DOCSLIB.ORG

OCCURRENCE of TURNIP MOSAIC VIRUS in PHALAENOPSIS Sp. in CHINA

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
OCCURRENCE of TURNIP MOSAIC VIRUS in PHALAENOPSIS Sp. in CHINA Journal of Plant Pathology (2017), 99 (3), 703-706 Edizioni ETS Pisa, 2017 703 OCCURRENCE OF TURNIP MOSAIC VIRUS IN PHALAENOPSIS sp. IN CHINA G.H. Zheng1*, D.W. Peng2*, Q.X. Tong1, 3, Z.Z. Zheng1 and Y.L. Ming1, 3 1 Xiamen Overseas Chinese Subtropical Plant Introduction Garden, National Plant Introduction Quarantine Base, Xiamen Key Laboratory for Plant Introduction, Quarantine and Natural Products, Xiamen, 361002, Fujian, China 2 School of Ophthalmology and Optometry, Eye Hospital, Wenzhou Medical University, Wenzhou, 325027, Zhejiang, China 3 College of Chemical Engineering, Huaqiao University, Xiamen, 361021, Fujian, China * The authors have contributed equally to the this study and should therefore be regarded as equivalent authors SUMMARY TuMV has great genetic versatility in adapting to dif- ferent environments and breaking host resistance. For A turnip mosaic virus (TuMV) isolate from asymptom- example, TuMV with just a single-nucleotide mutation in atic Phalaenopsis sp. was detected by indirect ELISA. Its the cylindrical inclusion gene (CI) can overcome the resis- presence was confirmed by RT-PCR with a pair of degen- tance gene TuRB01 (Walsh et al., 2002). A single mutation erate primers whose design was based on reported coat (+ 3394 T > C) in the viral P3 protein induces local necrotic protein gene sequences. Further analysis of the genomic lesions and overcomes extreme resistance in Brassica napus. sequence of this isolate designated as TuMV-ZH1 (Gen- Such a change results in systemic non-necrotic infection Bank accession No. KF246570) showed a high nucleotide when another mutation (+ 5447 T > C) in CI protein is in- sequence identity with isolate Lu2 (96.7%) and CHN 12 troduced (Jenner et al., 2002). (96.3%) from China. Phylogenetic analysis indicated that TuMV can infect 13 species of orchid plants, including TuMV-ZH1 belongs to the world-B lineage. To the best of Aceras anthropophorum, Anacamptis pyramidalis, Barlia lon- our knowledge, the above may be the first indication that gibracteata, Calanthe sp., Ophrys speculum, Ophrys tenthre- TuMV infects orchids in China. In addition, proteins P1 dinifera, Orchis italica, Orchis morio, Orchis militaris, Orchis and P3 of TuMV-ZH1 are highly mutated as previously papilionaceae, Orchis simia, Cymbidium sp. and Pescatorea reported for other TuMV isolates. sp., in which it induces mosaic symptoms (Lesemann and Vetten, 1985; Inouye, 1992). A TuMV isolate, denoted Keywords: TuMV, coat protein, genome, phylogenetic TuMV-ZH1, was identified in Phalaenopsis sp. in a sur- analysis. vey for orchid pathogens in China. This paper describes INTRODUCTION Turnip mosaic virus (TuMV) is transmitted by at least 89 species of aphids in a non-persistent manner and is an important member of the genus Potyvirus (Walsh and Jen- ner, 2002). This virus infects more than 318 plant species of 156 genera in 43 families and it damages Cruciferae. TuMV is widespread in temperate and subtropical regions of five continents and occurs to most regions of China. Studies have shown that TuMV isolates can be grouped into two pathotypes designated as Brassica (B) and Brassi- ca-Raphanus (BR), and further subdivided into four geno- groups called basal-B, basal-BR, Asia-BR and world-B (Ohshima et al., 2002). Placing TuMV isolates into these groups has become the main classification method of this virus (Sanchez et al., 2007; Farzadfar et al., 2009; Wang et al., 2009). Corresponding author: Y.L. Ming Fig. 1. Electron micrograph of virus particles purified from Fax: + 86.0592.2063215 infected Phalaenopsis sp. TuMV-ZH1 particles are filamen- E-mail: [email protected] tous and measure 