Loss of UBE2O Mitigates Beta Thalassemia Through Broad Proteomic Changes

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Nguyen, Anthony Tuan. 2018. Loss of UBE2O Mitigates Beta Thalassemia Through Broad Proteomic Changes. Doctoral dissertation, Harvard Medical School.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:37006483

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA ABSTRACT UBE2O is a ubiquitin-conjugating enzyme that is upregulated during terminal erythroid differentiation. We previously showed that UBE2O selectively ubiquitinates ribosomal proteins (RPs) and drives the elimination of ribosomes in reticulocytes and non- erythroid cells. Here, we showed that Ube2o-/- reticulocytes have a severe defect in the elimination of RPs by immunoblot analysis. We then used quantitative mass spectrometry to analyze the reticulocyte proteome in a global and unbiased manner. Of the 1235 proteins quantified, we observed significant elevations of 183 proteins, many of which were RPs. Similarly, we quantified the proteomic changes in HEK293-derived cells upon expression of UBE2O. Nearly 10% of all proteins, including RPs, were perturbed by UBE2O expression, which was consistent with the role of UBE2O in broadly remodeling the proteome. Since UBE2O preferentially targets basic proteins, we quantified the intracellular amino acid pools in mutant reticulocytes and found a depletion of free amino acids. As such, deletion of GCN2, an amino acid sensor, partially ameliorated the Ube2o-/- anemic phenotype. Using ribosome profiling, we showed that there is decreased ribosome occupancy of the globin genes in Ube2o-/- reticulocytes, which is consistent with an activation of the integrated stress response through GCN2. The attenuated translation of globin may likely underlie the anemic phenotype of the mutant. We next showed that a- globin is a direct substrate of UBE2O. Finally, loss of UBE2O was shown to mitigate phenotypes of globin excess in a mouse model of b-thalassemia. In addition to RPs, Ube2o-/- reticulocytes have elevated levels of ferritin as a result of the depression of ferritin translation. Moreover, these mutant cells have elevated levels of three additional non-RP substrates, RIOK1, PTRF, and NOP16. Using a pull-down assay, we showed that UBE2O has multiple conserved substrate recognition domains and is capable of multiple substrate recognition modalities. In summary, UBE2O is a hybrid ubiquitinating enzyme that broadly remodels the proteome during terminal erythroid differentiation. Defects in protein degradation during erythroid differentiation result in altered translation of globins and ferritins. Attenuated translation of globin appears to ameliorate b-thalassemia; thus, UBE2O is a novel and potent therapeutic target for this prevalent genetic disease.

2 TABLE OF CONTENTS

Abstract ……………………………………………………………………………………. 2 Table of Contents ………………………………………………………………………… 3 Acknowledgements ……………………………………………………………………… 4 Citation to Published Work …………………………………………………………….. 6 Glossary …………………………………………………………………………………… 7 1 INTRODUCTION ………………………………………………………………………... 8 1.1 Discovery of the ubiquitin proteasome system ……………………………. 8 1.2 UBE2O is a reticulocyte-specific hybrid E2-E3 enzyme ……………...... 10 1.3 Pathophysiology and treatment of b-thalassemia ………………………… 14 2 METHODS ………………………………………………………………………………. 18 3 RESULTS ……………………………………………………………………………….. 27 3.1 Quantitative proteomic analysis of UBE2O substrates …………………… 27 3.2 Impaired translation of globin in Ube2o-/- reticulocytes …………………… 29 3.3 Loss of UBE2O mitigates phenotypes of excess globin ...... 32 3.4 UBE2O executes a broad program of ubiquitination ……………………... 34 4 DISCUSSION AND CONCLUSION ...... 37 4.1 Implications for the treatment of b-thalassemia …………………………… 37 4.2 Crosstalk between protein translation and protein degradation …………. 38 4.3 UBE2O broadly remodels the proteome …………………………………… 39 4.4 Role of UBE2O in other terminally differentiated cells ……………………. 41 4.5 UPS in late erythroid differentiation ……………………………………...... 42 5 SUMMARY ………………………………………………………………………………. 44 References ………………………………………………………………………………... 45 Tables and Figures ……………………………………………………………………… 58

3 ACKNOWLEDGEMENTS

First and foremost, I would like to extend my deepest gratitude to my PhD advisor, Dr. Daniel Finley. Before ever meeting Dr. Finley, I met his wife, Dr. Chinfei Chen, who wholeheartedly endorsed him. Needless to say, Dr. Finley has only exceeded my expectations as a scientist, mentor, and friend over eight years later. I have been privileged to learn from and work alongside Dr. Finley, with the scientific freedom to pursue new ideas and experiments and an open-door policy that I have utilized countless times throughout my career. Over these eight years, I have had the opportunity to grow alongside members of the Finley lab. I would especially like to thank Miguel Prado, who joined the Finley with me back in September 2012. Miguel performed the mass spectrometry analysis for this project, and has been my closest collaborator. I would also like to thank Joshua Wilson- Grady, Geng Tian, and Mingwei Min who have helped with the in vitro biochemistry, which is an essential part of the project. During my PhD, I had the privilege of training two Master’s students from the University of Stuttgart, Verena Dederer and Mona Kawan. I would also like to thank many other key members of the lab, including Monica Boselli, Sharon Hung, Stefanie de Poot, Byung-Hoon Lee, and Suzanne Elsasser. I would also like to acknowledge many members of the Harvard-MIT MD-PhD Program (Loren Walensky, Stephen Blacklow, David Pellman, Thomas Michel, Amy Cohen, Robin Lichenstein, Jennifer DeAngelo, and Yi Shen), of the Harvard-MIT Health Sciences and Technology Program (Matthew Frosch, Richard Mitchell, David Cohen, Wolfram Goessling, Patty Cunningham, Zara Smith, and Karrol Altarejos), and of the Harvard Biological and Biomedical Sciences Program (Davie Van Vactor and Kate Hodgins). I consider myself incredibly fortunate to have met these wonderful people. My time in Boston would not have been nearly as fulfilling or productive without their support. I would like to thank our collaborators in the laboratory of Mark Fleming, including Paul Schmidt, Dean Campagna, and Anoop Sendamarai, who have helped with the mouse studies in this project. Their expertise in inherited anemias and mouse models of disease have uniquely complemented our work on ubiquitin biology. I would also like to thank my Dissertation Advisory Committee for following my progression as a scientist

4 during my PhD: David Golan, Benjamin Ebert, and Randy King. I have greatly benefited from their support and guidance in navigating my PhD and completing this work. Lastly, I would like to extend my deepest gratitude and love to my family, including my parents, Tanh and Tuyetmai, my wife, Vina, and my siblings, Catherine and Andrew. From my parents, I learned the value of hard work and of service to those in need. I would not be the person I am today without them. I am also thankful for Catherine’s and Andrew’s support; it has been a gift to share a common passion for medicine with my siblings. Most importantly, I would like to thank Vina who is the love of my life and the most positive and supportive person that I know. Vina has seen me through the highs and lows of my MD-PhD, and is truly the light of my life.

5 CITATION TO PUBLISHED WORK

Portions of this thesis were adapted from the following publication:

Nguyen AT*, Prado MA*, Schmidt PJ, Sendamarai AK, Wilson-Grady J, Min M, Campagna DR, Tian G, Shi Y, Dederer V, Kawan M, Kuehnle N, Paulo JA, Yao Y, Weiss MJ, Justice MJ, Gygi SP, Fleming MD, Finley D. UBE2O remodels the proteome during terminal erythroid differentiation. Science. 2017; 357: eaan0218.

