Tuning Adipogenic Differentiation in Adscs by Metformin and Vitamin D

International Journal of Molecular Sciences

Article Tuning Adipogenic Diﬀerentiation in ADSCs by Metformin and Vitamin D: Involvement of miRNAs

Sara Cruciani 1 , Giuseppe Garroni 1, Francesca Balzano 1 , Renzo Pala 1, Emanuela Bellu 1, Maria Laura Cossu 2 , Giorgio Carlo Ginesu 2 , Carlo Ventura 3 and Margherita Maioli 1,4,5,*

1 Department of Biomedical Sciences, University of Sassari, Viale San Pietro 43/B, 07100 Sassari, Italy; [email protected] (S.C.); [email protected] (G.G.); [email protected] (F.B.); [email protected] (R.P.); [email protected] (E.B.) 2 Department of Medical, Surgical and Experimental Sciences, General Surgery Unit 2 “Clinica Chirurgica”, University of Sassari, Viale San Pietro 8, 07100 Sassari, Italy; [email protected] (M.L.C.); [email protected] (G.C.G.) 3 Laboratory of Molecular Biology and Stem Cell Engineering, National Institute of Biostructures and Biosystems-Eldor Lab, Innovation Accelerator, Consiglio Nazionale delle Ricerche, 40129 Bologna, Italy; [email protected] 4 Department of Biomedical Sciences, Center for Developmental Biology and Reprogramming (CEDEBIOR), University of Sassari, Viale San Pietro 43/B, 07100 Sassari, Italy 5 Istituto di Ricerca Genetica e Biomedica, Consiglio Nazionale delle Ricerche (CNR), 09042 Monserrato, Cagliari, Italy * Correspondence: [email protected]; Tel.: +39-079-228-277

Received: 7 August 2020; Accepted: 26 August 2020; Published: 27 August 2020

Abstract: Fat tissue represents an important source of adipose-derived stem cells (ADSCs), which can differentiate towards several phenotypes under certain stimuli. Definite molecules as vitamin D are able to influence stem cell fate, acting on the expression of specific genes. In addition, miRNAs are important modulating factors in obesity and numerous diseases. We previously identified specific conditioned media able to commit stem cells towards defined cellular phenotypes. In the present paper, we aimed at evaluating the role of metformin on ADSCs differentiation. In particular, ADSCs were cultured in a specific adipogenic conditioned medium (MD), in the presence of metformin, alone or in combination with vitamin D. Our results showed that the combination of the two compounds is able to counteract the appearance of an adipogenic phenotype, indicating a feedforward regulation on vitamin D metabolism by metformin, acting on CYP27B1 and CYP3A4. We then evaluated the role of specific epigenetic modulating genes and miRNAs in controlling stem cell adipogenesis. The combination of the two molecules was able to influence stem cell fate, by modulating the adipogenic phenotype, suggesting their possible application in clinical practice in counteracting uncontrolled lipogenesis and obesity-related diseases.

Keywords: stem cells; miRNA; cellular mechanisms; gene expression; epigenetic; adipogenesis; conditioned media

1. Introduction Adipose-derived stem cells (ADSCs) are one of the most promising cells for regenerative medicine, due to their higher diﬀerentiation potential and easy propagation, as compared to other sources [1,2]. These cells, located in the stromal vascular fraction (SVF) of adipose tissue, exert a central role during adipogenesis, diﬀerentiating to produce mature adipocytes [3]. As mesenchymal stem cells (MSCs),

Int. J. Mol. Sci. 2020, 21, 6181; doi:10.3390/ijms21176181 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, 6181 2 of 13 they exhibit multipotency features, being able to maintain their undifferentiated state, controlled by the stemness related genes (Oct-4, NANOG, Sox2), or undergo differentiation [4,5]. Peroxisome proliferator-activated receptor γ (PPAR-γ) is a master regulator of adipocyte differentiation. PPAR-γ is required not only during adipogenic differentiation, but also in modulating insulin sensitivity and adipocyte metabolism [6]. In addition, several adipogenic surface markers as activating signal cointegrator-1 (ASC-1) and proton-coupled amino acid transporter (PAT2) have been identified to target white and brown adipocytes and fat depots for therapeutic purposes and obesity treatment [7,8]. Adipose tissue is essential in regulating homeostasis and metabolism of the whole body. Hypertrophy of resident adipocytes leads to uncontrolled pro-inflammatory cytokine secretion, metabolic stress, insulin resistance, cardiovascular disease, and obesity [9]. Vitamin D deficiency is strictly related to obesity and diabetes [10]. This molecule acts directly regulating adipose tissue metabolism, modulating adiponectin expression and the release of pro-inflammatory cytokines [11]. Several isoforms of cytochrome P450 (CYP) enzymes are responsible for its metabolism, in particular, for the 25-hydroxylation (CYP3A4, CYP27A1) and 1,25 hydroxylation (CYP27B1) [12]. A number of causes are involved in the pathogenesis of obesity. In addition, miRNAs have recently emerged as related to numerous metabolic dysfunctions, in particular for adipose tissue, controlling adipogenesis, insulin resistance, and inflammation [13,14]. For example, miR-145 is involved in adipogenic regulation of porcine and bovine preadipocytes [15,16]. An upregulation of miR-148a is associated with the inhibition of lipogenesis and the downregulation of specific adipogenic markers by direct inhibiting Wnt signaling pathway [14,17]. It is known that epigenetic factors, as for example, histone deacetylases (HDACs), are able to modulate adipogenesis, affecting the differentiation of adipocytes and modulating their metabolic features [18]. SIRT1 is required mainly during the early stages of adipogenesis and its upregulation blocks adipogenic differentiation, while increasing the expression of osteoblast markers [19,20]. SIRT2 maintains energy homeostasis by promoting lipolysis and inhibiting adipocyte differentiation by repressing PPAR-γ and FOXO1 deacetylation [21]. Metformin is currently used for the treatment of type II diabetes in obese patients. This molecule has pleiotropic properties, as anti-hyperglycemic, improving insulin sensitivity, inflammation modulation, and inhibition of intracellular lipid accumulation and adipogenesis, especially at specific concentrations [22,23]. Moreover, preadipocyte treatment with metformin suppresses adipocyte differentiation, altering the miRNA profile [24]. Within this context, we recently demonstrated that a combination of different molecules is able to counteract both the molecular program of adipogenesis, as peroxisome proliferator-activated receptor gamma (PPAR-γ) gene expression, as well as the appearance of lipid droplets. In particular, melatonin exerts a synergic effect with vitamin D on ADSCs, controlling adipose differentiation finely tuning osteogenesis and adipogenesis by epigenetic modifications [18,19]. In the present paper, we aimed at evaluating a novel effect of metformin on ADSCs differentiation, in the attempt to modulate adipogenesis, and investigated the activation of CYP involved in vitamin D metabolism. We also assessed whether, during adipogenic differentiation in the presence of metformin, epigenetic mechanisms and miRNAs may have been involved.

2. Results

2.1. Exposure to Metformin with or without Vitamin D Increases Stem Cell Potency Reducing the Expression of Adipogenic Markers Figure1 shows the mRNA levels of stemness-related genes in Adipose-derived stem cells (ADSCs) exposed to different conditioned media for 7, 14, and 21 days. As expected, when cells were exposed to the adipogenic differentiation medium (blue bars), a significant downregulation of Oct-4, Sox2, and NANOG could be observed, as compared to control untreated undifferentiated cells at the end of the observation time. Nevertheless, when metformin or vitamin D or both were added to the culturing medium, the expression of all the tested stemness genes was significantly upregulated, reaching expression values significantly higher than control untreated undifferentiated cells (black bars). At the Int. J. Mol. Sci. 2020, 21, 6181 3 of 13 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 3 of 13 same time, the expression of the main adipogenic orchestrator gene, Peroxisome proliferator-activated bars). At the same time, the expression of the main adipogenic orchestrator gene, Peroxisome receptor γ (PPAR-γ) (Panel D), was significantly downregulated, as compared to cells exposed to MD proliferator-activated receptor γ (PPAR-γ) (Panel D), was significantly downregulated, as compared alone (blue bars), just after 7 days in culture, reaching a minimum when the two molecules were added to cells exposed to MD alone (blue bars), just after 7 days in culture, reaching a minimum when the together in the differentiation medium (yellow bars). two molecules were added together in the differentiation medium (yellow bars).

