DOCSLIB.ORG

Disruption of INK4/CDK/Rb Cell Cycle Pathway by Gene Hypermethylation in Multiple Myeloma and MGUS

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Disruption of INK4/CDK/Rb Cell Cycle Pathway by Gene Hypermethylation in Multiple Myeloma and MGUS Correspondence 2533 Disruption of INK4/CDK/Rb cell cycle pathway by gene hypermethylation in multiple myeloma and MGUS Leukemia (2003) 17, 2533–2535. doi:10.1038/sj.leu.2403133 examination, skeletal survey, serum and urine protein electro- Published online 11 September 2003 phoresis, serum immunoglobulin (IgG, IgA and IgM) levels, renal function tests and serum calcium level. Monoclonal proteins were identified by cellulose acetate or agarose-gel TO THE EDITOR electrophoresis; if there was an abnormal band or equivocal Pathogenesis of cancer involves a stepwise accumulation of pattern, immunoelectrophoresis or immunofixation was per- genetic alterations that disrupt either the normal machinery formed. Of the 34 patients with MM, 15 (44.1%) were female of cell proliferation or its regulation by the activation of with a median age of 61.5 years (range 25–87). There were 21 cellular oncogenes or inactivation of tumor suppressor genes.1 (61.8%), seven (20.6%), five (14.7%) and one (2.9%) with IgG, Cellular proliferation is mediated by progression through the IgA, light chain and IgD MM. Five (14.7%), 10 (29.4%) and 19 cell cycle, where two cell cycle checkpoints are located at (55.9%) patients belonged to Durie–Salmon stage 1, stage 2 and G1S and G2M. Quiescent cells in G0 phase contain hypopho- stage 3 disease, respectively. Eight (23.5%) had impaired renal sphorylated RB, which sequesters the transcription factor E2F. function at diagnosis. The median paraprotein level at diagnosis Upon activation by mitogens, upregulation of D-type cyclins was 29.8 g/l (range 10–78). Of the six patients with MGUS, there results in activation of cyclin-dependent kinases (CDK), namely were three each of male and female patients. The median age CDK4 and CDK6, resulting in phosphorylation of RB. was 82 years (range 44–85). All had monoclonal gammopathy Hyperphosphorylated RB results in release of E2F, which of IgG subtype (three each of IgG/kappa and IgG/lamda). None activates transcription of S1-specific genes, and irreversible of the MGUS patients progressed to myeloma, amyloidosis or commitment to cell cycle progression. Negative regulatory other lymphoproliferative disease after a median follow-up time elements to the cell cycle progression include the INK4 (p15, of 3 years (range 1–7 years). p16, p18 and p19) and the CIP/KIP (p21CIP, p27KIP1 and p57KIP2) High molecular weight genomic DNA was isolated by families of proteins that give rise to cell cycle arrest.1 P15, p16, standard protocols from bone marrow aspirates of 34 patients p18 and p19 are coined INK4 family CDK inhibitors (CKI) with MM, six patients with MGUS and AF10 cell line (kindly as they share similar functional domains (ankyrin repeats provided by Professor Zelig Eshhar, Department of Immunology, for protein–protein interactions) that render them capable of Weizmann Institute of Science, Israel). The methylation-specific competing with cyclin D for CDK4 and 6, and thus inhibition of polymerase chain reaction (MSP) for gene promoter methylation CDKs 4 and 6. was performed as described in detail previously.3 Briefly, Multiple myeloma (MM) is characterized by neoplastic treatment of DNA with bisulfite for conversion of unmethylated, proliferation of monoclonal plasma cells. These neoplastic but not methylated, cytosine to uracil was performed with a plasma cells are believed to arise from a postgerminal center commercially available kit (CpGenome DNA modification kit, B cell, which migrates to the bone marrow, adheres to the Intergen, New York, USA) according to the manufacturer’s marrow stroma, and triggers subsequent bone resorption and a instructions. The primers for the methylated (M-MSP) and 2 paracrine cytokine loop. The natural course of disease may unmethylated (U-MSP) gene