6 GLOSSARY

AHSP alpha hemoglobin stabilizing protein

CR conserved region eIF2a eukaryotic initiation factor 2a

FTH1 ferritin heavy chain 1

FTL1 ferritin light chain 1

GCN2 general control nonderepressible 2, eif2ak4

HEK human embryonic kidney

HRI heme-regulated eIF2a kinase, eif2ak1

IRE iron-responsive element

KEGG Kyoto Encyclopedia of Genes and Genomes

LC-MS/MS liquid chromatography-tandem mass spectrometry

MCH mean corpuscular hemoglobin

MCV mean cellular volume

ORF open reading frame

RBC red blood cell

RP ribosomal protein

TMT tandem mass tagging

Ub ubiquitin

UBE2O ubiquitin-conjugating enzyme E2 O

UBE2O-WT wild type UBE2O

UBE2O-CA UBE2O-C1037A

UPS ubiquitin-proteasome system

7 1 INTRODUCTION 1.1 Discovery of the ubiquitin proteasome system The ubiquitin proteasome system (UPS) is a major protein degradation pathway in eukaryotes (1, 2). The UPS functions in cell cycle progression, protein quality control, transcription, signal transduction, apoptosis, and many other key biological processes (3). Ubiquitin is a highly stable and highly conserved protein that is found in all eukaryotic cells, and was first purified during the isolation of thymopoietin (4). Within this system, ubiquitin is covalently linked onto substrate proteins by a cascade of enzymes, the ubiquitin-activating enzyme E1, ubiquitin-conjugating enzymes E2, and E3 enzymes or ubiquitin ligases (5). Ubiquitination canonically serves to target proteins for degradation by the proteasome, which is the multi-subunit protease complex of the cell. The marker of ubiquitination determines the high specificity and selectivity of this proteolytic system, in contrast to lysosomal degradation. This posttranslational modification has also been shown to regulate protein interactions, protein activity, subcellular localization, and endocytosis for lysosomal degradation (3). The discovery of the UPS can be traced to key experiments performed in reticulocytes, which are terminally differentiating red blood cells (RBCs) that no longer contain lysosomes (6). The first evidence of a cell-free proteolytic system was obtained from reticulocyte lysates (7). This cell-free system was shown to degrade abnormal hemoglobin in an ATP-dependent manner at neutral pH. Unlike other single enzyme proteases known at the time, the UPS was resolved into two separate components required for activity, which suggested a multi-step degradation pathway (8). In this seminal work, reticulocyte lysate was resolved into two complementing fractions. Fraction I contained mostly hemoglobin, but also a small, heat-stable protein termed APF-1 at the time and later identified as ubiquitin (9). Fraction II contained the proteolytic activity when reconstituted with Fraction I (8). Single and multiple ubiquitin moieties were shown to be covalently conjugated onto reticulocyte proteins from Fraction II in an ATP-dependent manner (10, 11). This led to the hypothesis that conjugated proteins were proteolytic substrates of the system. In summary, these basic findings of a multi-component degradation system in reticulocytes marked the discovery of the UPS, which was awarded the Nobel Prize for Chemistry in 2004. However, for decades, it has been unclear why

8 reticulocytes have a highly active UPS. In Nguyen et al., we established the developmental role of the UPS to remodel the proteome in reticulocytes during terminal erythroid differentiation (12, 13). Ubiquitination is mediated by the E1-E2-E3 enzyme cascade, which were also discovered in reticulocytes (5). In the cell, there is typically one or two E1s, multiple E2s, and a large family of E3s. E1 enzyme is responsible for activating ubiquitin by forming a thioester bond with ubiquitin upon ATP hydrolysis. This enzyme was purified from reticulocyte Fraction II by gel filtration and by affinity purification using a ubiquitin- Sepharose column (14, 15). E1 was shown to be indispensable for cell survival in eukaryotes, using a temperature-sensitive mutant ts85 (16). The activated ubiquitin is then transferred onto an E2 ubiquitin-conjugating enzyme by transesterification. A similar affinity purification approach was used to purify the first E2 using a ubiquitin column in the presence of E1 and ATP; the E2 was eluted with a thiol compound, which was consistent with the transesterification of ubiquitin (17). Finally, the E3 ubiquitin ligase is responsible for transferring the activated ubiquitin from the E2 to a lysine residue on the substrate protein (18). The first E3 enzymes were also purified in the same study by Hershko and colleagues (17). E3 enzymes were noncovalently bound to the ubiquitin-Sepharose column, and was eluted with high salt or increasing pH. Ubiquitin ligases form the largest group of proteins involved in ubiquitination and primarily mediate substrate recognition by direct interaction within the ubiquitin cascade. There are three main subclasses of ubiquitin ligases, RING (Really Interesting New Gene), HECT (Homologous to the E6AP carboxyl terminus), and RBR (Ring-in-between- Ring). In brief, RING E3s bind the E2 enzyme (19) and promote ubiquitin transfer onto the substrate protein (20). In contrast, HECT ligases contain two domains, one of which binds the E2 and the other which contains an active site cysteine and accepts the ubiquitin through a thioester bond (21). Finally, RBR ligases function as RING/HECT hybrid enzymes with a RING domain that binds the E2 and a second RING domain that forms a thioester bond with ubiquitin, like a HECT domain (22). Substrate proteins can be ubiquitinated on a single residue (monoubiquitination), or monoubiquitinated on multiple residues (multi-monoubiquitination), or polyubiquitinated on a single residue with a polyubiquitin chain or branched polyubiquitin chain (23). Traditionally, monoubiquitination

9 and multi-monoubiquitination were considered to be non-degradation signals for intracellular trafficking or protein localization (24). However, recent work from several groups have demonstrated the role of multi-monoubiquitination in targeting substrates for proteasomal degradation (25-27). Lastly, the proteasome is a 2.5 MDa multi-subunit proteolytic complex (1). The proteasome is responsible for recognizing ubiquitinated proteins, removing the ubiquitin from the substrate, and translocating the protein into its proteolytic core. The 26S proteasome consists of a 28-subunit core particle (CP or 20S subunit), which contains the active site residues, and a 19-subunit regulatory particle (RP or 19S subunit), which contains the ubiquitin recognition and substrate translocation machinery. The 26S proteasome was first purified in complex from rabbit reticulocytes by DEAE chromatography and gel filtration (28). In the same year, the 20S subunit was also purified from rabbit reticulocyte lysate (29). Structural analysis of the 20S subunit showed that it contains four stacked seven subunit rings, forming a hydrophobic chamber that contains the proteolytic residues (30). The CP has a narrow translocation channel, which requires substrate proteins to be unfolded by the ATPase ring of the RP (31). The RP is also responsible for deubiquitinating the substrate proteins; this is performed by Rpn11, an ATP-dependent deubiquitinating enzyme that cleaves ubiquitin chains en bloc, and two ATP-independent deubiquitinating enzymes, Usp14 and Uch37 (31). Finally, the proteasome was shown to cycle through three different conformational states during its degradation cycle (32). In summary, these features of the 26S proteasome highlight the complexity of function and regulation involved in protein degradation.