A Oct-4 B Sox2 16 7 * * * MG 14 * 6 MD 12 * ) ) 5 MD+VIT -ΔΔCt -ΔΔCt 10 4 MD+MET 8 MD+VIT+MET 3 6 2 Fold of Change(2 of Fold FoldofChange (2 4

2 1

0 0 CTRL 7G 14G 21G CTRL 7G 14G 21G

C NANOG D PPAR- γ 6 6 * * 5 5 ) ) 4 4 -ΔΔCt -ΔΔCt

3 3

2 2 Fold of Change (2 Change of Fold Fold of Change (2 ** 1 1 **

0 0 CTRL 7G 14G 21G CTRL 7G 14G 21G

FigureFigure 1. ExpressionExpression of stemness of stemness genes genes and adipogenic and adipogenic regulating regulating genes. genes.The expression The expression of stemness- of stemness-relatedrelated genes Oct-4 genes (Panel Oct-4 (A)), (Panel Sox2( A(Panel)), Sox2 (B)), (Panel NANOG (B)), (Panel NANOG (C)) (Panel and the (C ))adipogenic and the adipogenic regulating regulatinggene PPAR- geneγ (Panel PPAR- (Dγ)),(Panel was evaluated (D)), was in evaluated Adipose-derived in Adipose-derived stem cells (ADSCs) stem cells cultured (ADSCs) in: culturedgrowing in:medium growing (MG), medium adipogenic (MG), differentia adipogeniction di ffmediumerentiation (MD) medium (blue bars), (MD) (blueor in MD bars), in or the in presence MD in the of presencevitamin D of (orange vitamin bars), D (orange or in MD bars), in the or presence in MD in of the metformin presence (green of metformin bars), or (green in MD bars),with metformin or in MD withplus metforminvitamin D (yellow plus vitamin bars). DThe (yellow mRNA bars). levels The for mRNAeach gene levels were for normalized each gene to were glyceraldehyde-3- normalized to −∆∆Ct ∆∆Ct glyceraldehyde-3-phosphate-dehydrogenasephosphate-dehydrogenase (GAPDH) and expressed (GAPDH) as and fold expressed of change as fold (2 of change) of the(2 mRNA− ) oflevels the mRNAobserved levels in undifferentiated observed in undi ffcontrolerentiated ADSCs control (black ADSCs bars) (black defined bars) as defined 1 (mean as ±SD; 1 (mean n = 6).SD; Datan = are6). ± Dataexpressed are expressed as mean as± SD mean referredSD referredto the control to the (* control p ≤ 0.05; (* p** p 0.05;≤ 0.01). ** p 0.01). ± ≤ ≤ 2.2.2.2. MetforminMetformin andand VitaminVitamin DD AreAre AbleAble toto ModulateModulate thethe ExpressionExpression ofof CYPCYP FigureFigure2 2shows shows the the e effectsffects ofof thethe twotwo moleculesmolecules onon CYP3A4CYP3A4 andand CYP27B1CYP27B1 genegene expression.expression. CYP3A4CYP3A4 (Panel(Panel A)A) waswas downregulateddownregulated afterafter 2121 daysdays ofof thethe adipogenicadipogenic didifferentiationfferentiation (blue(blue bars),bars), whilewhile beingbeing significantlysignificantly upregulatedupregulated sincesince thethe firstfirst daysdays ofof culturingculturing ADSCsADSCs inin thethe didifferentiationfferentiation mediummedium inin thethe presencepresence ofof metforminmetformin (green(green bars),bars), vitaminvitamin DD (orange(orange bars),bars), or bothboth (yellow(yellow bars). EvenEven CYP27B1CYP27B1 (Panel(Panel B)B) waswas upregulatedupregulated afterafter 77 daysdays ofof exposure,exposure, reachingreaching againagain levelslevels similarsimilar toto controlcontrol undiundifferentiatedfferentiated cells cells after after 21 21 days days of of culturing. culturing. 2.3. Metformin Inhibits Adipogenesis Recruiting Epigenetic Modulating Genes A CYP3A4 B CYP27B1 MG MD 40 7 * As expected, HDAC1 (Figure3, Panel*** A), SIRT1 (Figure3, Panel B), and SIRT2 (Figure3,MD+VIT Panel C) 35 6 MD+MET ** are induced30 during ADSC differentiation. In particular, SIRT2 was significantly increasedMD+VIT+MET at the end ) ) 5

-ΔΔCt 25 -ΔΔCt of the differentiation period (p 0.01) for all culturing4 conditions, as compared to control untreated 20 ≤ undifferentiated cells (black bars). Moreover, SIRT13 and HDAC1 mRNA levels were upregulated 15 2 (p 0.05Fold ofChange (2 10 ) in ADSCs cultured in differentiation mediumFold ofChange (2 with or without metformin and/or vitamin D ≤ ** for 7 and5 14 days respectively, as compared to control1 untreated undifferentiated cells.

0 0 CTRL 7G 14G 21G CTRL 7G 14G 21G Figure 2. Expression of CYP450. The expression of CYP3A4 (Panel (A)) and CYP27B1 (Panel (B)) was evaluated in ADSCs cultured in: growing medium (MG), adipogenic differentiation medium (MD) (blue bars), or in MD in the presence of vitamin D (orange bars), or in MD in the presence of metformin (green bars), or in MD with metformin plus vitamin D (yellow bars). The mRNA levels for each gene

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 3 of 13

bars). At the same time, the expression of the main adipogenic orchestrator gene, Peroxisome proliferator-activated receptor γ (PPAR-γ) (Panel D), was significantly downregulated, as compared to cells exposed to MD alone (blue bars), just after 7 days in culture, reaching a minimum when the two molecules were added together in the differentiation medium (yellow bars).

A Oct-4 B Sox2 16 7 * * * MG 14 * 6 MD 12 * ) ) 5 MD+VIT -ΔΔCt -ΔΔCt 10 4 MD+MET 8 MD+VIT+MET 3 6 2 Fold of Change(2 of Fold FoldofChange (2 4

2 1

0 0 CTRL 7G 14G 21G CTRL 7G 14G 21G

C NANOG D PPAR- γ 6 6 * * 5 5 ) ) 4 4 -ΔΔCt -ΔΔCt

3 3

2 2 Fold of Change (2 Change of Fold Fold of Change (2 ** 1 1 **

0 0 CTRL 7G 14G 21G CTRL 7G 14G 21G Figure 1. Expression of stemness genes and adipogenic regulating genes. The expression of stemness- related genes Oct-4 (Panel (A)), Sox2 (Panel (B)), NANOG (Panel (C)) and the adipogenic regulating gene PPAR-γ (Panel (D)), was evaluated in Adipose-derived stem cells (ADSCs) cultured in: growing medium (MG), adipogenic differentiation medium (MD) (blue bars), or in MD in the presence of vitamin D (orange bars), or in MD in the presence of metformin (green bars), or in MD with metformin plus vitamin D (yellow bars). The mRNA levels for each gene were normalized to glyceraldehyde-3- phosphate-dehydrogenase (GAPDH) and expressed as fold of change (2−∆∆Ct) of the mRNA levels observed in undifferentiated control ADSCs (black bars) defined as 1 (mean ±SD; n = 6). Data are expressed as mean ± SD referred to the control (* p ≤ 0.05; ** p ≤ 0.01).

2.2. Metformin and Vitamin D Are Able to Modulate the Expression of CYP Figure 2 shows the effects of the two molecules on CYP3A4 and CYP27B1 gene expression. CYP3A4 (Panel A) was downregulated after 21 days of the adipogenic differentiation (blue bars), while being significantly upregulated since the first days of culturing ADSCs in the differentiation medium in the presence of metformin (green bars), vitamin D (orange bars), or both (yellow bars). Int. J.Even Mol. Sci.CYP27B12020, 21 (Panel, 6181 B) was upregulated after 7 days of exposure, reaching again levels similar4 to of 13 control undifferentiated cells after 21 days of culturing.