15-18 × 700-800 nm. 704 Turnip mosaic virus in Phalaenopsis sp. Journal of Plant Pathology (2017), 99 (3), 703-706 Table 1. Primers for genomic sequence amplification of TuMV-ZH1. Primers Sequence (5’→3’) Primers Sequence (5’→3’) TuMV1-1 F AAAAATATAAAAACTCAACACA F CCACAGGTACACGCACT R TATAATTGGTTGCTGCGCTCT TuMV5-2 R TCCGTACACTTCTCTACCCAT F ATGGCAGCAGTTACATTCGCATC F CAAAGTTTTCCGAACCCGTA TuMV-1 R GCATCGTACAACTTGCCTTCGT TuMV6-1 R ACGAGGTCCTTATTAGCTCT F AAAAGAACGGACGAAATTCGCAA F TCCCAGAGCGAGAAAACGAA TuMV-2 R CCGATTGCAAGTTTCCGTGACC TuMV6-2 R ATCCAAGTATTTTCCCGTCT F AGAAAGGCTACACCCAATACGAG F ATTAGCACGAAAGACGGCCAA TuMV-3 R CACGCTGTATCTGCCGCCTA TuMV-7 R ACCATCAGCATCGCAATACACC F AGTCTACCAGAACTCGTCGAA F ATTATTTCGCTGAGTTCACACC TuMV3-3 R CGACATCCAATTTGAGCCTT TuMV8-1 R ATAGTTGACTGCCAGTATGACC F ATGTATTCAAGTTTATCAATGTGCT F AGTTTGATAGCTCGTTGTCACC TuMV4-1 R TGTCTTTGTCACTCTCGTGT TuMV8-2 R CTGCTTCTGCCTCTCTCGTTC F CTAGAGCAACTGCCACGGAA F GCCAGCTCAAGAGGATCTCACC TuMV4-2 R CCACTACCCTGTGCGTTC TuMV-9 R CACCACATGCGCTAACACCA F CACACCACCAGGTCGAGA F TCAAACCGCTCATTGACCAC TuMV5-1 R TCGTGCATACTCACTAGCTG TuMV-10 R GTCCCTTGCATCCTATCAAAT Table 2. TuMV isolate sources analysed in this study. GenBank Isolate Country Original host plant Group accession No. CHN 12 China unknown world-B AY090660 Lu2 China Brassica sp. world-B HQ446216 UK1 UK Brassica napus world-B AF169561 C42J Japan Brassica rapa world-B AB093625 A1 Italy Alliaria officinalis basal-B AB093598 A102/11 Italy Anemone coronaria basal-B AB093597 Fig. 2. Genome organization and sequencing strategy of Cal1 Italy Campania officinalis basal-BR AB093601 TuMV-ZH1. The approximate position of each overlapping KYD81J Japan Raphanus sativus basal-BR AB093613 region amplified by primer sets is shown. SGD311J Japan Raphanus sativus Asian-BR AB093619 ND10J Japan Raphanus sativus Asian-BR AB252130 ringspot virus, odontoglossum ringspot virus, cymbid- ium mosaic virus, bean yellow mosaic virus, cucumber the identification process and the genomic sequence of mosaic virus and orchid fleck dichorhavirus) was also TuMV-ZH1 to clarify its origin and genetic features. performed. Virion purification. TuMV particles were purified from MATERIALS AND METHODS asymptomatic or symptom-showing leaves (Thompson et al., 1988), were negatively stained with phosphotungstic Collection of orchid plants. A total of 403 samples, acid (PTA) for 5 min and examined under a JEM2100 distributed among 19 orchid genera (Cymbidium, Dendro- transmission electron microscope (JEOL, Japan). bium, Cattleya, Paphiopedilum, Oncidium, Phalaenopsis, Vanda, Bulbophyllum, Coelogyne, Calanthe, Cephalan- RNA extraction and RT-PCR. Total plant RNAs thera, Phaius, Malaxis, Miltonia, Neofinetia, Gastrochilus, were extracted from TuMV-infected leaves with the Epidendrum, Rhynchostylis, Dendrochilum) were collected Total RNAExtractor (Sangon Biotech, China) following from several Chinese main orchid producing areas, such the instructions of the manufacturer. cDNA was synthe- as Guangzhou, Zhuhai, Kunming and Xiamen. sized with the M-MuLV First Strand cDNA Synthesis Kit (Sangon Biotech, China). I-ELISA detection of TuMV. The polyclonal antibod- Degenerate primers were designed based on the re- ies to TuMV were purchased from AC Diagnostic Inc. ported coat protein (CP) gene (864 bp) of TuMV (CP-F (USA) and used at the working concentration of 1:2000. 5’-GCAGGYGARACRCTYGAYG-3’ and CP-R 5’-TA- Alkaline phosphatase (AP)-labelled IgG was purchased ACCCCTTAACGCCAAGTA-3’). PCR was performed from Beijing Biosynthesis Biotechnology Co. (China) with 2.5 μl 10 × PCR buffer, 1.0 μl dNTPs (10 mM each), and used at the working concentration of 1: 10000. The 2.0 μl cDNA, 1.0 μl (200 nM) of each primer, 0.5 μl of Fast- collected samples were tested for TuMV by I-ELISA ac- Pfu Fly DNA polymerase (TransGen Biotech, China) and cording to the method described by Hornbeck (1991). 