1.2 Discovery, structure, and function of UBE2O UBE2O, also known as E2-230K, is an E2 ubiquitin-conjugating enzyme that is highly and selectively expressed in the late erythroid lineage (33). UBE2O was first identified in a survey of E2 enzymes in rabbit reticulocytes (34). Unlike other low molecular weight E2 enzymes, UBE2O is 143 kDa, and was appropriately termed E2L for its large molecular weight or E2-230K for its apparent size. Nonetheless, UBE2O functioned like a traditional E2 enzyme. It contains a predicted ubiquitin-conjugating (UBC) domain with an active site cysteine (35); UBE2O can also form a labile adduct with

10 ubiquitin in the presence of ATP and E1 ubiquitin-activating enzyme (34). Similarly, UBE2O ubiquitinated nonphysiological substrates including yeast cytochrome c, histone H3, lysozyme, a-lactalbumin, and a-casein in an E3-independent fashion (36). At the time, UBE2O could not reconstitute ubiquitin-dependent degradation in the presence of E3, which suggested that its activity was regulatory (36). However, unlike other E2 enzymes, UBE2O could not be purified by covalent ubiquitin affinity methods (17), requiring the development of a separate purification process. UBE2O was also irreversibly inhibited by arsenite (36), which typically reacts with vicinal thiols and does not inhibit E2 enzymes with a single active site cysteine. Further worked showed that UBE2O was reversibly inhibited by aromatic (phenyl) arsenoxides, which indicated the presence of an intramolecular thiol relay mechanism in which an initial cysteine accepts ubiquitin from the E1, transfers it to the second cysteine and onto the substrate protein (37). For the first time, UBE2O was hypothesized to function as a combined E2-E3 hybrid enzyme. In this study, histone H2B was established as a model substrate for UBE2O; furthermore, UBE2O was observed to undergo autoubiquitination prominently in the absence of substrate. Finally, UBE2O did not cross-react with a polyclonal yeast anti- RAD6 antibody, which recognized most other reticulocyte E2s (38). In summary, UBE2O is a uniquely large E2 enzyme that is biochemically and structurally distinct from its class of ubiquitinating enzymes. Although UBE2O was first discovered in rabbit reticulocytes, UBE2O was notably absent in murine erythroleukemia (MEL) cells (39), which can undergo differentiation to reticulocytes in culture (40-43). Since MEL cells represent a proerythroblast-like stage, this observation suggested that UBE2O expression may increase during erythroid differentiation and decrease in mature erythrocytes. UBE2O levels were also reported to be reduced in undifferentiated MEL cells compared to those of other E2 enzymes (44). However, when MEL was differentiated in culture, the induction of UBE2O behaved qualitatively and was strongly influenced by the serum factors in the culture media (44). As such, UBE2O expression likely occurred at a later stage of differentiation compared to other E2 enzymes, and that MEL cells may not fully capture the extent of induction. Unlike MEL cells, Friend virus (FVA) cells differentiate into reticulocytes within 48 hours when treated with the physiological inducer of erythroid differentiation, erythropoietin

11 (Epo) (45, 46). Using this system, Ube2o mRNA was induced approximately 16- to 17- fold after 48 hours of culture with Epo, similar to the kinetics of globin induction (33). Immunoblot analysis showed that UBE2O expression peaked at the reticulocyte stage and was absent in mature erythrocytes, indicating the transient nature of its expression. In contrast, other E2 enzymes including E2-25K and UbcH5 were downregulated in FVA cells upon treatment with Epo. These data confirmed that UBE2O is highly and selectively induced during reticulocyte maturation contemporaneously with globin. In fact, UBE2O and globin appear to share a GATA1-dependent promoter (47), which would explain their shared induction in reticulocytes and their erythroblast precursors (48-50). UBE2O was reportedly found at high levels in skeletal muscle and heart tissue (35). However, reticulocytes were not used as a positive control, and these tissues are highly perfused, which may lead to antibody cross reaction. Finally, UBE2O was found at elevated levels in the vitreous proteome of idiopathic epiretinal membranes compared to normal vitreous tissue (51); UBE2O was proposed as a biomarker for this pathogenic state, but has not been validated in large sample studies. The function of UBE2O has been largely unknown. In 2009, UBE2O was one 39 human E2 proteins studied in a large-scale protein interaction study using yeast two- hybrid (Y2H) screening (52). UBE2O was found to have 15 reproducible positive interactions, including the ribosomal proteins RPL29, RPL12, RPS7 and RPS20. In an orthogonal affinity purification-mass spectrometry human interactome study, BioPlex 2.0, UBE2O was also found to interact with the ribosomal proteins RPL18 and RPL15, among other proteins (53). From the Y2H screen, UBE2O interacted with the E3 ligases, RNF10 and TRIM27. This subsequently led to the finding that UBE2O is required for the retromer- mediated retrograde transport pathway in cooperation with TRIM27 and the ubiquitin ligase enhancer MAGE-L2 (54). Specifically, MAGE-L2-TRIM27 was necessary for K63- linked ubiquitination of WASH regulatory complex in retromer-dependent transport. UBE2O was also implicated in NF-kB signaling and in fine-tuning BMP7 signaling in adipogenesis (55, 56). First, UBE2O was shown to bind TRAF6 to prevent its K63- polyubiquitination, which limited NF-kB signaling by IL-1b or lipopolysaccharides (55). UBE2O disrupted the interaction between TRAF6 and MyD88, which did not require the UBE2O UBC domain. Next, during adipogenesis, UBE2O was shown to monoubiquitinate

12 SMAD6 (56). This enhanced BMP7-induced signaling by decreasing binding of SMAD6 to the activated BMP type I receptor; in total, UBE2O potentiated adipocyte differentiation induced by BMP7. Finally, UBE2O was shown to multi-monoubiquitinate the nuclear localization signal of the BAP1 tumor suppressor; this prevented BAP1 nuclear localization, and was counteracted by BAP1 autodeubiquitination (57). Moreover, overexpression of UBE2O promoted adipogenesis in the 3T3-L1 cell line by sequestering BAP1 in the cytoplasm. More recently, UBE2O was implicated as a therapeutic target for mixed-lineage leukemias (MLL) (58). MLL leukemia is driven by translocations of the MLL gene with other chromosomes; MLL itself is a large protein that belongs to a complex associated with Set1 (Compass). UBE2O was shown to bind an internal segment of MLL and promoted the degradation of wild type MLL in response to interleukin-1 (IL-1) signaling (58). Stabilization of MLL inhibited MLL leukemia cell proliferation by displacing the chimeric MLL from its target genes, making the IL-1 pathway a target for MLL leukemia. The role of UBE2O in tumor initiation and progression was also studied (59). Deletion of Ube2o in a mouse model of breast cancer impaired mammary tumor progression and pulmonary metastasis; similarly, loss of UBE2O impaired formation and metastasis of invasive prostate carcinoma in mice. UBE2O was found to promote K48-linked ubiquitination of AMPKa2 for degradation by the proteasome, which activated the mTOR- HIF1a pathway, promoting tumorigenesis (59). In another study, UBE2O was shown to ubiquitinate c-Maf, which is a key transcription factor in multiple myeloma (60). In fact, UBE2O was downregulated in forms of multiple myeloma, and restoration of UBE2O increased c-Maf and promoted apoptosis of multiple myeloma cells. While these interesting studies indicate possible functions for UBE2O, they do not study the enzyme in its physiological context within the hematopoietic system. In Nguyen et al., we analyzed the role of UBE2O during terminal erythroid differentiation when the enzyme is physiologically induced (12, 13). As a result, we identified ribosomal proteins as the major class of targets for UBE2O, which were validated by prior interaction studies (52, 53). In an accompanying paper, Yanagitani et al. showed that UBE2O functions as a quality control ubiquitin ligase for ribosomal proteins and globin that are unassembled in from their multiprotein complex (61). Therefore, UBE2O is a fascinating ubiquitinating enzyme

13 that serves a fundamental role in human health and biology. In this thesis, we determine the physiological and dominant role of UBE2O during terminal erythroid differentiation.