promoter regions are shown in progress through monoclonal gammopathy of undetermined Table 1. DNA from eight normal donors was used as negative significance (MGUS) to MM. MGUS is found in approximately control, while methylated control DNA (CpGenome Universal 3% of persons older than 70 years and in 1% of those 50 years or Methylated DNA, Intergen) was used as positive control in all older. During long-term follow-up, approximately one-fourth of the experiments. MSP was performed in a thermal cycler (9700, patients develop MM, amyloidosis, macroglobulinemia, or other PE Biosystems, Foster City, CA, USA). The PCR mixture malignant lymphoproliferative disorders with a median interval contained 50 ng of bisulfite-treated DNA, 0.2 mM dNTPs, 2 mM of 10 years.2 MgCl2, 10 pmol of each primer, 1 Â PCR Buffer II and 2.5 U Aberrant gene promoter methylation is a mechanism whereby AmpliTaq Gold (Perkin-Elmer Biosystems) in a final volume of 3 gene expression is abrogated. It is therefore potentially 50 ml. The identity of the methylated and unmethylated involved in silencing of tumor suppressor genes during 3 sequences was confirmed by automated DNA sequencing. carcinogenesis. We studied if disruption of the INK4/cyclin PCR products were gel purified, sequenced bidirectionally (ABI D-CDK/RB pathway is a common mechanism in the pathogen- Prism dRhodamine Terminator Cycle Sequencing Kit, PE esis of MM and MGUS. Biosystem), and analyzed on an automated DNA sequence Diagnosis of MGUS is made in an asymptomatic patient with analyser (377 ABI Prism, PE Biosystem). monoclonal gammopathy with a low level of M-component None of the four genes tested were methylated in eight (IgG p3.5 g/dl, IgA p2 g/dl, and Bence Jones protein p1g/ normal bone marrow samples. Normal marrow DNA showed 24 h), less than 10% plasma cells in the bone marrow and unmethylated status by positive amplification in U-MSP but lack absence of lytic bone lesions. Diagnosis of MM was made of amplification in M-MSP, and methylated positive control according to standard criteria with marrow plasmacytosis, DNA showed complete methylation by positive amplification in presence of paraprotein and osteolytic bone lesions. Complete M-MSP but not by U-MSP. The specificity of the MSP was staging work-up for both MM and MGUS includes bone marrow verified by DNA sequencing of methylated positive control. DNA sequence of methylated control DNA is aligned and Correspondence: CS Chim, University Department of Medicine, compared with germline sequence of the wild-type DNA (WT). Queen Mary Hospital, University of Hong Kong, Hong Kong. Fax: (852)29741165; E-mail: [email protected] Methylated cytosine residues in CpG dinucleotide remained as Received 29 April 2003; accepted 8 August 2003; Published online 11 ‘C’, whereas unmethylated cytosine read as ‘T’ after bisulfite September 2003 conversion. Leukemia Correspondence 2534 Table 1 Methylation-specific polymerase chain reaction: primer sequences and reaction conditions Gene Forward primer Reverse primer Tm/cycles Size (bp) location p15 M-MSP GCG TTC GTA TTT TGC GGT T CGT ACA ATA ACC GAA CGA CCG A 631C/35 148 9p21 U-MSP TGT GAT GTG TTT GTA TTT TGT GGT T CCA TAC AAT AAC CAA ACA ACC AA 154 p16 M-MSP TTA TTA GAG GGT GGG GCG GAT CGC GAC CCC GAA CCG CGA CCG TAA 651C/35 150 9p21 U-MSP TTA TTA GAG GGT GGG GTG GAT TGT CAA CCC CAA ACC ACA ACC ATA A 151 p18 M-MSP TTATCGAATTGTTATTTTCGTTCG CGTCTCGCCGAAAAAATAATC 641C/35 93 1p32 U-MSP GGGTTATTGAATTGTTATTTTTGTTTG CATCCATCTCACCAAAAAAATAATC 95 RB M-MSP GGGAGTTTCGCGGACGTGAC ACGTCGAAACACGCCCCG 661C/35 152 13q14 U-MSP GGGAGTTTTGTGGATGTGAT ACATCAAAACACACCCCA 152 Tm: annealing temperature; M-MSP: methylation-specific polymerase chain reaction for the methylated allele; U-MSP: MSP for the unmethylated allele. At diagnosis, p16 hypermethylation occurred in 18 A similar frequency of p15 hypermethylation in both (52.9%) MM and none of the MGUS (P ¼ 0.02). Hypermethyla- MGUS and MM suggested p15 methylation to be an early tion of p15 occurred in 12 (35.3%) MM patients and three event. On