17 μl of double distilled water. Thermocycling conditions Serological detection of other quarantine plant viruses were 5 min at 94°C, 25 cylces of 30 s at 94°C, 20 s at 55°C, (cymbidium ringspot virus, tobacco mosaic virus, tomato 60 s at 72°C, and a final extension at 72°C for 5 min. PCR Journal of Plant Pathology (2017), 99 (3), 703-706 Zheng et al. 705 Fig. 3. Phylogenetic tree similarity of TuMV-ZH1 and other typical isolates based on genomic nucleotide sequence (A) and amino acid sequence (B). TuMV-ZH1 and several other isolates are clustered in the world-B lineage. products were analyzed by electrophoresis in 1% (w/v) virions from the infected Phalaenopsis were filamentous, agarose gels and stained by GoldView. 15-18 × 700-800 nm in size (Fig. 1). Other viruses detected The degenerate primers used for genome amplification by ELISA in the orchid samples tested were odontoglos- were designed by Oligo7 using conserved regions of the sum ringspot virus (25%) and cymbidium mosaic virus genomic sequence of TuMV (Table 1). The 5’ and 3’ termi- (14%). nal sequences were determined according to the sequence Sequence comparison revealed that the expected most related to the TuMV-ZH1 isolate. The schematic ge- 864 bp CP fragment had a 99% identity at the nucleo- nome amplification strategy is shown in Fig. 2. tide level with the homologous sequence of isolate BJ-B03 (KC119187). The complete genomic sequence of TuMV- Cloning and sequencing. The expected fragments were ZH1 obtained from assembled fragments (Fig. 2) was excised from the gel, cleaned by SanPrep Column DNA deposited in GenBank under accession No. KF246570. Gel Extraction Kit (Sangon Biotech, China) and ligated Its genome was 9,833 nt in length excluding the poly(A) to pUCm-T vector. After the transformation of Escherichia tail. Compared with other isolates, TuMV-ZH1 shared coli DH5α, plasmid insertion was confirmed by PCR and 96.7% and 98.2% sequence identity with isolate Lu2 at restriction enzyme digestion with PstI and BamHI. Recom- the nucleotide and
Load more

Recommended publications
  • Native Orchid Society South Australia
    Journal of the Native Orchid Society of South Australia Inc PRINT POST APPROVED VOLUME 25 NO. 11 PP 54366200018 DECEMBER 2001 NATIVE ORCHID SOCIETY OF SOUTH AUSTRALIA POST OFFICE BOX 565 UNLEY SOUTH AUSTRALIA 5061 The Native Orchid Society of South Australia promotes the conservation of orchids through the preservation of natural habitat and through cultivation. Except with the documented official representation from the Management Committee no person is authorised to represent the society on any matter. All native orchids are protected plants in the wild. Their collection without written Government permit is illegal. PRESIDENT: SECRETARY: Bill Dear Cathy Houston Telephone: 82962111 Telephone: 8356 7356 VICE-PRESIDENT David Pettifor Tel. 014095457 COMMITTEE David Hirst Thelma Bridle Bob Bates Malcolm Guy EDITOR: TREASURER Gerry Carne Iris Freeman 118 Hewitt Avenue Toorak Gardens SA 5061 Telephone/Fax 8332 7730 E-mail [email protected] LIFE MEMBERS Mr R. Hargreaves Mr G. Carne Mr L. Nesbitt Mr R. Bates Mr R. Robjohns Mr R Shooter Mr D. Wells Registrar of Judges: Reg Shooter Trading Table: Judy Penney Field Trips & Conservation: Thelma Bridle Tel. 83844174 Tuber Bank Coordinator: Malcolm Guy Tel. 82767350 New Members Coordinator David Pettifor Tel. 0416 095 095 PATRON: Mr T.R.N. Lothian The Native Orchid Society of South Australia Inc. while taking all due care, take no responsibility for the loss, destruction or damage to any plants whether at shows, meetings or exhibits. Views or opinions expressed by authors of articles within this Journal do not necessarily reflect the views or opinions of the Management. We condones the reprint of any articles if acknowledgement is given.