A CYP3A4 B CYP27B1 MG MD 40 7 * *** MD+VIT 35 6 MD+MET ** Int. J. Mol.30 Sci. 2020, 21, x FOR PEER REVIEW MD+VIT+MET4 of 13 ) ) 5

-ΔΔCt 25 -ΔΔCt 4 were20 normalized to glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and expressed as fold of 3 change15 (2−∆∆Ct) of the mRNA levels observed in undifferentiated control ADSCs (black bars) defined 2 Fold ofChange (2 10 Fold ofChange (2 as 1 (mean ±SD; n** = 6). Data are expressed as mean ± SD referred to the control (* p ≤ 0.05; ** p ≤ 0.01; 5 1

*** 0p ≤ 0.001). 0 CTRL 7G 14G 21G CTRL 7G 14G 21G 2.3. Metformin Inhibits Adipogenesis Recruiting Epigenetic Modulating Genes FigureFigure 2. Expression 2. Expression of of CYP450. CYP450. The The expression expression ofof CYP3A4CYP3A4 (Panel ( (AA)))) and and CYP27B1 CYP27B1 (Panel (Panel (B ())B was)) was evaluatedAsevaluated expected, in ADSCsin ADSCs HDAC1 cultured cultured (Figure in: in: growing3, growing Panel mediumA), medium SIRT1 (MG),(MG), (Figure adipogenic 3, Panel differentiation diB),ff erentiationand SIRT2 medium (Figure medium (MD) 3, (MD) Panel C)(blue are(blue induced bars), bars), or induringor MDin MD in ADSC in the the presence presencedifferentiation. of of vitamin vitamin In D D particular, (orange (orange bars), SIRT2 or or in in wasMD MD insignificantly in the the presence presence ofincreased ofmetformin metformin at the end(green of(green the bars), bars),differentiation or inor MDin MD with with period metformin metformin (p ≤ plus0.01) plus vitamin vitaminfor all D Dculturing (yellow(yellow bars). conditions, The The mRNA mRNA as levelscompared levels for for eacheach to gene control gene untreated were normalized undifferentiated to glyceraldehyde-3-phosphate-dehydrogenase cells (black bars). Moreover, SIRT1 (GAPDH)and HDAC1 and expressedmRNA levels as fold were of ∆∆Ct upregulatedchange (2− (p ≤) of0.05) the mRNAin ADSCs levels cultured observed in indifferenti undifferentiatedation medium control ADSCswith or (black without bars) metformin defined and/oras 1 (mean vitaminSD; D forn = 76). and Data 14 aredays expressed respectively, as mean as comparedSD referred to tocontrol the control untreated (* p 0.05;undifferentiated ** p 0.01; ± ± ≤ ≤ cells.*** p 0.001). ≤

A HDAC1 MG 12 * MD MD+VIT 10 MD+MET ) 8 MD+VIT+MET -ΔΔCt

4 Fold of Change(2 of Fold

0 CTRL 7G 14G 21G

B SIRT1 C SIRT2 9 12 ** 8 * 10 7 ) ) 6 8 -ΔΔCt -ΔΔCt

5 6 4

3 4 Fold ofChange (2 Fold ofChange (2 2 2 1

0 0 CTRL 7G 14G 21G CTRL 7G 14G 21G FigureFigure 3. Expression3. Expression of of epigenetic epigenetic modulatingmodulating ge genes.nes. The The expression expression of of HDAC1 HDAC1 (Panel (Panel (A)), (A SIRT1)), SIRT1 (Panel(Panel (B )),(B)), and and SIRT2 SIRT2 (Panel (Panel ( C(C)))) was was evaluatedevaluated in ADSCs cultured cultured in: in: growing growing medium medium (MG), (MG), adipogenicadipogenic diff differentiationerentiation medium medium (MD) (MD) (blue (blue bars), bars), or or in MDin MD in thein the presence presence of vitaminof vitamin D (orangeD (orange bars), or inbars), MD or in in the MD presence in the presence of metformin of metformin (green bars),(green orbars), in MD or in with MD metformin with metformin plus vitaminplus vitamin D (yellow D (yellow bars). The mRNA levels for each gene were normalized to glyceraldehyde-3-phosphate- bars). The mRNA levels for each gene were normalized to glyceraldehyde-3-phosphate-dehydrogenase −∆∆Ct dehydrogenase (GAPDH) and expressed as fold∆∆Ct of change (2 ) of the mRNA levels observed in (GAPDH) and expressed as fold of change (2− ) of the mRNA levels observed in undifferentiated undifferentiated control ADSCs (black bar) defined as 1 (mean ±SD; n = 6). Data are expressed as mean control ADSCs (black bar) defined as 1 (mean SD; n = 6). Data are expressed as mean SD referred ± SD referred to the control (* p ≤ 0.05; ** p ≤ 0.01).± ± to the control (* p 0.05; ** p 0.01). ≤ ≤ 2.4.2.4. miRNAs miRNAs Are Are Modulated Modulated by by Metformin Metformin miRNAs’miRNAs’ levels levels of of expression expression were were evaluatedevaluated in cells cells exposed exposed to to different different conditioned conditioned medium medium afterafter 21 days21 days in culure. in culure. As showed As showed in Figure in Figure4, miR-145 4, miR-145 (Panel A)(Panel was significantlyA) was significantly ( p 0.01) ( upregulatedp ≤ 0.01) upregulated only when cells were exposed to both metformin and vitamin D (yellow≤ bars), as only when cells were exposed to both metformin and vitamin D (yellow bars), as compared to control compared to control untreated undifferentiated cells (black bars) or MD alone (blue bars). An untreated undifferentiated cells (black bars) or MD alone (blue bars). An opposite trend could be opposite trend could be observed for miR-148a expression (Panel B), being significantly (p ≤ 0.05) observed for miR-148a expression (Panel B), being significantly (p 0.05) downregulated in ADSCs downregulated in ADSCs cultured in adipogenic medium in the presence≤ of both metformin and culturedvitamin in D adipogenic (yellow bars) medium as compared in the to presence control untreated of both metforminundifferentiated and vitamincells (black D (yellowbars). bars) as compared to control untreated undifferentiated cells (black bars).

Int. J. Mol. Sci. 2020, 21, 6181 5 of 13 Int.Int. J. J. Mol. Mol. Sci. Sci. 2020 2020, ,21 21, ,x x FOR FOR PEER PEER REVIEW REVIEW 55 of of 13 13

ABABmiR-145-5pmiR-145-5p miR-148a-3pmiR-148a-3p 1.41.4 55 **** ** 1.21.2 **

) 4 )

) 4 ) 11 -ΔΔCt -ΔΔCt -ΔΔCt -ΔΔCt 33 0.80.8 ** ****

0.60.6 22 0.40.4 Fold of Change (2 Change of Fold Fold of Change (2 Change of Fold Fold of Change (2 Change of Fold

Fold of Change (2 Change of Fold * **** 11 * 0.20.2 ****

00 00 CTRLCTRL MD MD MD+VIT MD+VIT MD+MET MD+MET MD+VIT+MET MD+VIT+MET CTRLCTRL MD MD MD+VIT MD+VIT MD+MET MD+MET MD+VIT+MET MD+VIT+MET