1.3 Pathophysiology and treatments of b-thalassemia Congenital anemias due to hemoglobin defects are among the most prevalent inherited disease worldwide, affecting over 300,000 children annually (62, 63). These disorders are characterized by an imbalance in the a- to b-globin chain ratio, which may lead to globin precipitation within red blood cells (RBCs). Specifically, b-thalassemia (originally called Cooley’s anemia) is caused by reduced or absent synthesis of the b- chains of the hemoglobin tetramer (64). In b-thalassemia, excess and unassembled a- chains precipitate and cause oxidative membrane damage, resulting in anemia through both RBC lysis and ineffective erythropoiesis (65-70). As such, the clinical severity of b- thalassemia is correlated with the degree of globin chain imbalance. The most severe form of this disease is b-thalassemia major in which minimal to no b-globin is produced. These patients have a profound and transfusion-dependent anemia that presents during late infancy. Other clinical sequelae of b-thalassemia major include extramedullary hematopoiesis, high-output heart failure, and infection (71-73). b-thalassemia intermedia is a less severe form that presents with a transfusion-independent anemia in early childhood (74). However, approximately half of these patients will become transfusion dependent and will receive a splenectomy for marked splenomegaly (75). Lastly, patients with b-thalassemia minor or trait are often clinically asymptomatic, but present with microcytosis (low RBC mean cellular volume), which can be often mistaken for iron deficiency anemia. As such, b-thalassemia is heterogeneous clinical disease, with over 200 disease-causing mutations identified thus far, the majority of which are single base pair changes (64). Approximately 1.5% of the global population, or 80 to 90 million people are carriers of b-thalassemia (76). The disease is highly prevalent in the Mediterranean, sub-Saharan Africa, Middle-East, Asian-Indian subcontinent, and Southeast Asia. The distribution of disease burden historically resembles that of malaria, which suggested that disease prevalence is under selective pressure from Plasmodium falciparum malaria (77). Finally, the treatment of b-thalassemia is centered around managing the symptoms and

14 morbidities associated with the anemia. While patients with thalassemia major are transfusion-dependent, individuals with thalassemia intermedia will receive transfusion for symptomatic relief and during periods of increased hematologic stress. The decision to initiate regular transfusion in these patients will depend on disease complications and goals of care (78). Unfortunately, there are limited treatment options that directly modulate globin production to alleviate disease burden and improve ineffective erythropoiesis. In 1972, Hunter and Jackson reported that a-globin was translated in excess of b- globin by over 20% in physiological conditions (79). However, the ratio of a- to b-globin normalized to 1:1 within 60 to 90 seconds (79). These fascinating findings estimated the half-life of a-globin to be less than one minute, among the shortest known in all eukaryotes. How then are excess, unpaired a-globin chains degraded? Could this degradation pathway be leveraged for the treatment of b-thalassemia? Earlier studies had shown that rabbit reticulocytes could degrade hemoglobin with abnormal amino acid analogs (80) and mutated or unassembled hemoglobin chains (81, 82). Moreover, the degradation of abnormal hemoglobin containing puromycin or an amino acid analog was rapid and ATP-dependent, and could be inhibited by hemin (83, 84), which suggested that there was involvement of the newly discovered UPS in reticulocytes. These studies would later shift from rabbit reticulocytes to hemolysate samples from patients with b- thalassemia. b-thalassemic hemolysates were found to degrade excess a-globin chains, but not intact hemoglobin tetramers, in an ATP- and ubiquitin- dependent manner (85). Moreover, a-globin was isolated from these reactions in monoubiquitinated form (albeit on different residues at the N- and C-termini), and rapidly degraded when added back to the reticulocyte lysate (86, 87). Given that a-globin degradation was highly dependent on ubiquitination, its degradation was accelerated by increasing concentrations of ubiquitin aldehyde, a potent inhibitor of deubiquitinating enzymes (88-90). Finally, mono- ubiquitinated a-globin was shown to be degraded in an ATP-dependent manner by purified 26S proteasomes and in an ATP-independent manner by purified 20S proteasomes (91). These in vitro experiments indicated that excess a-globin could be ubiquitinated and degraded by the proteasome. Further in vivo analysis was performed in the th3 mouse model of b-thalassemia intermedia, which contains a deletion of the b-

15 globin loci (92). When treated with proteasome inhibitors, b-thalassemic reticulocytes accumulated insoluble a-globin aggregates and polyubiquitinated a-globin (93). These cells were found to have enhanced proteasome activity as well as transcriptional upregulation of most proteasomal subunits in response to Nrf1 (93). Despite extensive evidence that a-globin can be degraded by the proteasome, it is unclear which ubiquitin ligase is responsible for ubiquitinating globin. In Nguyen et al., we showed that UBE2O ubiquitinated a- and b-globin in reconstituted reticulocyte lysates (12, 13). In this thesis, we confirm a-globin as a direct UBE2O substrate, and we identify the specific ubiquitination sites on globin using mass spectrometry. Iron overload and toxicity is another major complication of b-thalassemia either from transfusional iron overload or from increased intestinal absorption due to ineffective erythropoiesis (64). Iron absorption is primarily controlled by hepcidin, a small peptide made by hepatocytes, that inhibits iron uptake by blocking ferroportin, the iron transporter on enterocytes, and signaling for its degradation (94). Patients with b-thalassemia were found to have suppressed urinary hepcidin levels, which is consistent with their observed increase iron absorption and iron overload (95, 96). Therefore, it was hypothesized that increasing hepcidin levels may be beneficial in alleviating the iron overload in b- thalassemia. To that end, increased expression of hepcidin in a mouse model of b- thalassemia accordingly reduced iron overload and reduced the formation of insoluble globin aggregates and reactive oxygen species (97). However, increasing hepcidin also unexpectedly increased hemoglobin levels, reduced ineffective erythropoiesis and splenomegaly, and increased RBC lifespan. Dietary iron restriction also ameliorated the mouse model of thalassemia. This fascinating observation indicated that increasing hepcidin levels was a novel therapeutic avenue for the treatment of b-thalassemia. Increased hepcidin levels were naturally found in patients with mutations of TMPRSS6 (98), a membrane-bound serine protease in hepatocytes that represses hepcidin production. Accordingly, genetic deletion of TMPRSS6 in thalassemia improved anemia and reduced ineffective erythropoiesis and splenomegaly (99). Reducing TMPRSS6 levels by Tmprss6 siRNA in lipid nanoparticles and by antisense oligonucleotides also ameliorated b-thalassemia (100, 101). Additional studies combined TMPRSS6

16 knockdown and an oral iron chelator to further suppress iron uptake and to reduce ineffective erythropoiesis (102, 103). However, it is still unclear how reducing iron uptake can improve ineffective erythropoiesis and anemia in thalassemia. Increasing hepcidin and using iron chelators creates an artificial iron deficiency state for these animals. During erythropoiesis, HRI (or heme-regulated eIF2a kinase) is the dominant regulator of protein synthesis (104). Under conditions of iron or heme deficiency, HRI is activated and phosphorylates eIF2a and inhibits global translation, which constitutes an activation of the integrated stress response (105). Interestingly, TMPRSS6 knockdown does not ameliorate thalassemia in absence of HRI (unpublished data, Fleming lab). Similarly, HRI knockdown is embryonically lethal in b-thalassemia (106). Therefore, activation of the integrated stress response appears underlie the amelioration of b-thalassemia through HRI. In Nguyen et al., we showed that Ube2o-/- reticulocytes have an activated integrated stress response that is independent of HRI (12, 13). In this thesis, we show that loss of UBE2O can mitigate the anemia and ineffective erythropoiesis in b-thalassemia through a novel activation of the integrated stress response.

17 2 METHODS Antibodies The following antibodies were used for immunoblot analysis: streptavidin-HRP (Fisher, 21130, 1:10,000); anti-RPL37 (Abcam, ab103003, 1:500); anti-RPL23a (Sigma, SAB1300595, 1:1000); anti-RPL29 (Santa Cruz Biotech, sc-103166, 1:200); anti-UBE2O (Bethyl, A301-873A, 1:2000); anti-β-spectrin (Santa Cruz Biotech, sc-374309, 1:200); anti-GAPDH (Abcam, ab8245, 1:5000); anti-DDX56 (Origene, UM800050, 1:2000); anti- AHSP (Rockland, 100-401-E79, 1:1000); anti-RIOK1 (Bethyl, A302-457A, 1:1000); anti- PTRF (Bethyl, A301-269A, 1:1000); anti-NOP16 (Bethyl, A305-125A, 1:1000); anti- NOL12 (Bethyl, A302-733A, 1:2000); and anti-H2B (Cell Signaling (CST), 2934, 1:2000).

