800 1000 1200 0 200 400 600 800 1000 1200 28 Time (days) Time (days) 29 Figure S1. Substrate loading (A) and apparent substrate concentrations (B) in the bioreactor system during 30 the enrichment period. Symbols indicate ammonium (squares), nitrite (circles) and nitrate (triangles). Lin eage I Nitrospira Lineage II Nitrospira Total Nitrospira 100

Enrichment percentage (%) 20

0 18 33 39 Operation time (months)

32 Figure S2. Relative abundance of sublineage I and II Nitrospira bacteria in the bioreactor system over the 33 enrichment period. Sublineage abundances were normalized in relation to the relative abundance of the 34 total Nitrospira population in the enrichment culture. 100 100 80 80 80 80 80 79 76 75 75 75 74 73 71 72 71 71 72 74 74 71 71 70 71 71 70 71 71 70 71 71 71 73 70 70 70 70 70 Nitrospira sp. SG-bin1 95 80 100 86 86 86 86 85 77 76 76 75 74 74 72 72 72 72 72 74 75 71 71 71 71 71 71 71 71 71 71 71 72 73 70 70 70 70 70 Ca. Nitrospira nitrificans 90 80 86 100 95 94 92 92 77 76 76 76 74 74 71 72 72 71 72 74 75 71 71 71 71 71 71 71 71 71 71 70 71 72 70 69 69 69 70 Nitrospira sp. CG24B 80 86 95 100 95 91 91 77 76 76 76 74 74 71 72 71 71 71 74 74 71 71 71 71 71 70 71 71 71 71 70 71 72 70 69 70 69 70 Nitrospira sp. RSF5 85 80 86 94 95 100 91 91 77 76 76 76 74 74 71 72 71 71 71 74 74 71 71 70 71 71 71 71 71 71 71 70 71 72 69 69 69 69 70 Nitrospira sp. RSF1 80 80 86 92 91 91 100 93 77 76 76 76 74 74 71 72 71 71 72 74 74 71 71 71 71 71 71 71 71 71 71 70 71 72 69 69 69 69 70 Nitrospira sp. RSF12 75 79 85 92 91 91 93 100 77 76 76 76 74 74 71 72 71 71 72 74 74 71 71 71 71 71 70 71 71 71 71 70 71 72 69 69 70 69 70 Nitrospira sp. RSF9 70 76 77 77 77 77 77 77 100 75 74 74 73 73 71 71 71 71 71 73 74 70 70 70 70 70 70 70 70 70 70 70 70 72 69 69 69 70 70 Ca. Nitrospira kreftii 75 76 76 76 76 76 76 75 100 85 85 73 72 71 71 71 71 72 73 73 71 70 70 70 71 70 70 70 71 71 70 71 72 69 69 69 69 69 Nitrospira sp. UBA5698 75 76 76 76 76 76 76 74 85 100 94 72 72 70 71 71 71 71 72 72 71 70 70 70 70 70 70 70 70 70 70 71 72 69 69 69 69 69 Ca. Nitrospira nitrosa 75 75 76 76 76 76 76 74 85 94 100 72 72 71 71 71 71 71 72 73 70 70 70 70 70 70 70 70 70 70 70 71 72 69 69 69 69 69 Nitrospira sp. UW-LDO-01 74 74 74 74 74 74 74 73 73 72 72 100 95 73 73 73 72 74 77 77 72 72 71 72 72 72 72 72 72 72 71 72 74 70 70 70 70 70 Nitrospira sp. SG-bin2 73 74 74 74 74 74 74 73 72 72 72 95 100 72 72 73 72 74 77 77 72 72 71 72 72 71 72 72 72 72 71 72 73 70 70 70 70 70 Nitrospira sp. ST-bin4 71 72 71 71 71 71 71 71 71 70 71 73 72 100 86 88 88 72 72 73 73 73 72 72 72 71 72 72 72 72 72 72 73 70 70 71 71 72 Nitrospira lenta 72 72 72 72 72 72 72 71 71 71 71 73 72 86 100 88 89 71 72 74 73 72 72 72 71 72 72 72 72 72 71 72 74 71 70 71 71 71 Nitrospira sp. ST-bin5 71 72 72 71 71 71 71 71 71 71 71 73 73 88 88 100 98 71 72 73 72 72 72 72 72 72 72 72 72 72 71 72 73 70 70 70 70 71 Nitrospira sp. CG24D 71 72 71 71 71 71 71 71 71 71 71 72 72 88 89 98 100 71 72 73 72 72 72 72 72 72 72 72 72 72 71 72 74 70 70 70 71 71 Nitrospira sp. RSF13 72 72 72 71 71 72 72 71 72 71 71 74 74 72 71 71 71 100 74 73 71 71 70 70 70 70 70 71 71 71 71 72 73 70 69 70 70 70 Nitrospira inopinata 74 74 74 74 74 74 74 73 73 72 72 77 77 72 72 72 72 74 100 76 72 72 71 71 71 71 72 71 71 72 72 72 74 70 70 70 70 70 Nitrospira sp. UBA2082 74 75 