FigureFigure 4.4. 4. Expression ExpressionExpression ofof of miRNAsmiRNAs miRNAs afterafter after 2121 21 daysdays days ofof culturing. ofculturing. culturing. The The The expressionexpression expression ofof miR-145miR-145 of miR-145 (Panel(Panel (Panel ((AA)))) andand (A)) miR-148amiR-148aand miR-148a (Panel(Panel (Panel ((BB)))) (wasBwas)) was evaluatedevaluated evaluated inin ADSCs inADSCs ADSCs culturedcultured cultured in:in: in: growinggrowing growing mediummedium medium (MG),(MG), (MG), adipogenicadipogenic differentiationdifferentiationdifferentiation mediummedium (MD) (MD) (blue(blue (blue bars),bars), bars), oror or inin in MDMD inin thethe presencepresence ofof vitaminvitamin DD (orange(orange bars),bars), oror inin MDMD in in the the the presence presence presence of of of metformin metformin metformin (green (green (green bars), bars), bars), or or or in in in MD MD MD with with with metformin metformin metformin plus plus plus vitamin vitamin vitamin D D D (yellow (yellow (yellow bars). bars). bars). The mRNA levels for each gene were normalized to U6snRNA and expressed as fold of change (2−∆∆∆∆−∆∆CtCt) TheThe mRNA mRNA levels levels for for each each gene gene were normalized to U6snRNA andand expressedexpressed asas foldfoldof ofchange change (2 (2− ) ) ofof thethe mRNAmRNA levelslevels observedobserved inin undifferentiatedundifferentiated undifferentiated control control ADSCsADSCs (black(black bars)bars) defineddefineddefined asas 11 (mean(mean ±SD;±SD;SD; ± nn == 6).6).6). DataData Data areare are expressedexpressed expressed asas as meanmean mean ±± SDSDSD referredreferred referred toto to thethe the controlcontrol control (*(* (* pp p ≤≤ 0.05;0.05;0.05; ****** pp p ≤≤ 0.01).0.01).0.01). ± ≤ ≤ 2.5.2.5. MetforminMetformin Metformin CounteractCounteract Counteract ADSCADSC ADSC AdipAdip Adipogenicogenicogenic DifferentiationDifferentiation Differentiation DeDe Despitespitespite thethe PresencePresence of of a a Specific SpecificSpecific ConditionedConditioned Conditioned Medium MediumMedium ImmunohistochemicalImmunohistochemicalImmunohistochemical analysisanalysis analysis confirmedconfirmed confirmed thatthat that duriduri duringngng adipogenicadipogenic adipogenic differentiation,differentiation, differentiation, thethe presencepresence ofof metforminmetformin alonealone oror togethertogether withwith vitaminvitamin DD inin the the differentiation didifferentiationfferentiation medium medium inhibits inhibits adipogenicadipogenic differentiationdifferentiationdifferentiation (Figure(Figure 5).55).). InIn particular, particular, the the presencepresenpresencece ofof metforminmetformin counteractscounteracts the the expression expression of of the the mainmain markersmarkers ofof adipogenesis, adipogenesis, activatingactivating signalsignal cointegrator-1cointegrator-1 (ASC-1)(ASC-1) anan anddd proton-coupledproton-coupled aminoamino acidacid transporter transporter (PAT2), (PAT2),(PAT2), being beingbeing superimposable superimposablesuperimposable to controltoto controlcontrol untreated untreateduntreated undi undifferentiatedffundifferentiatederentiated cells. cells.cells. This eThisThisffect effecteffectwas higher waswas higherhigher when when metforminwhen metformimetformi and vitaminnn andand vitaminvitamin D were DD contemporarily werewere contemporarilycontemporarily added to addedadded the di totofferentiation thethe differentiationdifferentiation medium. medium.medium.On the other OnOn thethe hand, otherother ASC-1 hand,hand, and ASC-1ASC-1 PAT2 andand are clearlyPAT2PAT2 arar evidentee clearlyclearly in evident ADSCsevident committedinin ADSCsADSCs committedcommitted to the adipogenic toto thethe adipogenicadipogenicphenotype phenotype inphenotype the presence inin thethe of presencepresence the only ofadipogenicof thethe onlyonly adipogenic diadipogenicfferentiation differentiationdifferentiation medium (MD). mediummedium (MD).(MD).

FigureFigure 5. 5. AnalysisAnalysisAnalysis ofof of adipogenicadipogenic specificspecific specific proteinsproteins after after 21 21 days days in in culture.culture. Immunohistochemical Immunohistochemical analysisanalysis ofof of thethe the expressionexpression expression ofof of ASC-1ASC-1 ASC-1 andand and PAT2PAT2 PAT2 was was assessed assessed inin ADSCsADSCs culturedcultured inin thethe basicbasic growinggrowing mediummedium (MG)(MG) or or or andand and inin in thethe the differentiation differentiation differentiation mediummedium (MD) (MD) oror or thethe the differentiationdifferentiation differentiation mediummedium plusplus vitamin vitamin DD (MD+VIT)(MD+VIT) (MD+VIT) oror or metforminmetformin metformin (MD+MET)(MD+MET) (MD+MET) oror withorwith with bobothth both vitaminvitamin vitamin DD andand D and metforminmetformin metformin (MD+VIT+MET).(MD+VIT+MET). (MD+VIT+MET). TheThe figuresfiguresThe figures areare representativerepresentative are representative ofof differentdifferent of different independindepend independententent experiments.experiments. experiments. NucleiNuclei Nuclei areare labelledlabelled are labelled withwith with4,6-4,6- diamidino-2-phenylindolediamidino-2-phenylindole4,6-diamidino-2-phenylindole (DAPI,(DAPI, (DAPI, blue).blue). blue). ScaleScale Scale bars:bars: bars: 4040 µm.µm. 40 µ m.

2.6. The Syngergy between the Two Molecules Ameliorate the Expression of CYP450 2.6.2.6. TheThe SyngergySyngergy betweenbetween thethe TwoTwo MolecuMoleculesles AmeliorateAmeliorate thethe ExpressionExpression ofof CYP450CYP450 DuringDuring adipogenicadipogenic di differentiation,differentiation,fferentiation, expression expressionexpression of bothofof bothboth CYP3A4 CYP3A4CYP3A4 and CYP27A1 andand CYP27A1CYP27A1 could not couldcould be detected notnot bebe detecteddetected(Figure6 ).(Figure(Figure On the 6).6). other OnOn thethe hand, otherother the hand,hand, presence thethe presencepresence of metformin ofof metforminmetformin alone or alonealone together oror togethertogether with vitamin withwith vitaminvitamin D in the DD inindi ffthetheerentiation differentiationdifferentiation medium mediummedium increased increasedincreased the expression thethe expresexpres of thesesionsion enzymes ofof thesethese involved enzymesenzymes in involved theinvolved first 25-hydroxylation inin thethe firstfirst 25-25- hydroxylationhydroxylation ofof vitaminvitamin D.D. InIn partparticularicular forfor CYP3A4,CYP3A4, thethe levelslevels ofof expressionexpression areare clearlyclearly evidentevident inin

Int.Int. J. J.Mol. Mol. Sci. Sci. 20202020, 21, 21, x, FOR 6181 PEER REVIEW 6 6of of 13 13

ADSCsInt. J. Mol. cultured Sci. 2020, in21 ,the x FOR presence PEER REVIEW of the two molecules, as compared to ADSCs cultured in adipogenic6 of 13 differentiationof vitamin D. Inmedium particular (MD) for alone. CYP3A4, the levels of expression are clearly evident in ADSCs cultured ADSCsin the presence cultured ofin thethe twopresence molecules, of the astwo compared molecule tos, as ADSCs compared cultured to ADSCs in adipogenic cultured diinﬀ adipogenicerentiation differentiationmedium (MD) medium alone. (MD) alone.

Figure 6. Analysis of CYP450 after 21 days in culture. Immunohistochemical analysis of the expression

of CYP27A1 and CYP3A4 was assessed in ADSCs cultured in the basic growing medium (MG) or and Figure 6. Analysis of CYP450 after 21 days in culture. Immunohistochemical analysis of the expression inFigure the differentiation 6. Analysis of CYP450medium after (MD) 21 daysor the in culture.differentiation Immunohistochemical medium plus vitamin analysis Dof (MD+VIT)the expression or of CYP27A1 and CYP3A4 was assessed in ADSCs cultured in the basic growing medium (MG) or and in metforminof CYP27A1 (MD+MET) and CYP3A4 or waswith assessed both vitamin in ADSCs D and cult uredmetformin in the basic(MD+VIT+MET). growing medium The (MG)figures or areand the differentiation medium (MD) or the differentiation medium plus vitamin D (MD+VIT) or metformin representativein the differentiation of different medium independent (MD) or theexperime differentiationnts. Nuclei medium are labelled plus vitamin with 4,6-diamidino-2- D (MD+VIT) or (MD+MET) or with both vitamin D and metformin (MD+VIT+MET). The figures are representative phenylindolemetformin (MD+MET) (DAPI, blue). or Scalewith bars:both 40vitamin µm. D and metformin (MD+VIT+MET). The figures are representativeof different independent of different experiments. independent Nuclei experime are labellednts. Nuclei with 4,6-diamidino-2-phenylindoleare labelled with 4,6-diamidino-2- (DAPI, blue). Scale bars: 40 µm. 2.7. Metforminphenylindole Counteract (DAPI, blue).Fat Droplet Scale bars: Accumulation 40 µm. 2.7. Metformin Counteract Fat Droplet Accumulation 2.7. FigureMetformin 7 showsCounteract that Fat during Droplet adipogenic Accumulation commi tment, the presence of metformin or both metforminFigure and7 shows vitamin that D during in ADSCs adipogenic exposed commitment, to the MD, the is presenceable to counteracted of metformin intracellular or both metformin lipid Figure 7 shows that during adipogenic commitment, the presence of metformin or both accumulation.and vitamin DAs in shown, ADSCs cells exposed cultured to the in MD,the presen is ablece to of counteracted MD alone showed intracellular a higher lipid number accumulation. of lipid metformin and vitamin D in ADSCs exposed to the MD, is able to counteracted intracellular lipid droplets,As shown, as cellscompared cultured to contol in the presenceuntreated of undiffe MD alonerentiated showed cells. a higherMetformin number was ofable lipid to droplets,inhibit accumulation. As shown, cells cultured in the presence of MD alone showed a higher number of lipid adipogenesisas compared toof contolADSCs, untreated but this undi effectfferentiated was higher cells. Metformin when the was two able molecules to inhibit adipogenesiswere added of droplets, as compared to contol untreated undifferentiated cells. Metformin was able to inhibit simultaneouslyADSCs, but this toe theffect MD. was higher when the two molecules were added simultaneously to the MD. adipogenesis of ADSCs, but this effect was higher when the two molecules were added simultaneously to the MD.

