Journal of Plant Pathology (2017), 99 (3), 703-706 Edizioni ETS Pisa, 2017 703 OCCURRENCE OF TURNIP MOSAIC VIRUS IN PHALAENOPSIS sp. IN CHINA G.H. Zheng1*, D.W. Peng2*, Q.X. Tong1, 3, Z.Z. Zheng1 and Y.L. Ming1, 3 1 Xiamen Overseas Chinese Subtropical Plant Introduction Garden, National Plant Introduction Quarantine Base, Xiamen Key Laboratory for Plant Introduction, Quarantine and Natural Products, Xiamen, 361002, Fujian, China 2 School of Ophthalmology and Optometry, Eye Hospital, Wenzhou Medical University, Wenzhou, 325027, Zhejiang, China 3 College of Chemical Engineering, Huaqiao University, Xiamen, 361021, Fujian, China * The authors have contributed equally to the this study and should therefore be regarded as equivalent authors SUMMARY TuMV has great genetic versatility in adapting to dif- ferent environments and breaking host resistance. For A turnip mosaic virus (TuMV) isolate from asymptom- example, TuMV with just a single-nucleotide mutation in atic Phalaenopsis sp. was detected by indirect ELISA. Its the cylindrical inclusion gene (CI) can overcome the resis- presence was confirmed by RT-PCR with a pair of degen- tance gene TuRB01 (Walsh et al., 2002). A single mutation erate primers whose design was based on reported coat (+ 3394 T > C) in the viral P3 protein induces local necrotic protein gene sequences. Further analysis of the genomic lesions and overcomes extreme resistance in Brassica napus. sequence of this isolate designated as TuMV-ZH1 (Gen- Such a change results in systemic non-necrotic infection Bank accession No. KF246570) showed a high nucleotide when another mutation (+ 5447 T > C) in CI protein is in- sequence identity with isolate Lu2 (96.7%) and CHN 12 troduced (Jenner et al., 2002). (96.3%) from China. Phylogenetic analysis indicated that TuMV can infect 13 species of orchid plants, including TuMV-ZH1 belongs to the world-B lineage. To the best of Aceras anthropophorum, Anacamptis pyramidalis, Barlia lon- our knowledge, the above may be the first indication that gibracteata, Calanthe sp., Ophrys speculum, Ophrys tenthre- TuMV infects orchids in China. In addition, proteins P1 dinifera, Orchis italica, Orchis morio, Orchis militaris, Orchis and P3 of TuMV-ZH1 are highly mutated as previously papilionaceae, Orchis simia, Cymbidium sp. and Pescatorea reported for other TuMV isolates. sp., in which it induces mosaic symptoms (Lesemann and Vetten, 1985; Inouye, 1992). A TuMV isolate, denoted Keywords: TuMV, coat protein, genome, phylogenetic TuMV-ZH1, was identified in Phalaenopsis sp. in a sur- analysis. vey for orchid pathogens in China. This paper describes INTRODUCTION Turnip mosaic virus (TuMV) is transmitted by at least 89 species of aphids in a non-persistent manner and is an important member of the genus Potyvirus (Walsh and Jen- ner, 2002). This virus infects more than 318 plant species of 156 genera in 43 families and it damages Cruciferae. TuMV is widespread in temperate and subtropical regions of five continents and occurs to most regions of China. Studies have shown that TuMV isolates can be grouped into two pathotypes designated as Brassica (B) and Brassi- ca-Raphanus (BR), and further subdivided into four geno- groups called basal-B, basal-BR, Asia-BR and world-B (Ohshima et al., 2002). Placing TuMV isolates into these groups has become the main classification method of this virus (Sanchez et al., 2007; Farzadfar et al., 2009; Wang et al., 2009). Corresponding author: Y.L. Ming Fig. 1. Electron micrograph of virus particles purified from Fax: + 86.0592.2063215 infected Phalaenopsis sp. TuMV-ZH1 particles are filamen- E-mail: [email protected] tous and measure 15-18 × 700-800 nm. 704 Turnip mosaic virus in Phalaenopsis sp. Journal of Plant Pathology (2017), 99 (3), 703-706 Table 1. Primers for genomic sequence amplification of TuMV-ZH1. Primers Sequence (5’→3’) Primers Sequence (5’→3’) TuMV1-1 F AAAAATATAAAAACTCAACACA F CCACAGGTACACGCACT R TATAATTGGTTGCTGCGCTCT TuMV5-2 R TCCGTACACTTCTCTACCCAT F ATGGCAGCAGTTACATTCGCATC F CAAAGTTTTCCGAACCCGTA TuMV-1 R GCATCGTACAACTTGCCTTCGT TuMV6-1 R ACGAGGTCCTTATTAGCTCT F AAAAGAACGGACGAAATTCGCAA F TCCCAGAGCGAGAAAACGAA TuMV-2 R CCGATTGCAAGTTTCCGTGACC TuMV6-2 R ATCCAAGTATTTTCCCGTCT F AGAAAGGCTACACCCAATACGAG F ATTAGCACGAAAGACGGCCAA TuMV-3 R CACGCTGTATCTGCCGCCTA TuMV-7 R ACCATCAGCATCGCAATACACC F AGTCTACCAGAACTCGTCGAA F ATTATTTCGCTGAGTTCACACC TuMV3-3 R CGACATCCAATTTGAGCCTT TuMV8-1 R ATAGTTGACTGCCAGTATGACC F ATGTATTCAAGTTTATCAATGTGCT F AGTTTGATAGCTCGTTGTCACC TuMV4-1 R TGTCTTTGTCACTCTCGTGT TuMV8-2 R CTGCTTCTGCCTCTCTCGTTC F CTAGAGCAACTGCCACGGAA F GCCAGCTCAAGAGGATCTCACC TuMV4-2 R CCACTACCCTGTGCGTTC TuMV-9 R CACCACATGCGCTAACACCA F CACACCACCAGGTCGAGA F TCAAACCGCTCATTGACCAC TuMV5-1 R TCGTGCATACTCACTAGCTG TuMV-10 R GTCCCTTGCATCCTATCAAAT Table 2. TuMV