75 74 74 74 74 74 73 72 73 77 77 73 74 73 73 73 76 100 72 72 72 72 72 72 73 74 73 73 72 72 75 70 70 70 70 71 Nitrospira sp. RCA 71 71 71 71 71 71 71 70 71 71 70 72 72 73 73 72 72 71 72 72 100 99 78 79 78 78 80 81 82 81 72 73 73 71 70 70 71 71 Nitrospira sp. Baikal-G1 71 71 71 71 71 71 71 70 70 70 70 72 72 73 72 72 72 71 72 72 99 100 78 78 78 78 79 81 81 81 72 72 72 70 70 70 71 71 Nitrospira sp. BD2 70 71 71 71 70 71 71 70 70 70 70 71 71 72 72 72 72 70 71 72 78 78 100 79 79 80 81 83 83 82 71 72 72 70 70 70 70 70 Nitrospira sp. CG24E 71 71 71 71 71 71 71 70 70 70 70 72 72 72 72 72 72 70 71 72 79 78 79 100 81 81 83 82 82 82 71 72 71 70 69 70 70 70 Nitrospira sp. RSF3 71 71 71 71 71 71 71 70 71 70 70 72 72 72 71 72 72 70 71 72 78 78 79 81 100 92 82 83 82 83 71 72 71 70 70 70 70 70 Nitrospira sp. CG24A 70 71 71 70 71 71 70 70 70 70 70 72 71 71 72 72 72 70 71 72 78 78 80 81 92 100 83 83 83 83 71 72 71 70 69 70 70 70 Nitrospira sp. RSF6 71 71 71 71 71 71 71 70 70 70 70 72 72 72 72 72 72 70 72 73 80 79 81 83 82 83 100 85 85 85 72 72 72 70 70 70 70 70 Nitrospira sp. RSF7 71 71 71 71 71 71 71 70 70 70 70 72 72 72 72 72 72 71 71 74 81 81 83 82 83 83 85 100 89 89 72 73 72 70 70 70 71 71 Nitrospira sp. RCB 70 71 71 71 71 71 71 70 71 70 70 72 72 72 72 72 72 71 71 73 82 81 83 82 82 83 85 89 100 97 71 73 72 70 70 70 70 71 Nitrospira sp. palsa 1315 71 71 71 71 71 71 71 70 71 70 70 72 72 72 72 72 72 71 72 73 81 81 82 82 83 83 85 89 97 100 72 73 72 70 70 70 70 71 Nitrospira sp. palsa 1310 71 71 70 70 70 70 70 70 70 70 70 71 71 72 71 71 71 71 72 72 72 72 71 71 71 71 72 72 71 72 100 75 73 70 70 70 70 70 Nitrospira japonica 71 72 71 71 71 71 71 70 71 71 71 72 72 72 72 72 72 72 72 72 73 72 72 72 72 72 72 73 73 73 75 100 74 71 70 70 70 71 Nitrospira sp. CR1.3 73 73 72 72 72 72 72 72 72 72 72 74 73 73 74 73 74 73 74 75 73 72 72 71 71 71 72 72 72 72 73 74 100 71 71 71 71 72 Nitrospira moscoviensis 70 70 70 70 69 69 69 69 69 69 69 70 70 70 71 70 70 70 70 70 71 70 70 70 70 70 70 70 70 70 70 71 71 100 75 74 75 75 Nitrospira sp. NOB 70 70 69 69 69 69 69 69 69 69 69 70 70 70 70 70 70 69 70 70 70 70 70 69 70 69 70 70 70 70 70 70 71 75 100 79 78 79 Nitrospira sp. CR1.2 70 70 69 70 69 69 70 69 69 69 69 70 70 71 71 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 71 74 79 100 79 79 Nitrospira sp. CR1.1 70 70 69 69 69 69 69 70 69 69 69 70 70 71 71 70 71 70 70 70 71 71 70 70 70 70 70 71 70 70 70 70 71 75 78 79 100 92 Nitrospira defluvii 70 70 70 70 70 70 70 70 69 69 69 70 70 72 71 71 71 70 70 71 71 71 70 70 70 70 70 71 71 71 70 71 72 75 79 79 92 100 Nitrospira sp. ND1 Nitrospira Ca. Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Ca. Nitrospira Ca. Nitrospira Nitrospira Nitrospira Nitrospira lenta Nitrospira Nitrospira Nitrospira Nitrospira inopinata Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira Nitrospira japonica Nitrospira Nitrospira moscoviensis Nitrospira Nitrospira Nitrospira Nitrospira defluvii Nitrospira Nitrospira nitrosa Nitrospira nitrificans Nitrospira kreftii sp. CG24B sp. RSF12 sp. SG-bin2 sp. ST-bin4 sp. ST-bin5 sp. RSF13 sp. UBA2082 sp. RCA sp. RSF3 sp. RSF6 sp. RCB sp. palsa 1315 sp. palsa 1310 sp.ND1 sp. SG-bin1 sp. RSF5 sp. RSF1 sp. RSF9 sp. UBA5698 sp. UW-LDO-01 sp. CG24D sp. Baikal-G1 sp. BD2 sp. CG24E sp. CG24A sp. RSF7 sp. NOB sp. CR1.3 sp. CR1.2 sp. CR1.1