Figure 7. Effect of metformin and vitamin D on lipid accumulation in ADSCs during adipogenic Figure 7. Effect of metformin and vitamin D on lipid accumulation in ADSCs during adipogenic differentiation. (A) shows the lipid accumulation in ADSCs cultured in the basic growing medium (MG) differentiation. (A) shows the lipid accumulation in ADSCs cultured in the basic growing medium or and in the differentiation medium (MD) or the differentiation medium plus vitamin D (MD+VIT) (MG)Figure or 7.and Effect in theof metformindifferentiation and mediumvitamin D(MD) on lipid or the accumulation differentiation in ADSCsmedium during plus vitaminadipogenic D or metformin (MD+MET) or with both vitamin D and metformin (MD+VIT+MET). Scale bar 100 µm. (MD+VIT)differentiation. or metformin (A) shows (MD+MET) the lipid accumulationor with both vitaminin ADSCs D andcultured metformin in the (MD+VIT+MET).basic growing medium Scale The amount of lipid accumulation and (B) was calculated using ImageJ. Data are expressed as mean SD. (MG) or and in the differentiation medium (MD) or the differentiation medium plus vitamin± D (MD+VIT) or metformin (MD+MET) or with both vitamin D and metformin (MD+VIT+MET). Scale

Int. J. Mol. Sci. 2020, 21, 6181 7 of 13

3. Discussion Adipose-derived stem cells (ADSCs) represent a prominent resource for autologous and allogenic transplantation, due to their proliferative and regenerative capabilities [25]. In the adipose tissue, ADSCs represent a fraction of the entire resident population, that can undergo differentiation under specific external stimuli [26]. In the niche in which they reside, ADSCs are responsible for maintaining adipose tissue physiology and its renewal [27]. Moreover, in recent years, different kind of isolation procedures of these cells from the stromal vascular fraction (SVF) have been optimized in order to easily obtain a high yield of stem cells with a higher differentiation potential, as compared to stem cells from other sources [25,28–30]. In physiological conditions, ADSCs are involved in the process of adipogenesis, differentiating in pre-adipocytes and mature adipocytes maintaining the homeostasis of adipose tissue [31]. Alterations in ADSC differentiation and in adipose tissue physiology are related to a state of low-grade inflammation and diabetes, leading to obesity [32]. Understanding the molecular mechanisms involved in these alterations could contribute in controlling adipogenesis and its related metabolic complications, as cardiovascular risk. Within this context, we previously demonstrated that the combination of melatonin and vitamin D is able to counteract adipogenic differentiation in ADSCs, reducing cytoplasmatic fatty acid accumulation and maintaining the pluripotency of stem cells [33,34]. In the present paper, we evaluated the effect of metformin and vitamin D, alone or in combination, on ADSC adipogenic differentiation. Metformin is a well-known drug used in the management of obesity, for its capability in reducing body weight in obese patients [35,36]. In addition, vitamin D supplementation has been shown to induce a decrease in weight and body mass index (BMI), reducing the risk of developing type 2 diabetes, cardiovascular diseases, and hypertension [37]. Furthermore, it is demonstrated that obesity is associated with low levels of circulating vitamin D, and with a reduced activity of CYP450 involved in its activation [38–40]. To become biologically active, vitamin D must be converted in 1,25-dihydroxyvitamin D (1,25(OH)2D3). CYP3A4 is considered the most important drug-metabolizing cytochrome P450, with a vitamin D 25-hydroxylase activity [41,42], as well as CYP27A1, both being distributed in various tissues [43]. Once converted in 25-hydroxyvitamin D3, vitamin D must be converted in 1,25(OH)2D3. This second step involves another 1α- hydroxylase, known as CYP27B1 [44]. Our experiments showed that, during adipogenic differentiation, the presence of metformin within ADSC differentiation medium, alone or in combination with vitamin D, was able to significantly increase the expression of CYP3A4, even at the molecular level, and that of CYP27A1, as compared to cells cultured in the presence of the adipogenic differentiation medium alone (Figure2, Panel A and Figure6). We also highlight that the gene expression levels of CYP27B1 were induced by metformin with or without vitamin D during the first 7 days of the differentiation procedure (Figure2, Panel B). The capability of the two molecules to counteract adipogenic di fferentiation was further inferred by the significant downregulation of the main markers of the adipogenic phenotype, PPAR- γ (Figure1, Panel D), ASC-1 and PAT2 (Figure5), and lipid droplet accumulation (Figure7). Concomitantly, the maintenance of the multipotent state was assessed by the increased expression of stemness-related genes, Oct-4, Sox2, and NANOG, whose mRNA levels were significantly upregulated along with all the differentiation period when metformin alone or with vitamin D were present (Figure1, Panels A, B, and C). To this end, the stemness-related genes undergo a significant downregulation when stem cells are committed toward a specific phenotype [45]. We then evaluated the effect of metformin and vitamin D in the modulation of epigenetic genes, HDAC1 and Sirtuins. Other authors previously described that reduced HDAC1, SIRT1, and SIRT2 expression promotes adipogenesis and accumulation of visceral fat in human obesity [46,47]. Here, we show that ADSC exposure to metformin and vitamin D increases the expression of all the above-mentioned epigenetic modulators (Figure3), suggesting their involvement in blocking adipogenic differentiation. A crucial role in the process of adipogenesis is played by miRNAs. Here, we investigated the expression of miR-145 and miR-148, whose levels were respectively up and downregulated in ADSCs exposed to metformin, together with vitamin D (Figure4). Other authors previously demonstrated that miR-145 is downregulated during in vivo and in vitro adipogenesis, while its upregulation inhibits adipogenesis by reducing the activity of PI3K/Akt Int. J. Mol. Sci. 2020, 21, 6181 8 of 13 and MAPK signaling pathways [15,16]. Even miR-148a expression is influenced by lipid accumulation. When upregulated, miR-148a promotes adipogenic differentiation, while inhibiting preadipocytes differentiation when downregulated [17,48]. Our results suggest a synergic role of metformin and vitamin D in counteracting adipogenic differentiation, by modulating specific miRNAs, in particular, upregulating the expression of miR-145 and downregulating miR-148. Thus, we could hypothesize that metformin and vitamin D could interfere in an interesting network involving miRNAs and adipogenic orchestrator genes.