isolate sources analysed in this study. GenBank Isolate Country Original host plant Group accession No. CHN 12 China unknown world-B AY090660 Lu2 China Brassica sp. world-B HQ446216 UK1 UK Brassica napus world-B AF169561 C42J Japan Brassica rapa world-B AB093625 A1 Italy Alliaria officinalis basal-B AB093598 A102/11 Italy Anemone coronaria basal-B AB093597 Fig. 2. Genome organization and sequencing strategy of Cal1 Italy Campania officinalis basal-BR AB093601 TuMV-ZH1. The approximate position of each overlapping KYD81J Japan Raphanus sativus basal-BR AB093613 region amplified by primer sets is shown. SGD311J Japan Raphanus sativus Asian-BR AB093619 ND10J Japan Raphanus sativus Asian-BR AB252130 ringspot virus, odontoglossum ringspot virus, cymbid- ium mosaic virus, bean yellow mosaic virus, cucumber the identification process and the genomic sequence of mosaic virus and orchid fleck dichorhavirus) was also TuMV-ZH1 to clarify its origin and genetic features. performed. Virion purification. TuMV particles were purified from MATERIALS AND METHODS asymptomatic or symptom-showing leaves (Thompson et al., 1988), were negatively stained with phosphotungstic Collection of orchid plants. A total of 403 samples, acid (PTA) for 5 min and examined under a JEM2100 distributed among 19 orchid genera (Cymbidium, Dendro- transmission electron microscope (JEOL, Japan). bium, Cattleya, Paphiopedilum, Oncidium, Phalaenopsis, Vanda, Bulbophyllum, Coelogyne, Calanthe, Cephalan- RNA extraction and RT-PCR. Total plant RNAs thera, Phaius, Malaxis, Miltonia, Neofinetia, Gastrochilus, were extracted from TuMV-infected leaves with the Epidendrum, Rhynchostylis, Dendrochilum) were collected Total RNAExtractor (Sangon Biotech, China) following from several Chinese main orchid producing areas, such the instructions of the manufacturer. cDNA was synthe- as Guangzhou, Zhuhai, Kunming and Xiamen. sized with the M-MuLV First Strand cDNA Synthesis Kit (Sangon Biotech, China). I-ELISA detection of TuMV. The polyclonal antibod- Degenerate primers were designed based on the re- ies to TuMV were purchased from AC Diagnostic Inc. ported coat protein (CP) gene (864 bp) of TuMV (CP-F (USA) and used at the working concentration of 1:2000. 5’-GCAGGYGARACRCTYGAYG-3’ and CP-R 5’-TA- Alkaline phosphatase (AP)-labelled IgG was purchased ACCCCTTAACGCCAAGTA-3’). PCR was performed from Beijing Biosynthesis Biotechnology Co. (China) with 2.5 μl 10 × PCR buffer, 1.0 μl dNTPs (10 mM each), and used at the working concentration of 1: 10000. The 2.0 μl cDNA, 1.0 μl (200 nM) of each primer, 0.5 μl of Fast- collected samples were tested for TuMV by I-ELISA ac- Pfu Fly DNA polymerase (TransGen Biotech, China) and cording to the method described by Hornbeck (1991). 17 μl of double distilled water. Thermocycling conditions Serological detection of other quarantine plant viruses were 5 min at 94°C, 25 cylces of 30 s at 94°C, 20 s at 55°C, (cymbidium ringspot virus, tobacco mosaic virus, tomato 60 s at 72°C, and a final extension at 72°C for 5 min. PCR Journal of Plant Pathology (2017), 99 (3), 703-706 Zheng et al. 705 Fig. 3. Phylogenetic tree similarity of TuMV-ZH1 and other typical isolates based on genomic nucleotide sequence (A) and amino acid sequence (B). TuMV-ZH1 and several other isolates are clustered in the world-B lineage. products were analyzed by electrophoresis in 1% (w/v) virions from the infected Phalaenopsis were filamentous, agarose gels and stained by GoldView. 15-18 × 700-800 nm in size (Fig. 1). Other viruses detected The degenerate primers used for genome amplification by ELISA in the orchid samples tested were odontoglos- were designed by Oligo7 using conserved regions of the sum ringspot virus (25%) and cymbidium mosaic virus genomic sequence of TuMV (Table 1). The 5’ and 3’ termi- (14%). nal sequences were determined according to the sequence Sequence comparison revealed that the expected most related to the TuMV-ZH1 isolate. The schematic ge- 864 bp CP fragment had a 99% identity at the nucleo- nome amplification strategy is shown in Fig. 2. tide level with the homologous sequence of isolate BJ-B03 (KC119187). The complete genomic sequence of TuMV- Cloning and sequencing. The expected fragments were ZH1 obtained from assembled fragments (Fig. 2) was excised from the gel, cleaned by SanPrep Column DNA deposited in GenBank under accession No. KF246570. Gel Extraction Kit (Sangon Biotech, China) and ligated Its genome was 9,833 nt in length excluding the poly(A) to pUCm-T vector. After the transformation of Escherichia tail. Compared with other isolates, TuMV-ZH1 shared coli DH5α, plasmid insertion was confirmed by PCR and 96.7% and 98.2% sequence identity with isolate Lu2 at restriction enzyme digestion with PstI and BamHI. Recom- the nucleotide and