the other hand, in contrast to the frequent (50%) MGUS patients (P ¼ 0.68). Concurrent p15 and methylation of p16 in MM,4 there was absence of methylation p16 methylation occurred in six (17.6%) of patients with of p16 in MGUS (P ¼ 0.02). Therefore, p16 methylation MM. None of the patients with MM and MGUS had methy- might be an event associated with progression to MM. lation of p18 or RB. AF10 had completely unmethylated Indeed, this notion was supported by a study of p16 methylation p15, p18 and RB but biallelic methylation of p16. In some in a large cohort of patients with MGUS (N ¼ 40), MM (N ¼ 98) patients with methylated DNA, the presence of amplification by and plasma cell leukemia (N ¼ 5),6 which showed frequent U-MSP might be due to contamination by other cells in the p16 methylation in 40% of MM and 80% of plasma cell marrow biopsy. However, hemizygous methylation cannot be leukemia, but not in any of the patients with MGUS. excluded. Indeed, the absence of unmethylated band in the Furthermore, methylation studies in myeloma, acute leukemia homogeneous cell line indicates biallelic methylation of p16 and esophageal cancer also suggested p16 methylation to be gene. associated with clonal evolution and disease progression. Ideally, MSP status of the neoplastic plasma cells will only be Therefore, the role of p16 methylation as a marker of elucidated if marrow cells have been sorted for CD38- or progression to MM warrants further study. CD138-positive cells. Here, MSP of the four genes has been first p18 is important in the terminal differentiation of B validated in eight normal control DNA by demonstration of the lymphocytes into plasma cell by the induction of cell cycle lack of methylation, and further verified by sequencing. Given arrest.7 Although frequent homozygous deletion (38%) of p18 that methylation detected by MSP is a positive signal with a high genes has been reported in myeloma cell lines, deletion of the sensitivity (up to 1 Â 105 for p15 gene),3 our results are still valid p18 has been identified in only 6% of patients with MM.7 There without sorting of the marrow for plasma cells.
Load more

Recommended publications
  • INK4 Locus of the Tumor-Resistant Rodent, the Naked Mole Rat, Expresses a Functional P15/P16 Hybrid Isoform
    INK4 locus of the tumor-resistant rodent, the naked mole rat, expresses a functional p15/p16 hybrid isoform Xiao Tiana,1, Jorge Azpuruaa,1,2, Zhonghe Kea, Adeline Augereaub, Zhengdong D. Zhangc, Jan Vijgc, Vadim N. Gladyshevb, Vera Gorbunovaa,3, and Andrei Seluanova,3 aDepartment of Biology, University of Rochester, Rochester, NY 14627; bBrigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and cAlbert Einstein College of Medicine, Bronx, NY 10461 Edited* by Eviatar Nevo, Institute of Evolution, Haifa, Israel, and approved December 1, 2014 (received for review September 21, 2014) The naked mole rat (Heterocephalus glaber) is a long-lived and because, in mammals, it encodes three distinct tumor suppressors: tumor-resistant rodent. Tumor resistance in the naked mole rat p16INK4a, p15INK4b, and p19ARF (p14ARF in human) (9). These is mediated by the extracellular matrix component hyaluronan three proteins coordinate a signaling network that depends on of very high molecular weight (HMW-HA). HMW-HA triggers hy- the activities of the retinoblastoma protein (RB) and the p53 persensitivity of naked mole rat cells to contact inhibition, which is tumor suppressor protein. The p16INK4a and p15INK4b pro- associated with induction of the INK4 (inhibitors of cyclin depen- teins are cyclin-dependent kinase inhibitors that directly in- dent kinase 4) locus leading to cell-cycle arrest. The INK4a/b locus is hibit the binding of cyclins to their target cyclin-dependent among the most frequently mutated in human cancer. This locus kinases (10). p16INK4a is involved in establishing replicative encodes three distinct tumor suppressors: p15INK4b, p16INK4a, and senescence, oncogene-induced senescence, and stress-induced INK4b ARF (alternate reading frame).