4. Materials and Methods

4.1. Cell Isolation and Treatment ADSCs were isolated from subcutaneous adipose tissue of human male and female patients (n = 6, age = 45 15 years, BMI: 22 3 kg/m2), as previously described [16], after signed written ± ± informed consent. Briefly, the harvested tissue was washed twice with sterile Dulbecco’s phosphate buffered saline (DPBS) (Euroclone, Milano, Italy) containing 200 U/mL penicillin and 0.1 mg/mL streptomycin (Euroclone, Milano, Italy) and then processed by mechanical and enzymatic digestion in collagenase type I (Gibco Life Technologies, Grand Island, NY, USA). The digested samples were then centrifuged 10 min at 600 g and the stromal vascular fraction (SVF) containing ADSCs was × resuspended in a basic growing medium composed of Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies Grand Island, NY, USA) supplemented with 20% fetal bovine serum (FBS) (Life Technologies, Grand Island, NY, USA), 200 mM L-glutamine (Euroclone, Milano, Italy), and 200 U/mL penicillin—0.1 mg/mL streptomycin (Euroclone, Milano, Italy). The culture medium was changed every 3 days and, when cells reached the confluence, they were immunomagnetically selected with a primary monoclonal anti-c/kit (CD117) antibody (MicroBeads, MACS Miltenyi Biotec, Bologna, Italy), and characterized by flow cytometry with primary antibodies directed against CD73, CD90, CD105, CD45, and CD31, as previously described [33]. The resulting ADSCs were used to performed next experiments. A group of cells used as the undifferentiated control was maintained in a basic growing medium (MG). A group of cells was differentiated towards the adipogenic phenotype using a specific conditioned differentiation medium (MD) (StemPro Adipocyte Differentiation Medium, Gibco Life Technologies, Grand Island, NY, USA), as positive control of adipogenic differentiation. Other groups of cells were exposed to MD in combination with other molecules, 10–6 M vitamin D (Sigma Aldrich Chemie GmbH, Munich, Germany) or 5 mM metformin (Sigma Aldrich Chemie GmbH, Munich, Germany) or both (MD+VIT; MD+MET; MD+VIT+MET). All the experiments were performed two times (in three technical replicates), separately for each sample.

4.2. Gene Expression Analysis Gene expression analysis was performed in ADSCs exposed to the above described conditions after 7, 14, and 21 days in culture. Total RNA was extracted using ChargeSwitch Nucleic Acid Purification Technology (Thermo Fisher Scientific, Grand Island, NY, USA) according to the manufacturer’s instructions and quantified by NanoDrop™ One/OneC Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Grand Island, NY, USA). Then, 1 µg of RNA from each treatment was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Grand Island, NY, USA). Quantitative real-time PCR was performed in triplicate using a CFX Thermal Cycler (Bio-Rad, Hercules, CA, USA) under standard qRT-PCR conditions specified in Platinum® Quantitative PCR SuperMix-UDG Kit protocol (Thermo Fisher Scientific, Grand Island, NY, USA) (50 ◦C for 2 min, 95 ◦C for 2 min, and then cycled at 95 ◦C for 15 s, 55–59 ◦C for 30 s, and 60 ◦C for 1 min, for 40 cycles). Target Ct values of each sample were normalized on hGAPDH, considered as a reference gene, whose expression did not show any variation during adipogenesis, although some authors have observed variations in its expression during differentiation [49]. The mRNA levels of ∆∆Ct ADSCs treated with the previous described condition were expressed as fold of change (2− ) of Int. J. Mol. Sci. 2020, 21, 6181 9 of 13 the mRNA levels observed in undifferentiated ADSCs at time 0, define as a control. All primers were designed with Primer3, spanning all exons and highly specific. They are from Invitrogen and are described in Table1. The qRT-PCR analysis was performed for the following genes: octamer-binding transcription factor 4 (Oct-4); sex determining region Y-box 2 (Sox2); homeobox protein Nanog (NANOG); peroxisome proliferator-activated receptor gamma (PPAR-γ), histone deacetylases class I (HDAC1); histone deacetylases class III or Sirtuins (SIRT 1 and 2); cytochrome P450 family 3 subfamily A member 4 (CYP3A4), and cytochrome P450 family 27 subfamily B member 1 (CYP27B1).

Table 1. Primers sequences.

Primer Name Forward Reverse hGAPDH GAGTCAACGGAATTTGGTCGT GACAAGCTTCCCGTTCTCAG Oct-4 GAGGAGTCCCAGGCAATCAA CATCGGCCTGTGTATATCCC Sox2 CCGTTCATGTAGGTCTCGGAGCTG CAACGGCAGCTACAGCTAGATGC NANOG CATGAGTGTGGATCCAGCT CCTGAATAAGCAGATCCAT PPAR-γ AATCCGTCTTCATCCACAGG GTGAAGACCAGCCTCTTTGC HDAC1 ACTGCTAAAGTATCACCAGAGGG CACACTTGGCGTGTCCTTTG SIRT1 CATTTTCCATGGCGCTGAGG TGCTGGTGGAACAATTCCTGT SIRT2 TTGCTGAGCTCCTTGGATGG GGGGAGGGAGCTGTAAGAGA CYP3A4 TAGCCCAGCAAAGAGCAACA CAAAAGGCCTCCGGTTTGTG CYP27B1 CCTGAACCAGACCATGACCC GAGCCTTTGCCATTCTTCGC

4.3. miRNA Expression The level of expression of hsa-miR-145-5p (miR-145) and hsa-miR-148a-3p (miR-148) was evaluated using a reverse transcription followed by polymerase chain reaction (RT-PCR) using TaqMan® MicroRNA Reverse Transcription Kit, (Thermo Fisher Scientific, Grand Island, NY, USA) as previously described [50]. RNA was extracted from cells using Mirvana MIRNA ISO Kit 10-40ISO (Life Technologies) according to manufacturer’s instructions and are described in Table2. The raw Ct values for each miRNA and U6snRNA were checked for normal distribution. The Kruskal–Wallis test and Wilcoxon signed-rank test were applied to compare the groups at different times of observation, assuming a p value < 0.05 as statistically significant. All the analysis and graphics were performed with the Statistical Package for the Social Sciences (SPSS) software version 13.0 (SPSS Inc., Chicago, IL, USA).

Table 2. miRNA accession numbers, symbols, and sequences.

Accession ID Number Symbol Sequence MIMAT0000437 hsa-miR-145-5p GUCCAGUUUUCCCAGGAAUCCCU MIMAT0000243 hsa-miR-148a-3p UCAGUGCACUACAGAACUUUGU

4.4. Immunostaining ADSCs were cultured for 21 days with different described condition and fixed with 4% of paraformaldehyde (Sigma Aldrich Chemie GmbH, Hamburg, Germany) for 30 min at room temperature. After permeabilization by 0.1% Triton X-100 (Thermo Fisher Scientific, Grand Island, NY, USA) -PBS, cells were washed in PBS three times for 5 min. After washing, ADSCs were incubated with 3% bovine serum albumin (BSA)—0.1% triton X-100 in PBS (Thermo Fisher Scientific, Grand Island, NY, USA) for 30 min and then exposed overnight at 4 ◦C to the primary anti-mouse monoclonal antibodies directed against activating signal cointegrator-1 (ASC-1) (Santa Cruz Biotechnology, Heidelberg, Germany), proton-coupled amino acid transporter (PAT2) (Santa Cruz Biotechnology), CYP27A1 (Abcam, Cambridge, UK), and CYP3A4 (Abcam, Cambridge, UK). Finally, cells were washed two times in PBS for 5 min and stained at 37 ◦C for 1 h in the dark with the fluorescence-conjugated goat anti rabbit IgG secondary antibody (Life Technologies, USA) and goat anti mouse IgG secondary antibody Int. J. Mol. Sci. 2020, 21, 6181 10 of 13

(Life Technologies, USA). Nuclei were labelled with 1 µg/mL 4,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientiﬁc, Grand Island, NY, USA). All microscopy analyses were performed with a confocal microscope (TCS SP5, Leica, Nussloch, Germany).

4.5. Oil Red Staining To evaluate the lipid droplet accumulation, ADSCs were cultured for 21 days in the above described conditions. After 21 days, cells were ﬁxed for 30 min at RT in 10% formalin, then washed twice in H2O and in 60% isopropanol for 5 min. Cells were then incubated in oil red solution for 15 min at RT and washed once with H2O to removed excess solution. Adipogenesis was evaluated under light microscopy and analysis of lipid accumulation was performed using image analysis software ImageJ, version 1.8.0 (ImageJ, National Institutes of Health, United States Department of Health and Human Services, USA).

4.6. Statistical Analysis Statistical analysis was performed using Statistical Package for the Social Sciences version 13 software (SPSS Inc., Chicago, IL, USA). The experiments were performed two times with three technical replicates for each treatment. For this study, the distributions of each group variance were evaluated with the non-parametric Kruskal–Wallis rank sum and Wilcoxon signed-rank test, assuming a p value < 0.05 as statistically signiﬁcant.