35 36 Figure S3. Genome similarity heatmap showing the pairwise ANI comparisons between the Nitrospira 37 MAGs obtained in this study (in bold) and publicly available high-quality genomes of sublineage I and II 38 Nitrospira species. CR1.1 CR1.3 sp. sp. CR1.2 sp.

Nitrospira Nitrospira Nitrospira Ammonia monooxygenase (AMO)

Hydroxylamine dehydrogenase (HAO)

Nitrite oxidoreductase (NXR)

Urease (UreABC)

Cyanase (CynS)

Cooper−dependent nitrite reductase (NirK)

Assimilatory nitrite reductase (NirA)

Octaheme nitrite reductase (ONR)

Ammonium transporter (Amt)

Ammonium transporter (Rh50)

Carbonic anhydrase (CA)

Formate dehydrogenase (S-FDH)

Respiratory chain Complex I - V

Cytochrome bd-like terminal oxidase

Glycolysis/gluconeogenesis

Reductive/Oxidative TCA cycle

Pentose phosphate pathway

Superoxide dismutase (SOD)

Catalase 39 40 Figure S4. Distribution pattern of key metabolic features involved in nitrogen and alternative energy 41 metabolisms in the canonical nitrite-oxidizing Nitrospira MAGs retrieved in this study. Dark grey and white 42 indicate presence and absence of the respective genes, respectively. 43 44 Figure S5. Circular representation of the “Ca. N. kreftii” chromosome. From outside to inside the rings 45 display: (1) and (2) predicted coding sequences on forward and reverse strand, respectively, (3) Genes 46 involved in ammonia and nitrite oxidation. Red: amoABC, haoAB and cycAB; orange: nxrABC. (4) Local 47 GC bias and (5) GC skew (green: positive, blue: negative). A B

120 120 ) ) -1 -1 h . h . 100 100

80 80

60 60

40 40 K + = 1.84 ± 0.7 μM NH + + NH s(app)_NH4 4 3 + ~ 0.033 μM NH Ki = 335.4 ± 121.9 μM NH4 + NH3 3 20 20 V = 124 ± 4.8 μM N h-1 ~ 5.96 μM NH3 max

floc size: 3 μm2 = 66.5 μmol N mg protein-1 h-1

0 ammonium oxidation (μM Total 0 Total ammonium oxidation (μM Total

0 100 200 300 400 0 5 10 15 20 25 30 + + NH4 + NH3 concentration (μΜ) NH4 + NH3 concentration (μΜ) C D

200 200 ) ) -1 -1 h h . .

150 150

100 100

K + = 2.89 ± 0.8 μM NH + + NH 50 50 s(app)_NH4 4 3 K = 261.6 ± 68 μM NH + + NH i 4 3 ~ 0.051 μM NH3 ~ 4.65 μM NH -1 3 Vmax = 203.2 ± 5.9 μM N h floc size: 8.4 μm2 = 96.6 μmol N mg protein-1 h-1

0 ammonium oxidation (μM Total Total ammonium oxidation (μM Total 0

0 50 100 150 200 250 300 350 400 450 0 10 20 30 40 NH + + NH concentration (μΜ) NH + + NH concentration (μΜ) 48 4 3 4 3