    [Show full text]
  • The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression
    International Journal of Molecular Sciences Review The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression Tingting Zou and Zhenghong Lin * School of Life Sciences, Chongqing University, Chongqing 401331, China; [email protected] * Correspondence: [email protected] Abstract: The cell cycle is a collection of events by which cellular components such as genetic materials and cytoplasmic components are accurately divided into two daughter cells. The cell cycle transition is primarily driven by the activation of cyclin-dependent kinases (CDKs), which activities are regulated by the ubiquitin-mediated proteolysis of key regulators such as cyclins, CDK inhibitors (CKIs), other kinases and phosphatases. Thus, the ubiquitin-proteasome system (UPS) plays a pivotal role in the regulation of the cell cycle progression via recognition, interaction, and ubiquitination or deubiquitination of key proteins. The illegitimate degradation of tumor suppressor or abnormally high accumulation of oncoproteins often results in deregulation of cell proliferation, genomic instability, and cancer occurrence. In this review, we demonstrate the diversity and complexity of the regulation of UPS machinery of the cell cycle. A profound understanding of the ubiquitination machinery will provide new insights into the regulation of the cell cycle transition, cancer treatment, and the development of anti-cancer drugs. Keywords: cell cycle regulation; CDKs; cyclins; CKIs; UPS; E3 ubiquitin ligases; Deubiquitinases (DUBs) Citation: Zou, T.; Lin, Z. The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression. 1. Introduction Int. J. Mol. Sci. 2021, 22, 5754. https://doi.org/10.3390/ijms22115754 The cell cycle is a ubiquitous, complex, and highly regulated process that is involved in the sequential events during which a cell duplicates its genetic materials, grows, and di- Academic Editors: Kwang-Hyun Bae vides into two daughter cells.
    [Show full text]
  • Epithelial Cell Death Analysis of Cell Cycle by Flow Cytometry White Paper
    Epithelial Cell Death Analysis of Cell Cycle by Flow Cytometry White Paper Authors: Savithri Balasubramanian, John Tigges, Vasilis Toxavidis, Heidi Mariani. Affiliation: Beth Israel Deaconess Medical Center Harvard Stem Cell Institute a Beckman Coulter Life Sciences: Epithelial Cell Death Analysis of Cell Cycle by Flow Cytometry PRINCIPAL OF TECHNIQUE Background: Cell cycle, or cell-division cycle, is the series of events that takes place in a cell leading to its division and duplication (replication). In cells without a nucleus (prokaryotic), cell cycle occurs via a process termed binary fission. In cells with a nucleus (eukaryotes), cell cycle can be divided in two brief periods: interphase—during which the cell grows, accumulating nutrients needed for mitosis and duplicating its DNA—and the mitosis (M) phase, during which the cell splits itself into two distinct cells, often called «daughter cells». Cell-division cycle is a vital process by which a single-celled fertilized egg develops into a mature organism, as well as the process by which hair, skin, blood cells, and some internal organs are renewed. Cell cycle consists of four distinct phases: G1 phase, S phase (synthesis), G2 phase (collectively known as interphase) and M phase (mitosis). M phase is itself composed of two tightly coupled processes: mitosis, in which the cell’s chromosomes are divided between the two daughter cells, and cytokinesis, in which the cell’s cytoplasm divides in half forming distinct cells. Activation of each phase is dependent on the proper progression and completion of the previous one. Cells that have temporarily or reversibly stopped dividing are said to have entered a state of quiescence called G0 phase.