5. Conclusions Adipogenesis involves several cellular modifications, lipid accumulation, and altered gene expression levels. miRNAs and epigenetic modulators, as HDAC and Sirtuins, promote stem cell differentiation, through modulation of stemness-related genes. Understanding the molecular mechanisms involved in stem cell differentiation processes is a major challenge in the development of regenerative medicine. In the present paper, we exposed ADSCs to a combination of different molecules in the attempt to modulate adipogenic differentiation, and provide novel cues that could be exploited to ameliorate adipogenesis-related metabolic syndrome. Our findings describe for the first time specific miRNAs, as target for metformin and vitamin D, disclosing future application for these molecules in pathological conditions involving miR-145 and miR-148a.

Author Contributions: Conceptualization, S.C. and M.M.; methodology, G.G., F.B., R.P. and E.B.; software, S.C., F.B.; validation, C.V. and M.M.; investigation, S.C., G.C.G.; resources, G.C.G., M.L.C.; data curation, S.C.; writing—original draft preparation, S.C.; writing—review and editing, C.V., M.M.; supervision, M.M. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by “Fondo di Ateneo per la ricerca 2019”. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References

1. El-Badawy, A.; Amer, M.; Abdelbaset, R.; Sherif, S.N.; Abo-Elela, M.; Ghallab, Y.H.; Elhamid, H.A.; Ismail, Y.; El-Badri, N. Adipose Stem Cells Display Higher Regenerative Capacities and More Adaptable Electro-Kinetic Properties Compared to Bone Marrow-Derived Mesenchymal Stromal Cells. Sci. Rep. 2016, 6, 37801. [CrossRef] 2. Cruciani, S.; Santaniello, S.; Montella, A.; Ventura, C.; Maioli, M. Orchestrating stem cell fate: Novel tools for regenerative medicine. World J. Stem Cells 2019, 11, 464–475. [CrossRef] 3. Tang, Q.-Q.; Lane, M.D. Adipogenesis: From Stem Cell to Adipocyte. Annu. Rev. Biochem. 2012, 81, 715–736. [CrossRef] 4. Kozlowska, U.; Krawczenko, A.; Futoma, K.; Jurek, T.; Rorat, M.; Patrzalek, D.; Klimczak, A. Similarities and diﬀerences between mesenchymal stem/progenitor cells derived from various human tissues. World J. Stem Cells 2019, 11, 347–374. [CrossRef] Int. J. Mol. Sci. 2020, 21, 6181 11 of 13

5. Rinaldi, S.; Maioli, M.; Santaniello, S.; Pigliaru, G.; Ventura, C.; Montela, A.; Sanna, R.; Bandiera, P.; Bagella, L.; Delitala, A.P.; et al. Amniotic fluid stem cells morph into a cardiovascular lineage: Analysis of a chemically induced cardiac and vascular commitment. Drug Des. Dev. Ther. 2013, 7, 1063–1073. [CrossRef] 6. Lefterova, M.I.; Haakonsson, A.K.; Lazar, M.A.; Mandrup, S. PPARγ and the global map of adipogenesis and beyond. Trends Endocrinol. Metab. 2014, 25, 293–302. [CrossRef] 7. Ussar, S.; Lee, K.; Dankel, S.N.; Boucher, J.; Haering, M.-F.; Kleinridders, A.; Thomou, T.; Xue, R.; Macotela, Y.; Cypess, A.M.; et al. ASC-1, PAT2, and P2RX5 are cell surface markers for white, beige, and brown adipocytes. Sci. Transl. Med. 2014, 6, 247ra103. [CrossRef] 8. Ma, X.; Lee, P.; Chisholm, D.J.; James, D.E. Control of Adipocyte Differentiation in Different Fat Depots; Implications for Pathophysiology or Therapy. Front. Endocrinol. 2015, 6, 1. [CrossRef][PubMed] 9. Choe, S.S.; Huh, J.Y.; Hwang, I.J.; Kim, J.I.; Kim, J.B. Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders. Front. Endocrinol. 2016, 7, 9. [CrossRef] 10. Pereira-Santos, M.; Costa, P.R.D.F.; Assis, A.M.O.; Santos, C.A.S.T.; Santos, D.B. Obesity and vitamin D deficiency: A systematic review and meta-analysis. Obes. Rev. 2015, 16, 341–349. [CrossRef] 11. Abbas, M.A. Physiological functions of Vitamin D in adipose tissue. J. Steroid Biochem. Mol. Boil. 2017, 165, 369–381. [CrossRef] 12. Jones, G.; Prosser, D.E.; Kaufmann, M. Cytochrome P450-mediated metabolism of vitamin D. J. Lipid Res. 2013, 55, 13–31. [CrossRef] 13. McGregor, R.A.; Choi, M.-S. microRNAs in the Regulation of Adipogenesis and Obesity. Curr. Mol. Med. 2011, 11, 304–316. [CrossRef] 14. Iacomino, G.; Siani, A. Role of microRNAs in obesity and obesity-related diseases. Genes Nutr. 2017, 12, 23. [CrossRef] 15. Wang, L.; Zhang, S.; Cheng, G.; Mei, C.; Li, S.; Zhang, W.; Junjvlieke, Z.; Zan, L.; Zainaguli, J. MiR-145 reduces the activity of PI3K/Akt and MAPK signaling pathways and inhibits adipogenesis in bovine preadipocytes. Genomics 2020, 112, 2688–2694. [CrossRef] 16. Guo, Y.; Chen, Y.; Zhang, Y.; Zhang, Y.; Chen, L.; Mo, D. Up-regulated miR-145 Expression Inhibits Porcine Preadipocytes Differentiation by Targeting IRS1. Int. J. Boil. Sci. 2012, 8, 1408–1417. [CrossRef] 17. Shi, C.; Zhang, M.; Tong, M.; Yang, L.; Pang, L.; Chen, L.; Xu, G.; Chi, X.; Hong, Q.; Ni, Y.; et al. miR-148a is Associated with Obesity and Modulates Adipocyte Differentiation of Mesenchymal Stem Cells through Wnt Signaling. Sci. Rep. 2015, 5, 9930. [CrossRef] 18. Ferrari, A.; Longo, R.; Peri, C.; Coppi, L.; Caruso, D.; Mai, A.; Mitro, N.; De Fabiani, E.; Crestani, M. Inhibition of class I HDACs imprints adipogenesis toward oxidative and brown-like phenotype. Biochim. Biophys. Acta BBA Mol. Cell Boil. Lipids 2020, 1865, 158594. [CrossRef] 19. Zhou, Y.; Song, T.; Peng, J.; Zhou, Z.; Wei, H.; Zhou, R.; Jiang, S.; Peng, J. SIRT1 suppresses adipogenesis by activating Wnt/β-catenin signaling in vivo and in vitro. Oncotarget 2016, 7, 77707–77720. [CrossRef] [PubMed] 20. Bäckesjö, C.-M.; Li, Y.; Lindgren, U.; Haldosén, L.-A. Activation of Sirt1 Decreases Adipocyte Formation during Osteoblast Differentiation of Mesenchymal Stem Cells. Cells Tissues Organs 2008, 189, 93–97. [CrossRef] 21. Wang, F.; Tong, Q. SIRT2 Suppresses Adipocyte Differentiation by Deacetylating FOXO1 and Enhancing FOXO1’s Repressive Interaction with PPARγ. Mol. Boil. Cell 2009, 20, 801–808. [CrossRef] 22. Alexandre, K.B.; Smit, A.M.; Gray, I.P.; Crowther, N.J. Metformin inhibits intracellular lipid accumulation in the murine pre-adipocyte cell line, 3T3-L1. Diabetes Obes. Metab. 2008, 10, 688–690. [CrossRef] 23. Chen, D.; Wang, Y.; Wu, K.; Wang, X. Dual Effects of Metformin on Adipogenic Differentiation of 3T3-L1 Preadipocyte in AMPK-Dependent and Independent Manners. Int. J. Mol. Sci. 2018, 19, 1547. [CrossRef] [PubMed] 24. Fujita, K.; Iwama, H.; Oura, K.; Tadokoro, T.; Hirose, K.; Watanabe, M.; Sakamoto, T.; Katsura, A.; Mimura, S.; Nomura, T.; et al. Metformin-suppressed differentiation of human visceral preadipocytes: Involvement of microRNAs. Int. J. Mol. Med. 2016, 38, 1135–1140. [CrossRef][PubMed] 25. Mazini, L.; Rochette, L.; Amine, M.; Malka, G. Regenerative Capacity of Adipose Derived Stem Cells (ADSCs), Comparison with Mesenchymal Stem Cells (MSCs). Int. J. Mol. Sci. 2019, 20, 2523. [CrossRef][PubMed] 26. Kolf, C.M.; Cho, E.; Tuan, R.S. Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: Regulation of niche, self-renewal and differentiation. Arthritis Res. Ther. 2007, 9, 204. [CrossRef][PubMed] Int. J. Mol. Sci. 2020, 21, 6181 12 of 13