49 Figure S6. Ammonium oxidation kinetics of the “Ca. N. kreftii” enrichment culture. The red curves indicate 50 the best fit (A, C) of all data to the substrate inhibition model and (B, D) of the data retrieved for non- 51 inhibitory ammonium concentrations in a Michaelis-Menten kinetic equation. The reported standard errors 52 are based on nonlinear regression. Results for two biological replicates are shown here; a third biological 53 replicate is shown in Figure 4. A B 220 180 200

160 ) ) -1 -1 180 h h . . 140 160

120 140

100 120

- 100 - 80 K - = 8.03 ± 1.9 μM NO K - = 15.7 ± 8.7 μM NO s(app)_NO2 2 s(app)_NO2 2

-1 80 -1 60 Vmax = 172.8 ± 6.6 μM N h Vmax = 214.1 ± 8.9 μM N h

= 61.4 μmol N mg protein-1 h-1 60 = 57.8 μmol N mg protein-1 h-1 40 floc size: 1.6 μm2 40 floc size: 6.2 μm2 Total nitrite oxidation (μM Total

Total nitrite oxidation (μM Total 20 20

0 0

0 500 1000 1500 2000 0 500 1000 1500 2000 NΟ - concentration (μΜ) 2 NΟ - concentration (μΜ) 54 2

55 Figure S7. Nitrite oxidation kinetics of the “Ca. N. kreftii” enrichment culture. The red curves indicate the 56 best fit of the data to the Michaelis-Menten kinetic equation. The reported standard errors are based on 57 nonlinear regression. (A, B) Results for two biological replicates are shown here; a third biological replicate 58 is shown in Figure 5. A B 300

) ) 300 -1 -1 h h . . 250 250

200 200

150 150 K = 194.4 ± 61.8 μM NH + + NH K + = 3.89 ± 1.1 μM NH + + NH i 4 3 s(app)_NH4 4 3 100 100 ~ 0.069 μM NH ~ 2.17 μM NH3 3 2 -1 floc size: 7.7 μm Vmax = 323.2 ± 24.6 μM N h

50 50 = 125.1 μmol N mg protein-1 h-1

Total ammonium oxidation (μM Total ammonium oxidation (μM Total 0

0 20 40 60 80 100 120 140 160 0 5 10 15 20 25 30 + + NH4 + NH3 concentration (μΜ) NH4 + NH3 concentration (μΜ) C D 250 250 ) -1

) -1 h . h . 200 200

150 150

+ 100 + K + = 1.69 ± 1 μM NH + NH Ki = 259 ± 94 μM NH4 + NH3 100 s(app)_NH4 4 3 ~ 0.03 μM NH3 ~ 4.61 μM NH3 2 -1 floc size: 2.2 μm Vmax = 264.8 ± 10.6 μM N h 50 50 = 167.9 μmol N mg protein-1 h-1

0 0 Total ammonium oxidation (μM Total Total ammonium oxidation (μM Total 0 20 40 60 80 100 120 0 5 10 15 20 25 30 35 NH + + NH concentration (μΜ) NH + + NH concentration (μΜ) 59 4 3 4 3 60 Figure S8. Ammonium oxidation kinetics of the “Ca. N. kreftii” enrichment culture, adapted to 1mM 61 ammonium feeding. The red curves indicate the best fit (A, C) of all data to the substrate inhibition model 62 and (B, D) of the data retrieved for non-inhibitory ammonium concentrations in a Michaelis-Menten kinetic 63 equation. The reported standard errors are based on nonlinear regression. Results for two biological 64 replicates are shown here; a third biological replicate is shown in Figure 6A, B. A B 180 160

160 140 ) ) -1 -1

h 140 h . . 120 120 100 100 80 80 - - K - = 14 ± 3.3 μM NO K - = 21.1 ± 4.2 μM NO 60 s(app)_NO2 2 s(app)_NO2 2 60 -1 -1 V = 143.9 ± 7.5 μM N h V = 167.6 ± 5 μM N h max max 40 -1 -1 40 = 87.4 μmol N mg protein-1 h-1 = 90.4 μmol N mg protein h 2 Total nitrite oxidation (μM Total 2 nitrite oxidation (μM Total floc size: 7.7 μm 20 floc size: 11.3 μm 20

0 0

0 500 1000 1500 2000 0 500 1000 1500 2000 - NΟ - concentration (μΜ) NΟ2 concentration (μΜ) 2 65 66 Figure S9. Nitrite oxidation kinetics of the “Ca. N. kreftii” enrichment culture, adapted to 1mM ammonium 67 feeding. The red curves indicate the best fit of the data to the Michaelis-Menten kinetic equation. The 68 reported standard errors are based on nonlinear regression. (A, B) Results for two biological replicates 69 are shown here; a third biological replicate is shown in Figure 6C. Α B