Animal care and analysis Ube2oE1121X/E1121X mice (Ube2ohem9/hem9) were generated previously (107) and backcrossed onto a C57BL/6J genetic background (N > 10). Eif2ak4tm1.2Dron (GCN2-/-) mice were generated previously (108) and backcrossed onto a C57BL/6J genetic background (N > 10). Hbb-b1tm1Unc Hbb-b2tm1Unc (Hbbth3/+) animals were generated previously (92) and backcrossed onto a C57BL/6J genetic background (N > 10). All genetically modified mice were born and housed in the barrier facility at Boston Children’s Hospital and handled according to approved IACUC (Institutional Animal Care and Use Committee) protocols.

Blood analysis Whole blood for complete blood counts (CBC) was collected retro-orbitally from animals anesthetized with 1.0% tribromoethanol in isoamyl alcohol (Avertin), isoflurane (1-4% in oxygen) or ketamine/xylazine (100-120 mg/kg ketamine and 10 mg/kg xylazine) in sterile saline. Samples were analyzed on an Avida 120 analyzer (Bayer) in the Boston Children's Hospital Department of Laboratory Medicine Clinical Core Laboratories. Reticulocytosis was induced by two methods: (i) serial retro-orbital bleeds of approximately 2% of the mouse’s body weight on days 1, 3, and 5, or (ii) intraperitoneal phenylhydrazine injection at 40 mg/kg on days 0, 1 and 3. Reticulocytes were collected by retro-orbital bleeding on day 7 into EDTA-coated Microtainer tubes (BD Biosciences). One-way ANOVA with Tukey's multiple comparisons test was performed using GraphPad Prism for Mac.

18 Ex vivo differentiation of reticulocytes Reticulocytes were cultured in IMDM supplemented with 20% BIT (serum substitute, StemCell Technologies), 0.1% monothioglycerol (Sigma), 100 units/mL penicillin, 100 µg/mL streptomycin, and 2 mM L-glutamine. Cells were diluted 1:500 in complete medium and cultured in a water-saturated atmosphere at 37°C with 5% CO2.

Immunoblot analysis of UBE2O substrates and eIF2α in reticulocyte lysates Reticulocytes from ex vivo differentiation or from phenylhydrazine-induced mice were washed 5x in ice-cold PBS with manual removal of the buffy coat. The packed cells were lysted with 2x vol of urea lysis buffer (ULB; 50 mM Na-HEPES [pH 7.5], 8M urea, 75 mM NaCl, 1x EDTA-free protease inhibitor cocktail [Roche], 1x PhosSTOP phosphatase inhibitor cocktail [Roche]) in Fig. 2c and Fig. 5c., or 2x vol of SDS lysis buffer (SLB; 50 mM Na-HEPES [pH 7.5], 2% SDS, 150 mM NaCl, 1x EDTA-free protease inhibitor cocktail [Roche], 1x PhosSTOP phosphatase inhibitor cocktail [Roche]) in Fig. 3c, for 15 min at RT. The lysate was clarified by centrifugation at 13,200 rpm for 10 min at 4°C. 100 µg of protein was loaded per lane, and analyzed by 4-12% SDS-PAGE (Invitrogen) using MES running buffer. The samples were transferred to 0.2 µM PVDF membranes (Amersham), and blocked with 5% BSA in 1x TBST for 1 hour at RT. Membranes were incubated with the respective antibodies at 4°C overnight. Finally, the membranes were incubated with IRDye secondary antibodies (LI-COR) for 1 hour at RT, washed 3x with TBST and 1x with TBS buffer, and imaged using the Odyssey CLx infrared imaging system (LI-COR).

Reticulocyte sample preparation for TMT quantification Reticulocytes from Ube2o-/- and wild type animals were washed 5x with ice-cold PBS. The cells were processed for hemoglobin removal following the protocol provided with the Hemoglobind™ kit (BSG). Reticulocytes were lysed by vortexing for 5 minutes at room temperature with 10 bed vol of 0.02 M potassium phosphate pH 6.5. Extra 10 bed vol of Hemoglobind™ suspension was added to the samples and vortexed for another 10 min at room temperature followed by 4 min of centrifugation at 10,000 x g. The supernatants, which contain hemoglobin-depleted sample, were collected and protein concentration measured by BCA (Thermo). 100 µg of protein were processed for TMT quantification.

19 Generation of the Flp-In T-REx 293 cell line with UBE2O expression The full open-reading frame of the human UBE2O gene was cloned into the pCDNA 5/FRT/TO plasmid (Invitrogen) in an untagged form. The untransfected Flp-In T-REx 293 cell line (Thermo Fisher) was cultured in DMEM supplemented with 10% FBS, 2 mM L- glutamine, 100 units/mL penicillin, 100 µg/mL streptomycin, 100 µg/mL Zeocin, and 15 µg/mL blasticidin. At 60% confluency, the cell line was transfected with the human UBE2O pCDNA5/FRT/TO plasmid and the pOG44 recombinase vector using polyethylenimine (PEI) at a 1:4 DNA to PEI ratio. After 24 hours, the media was changed to DMEM with 10% FBS and 2 mM L-glutamine. After 48 hours, stable transfectants were selected using hygromycin B. Colonies were visible after two weeks of selection, and were transferred to complete media with hygromycin B and blasticidin to maintain selection of stable transformants. The resulting clones are referred to as 293-E2O-WT, or, in the case of the C1040A mutant, 293-E2O-CA. Cell lines were tested for mycoplasma contamination.

Preparation of Flp-In T-REx 293 cells for tandem mass tags (TMT) analysis 293-E2O-WT and 293-E2O-CA cells were treated with 10 µg/mL doxycycline for 12, 24, 48, and 72 hours or without doxycycline. Cells were washed 2x with ice-cold PBS, and scraped into a 50-mL conical tubes with PBS. The cell pellet was lysed with SLB at RT. The cell lysate was then passed 10x through a 25G needle, centrifuged at 13,200 rpm for 10 min at 4°C and protein concentration quantified by BCA (Thermo). 150 µg of protein for each sample were processed for TMT analysis.

Quantitative metabolomic analysis of reticulocytes Reticulocytes from phenylhydrazine-induced mice were washed 5x with 5 mL of ice-cold PBS. Immediately after washing, 4 mL of 80% methanol (pre-chilled to -80°C) was added to the reticulocytes. The sample was then placed on dry ice and transferred to -80°C for 20 min. Next, the samples were thawed on ice until they could be resuspended into a homogenous mixture. The samples were then centrifuged at 4,000 rpm for 5 min at 4°C to pellet cell debris and precipitated proteins. The supernatant was transferred to a 50- mL conical tube, pre-chilled on dry ice. Next, the cell pellet was resuspended with 500 µl of 80% methanol by vortexing, and centrifuged at 13,200 rpm for 5 min at 4°C. The

20 supernatant was carefully transferred to the 50 mL conical tube on dry ice. Finally, the cell pellet was resuspended with another 500 µl of 80% methanol and centrifuged at 13,200 rpm for 5 min at 4°C. The supernatant was pooled with the other two extractions on dry ice. To dry the samples, 1.5 mL of the extracted metabolites were aliquoted to a 1.5-mL Eppendorf tube, and vacuum dried without heat. The pellets were stored at -80°C until submitted for analysis. Quantitative metabolomics profiling was performed at the BIDMC Mass Spectrometry Core Facility (Boston, MA). LC-MS/MS was performed on a QTRAP 5500 (SCIEX). Metabolites were normalized to total cell volume, as calculated by RBC count per µl of blood and mean cellular volume.