27. Panina, Y.A.; Yakimov, A.S.; Komleva, Y.K.; Morgun, A.V.; Lopatina, O.L.; Malinovskaya, N.A.; Shuvaev, A.N.; Salmin, V.V.;Taranushenko, T.E.; Salmina, A.B. Plasticity of Adipose Tissue-Derived Stem Cells and Regulation of Angiogenesis. Front. Physiol. 2018, 9, 30. [CrossRef][PubMed] 28. Trivisonno, A.; Alexander, R.W.; Baldari, S.; Cohen, S.R.; Di Rocco, G.; Gentile, P.; Magalon, G.; Magalon, J.; Miller, R.B.; Womack, H.; et al. Intraoperative Strategies for Minimal Manipulation of Autologous Adipose Tissue for Cell- and Tissue-Based Therapies: Concise Review. STEM CELLS Transl. Med. 2019, 8, 1265–1271. [CrossRef][PubMed] 29. Aronowitz, J.A.; Lockhart, R.A.; Hakakian, C.S. Mechanical versus enzymatic isolation of stromal vascular fraction cells from adipose tissue. SpringerPlus 2015, 4, 713. [CrossRef] 30. Bianchi, F.; Maioli, M.; Leonardi, E.; Olivi, E.; Pasquinelli, G.; Valente, S.; Mendez, A.J.; Ricordi, C.; Raffaini, M.; Tremolada, C.; et al. A New Nonenzymatic Method and Device to Obtain a Fat Tissue Derivative Highly Enriched in Pericyte-Like Elements by Mild Mechanical Forces from Human Lipoaspirates. Cell Transplant. 2013, 22, 2063–2077. [CrossRef] 31. Rodriguez, A.-M.; Elabd, C.; Amri, E.-Z.; Ailhaud, G.; Dani, C. The human adipose tissue is a source of multipotent stem cells. Biochimie 2005, 87, 125–128. [CrossRef][PubMed] 32. Ruiz-Ojeda, F.J.; Rupérez, A.I.; Gomez-Llorente, C.; Gil, Á.; Aguilera, C.M. Cell Models and Their Application for Studying Adipogenic Differentiation in Relation to Obesity: A Review. Int. J. Mol. Sci. 2016, 17, 1040. [CrossRef][PubMed] 33. Basoli, V.; Santaniello, S.; Cruciani, S.; Ginesu, G.C.; Cossu, M.L.; Delitala, A.P.; Serra, P.A.; Ventura, C.; Maioli, M. Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells. Int. J. Mol. Sci. 2017, 18, 981. [CrossRef][PubMed] 34. Santaniello, S.; Cruciani, S.; Basoli, V.; Balzano, F.; Bellu, E.; Garroni, G.; Ginesu, G.C.; Cossu, M.L.; Facchin, F.; Delitala, A.P.; et al. Melatonin and Vitamin D Orchestrate Adipose Derived Stem Cell Fate by Modulating Epigenetic Regulatory Genes. Int. J. Med Sci. 2018, 15, 1631–1639. [CrossRef][PubMed] 35. Desilets, A.R.; Dhakal-Karki, S.; Dunican, K.C. Role of Metformin for Weight Management in Patients Without Type 2 Diabetes. Ann. Pharmacother. 2008, 42, 817–826. [CrossRef][PubMed] 36. Park, M.H.; Kinra, S.; Ward, K.J.; White, B.; Viner, R.M. Metformin for Obesity in Children and Adolescents: A Systematic Review. Diabetes Care 2009, 32, 1743–1745. [CrossRef] 37. Entezari, M.H.; Khosravi, Z.S.; Kafeshani, M.; Tavasoli, P.; Zadeh, A.H. Effect of Vitamin D supplementation on weight loss, glycemic indices, and lipid profile in obese and overweight women: A clinical trial study. Int. J. Prev. Med. 2018, 9, 63. [CrossRef] 38. Earthman, C.P.; Beckman, L.M.; Masodkar, K.; Sibley, S.D. The link between obesity and low circulating 25-hydroxyvitamin D concentrations: Considerations and implications. Int. J. Obes. 2011, 36, 387–396. [CrossRef] 39. Wortsman, J.; Matsuoka, L.Y.; Chen, T.C.; Lu, Z.; Holick, M.F. Decreased bioavailability of vitamin D in obesity. Am. J. Clin. Nutr. 2000, 72, 690–693. [CrossRef] 40. Szymczak-Pajor, I.; Sliwińska,A.´ Analysis of Association between Vitamin D Deficiency and Insulin Resistance. Nutrients 2019, 11, 794. [CrossRef] 41. Gupta, R.P.; Hollis, B.W.; Patel, S.; Patrick, K.S.; Bell, N.H. CYP3A4 is a Human Microsomal Vitamin D 25-Hydroxylase. J. Bone Miner. Res. 2003, 19, 680–688. [CrossRef][PubMed] 42. Wang, Z.; Schuetz, E.G.; Xu, Y.; Thummel, K.E. Interplay between vitamin D and the drug metabolizing enzyme CYP3A4. J. Steroid Biochem. Mol. Boil. 2012, 136, 54–58. [CrossRef][PubMed] 43. Schuster, I. Cytochromes P450 are essential players in the vitamin D signaling system. Biochim. Biophys. Acta BBA Proteins Proteom. 2011, 1814, 186–199. [CrossRef][PubMed] 44. Prosser, D.E.; Jones, G. Enzymes involved in the activation and inactivation of vitamin D. Trends Biochem. Sci. 2004, 29, 664–673. [CrossRef] 45. Maioli, M.; Rinaldi, S.; Santaniello, S.; Castagna, A.; Pigliaru, G.; Delitala, A.P.; Bianchi, F.; Tremolada, C.; Fontani, V.; Ventura, C. Radioelectric Asymmetric Conveyed Fields and Human Adipose-Derived Stem Cells Obtained with a Nonenzymatic Method and Device: A Novel Approach to Multipotency. Cell Transplant. 2014, 23, 1489–1500. [CrossRef] Int. J. Mol. Sci. 2020, 21, 6181 13 of 13

46. Perrini, S.; Porro, S.; Nigro, P.; Cignarelli, A.; Caccioppoli, C.; Genchi, V.A.; Martines, G.; De Fazio, M.; Capuano, P.; Natalicchio, A.; et al. Reduced SIRT1 and SIRT2 expression promotes adipogenesis of human visceral adipose stem cells and associates with accumulation of visceral fat in human obesity. Int. J. Obes. 2019, 44, 307–319. [CrossRef] 47. Yoo, E.J.; Chung, J.-J.; Choe, S.S.; Kim, K.H.; Kim, J.B. Down-regulation of Histone Deacetylases Stimulates Adipocyte Diﬀerentiation. J. Boil. Chem. 2006, 281, 6608–6615. [CrossRef] 48. He, H.; Cai, M.; Zhu, J.; Xiao, W.; Liu, B.; Shi, Y.; Yang, X.; Liang, X.; Zheng, T.; Hu, S.; et al. miR-148a-3p promotes rabbit preadipocyte diﬀerentiation by targeting PTEN. Vitr. Cell. Dev. Boil. Anim. 2018, 54, 241–249. [CrossRef] 49. Ferguson, B.S.; Nam, H.; Hopkins, R.G.; Morrison, R.F. Impact of Reference Gene Selection for Target Gene Normalization on Experimental Outcome Using Real-Time qRT-PCR in Adipocytes. PLoS ONE 2010, 5, e15208. [CrossRef] 50. Balzano, F.; Campesi, I.; Cruciani, S.; Garroni, G.; Bellu, E.; Giudici, S.D.; Angius, A.; Oggiano, A.; Rallo, V.; Capobianco, G.; et al. Epigenetics, Stem Cells, and Autophagy: Exploring a Path Involving miRNA. Int. J. Mol. Sci. 2019, 20, 5091. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).