    [Show full text]
  • Virus Diseases in Canola and Mustard
    Virus diseases in canola and mustard Agnote DPI 495, 1st edition, September 2004 Kathi Hertel, District Agronomist, Dubbo www.agric.nsw.gov.au Mark Schwinghamer, Senior Plant Pathologist, and Rodney Bambach, Technical Officer, Tamworth Agricultural Institute INTRODUCTION DISTRIBUTION Virus diseases in canola (Brassica napus) were Viruses have probably occurred in canola since found in recent seasons in production areas across commercial crops started but were unrecognised Australia. Beet western yellow virus (BWYV) was due to indistinct symptoms. However, in NSW first identified in eastern and Western Australia pulse crops surveyed and tested for a range of in the early 1980s. At that time it infected canola viruses between 1994 and 2003, BWYV and a wide range of other plants in Tasmania. increased in incidence, suggesting that an Since 1998 it has become very common outside increase in BWYV may have occurred in canola of Tasmania in canola, mustard (Brassica juncea) also over that period. and pulse crops, often at high infection levels. Two A major survey of canola crops in Western viruses, Cauliflower mosaic virus (CaMV) and Australia in 1998 showed than BWYV was very Turnip mosaic virus (TuMV), have also been common. In NSW, symptoms suggestive of detected in canola in eastern and Western Australia BWYV were widespread in canola early in 1999. and mustard in NSW. Relatively little information This prompted laboratory tests which confirmed on CaMV and TuMV is available, but in Western the presence of BWYV but were unable to Australia they are much less common in canola confirm associations with viral symptoms. Major than BWYV.
    [Show full text]
  • Nlcdec2018.Pdf
    D E C E M B E R - J A N U A R Y I S S U E Landcare Linkup N E X T L A N D C A R E L I N K U P 2 0 1 9 M O N T H L Y E C O - C O N V E R S A T I O N S Thursday 24th January, 5-7pm Find a Frog in February with Eva Ford, MRCCC Become a Citizen Scientist and learn how to contribute to the knowledge and future of a special fauna group – amphibians. Frogs have an amazing their life cycle and adaptations to different habitats. They also tell us of things we can’t see that may affect our future. To help them we need to know where they live and what they need. Learn how to identify your local frogs, how to send in a record of frogs you encounter and what you can do to improve conditions for these wonderful animals. A fabulous event to bring your kids along to, last activity before school goes back... Don't forgot to bring your gumboots as we could get wet while searching for frogs! BOOK HERE ONLINE BOOKING ONLY RSVP by Monday 21st January Book and pay for Noosa Landcare events by clicking here. These monthly events are free for Noosa Landcare Members and Bushlandcare Program volunteers and $10 for general entry. Page 2. General Manager Muses Vines in the City B Y P H I L M O R A N In June 2017, I contacted Shaun Walsh who is CEO of South Bank and Roma Street Parklands Indeed the volunteers had come on a tour to with a view to get some Richmond Birdwing vines Pomona to have a look at Shaun’s property in established in the heart of Brisbane.