Ribosome profiling of reticulocytes The library of ribosome-protected fragments (RPFs) was generated using the TruSeq Ribo Profile (Mammalian) Library Prep Kit (Illumina) according to the manufacturer’s instructions. Reticulocytes were washed with ice-cold PBS, treated with cycloheximide at 0.1mg/mL in PBS, and lysed according to the manufacturer’s instructions. Ribosomes were purified using MicroSpin S-400 columns (GE), and rRNA was removed using the Ribo-Zero Gold Kit (Illumina). After 3’ adaptor ligation, reverse transcription of the library, and cDNA amplification, the RPF libraries were purified using an 8% native polyacrylamide gel. The library concentrations were measured on a Qubit (Thermo), and the libraries were analyzed on a Bioanalyzer (Agilent) at the Harvard Medical School Biopolymers Facility. Sequencing of the libraries was performed on a HiSeq 2000 (Illumina) with a read length of 51 cycles at the Harvard Bauer Core Facility. Data analysis was performed according to the workflow in the TruSeq Ribo Profile Bioinformatics guide. Sequence alignment to the UCSC mm10 mouse genome was performed using TopHat (109), and genes were quantified using CuffLinks (110). Gene coverage was calculated using BEDTools (111) and normalized to the total number of mapped reads per million (reads per million, RPM). Data and all figures were visualized and generated using the Integrated Genomics Viewer (112) (Broad Institute).

21 In vitro ubiquitination reactions using recombinant UBE2O Mouse UBE2O WT and catalytic dead (C1037A) were expressed in 6His-tagged form, using the baculovirus system (Life Technologies), following manufacturer’s instructions, and purified on Ni-NTA beads (Qiagen). Based on previous work (37), ubiquitination reactions were carried out with 700 nM UBE2O, 100 nM His-UBE1, 1 µM biotin-ubiquitin, 2 mM ATP, 10 mM phosphocreatine, and 20 µg/mL creatine kinase in buffer containing

50 mM Tris-HCl (pH 7.4), 5 mM MgCl2. H2B (New England Biolabs) and a-globin (HBA2, MyBioSource) were used at 7.7 µM and 1 µM, respectively. Reactions were kept on a rotating wheel in 37°C for 45 minutes.

Mapping of hemoglobin ubiquitination sites Globin ubiquitination sites were identified using an antibody recognizing the diglycine K- e-GG motif that remains after trypsin digestion of ubiquitinated lysine residues. These GG-motifs were purified using the PTMScan Kit (Cell Signaling Technology) according to the manufacturer’s instructions. Briefly, untreated reticulocytes from Ube2o-/- and wild type mice were washed with PBS and lysed with urea lysis buffer (20 mM HEPES pH 8.0, 8 M urea, 1x protease and phosphatase inhibitors (Roche)). The cell lysate was reduced with TCEP and then alkylated with N-ethylmaleimide. Proteins were precipitated by methanol-chloroform and resuspended in 20mM HEPES pH 8.0, 8M urea. 30 mg of proteins were diluted 1:1 with 50 mM ammonium bicarbonate before LysC digestion (5 ng/ml) at RT for 1 hour. The urea was diluted to 1 M with 50 mM ammonium bicarbonate, trypsin was added at 1:200 (trypsin:protein) ratio overnight at 37°C. The trypsin was quenched with 5% formic acid, and digested peptides were desalted using the C18 SepPak solid-phase extraction cartridges (Waters) and dried. Finally, GG-peptides were purified by immunoaffinity using a GG-antibody conjugated to protein A agarose beads, eluted with formic acid, and desalted using the C18 Stop and Go Extraction Tip (STAGE- Tip). All peptides were separated on a reversed-phase C18 column and directly injected into the mass spectrometer where the most intense MS1 peaks detected in the Orbitrap were selected and fragmented for MS2 analysis. Peptide identification was performed using SEQUEST. For these experiments, different mass spectrometers were used: LTQ Orbitrap XL, LTQ Orbitrap Velos and Orbitrap Velos PRO (Thermo Fisher).

22 Quantitative PCR analysis of Ftl1 and Fth1 transcripts in reticulocytes RNA from Ube2o-/- and wild type reticulocytes was isolated using the RNeasy mini kit (Qiagen) following the manufacturer’s instructions. Purified mRNAs were reverse transcribed to cDNAs. Taqman probes (Thermo Fisher) were used for the quantification of Ftl1 and Fth1 transcripts in the 7500 fast RT PCR system (Applied Biosystems).

Recombinant expression of UBE2O conserved region constructs The CR1 construct contained residues 1-534, and the CR2 construct contained residues 472 and 719. The CR1 and CR2 fragments were cloned into a modified pET28c vector (EMD Millipore), where the sequence between the NcoI and NdeI site has been replaced with a minimal biotin carboxyl carrier peptide (BCCP) sequence (113), to facilitate the addition of a biotin tag to the N-terminus of the CR constructs. CR1 was amplified by PCR (Phusion High-Fidelity PCR kit, New England BioLabs) using mouse Ube2o cDNA: 5’ primer GGTGGTCATATGGCGGATCCCGCAGCG 3’ primer GGTGGTCTCGAGTCACTTGAAGTCACGGGTGACC CR2 was amplified in the same manner: 5’ primer GGTGGTCATATGGCAGAGCAGGACGCAGATG 3’ primer GGTGGTCTCGAGTCAGCCTTCCACGGAGTCGTAGTC To obtain pET28c-CR1/2, the PCR products were digested with NdeI and XhoI, gel purified, and ligated. These constructs contain a C-terminal His6X tag for protein purification purposes. BL21 E. coli (EMD Millipore) were co-transformed with pET28c-CR1/2 and pACYCDuet- BirA (lacking a His tag). Cultures were grown at 37°C to an OD of 0.6, at which point IPTG was added to 0.5 mM, and cultures were transferred to 16°C for 20 hours. Cells were harvested, then lysed by French press at 4°C in a buffer containing 10% glycerol, 50 mM Tris-HCl (pH 8.5), 500 mM NaCl, 5 mM PMSF, and a protease inhibitor cocktail. Cleared lysates were incubated with 2 mL (bed volume) of equilibrated Ni-NTA resin (Qiagen) for 1 hr. The resins were washed 4X in 15 mL lysis buffer containing 25 mM imidazole, and once with 15 mL of lysis buffer containing 50 mM NaCl. Proteins were eluted in 15 mL of this low salt lysis buffer containing 250 mM imidazole. Eluates were concentrated by ultrafiltration to a volume of 3 mL. Samples were resolved by anion

23 exchange (AEX, HiTrap Q HP column, GE Healthcare) using a 25-min linear gradient of 0 to 1M NaCl in 20 mM Tris-HCl (pH 8.5). Fractions containing the purified band of interest were pooled and concentrated by ultrafiltration. The resulting samples were further purified by gel filtration (HiLoadTM 16/600 SuperdexTM pg column, GE Healthcare), in a buffer containing 50 mM NaCl in 20 mM Tris-HCl (pH 7.4).

Purification of UBE2O substrates cDNAs of DDX56, NOL12, NOP16, and PTRF were purchased from Harvard Plasmid and cloned into pET15b vector (EMD Millipore). Constructs were transformed into Rosetta E. coli (EMD Millipore) and grown to an OD of 0.6 (1L of culture), at which point IPTG was added to 0.5 mM, and cultures were transferred to 16°C for 20 hours. Cells were harvested, then lysed by French press at 4°C in a buffer containing 10 % glycerol, 50 mM Tris-HCl (pH 8.5), 500 mM NaCl, 5 mM PMSF, and a protease inhibitor cocktail. Substrates were purified by Ni-NTA similarly to the UBE2O CR, and further separated by gel filtration (HiLoad 16/600 Superdex pg column, GE Healthcare), in a buffer containing 50 mM NaCl in 20 mM Tris-HCl (pH 7.4). H2B was purchased from New England BioLabs. Recombinant human AHSP was prepared as a GST-fusion protein in E. coli using the vector pGEX-2T, as described (114).