    [Show full text]
  • Recruitment of Leukemic Cells from G 0 Phase of the Cell Cycle By
    Leukemia (2003) 17, 2049–2059 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu CORRESPONDENCE Recruitment of leukemic cells from G0 phase of the cell cycle by interferons results in conversion of resistance to daunorubicin Leukemia (2003) 17, 2049–2051. doi:10.1038/sj.leu.2403085 were not affected by daunorubicin-induced cell death. To analyze whether a similar cell cycle-specific sensitivity to Ara-C TO THE EDITOR and daunorubicin was observed in other leukemic cell lines, we analyzed four acute lymphoblastic leukemia cell lines and one Although the majority of patients with acute myeloid leukemia CML blast crisis cell line, which were generated in our (AML) responds to initial treatment, relapse of the disease occurs laboratory by culturing of leukemic blasts from five different in a significant percentage of these patients.1 The cell cycle patients in serum-free medium at high cell concentrations until status of leukemic cells may play an important role in the spontaneous sustained proliferation of the leukemic cells response to treatment of leukemic cells. Especially, the broadly occurred. These cell lines cytogenetically and phenotypically used cytotoxic agent Cytarabine (Ara-C) has been demonstrated resembled the primary leukemia. Figure 1b shows the median to exert its action via intercalation into the DNA of cells cell cycle distribution within these cell lines after incubation for À6 specifically in the S phase of the cell cycle, and sensitivity to this 48 h in medium alone, or in medium containing 1 Â 10 M Ara- agent is therefore described to be specific for cells in active cell C or daunorubicin.
    [Show full text]
  • P53 Phosphorylation and Association with Murine Double Minute 2, C-Jun
    [CANCER RESEARCH 60, 896–900, February 15, 2000] Advances in Brief p53 Phosphorylation and Association with Murine Double Minute 2, c-Jun ARF NH2-Terminal Kinase, p14 , and p300/CBP during the Cell Cycle and after Exposure to Ultraviolet Irradiation1 Thomas Buschmann, Victor Adler, Ekaterina Matusevich, Serge Y. Fuchs, and Ze’ev Ronai2 Ruttenberg Cancer Center, Mount Sinai School of Medicine, New York, New York 10029 Abstract though the mechanisms underlying the ability of p53 to elicit such opposing effects are yet to be identified, independent studies point to p53 phosphorylation and association with proteins is implicated in its a different set of p53 regulators and effectors that are affected by p53 stability and activity. We have compared the association of DNA-bound in each of these scenarios. and overall pools of p53 with murine double minute 2 (Mdm2), c-Jun NH -terminal kinase (JNK), p300/CBP, and p14ARF during cell cycle In studying the regulation of p53 stability, we demonstrated previ- 2 ously that, in Swiss 3T3 cells, JNK and Mdm2 target p53 degradation progression. Whereas DNA-bound p53 associates with JNK at G0-G1 and in different phases of the cell cycle (7). In this study, we have with Mdm2 and p300 during S and G2-M phases, the general pool of p53 was found in complex with JNK and Mdm2 almost throughout the cell compared the association of subpopulations of p53 with proteins cycle. Phosphorylation of p53 at serines 9, 15, and 20 is at the highest levels implicated in stability and activity of p53 and monitored the pattern of at G1 and at serines 37 and 392 during G2-M phase.
    [Show full text]
  • Increased Expression of Unmethylated CDKN2D by 5-Aza-2'-Deoxycytidine in Human Lung Cancer Cells
    Oncogene (2001) 20, 7787 ± 7796 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Increased expression of unmethylated CDKN2D by 5-aza-2'-deoxycytidine in human lung cancer cells Wei-Guo Zhu1, Zunyan Dai2,3, Haiming Ding1, Kanur Srinivasan1, Julia Hall3, Wenrui Duan1, Miguel A Villalona-Calero1, Christoph Plass3 and Gregory A Otterson*,1 1Division of Hematology/Oncology, Department of Internal Medicine, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA; 2Department of Pathology, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA; 3Division of Human Cancer Genetics, Department of Molecular Virology, Immunology and Medical Genetics, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA DNA hypermethylation of CpG islands in the promoter Introduction region of genes is associated with transcriptional silencing. Treatment with hypo-methylating agents can Methylation of cytosine residues in CpG sequences is a lead to expression of these silenced genes. However, DNA modi®cation that plays a role in normal whether inhibition of DNA methylation in¯uences the mammalian development (Costello and Plass, 2001; expression of unmethylated genes has not been exten- Li et al., 1992), imprinting (Li et al., 1993) and X sively studied. We analysed the methylation status of chromosome inactivation (Pfeifer et al., 1990). To date, CDKN2A and CDKN2D in human lung cancer cell lines four mammalian DNA methyltransferases (DNMT) and demonstrated that the CDKN2A CpG island is have been identi®ed (Bird and Wole, 1999). Disrup- methylated, whereas CDKN2D is unmethylated. Treat- tion of the balance in methylated DNA is a common ment of cells with 5-aza-2'-deoxycytidine (5-Aza-CdR), alteration in cancer (Costello et al., 2000; Costello and an inhibitor of DNA methyltransferase 1, induced a dose Plass, 2001; Issa et al., 1993; Robertson et al., 1999).