    [Show full text]
  • Highly Efficient Protoplast Isolation and Transient Expression System
    International Journal of Molecular Sciences Article Highly Efficient Protoplast Isolation and Transient Expression System for Functional Characterization of Flowering Related Genes in Cymbidium Orchids Rui Ren 1 , Jie Gao 1, Chuqiao Lu 1, Yonglu Wei 1, Jianpeng Jin 1, Sek-Man Wong 2,3,4, Genfa Zhu 1,* and Fengxi Yang 1,* 1 Guangdong Key Laboratory of Ornamental Plant Germplasm Innovation and Utilization, Environmental Horticulture Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China; [email protected] (R.R.); [email protected] (J.G.); [email protected] (C.L.); [email protected] (Y.W.); [email protected] (J.J.) 2 Department of Biological Sciences, National University of Singapore (NUS), 14 Science Drive 4, Singapore 117543, Singapore; [email protected] 3 National University of Singapore Suzhou Research Institute (NUSRI), Suzhou Industrial Park, Suzhou 215000, China 4 Temasek Life Sciences Laboratory, National University of Singapore, 1 Research Link, Singapore 117604, Singapore * Correspondence: [email protected] (G.Z.); [email protected] (F.Y.) Received: 28 February 2020; Accepted: 24 March 2020; Published: 25 March 2020 Abstract: Protoplast systems have been proven powerful tools in modern plant biology. However, successful preparation of abundant viable protoplasts remains a challenge for Cymbidium orchids. Herein, we established an efficient protoplast isolation protocol from orchid petals through optimization of enzymatic conditions. It requires optimal D-mannitol concentration (0.5 M), enzyme concentration (1.2 % (w/v) cellulose and 0.6 % (w/v) macerozyme) and digestion time (6 h). With this protocol, the highest yield (3.50 107/g fresh weight of orchid tissue) and viability (94.21%) of × protoplasts were obtained from flower petals of Cymbidium.
    [Show full text]
  • Chromosome Numbers and Cross-Compatibility in the Genus Cymbidium and Some Related Tropical Genera (Orchidaceae)
    CHROMOSOME NUMBERS AND CROSS-COMPATIBILITY IN THE GENUS CYMBIDIUM AND SOME RELATED TROPICAL GENERA (ORCHIDACEAE) A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAII IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN HORTICULTURE AUGUST 1977 By Kenneth W. Leonhardt Dissertation Committee: Yoneo Sagawa, Chairman Haruyuki Kamemoto Henry Y. Nakasone Philip E. Parvin William L. Theobald We certify that we have read this dissertation and that in our opinion it is satisfactory in scope and quality as a dissertation for the degree of Doctor of Philosophy in Horticulture. DISSERTATION COMMITTEE (7 'Cry^o , w A Chairman Chromosome Numbers and Cross-Compatibility in the Genus Cymbidium and Some Related Tropical Genera (Orchidaceae) Abstract Investigations on chromosome numbers and cross-compatibility were made with species and hybrids of Cymbidium and other tropical genera of the family Orchidaceae. Chromosome number determinations were made of 163 plants. One hundred nineteen counts of Cymbidium clones were made of which 92 are reported for the first time. Diploid, triploid, tetraploid, hexaploid and aneuploid individuals were determined. Triploid cultivars of two species, C. insigne 'Bierii' and C. pumilum 'Yashima' were found. Forty- four counts of intergeneric hybrids and genera other than Cymbidium were made. The hybrid status of 17 progenies of intergeneric pollinations was determined by analysis of somatic chromosome numbers. Nine plants derived from colchicine treated protocorms were identified as polyploids; 8 being euploid and 1 a mixoploid. The origin of the polyploid nature of some of the hybrids not subjected to colchicine treatments is dis­ cussed. It was verified cytologically that Cymbidium did hybridize with Ansellia and Catasetum.