UBE2O-substrate binding assays Binding and washing steps were carried out in a buffer containing 50 mM NaCl and 20 mM Tris-HCl (pH 7.4), except in the case of PTRF, where 1% NP40 was supplemented to these buffers. Additionally, 1% (w/v) ovalbumin was included during all binding steps as a carrier. For each assay, 5 µL of high capacity streptavidin agarose (Thermo Fisher) was used to bind >50 µg of CR1 or CR2 in a volume of 100 µL for 1 hr at room temperature, which is in excess over that required to saturate the resin. After washing 4X for a total vol of 100 bed vol, >100 µg of substrate was mixed with resin in a total vol of 150 µL and incubated overnight at 4°C. 10% of the volume was then removed to assess input levels for each pulldown. The resin was again washed 4X for a total of 100 bed vol, and samples were eluted in SDS-sample buffer at 95°C for 10 min. Samples were separated by SDS-PAGE and analyzed by immunoblotting using substrate-specific

24 antibodies. Input was loaded at 2.5% of the total vol and 25% of eluate was analyzed. AHSP was tested for binding to CR1 and CR2 in a similar manner as the other substrates, except that Ni-NTA resin was used, and 25 mM imidazole was added to the binding and wash buffers.

Bioinformatics analysis of gene expression during late stage erythropoiesis Transcriptome datasets of human and murine terminal erythropoiesis were obtained from (48, 49, 115). Ubiquitin-proteasome system related genes, 1070 total genes, were isolated from the dataset, and their fold induction was compared between orthochromatic and proerythroblast stages. The data was analyzed and plotted on R. RNA-sequencing data from mouse erythropoiesis was used to compare relative gene expression of specific ubiquitin-conjugating enzymes and ubiquitin ligases from the proerythroblast to reticulocyte stage (48). Gene induction was analyzed and plotted using GraphPad Prism for Mac.

Tandem mass tag (TMT) analysis 150 µg of protein was reduced with 5 mM TCEP for 30 min, then alkylated with 14 mM iodoacetamide for 30 min, and finally quenched with 10 mM DTT for 15 min at room temperature. Proteins were then precipitated with methanol and chloroform. The pellet was resuspended in 200 mM EPPS (pH 8.5) before overnight digestion at room temperature with LysC (1:100, LysC:protein). Next, trypsin was added to the samples at 1:75 (trypsin:protein) ratio and incubated at 37°C for another 5 hours. After digestion, samples were centrifuged at 14,000 x g for 10 min to remove possible undigested protein aggregates from the samples. Peptides concentration were quantified using a BCA assay (Thermo). For peptide labeling, 25 µg of peptides per sample were prepared at 1 µg/µl concentration in 200 mM EPPS (pH 8.5), ACN was added to a final concentration of 30% and then 50 µg of each TMT reagent, incubating for 1 hour at room temperature. Finally, the reactions were quenched with 0.3% hydroxylamine for 15 min at RT. For all TMT experiments, TMT10plex or TMT6plex kits (Thermo) were used. After labeling, peptides from each sample were mixed together in equal amounts, desalted using the tC18 SepPak solid-phase extraction cartridges (Waters), and dried using the SpeedVac. Dried

25 peptides were resuspended in 5% ACN, 10 mM NH4HCO3 pH 8 and fractionated in a basic pH reversed phase chromatography using a HPLC equipped with a 3.5µm Zorbax 300 Extended-C18 column (Agilent). All 96 fractions collected were combined in 24, being 12 of them desalted following the C18 Stop and Go Extraction Tip (STAGE-Tip) and dried down in the SpeedVac. Finally, peptides were resuspended in 3% FA, 3% ACN and then injected and separated in a C18 (Accucore 150 2.6 µm) reversed phase chromatography using a Proxeon EASY-nLC 1000 LC pump (Thermo Fisher) coupled to an Orbitrap Fusion mass spectrometer (Thermo Fisher) as described previously (116). To obtain the best quantitative values from the TMT, each analysis was performed using the multi-notch MS3 (SPS-MS3) method (117, 118). All RAW files obtained from the mass spectrometer were transformed using in-house software (119) based on SEQUEST for the identification and relative quantification of the proteins presence in the samples. Shortly, mass spectra were searched against the mouse Uniprot database (July 2014) or human Uniprot database (February 2014), both with the most common contaminants, and a reverse decoy database. Peptide intensities were quantified by extracting the signal-to-noise ratio and proteins were further collapsed to a final protein-level FDR of 1% (120). Gene Ontology and KEGG enrichment analysis were done using Enrichr (121, 122).

26 3 RESULTS 3.1 Quantitative proteomic analysis of UBE2O substrates We previously showed that ribosomal proteins (RPs) are a major class of targets for UBE2O (12, 13). First, we found that recombinant UBE2O preferentially ubiquitinated RPs in Ube2o-/- reticulocyte lysate. Second, we demonstrated that UBE2O can efficiently ubiquitinate purified 80S ribosomes. Finally, we reconstituted the ubiquitination of individual RPs using purified components, which suggested that UBE2O can directly recognize these proteins outside of the 80S complex (13). Consistent with these data, we found that Ube2o-/- reticulocytes have elevated levels of RPs; included in this cohort of RPs were RPL35 and RPL29, which have been shown to interact with UBE2O by high throughput screening (52, 123). Finally, we showed that Ube2o-/- reticulocytes have elevated levels of not only RPs, but also of 80S ribosomes. Elevated levels of RPs and 80S ribosomes may reflect either an increase in production of ribosomal subunits and ribosome biogenesis or a broad defect in RP elimination. Since ubiquitination is canonically a marker for degradation (3), we favored the latter hypothesis. To this end, we cultured reticulocytes from Ube2o-/- and wild type animals in an ex vivo system, in which reticulocytes spontaneously mature into erythrocytes over 48 to 72 hours (124, 125). We then immunoblotted for various RPs in 24 hour increments over this time period. We found that Ube2o-/- reticulocytes had a significant delay in the elimination of RPs compared to wild type reticulocytes (Figure 1). In fact, these RPs persisted beyond 48 to 72 hours of ex vivo culture in the absence of UBE2O. These late stage Ube2o-/- reticulocytes appeared to have similar levels of RPs compared to undifferentiated wild type reticulocytes, as judged from band intensity. Finally, we observed that UBE2O levels steadily declined during differentiation of wild type reticulocytes, which is consistent with the elimination of this protein in mature erythrocytes (33). We used GAPDH and b-spectrin, which are not eliminated during terminal differentiation (126), as loading controls. As such, Ube2o-/- reticulocytes have a severe defect in the elimination of RPs, as supported by additional flow cytometry and polysome profile data (12, 13). To further elucidate the broad effects of UBE2O on the reticulocyte proteome, we used multiplexed quantitative proteomics with tandem mass tags (TMT) (127). This