    [Show full text]
  • Structure of Human Cyclin-Dependent Kinase Inhibitor P19ink4d
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Research Article 1279 Structure of human cyclin-dependent kinase inhibitor p19INK4d: comparison to known ankyrin-repeat-containing structures and implications for the dysfunction of tumor suppressor p16INK4a Roland Baumgartner1, Carlos Fernandez-Catalan1, Astar Winoto2, Robert Huber1, Richard A Engh1* and Tad A Holak1* Background: The four members of the INK4 gene family (p16INK4a, p15INK4b, Addresses: 1Max Planck Institute for Biochemistry, p18INK4c and p19INK4d) inhibit the closely related cyclin-dependent kinases D-82152 Martinsried, Federal Republic of Germany 2 CDK4 and CDK6 as part of the regulation of the G →S transition in the cell- and Department of Molecular and Cell Biology, 1 University of California Berkeley, CA 94720-3200, INK4a division cycle. Loss of INK4 gene product function, particularly that of p16 , USA. is found in 10–60% of human tumors, suggesting that broadly applicable anticancer therapies might be based on restoration of p16INK4a CDK inhibitory *Corresponding authors. function. Although much less frequent, defects of p19INK4d have also been E-mail: [email protected] [email protected] associated with human cancer (osteosarcomas). The protein structures of some INK4 family members, determined by nuclear magnetic resonance (NMR) Key words: cell cycle, CDK4 inhibitor, p19INK4d, spectroscopy and X-ray techniques, have begun to clarify the functional role of p16INK4a, structure p16INK4a and the dysfunction introduced by the mutations associated with Received: 9 April 1998 human tumors. Revisions requested: 5 June 1998 Revisions received: 30 July 1998 Results: The crystal structure of human p19INK4d has been determined at 1.8 Å Accepted: 31 July 1998 resolution using multiple isomorphous replacement methods.
    [Show full text]
  • A P53-Responsive Mirna Network Promotes Cancer Cell Quiescence Ting La1, Guang Zhi Liu2, Margaret Farrelly1, Nicole Cole3, Yu Chen Feng1, Yuan Yuan Zhang1, Simonne K
    Published OnlineFirst October 9, 2018; DOI: 10.1158/0008-5472.CAN-18-1886 Cancer Tumor Biology and Immunology Research A p53-Responsive miRNA Network Promotes Cancer Cell Quiescence Ting La1, Guang Zhi Liu2, Margaret Farrelly1, Nicole Cole3, Yu Chen Feng1, Yuan Yuan Zhang1, Simonne K. Sherwin1, Hamed Yari1, Hessam Tabatabaee1, Xu Guang Yan1, Su Tang Guo4, Tao Liu5, Rick F. Thorne2,6, Lei Jin7, and Xu Dong Zhang1,2 Abstract Cancer cells in quiescence (G0 phase) are resistant to miRNA-455-3p targeted CDK2-associated cullin domain 1 death, and re-entry of quiescent cancer cells into the cell- (CAC1), which enhanced CDK2-mediated phosphorylation cycle plays an important role in cancer recurrence. Here we of p27 necessary for its polyubiquitination. Of note, the show that two p53-responsive miRNAs utilize distinct but gene encoding miRNA-27b-3p was embedded in the intron complementary mechanisms to promote cancer cell quies- of the chromosome 9 open reading frame 3 gene that was cence by facilitating stabilization of p27. Purified quiescent transcriptionally activated by p53. Similarly, the host gene B16 mouse melanoma cells expressed higher levels of of miRNA-455-3p, collagen alpha-1 (XXVII) chain, was also a miRNA-27b-3p and miRNA-455-3p relative to their prolif- p53 transcriptional target. Collectively, our results identify erating counterparts. Induction of quiescence resulted in miRNA-27b-3p and miRNA-455-3p as important regulators increased levels of these miRNAs in diverse types of human of cancer cell quiescence in response to p53 and suggest that cancer cell lines. Inhibition of miRNA-27b-3p or miRNA- manipulating miRNA-27b-3p and miRNA-455-3p may con- 455-3p reduced, whereas its overexpression increased, the stitute novel therapeutic avenues for improving outcomes of proportion of quiescent cells in the population, indicating cancer treatment.