    [Show full text]
  • Aphid Transmission of Potyvirus: the Largest Plant-Infecting RNA Virus Genus
    Supplementary Aphid Transmission of Potyvirus: The Largest Plant-Infecting RNA Virus Genus Kiran R. Gadhave 1,2,*,†, Saurabh Gautam 3,†, David A. Rasmussen 2 and Rajagopalbabu Srinivasan 3 1 Department of Plant Pathology and Microbiology, University of California, Riverside, CA 92521, USA 2 Department of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC 27606, USA; [email protected] 3 Department of Entomology, University of Georgia, 1109 Experiment Street, Griffin, GA 30223, USA; [email protected] * Correspondence: [email protected]. † Authors contributed equally. Received: 13 May 2020; Accepted: 15 July 2020; Published: date Abstract: Potyviruses are the largest group of plant infecting RNA viruses that cause significant losses in a wide range of crops across the globe. The majority of viruses in the genus Potyvirus are transmitted by aphids in a non-persistent, non-circulative manner and have been extensively studied vis-à-vis their structure, taxonomy, evolution, diagnosis, transmission and molecular interactions with hosts. This comprehensive review exclusively discusses potyviruses and their transmission by aphid vectors, specifically in the light of several virus, aphid and plant factors, and how their interplay influences potyviral binding in aphids, aphid behavior and fitness, host plant biochemistry, virus epidemics, and transmission bottlenecks. We present the heatmap of the global distribution of potyvirus species, variation in the potyviral coat protein gene, and top aphid vectors of potyviruses. Lastly, we examine how the fundamental understanding of these multi-partite interactions through multi-omics approaches is already contributing to, and can have future implications for, devising effective and sustainable management strategies against aphid- transmitted potyviruses to global agriculture.
    [Show full text]
  • Transcriptional Mapping of the Messenger and Leader Rnas of Orchid fleck Virus, a Bisegmented Negative-Strand RNA Virus
    Virology 452-453 (2014) 166–174 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/yviro Transcriptional mapping of the messenger and leader RNAs of orchid fleck virus, a bisegmented negative-strand RNA virus Hideki Kondo a,n, Kazuyuki Maruyama a, Sotaro Chiba a, Ida Bagus Andika b, Nobuhiro Suzuki a a Institute of Plant Science and Resources (IPSR), Okayama University, Kurashiki 710-0046, Japan b Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, PR China article info abstract Article history: The transcriptional strategy of orchid fleck virus (OFV), which has a two-segmented negative-strand RNA Received 3 December 2013 genome and resembles plant nucleorhabdoviruses, remains unexplored. In this study, the transcripts of Returned to author for revisions six genes encoded by OFV RNA1 and RNA2 in the poly(A)-enriched RNA fraction from infected plants 25 December 2013 were molecularly characterized. All of the OFV mRNAs were initiated at a start sequence 30-UU-50 with Accepted 11 January 2014 one to three non-viral adenine nucleotides which were added at the 50 end of each mRNA, whereas their Available online 4 February 2014 30 termini ended with a 50-AUUUAAA(U/G)AAAA(A)n-30 sequence. We also identified the presence of Keywords: polyadenylated short transcripts derived from the 30-terminal leader regions of both genomic and fl Orchid eck virus antigenomic strands, providing the first example of plus- and minus-strand leader RNAs in a segmented Dichorhavirus minus-strand RNA virus. The similarity in the transcriptional strategy between this bipartite OFV and Rhabdovirus monopartite rhabdoviruses, especially nucleorhabdoviruses (family Rhabdoviridae) is additional support Negative-strand RNA virus Bipartite genome for their close relationship.
    [Show full text]
  • Prioritised List of Endemic and Exotic Pathogens
    Hort Innovation – Milestone Report: VG16086 Appendix 1 - Prioritised list of endemic and exotic pathogens Pathogens affecting vegetable crops and known to occur in Australia (endemic). Those considered high priority due to their wide distribution and/or economic impacts are coded in blue, moderate in green and low in yellow. Where information is lacking on their distribution and/or economic impacts there is no color coding. Pathogen Pathogen genus Pathogen species (subspp. etc) Crops affected Disease common name Vector if known Group Bacteria Acidovorax A. avenae supbsp. citrulli Cucurbits Bacterial fruit blotch Agrobacterium A. tumefaciens Parsnip Crown gall Erwinia E. carotovora Asian vegetables, brassicas, Soft rot, head rot cucurbits, lettuce Pseudomonas Pseudomonas spp. Asian vegetables, brassicas Soft rot, head rot Pseudomonas spp. Basil Bacterial leaf spot P. cichorii Brassica, lettuce Zonate leaf spot (brassica), bacterial rot and varnish spot (lettuce) P. flectens Bean Pod twist P. fluorescens Mushroom Bacterial blotch, brown blotch P. marginalis Lettuce, brassicas Bacterial rot, varnish spot P. syringae pv. aptata Beetroot, silverbeet Bacterial blight P. syringae pv. apii Celery Bacterial blight P. syringae pv. coriandricola Coriander, parsley Bacterial leaf spot P. syringae pv. lachrymans Cucurbits Angular leaf spot P. syringae pv. maculicola Asian vegetables, brassicas Bacterial leaf spot, peppery leaf spot P. syringae pv. phaseolicola bean Halo blight P. syringae pv. pisi Pea Bacterial blight P. syringae pv. porri Leek, shallot, onion Bacterial leaf blight P. syringae pv. syringae Bean, brassicas Bacterial brown spot P. syringae pv. unknown Rocket Bacterial blight P. viridiflava Lettuce, celery, brassicas Bacterial rot, varnish spot Ralstonia R. solanacearum Capsicum, tomato, eggplant, Bacterial wilt brassicas Rhizomonas R.