200 10 μΜ 100 20 μΜ 50 μΜ 80 150 100 μΜ 200 μΜ

60 100

concentration (μΜ) 50 + 4 20 NH

0 Relative maximum activity (%) 0

0 2 4 6 8 10 20 50 100 200 + Time (hours) Initial NH4 concentration (μΜ) C D 300 100

250 80

200 60

150

40 100 concentration (μΜ) - 2 20 50 NΟ

0 Relative maximum activity (%) 0

0 2 4 6 8 10 20 50 100 200 Time (hours) Initial NΟ - concentration (μΜ) 70 2 71 Figure S10. Oxidation of increasing concentrations of (A) ammonium and (B) nitrite in batch incubations 72 inoculated with the “Ca. N. kreftii” enrichment culture. Relative maximum (C) ammonium and (D) nitrite 73 oxidation rates were recorded at the substrate concentrations shown in (A) and (B) and calculated in relation 74 to the maximum oxidation rate observed during the respective experiment. Symbols and error bars 75 represent averages and standard deviations of three biological replicates, respectively. 76 Table S1. Specifications of the FISH probes used in this study.

Probe Target FA %a Sequence (5’à3’) Reference Nitrospira phylum Ntspa712 35 CGCCTTCGCCACCGGCCTTCC (1) (most members) Comp- Competitor to - CGCCTTCGCCACCGGTGTTCC (1) Ntspa712 Ntspa712 Ntspa662 genus Nitrospira 35 GGAATTCCGCGCTCCTCT (1) Comp- Competitor to - GGAATTCCGCTCTCCTCT (1) Ntspa662 Ntspa662 Sublineage I of the Ntspa1431 35 TTGGCTTGGGCGACTTCA (2) genus Nitrospira Sublineage II of the Ntspa1151 35-40 TTCTCCTGGGCAGTCTCT CC (2) genus Nitrospira EUB338 Most bacteria 0-50 GCTGCCTCCCGTAGGAGT (3) (Bact338) EUB338 II Planctomycetales 0-50 GCAGCCACCCGTAGGTGT (4) (SBACT P 338) EUB338 III Verrucomicrobiales 0-50 GCTGCCACCCGTAGGTGT (4) (SBACT V 338) 77 aConcentration of formamide (FA) in the hybridization buffer 78 79 Table S2. Enrichment of the bioreactor’s biomass in Nitrospira bacteria over the total enrichment period 80 determined by quantitative FISH.

Operation time Enrichment S.E. (months) (%) (±) 0 5.4 8.9 8 53 17.9 11 71.3 25.5 14 73.7 14.7 17 57 29.5 18 64.8 15 19 83.5 14.9 24 65.3 18.9 26 85.1 6.5 27 90.5 7.6 28 86.1 10 33 71.7 8 35 55.9 17.5 39 71.9 18.2 81 82 Dataset S1 (separate file). Overview of the medium- and high-quality metagenome-assembled genomes 83 (MAGs; completeness ≥75%, contamination ≤10%) obtained from the enrichment culture after 17 months 84 of enrichment. 85 86 Dataset S2 (separate file). Overview of the medium- and high-quality metagenome-assembled genomes 87 (MAGs; completeness ≥75%, contamination ≤10%) obtained from the enrichment culture after 39 months 88 of enrichment. 89 90 Dataset S3 (separate file). “Ca. Nitrospira kreftii” proteins with predicted functions in key metabolic 91 pathways. 92 SI References

94 1. Daims H, Nielsen JL, Nielsen PH, Schleifer KH, Wagner M. In situ characterization of Nitrospira- 95 like nitrite-oxidizing bacteria active in wastewater treatment plants. Applied and environmental 96 microbiology. 2001;67(11):5273-84. 97 2. Maixner F, Noguera DR, Anneser B, Stoecker K, Wegl G, Wagner M, et al. Nitrite concentration 98 influences the population structure of Nitrospira-like bacteria. Environmental Microbiology. 2006;8(8):1487- 99 95. 100 3. Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA. Combination of 16S rRNA- 101 targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Applied and 102 Environmental Microbiology. 1990;56(6):1919-25. 103 4. Daims H, Brühl A, Amann R, Schleifer K-H, Wagner M. The Domain-specific Probe EUB338 is 104 Insufficient for the Detection of all Bacteria: Development and Evaluation of a more Comprehensive Probe 105 Set. Systematic and Applied Microbiology. 1999;22(3):434-44.