    [Show full text]
  • P21 Loss Cooperates with INK4 Inactivation Facilitating
    Research Article p21 Loss Cooperates with INK4 Inactivation Facilitating Immortalization and Bcl-2–Mediated Anchorage- Independent Growth of Oncogene-Transduced Primary Mouse Fibroblasts Christopher J. Carbone,1 Xavier Gran˜a,1,2 E. Premkumar Reddy,1,2 and Dale S. Haines1,2 1Fels Institute for Cancer Research and Molecular Biology and 2Department of Biochemistry, Temple University School of Medicine, Philadelphia, Pennsylvania Abstract These kinase complexes phosphorylate pocket proteins pRb, p107, and p130, leading to release of the E2F family of transcriptional The INK4 and CIP cyclin-dependent kinase (Cdk) inhibitors regulators and transcription of genes required for cell cycle (CKI) activate pocket protein function by suppressing Cdk4 progression and DNA synthesis. Cdk activity is negatively regulated and Cdk2,respectively. Although these inhibitors are lost in by the INK4 (p16INK4A, p15INK4B, p18INK4C, and p19INK4D) and CIP/ tumors,deletion of individual CKIs results in modest Kip (p21Waf1/Cip1, p27Kip1, and p57Kip2) family of inhibitors (2). proliferation defects in murine models. We have evaluated Induction of these proteins by stress, growth-inhibitory, or cooperativity between loss of all INK4 family members (using differentiation-inducing signals provides a means of halting cell cdk4r24c mutant alleles that confer resistant to INK4 cycle progression to allow for repair or promoting exit from the cell inhibitors) and p21Waf1/Cip1 in senescence and transformation cycle. of mouse embryo fibroblasts (MEF). We show that mutant It was initially thought that Cdk4/Cdk6 and Cdk2 work cdk4r24c and p21 loss cooperate in pRb inactivation and MEF sequentially on pRb and play essential and nonredundant roles immortalization. Our studies suggest that cdk4r24c mediates in promoting cell cycle progression (3).
    [Show full text]
  • The Cyclin-Dependent Kinase Inhibitor and Tumor Suppressor Locus P16/INK4A- P14arf and Regulation of the Transition Into and out of the Cell Cycle
    The Cyclin-Dependent Kinase Inhibitor and Tumor Suppressor Locus p16/INK4A- p14ARF and Regulation of the Transition Into and Out of the Cell Cycle by Payal Agarwal A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama May 7, 2012 Copyright, 2011 by Payal Agarwal Approved by Richard C. Bird, Chair, Professor of Pathobiology Bruce F. Smith, Professor of Pathobiology Frederik W. van Ginkel, Associate Professor of Pathobiology Anthony G. Moss, Associate Professor of Biological Sciences Abstract p16/INK4A/CDKN2A is an important tumor suppressor gene located in the INK4A/ARF locus, which encodes a 16 kDa protein known as p16, and a 14 kDa protein known as p14ARF in humans. p16 arrests cell cycle in early G1 phase thereby inhibiting the binding of cyclin dependent kinase 4/6 with cyclinD1. This leaves the retinoblastoma protein (pRb) tumor suppressor hypo-phosphorylated and S phase transcription factor E2F bound and inactive. p14ARF expression up-regulates cyclin dependent kinase inhibitor p21, which inhibits the G1/S phase transition by stabilizing p53 expression upon disassociation from mdm2. We hypothesized that p16 has a role in exit from the cell cycle, becomes defective in cancer cells and has binding partners other than CDK4/CDK6 in quiescent or differentiated cells when their canonical target proteins are thought to be nonfunctional. We have hypothesized that INK4A/ARF encoded proteins perform important regulatory roles that are defective in canine mammary cancer and may cause loss of differentiation potential. Well characterized p16-defective canine mammary cancer cell lines, normal canine fibroblasts, and CMT-derived p16-transfected CMT cell clones, are used to investigate expression of p16 after serum starvation into quiescence followed by re-feeding to induce cell cycle re-entry.