    [Show full text]
  • The Complete Plastid Genome Sequence of Iris Gatesii (Section Oncocyclus), a Bearded Species from Southeastern Turkey
    Aliso: A Journal of Systematic and Evolutionary Botany Volume 32 | Issue 1 Article 3 2014 The ompletC e Plastid Genome Sequence of Iris gatesii (Section Oncocyclus), a Bearded Species from Southeastern Turkey Carol A. Wilson Rancho Santa Ana Botanic Garden, Claremont, California Follow this and additional works at: http://scholarship.claremont.edu/aliso Part of the Botany Commons, Ecology and Evolutionary Biology Commons, and the Genomics Commons Recommended Citation Wilson, Carol A. (2014) "The ompC lete Plastid Genome Sequence of Iris gatesii (Section Oncocyclus), a Bearded Species from Southeastern Turkey," Aliso: A Journal of Systematic and Evolutionary Botany: Vol. 32: Iss. 1, Article 3. Available at: http://scholarship.claremont.edu/aliso/vol32/iss1/3 Aliso, 32(1), pp. 47–54 ISSN 0065-6275 (print), 2327-2929 (online) THE COMPLETE PLASTID GENOME SEQUENCE OF IRIS GATESII (SECTION ONCOCYCLUS), A BEARDED SPECIES FROM SOUTHEASTERN TURKEY CAROL A. WILSON Rancho Santa Ana Botanic Garden and Claremont Graduate University, 1500 North College Avenue, Claremont, California 91711 ([email protected]) ABSTRACT Iris gatesii is a rare bearded species in subgenus Iris section Oncocyclus that occurs in steppe communities of southeastern Turkey. This species is not commonly cultivated, but related species in section Iris are economically important horticultural plants. The complete plastid genome is reported for I. gatesii based on data generated using the Illumina HiSeq platform and is compared to genomes of 16 species selected from across the monocotyledons. This Iris genome is the only known plastid genome available for order Asparagales that is not from Orchidaceae. The I. gatesii plastid genome, unlike orchid genomes, has little gene loss and rearrangement and is likely to be similar to other genomes from Asparagales.
    [Show full text]
  • Networks in a Large-Scale Phylogenetic Analysis: Reconstructing Evolutionary History of Asparagales (Lilianae) Based on Four Plastid Genes
    Networks in a Large-Scale Phylogenetic Analysis: Reconstructing Evolutionary History of Asparagales (Lilianae) Based on Four Plastid Genes Shichao Chen1., Dong-Kap Kim2., Mark W. Chase3, Joo-Hwan Kim4* 1 College of Life Science and Technology, Tongji University, Shanghai, China, 2 Division of Forest Resource Conservation, Korea National Arboretum, Pocheon, Gyeonggi- do, Korea, 3 Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, United Kingdom, 4 Department of Life Science, Gachon University, Seongnam, Gyeonggi-do, Korea Abstract Phylogenetic analysis aims to produce a bifurcating tree, which disregards conflicting signals and displays only those that are present in a large proportion of the data. However, any character (or tree) conflict in a dataset allows the exploration of support for various evolutionary hypotheses. Although data-display network approaches exist, biologists cannot easily and routinely use them to compute rooted phylogenetic networks on real datasets containing hundreds of taxa. Here, we constructed an original neighbour-net for a large dataset of Asparagales to highlight the aspects of the resulting network that will be important for interpreting phylogeny. The analyses were largely conducted with new data collected for the same loci as in previous studies, but from different species accessions and greater sampling in many cases than in published analyses. The network tree summarised the majority data pattern in the characters of plastid sequences before tree building, which largely confirmed the currently recognised phylogenetic relationships. Most conflicting signals are at the base of each group along the Asparagales backbone, which helps us to establish the expectancy and advance our understanding of some difficult taxa relationships and their phylogeny.