    [Show full text]
  • Exit from Quiescence Displays a Memory of Cell Growth and Division
    ARTICLE DOI: 10.1038/s41467-017-00367-0 OPEN Exit from quiescence displays a memory of cell growth and division Xia Wang1,2, Kotaro Fujimaki1, Geoffrey C. Mitchell1,3, Jungeun Sarah Kwon1, Kimiko Della Croce1, Chris Langsdorf4, Hao Helen Zhang5 & Guang Yao1,6 Reactivating quiescent cells to proliferate is critical to tissue repair and homoeostasis. Quiescence exit is highly noisy even for genetically identical cells under the same environmental conditions. Deregulation of quiescence exit is associated with many diseases, but cellular mechanisms underlying the noisy process of exiting quiescence are poorly understood. Here we show that the heterogeneity of quiescence exit reflects a memory of preceding cell growth at quiescence induction and immediate division history before quiescence entry, and that such a memory is reflected in cell size at a coarse scale. The deterministic memory effects of preceding cell cycle, coupled with the stochastic dynamics of an Rb-E2F bistable switch, jointly and quantitatively explain quiescence-exit heterogeneity. As such, quiescence can be defined as a distinct state outside of the cell cycle while displaying a sequential cell order reflecting preceding cell growth and division variations. 1 Department of Molecular and Cellular Biology, University of Arizona, Tucson, AZ 85721, USA. 2 School of Biological and Medical Engineering, Hefei University of Technology, Hefei, Anhui 230009, China. 3 Department of Biology, Wofford College, Spartanburg, SC 29303, USA. 4 Molecular Probes, Thermo Fisher Scientific, Eugene, OR 97402, USA. 5 Department of Mathematics, University of Arizona, Tucson, AZ 85721, USA. 6 Arizona Cancer Centre, University of Arizona, Tucson, AZ 85719, USA. Xia Wang, Kotaro Fujimaki and Geoffrey C.
    [Show full text]
  • Induction of Cip/Kip and Ink4 Cyclin Dependent Kinase Inhibitors by Interferon-A in Hematopoietic Cell Lines
    Oncogene (1997) 14, 415 ± 423 1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00 Induction of Cip/Kip and Ink4 cyclin dependent kinase inhibitors by interferon-a in hematopoietic cell lines Olle Sangfelt, Sven Erickson, Stefan Einhorn and Dan Grande r Department of Oncology/Pathology, Radiumhemmet, Building P8, Karolinska Hospital and Institute, S-171 76 Stockholm, Sweden One prominent eect of IFNs is their cell growth exert cell growth inhibitory eects. It has since been inhibitory activity. The exact molecular mechanism found that this antiproliferative action of IFNs can be behind this inhibition of proliferation remains to be observed in many cell types from established cell lines, elucidated. Possible eectors for IFN-induced growth normal tissues and primary tumor cells (Taylor- inhibition are the recently discovered cyclin-dependent Papadimitriou and Rozengurt, 1985). It has been kinase inhibitors. The eect of IFN-a treatment on the postulated that this eect may, at least in part, members of the Ink4 and Cip/Kip families of Cdk mediate the antitumor eects observed in some inhibitors was investigated in three hematopoietic cell malignancies (Brenning et al., 1985). In vitro culture lines Daudi, U-266 and H9. Two of these cell lines, of susceptible cell types with IFN commonly leads to Daudi and U-266, respond to IFN-a by G1 arrest, G1 arrest, but sometimes to a lengthening of S-phase or whereas the H9 cell line is not growth arrested by IFN-a. all phases of the cell cycle (Roos et al., 1984). We show that a p53-independent upregulation of p21 With the discovery of the proteins that normally mRNA occurs following IFN-a treatment in all three cell regulate the cell cycle, some of the molecular eectors lines.
    [Show full text]