    [Show full text]
  • First Evidence of the Occurrence of Turnip Mosaic Virus in Ukraine and Molecular Characterization of Its Isolate
    Received: 7 September 2017 | Accepted: 1 March 2018 DOI: 10.1111/jph.12703 ORIGINAL ARTICLE First evidence of the occurrence of Turnip mosaic virus in Ukraine and molecular characterization of its isolate Oleksiy Shevchenko1 | Ryosuke Yasaka2,3 | Olha Tymchyshyn1 | Tetiana Shevchenko1 | Kazusato Ohshima2,3 1Virology Department, ESC “Institute of Biology and Medicine”, Taras Shevchenko Abstract National University of Kyiv, Kyiv, Ukraine A total of 54 samples of Brassicaceae crops showing symptoms of mosaic, mottling, 2 Laboratory of Plant Virology, Department vein banding and/or leaf deformation were collected in Kyiv region (northern central of Applied Biological Sciences, Faculty of Agriculture, Saga University, Saga, Japan part of Ukraine) in 2014–2015. A half of collected samples was found to be infected 3The United Graduate School of Agricultural with Turnip mosaic virus (TuMV), and TuMV was detected in samples from Brassica Sciences, Kagoshima University, Kagoshima, oleracea var. capitata (cabbage), Raphanus sativus, Brassica juncea, Raphanus sp., Japan Sinapis alba, Camelina sativa and Bunias orientalis (weed). The full- length sequence of Correspondence the genomic RNA of a Ukrainian isolate (UKR9), which was isolated from cabbage, O. Shevchenko, Virology Department, ESC “Institute of Biology and Medicine”, Taras was determined. Recombination analysis of UKR9 isolate showed that this isolate Shevchenko National University of Kyiv, was an interlineage recombinant of world- Brassica and Asian- Brassica/Raphanus phy- Kyiv, Ukraine.
    [Show full text]
  • From Tibet (Xizang), China
    A New Species of Cymbidium (Orchidaceae) from Tibet (Xizang), China Chunlin Long, Zhiling Dao, and Heng Li Kunming Institute of Botany, Chinese Academy of Sciences, Heilongtan, Kunming, Yunnan 650204, People's Republic of China. [email protected] ABSTRACT. Cymbidium chawalongense C. L. Cymbidium chawalongense C. L. Long, H. Li & Long, H. Li & Z. L. Dao (Orchidaceae), collected Z. L. Dao, sp. nov. TYPE: China. Xizang [Ti- from southeast Xizang (Tibet), China, is described bet]: Chayu Xian, Chawalong, 2300 m, in co- as new. The new species is similar to C. ¯oribun- niferous forest, ¯owers pale greenish, 14 May dum Lindley in morphology and habitat, but differs 2001, Gaoligongshan Expedition 13727 (ho- in having an erect scape, very widely spread ¯ow- lotype, KUN). Figure 1. ers, pale green sepals and petals, and a white, non- mottled lip. Species nova Cymbidio ¯oribundo af®nis, sed scape er- ecto 22 cm longo, ¯oribus patulis, sepalis et petalis chlo- Key words: China, Cymbidium, Orchidaceae, roticis, labello albo non maculato differt. Tibet, Yunnan. Plants terrestrial, to 43 cm tall, with a short rhi- zome. Pseudobulbs congested, cylindric, slightly There are about 48 species in the genus Cym- ¯attened, 1.5 cm long and thick, enclosed in cat- bidium Swartz, distributed in tropical and subtrop- aphylls and leaf bases. Cataphylls 3 or 4, widely ical regions of Asia and Australia (Chen, 1999). ovate and lanceolate, 2±5.5 3 2±2.5 cm at base, About 29 species are distributed in China, of which acuminate at apex. Leaves usually 5 per pseudo- 28 are found in Yunnan Province (Chen, 1999).
    [Show full text]