27 allowed for an unbiased and global survey of potential UBE2O substrates, including additional RPs. Due to the high concentration of hemoglobin in reticulocytes, up to 98% of soluble protein (128), we used a hemoglobin depleting resin to enrich for non- hemoglobin proteins. In total, we quantified 1235 proteins from Ube2o-/- and wild type reticulocytes after hemoglobin removal (Figure 2). We found that 183 proteins were significantly elevated in mutant reticulocytes by at least 25%, which suggested that UBE2O broadly remodels the proteome during terminal erythroid differentiation. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis (121) showed a significant selection for ribosomes (adjusted P value = 3.23 x 10-6). Significantly upregulated RPs included RPL35A, RPL29, RPL15, RPL6, RPL30, RPL18, RPL14, RPL22, RPL23A, RPL7A, RPL27, RPL13, and RPL4. This selection for 60S RPs was consistent with prior observations that UBE2O preferentially ubiquitinates large 80S subunit RPs (12, 13). Additional pathways for endocytosis, protein export, and protein processing in the endoplasmic reticulum were also enriched by KEGG analysis. Of note, the two most elevated proteins in Ube2o-/- reticulocytes were ferritins (FTL1 and FTH1), which reflect translational control rather than defects in elimination (see Section 3.4). Finally, while upregulated proteins were assigned as putative UBE2O substrates, we also identified 65 proteins that were significantly downregulated in Ube2o-/- reticulocytes, including BPGM, SNCA, ALAS2, and OTUB2. Given that ubiquitination is a classical marker for degradation, this may likely reflect broad secondary effects on protein abundance due to the loss of UBE2O. In Nguyen et al., we generated a non-erythroid cell line that can overexpress UBE2O under a doxycycline-inducible promoter, which we termed 293-E2O cells (12, 13). The 293-E2O cells were shown to overexpress UBE2O-WT and UBE2O-CA when treated with doxycycline, without any effect on cell viability. We demonstrated that overexpression of UBE2O in these HEK293-derived cells drove the destabilization of individual RPs as well as the elimination of 80S ribosomes. This model system provided another powerful tool to assess the broad effects of UBE2O activity on the non-erythroid proteome. To this end, we employed TMT mass spectrometry to quantify the proteomic changes upon UBE2O expression in an unbiased and global manner. In total, we quantified 7807 proteins over 0, 12, 24, 48, and 72 hours of UBE2O-WT and -CA expression (Figure 3).

28 685 proteins were downregulated by at least 50% after 72 hours with UBE2O-WT expression compared to UBE2O-CA expression. KEGG analysis was significantly enriched for the ribosome (adjusted P value = 2.77 x 10-6), ribosome pathway, and Fanconi anemia pathway. Large subunit RPs included RPL36AL, RPL35A, RPL36A, RPL35, RPL31, RPL34, RPL5, RPL29, RPL18A, RPL10, RPL19, and RPL18; small subunit RPs included RPS23, RPS2, RPS18, RPS3, RPS9, and RPS5. We represented the relative abundance of these RPs in a heat map based on the log2 of the fold-change between UBE2O-WT and UBE2O-CA expression. While UBE2O appeared to preferentially destabilize large subunit RPs, we now observed the elimination of small subunit RPs in non-erythroid cells. Based on isoelectric point analysis, we determined that UBE2O preferentially targeted basic proteins, which is consistent with its effect on RPs (13). Finally, we assigned additional putative non-RPUBE2O substrates, including PTRF, RIOK1, NOP16, NOL12, and DDX56 (see Section 3.4). Therefore, we concluded that UBE2O can function in non-erythroid cells without an erythroid-specific factor; moreover, UBE2O is sufficient to drive the elimination of RPs, assembled ribosomes, and tens to hundreds of additional proteins, with a preference for basic proteins.

3.2 Impaired translation of globin in Ube2o-/- reticulocytes How does impaired ribosome elimination cause the anemic phenotype of the Ube2o-/- mutant? The Ube2o-/- phenotype of excess RPs and 80S ribosomes may enhance translation due to the persistence of the protein production machinery; in turn, this would portend phenotypes of excess globin synthesis, rather than reduced hemoglobin levels. To this end, we sought to elucidate the connection between impaired protein degradation and protein translation. Historically, proteasome function has been linked to amino acid homeostasis in yeast and mammalian cells (129, 130). Reticulocytes are ideal cells to study amino acid homeostasis since these cells eliminate their amino acid transporters during terminal erythroid differentiation (49, 131). When wild type reticulocytes were treated with proteasome inhibitors, quantitative metabolomic analysis showed a depletion in multiple pools of free amino acids (12, 13). The two most depleted amino acids were Lys and Arg, two basic amino acids, that are abundant in RPs (12). These data suggested that amino acid levels in reticulocytes were highly sensitive to

29 proteasome function. Since UBE2O is a dominant ubiquitinating factor during terminal differentiation, loss of UBE2O may lead to severely perturbed amino acid homeostasis. To this end, we sought to characterize the amino acid supply in Ube2o-/- and wild type reticulocytes using quantitative metabolomic profiling. Preliminary data showed that Ube2o-/- reticulocytes were depleted in a subset of free amino acids (12). Using stringent replicates and controlling for total RBC mass, as calculated by mean cellular volume and RBC count per µl of blood, we demonstrated that Ube2o-/- reticulocytes indeed have depleted pools of intracellular amino acids compared to wild type reticulocytes (Figure 4). These mutant cells had significantly lower pools of Ser, Tryp, and Arg, of which Arg is highly represented in RPs. Lys, which is also highly found in RPs, was also depleted in Ube2o-/- reticulocytes, but missed significance (p value = 0.08). These data also showed a significant accumulation of amino acid pools including Asp, Gly, and Glu. Asp and Glu are the two acidic amino acids at neutral pH. This accumulation of amino acids may represent an impairment of translation, consistent with the Ube2o-/- phenotype and with further data presented. Perturbations of amino acids pools have been demonstrated with proteasomal inhibition (129, 130), rather than with the deficiency of a single ubiquitinating factor. These significant changes in the amino acid composition in Ube2o-/- reticulocytes further emphasize the dominant role of UBE2O in erythroid maturation. GCN2 (general control non-depressible-2), or eIF2ak4, is an intracellular kinase that senses amino acid availability (105). GCN2 is thought to sense amino acid deprivation through the binding of uncharged transfer RNAs (132). Moreover, GCN2 activation has also been linked to proteasome inhibition (133-135). By immunoprecipitation, we previously showed that GCN2 is phosphorylated in Ube2o-/- reticulocytes, which represents the activated form of this protein (12). As such, GCN2 may play an important role in the Ube2o-/- phenotype. To this end, we crossed the Ube2o- /- line to an Eif2ak4-/- deletion (108). At baseline, the Eif2ak4-/- mutant is hematologically indistinguishable from wild type mice, in the absence of amino acid starvation (Table 1). However, GCN2 deficiency actually increased hemoglobin levels in the Ube2o-/- mutant. We observed a mitigation of the anemia in the double mutant with a significant erythrocytosis, or increase in numbers of RBCs. The mean volume and hemoglobin concentration of these RBCs were unaffected by loss of GCN2. Therefore, we found

30 strong genetic interaction between Ube2o and eif2ak4, which is consistent with our data on GCN2 activation and amino acid depletion. Finally, we considered the possibility that this was a non-specific genetic interaction due to the downstream activation of eIF2a or eukaryotic translation initiation factor 2A. Since GCN2 belongs to a family of four well- studied eIF2a kinases, we crossed the Ube2o-/- line to a deletion of the heme-regulated eIF2a kinase (HRI). Deletion of HRI, the dominant regulator of translation in reticulocytes (104), did not modify the anemic phenotype (13), confirming the specificity of interaction between UBE2O and GCN2. Since GCN2 is activated in Ube2o-/- reticulocytes, we then probed the phosphorylation state of eIF2a in these cells. By immunoblotting, we found that eIF2a is hyperphosphorylated in the absence of UBE2O, which constitutes an activation of the integrated stress response (12, 13). The phosphorylation of eIF2a has been shown to reduce the rate of general protein synthesis within the cell and to promote the translation of genes involved in stress response (136, 137). Moreover, eIF2a phosphorylation has been shown to be necessary for producing hypochromic, microcytic anemia in wild type mice under iron deficiency (104). To confirm that there is decreased globin translation in Ube2o-/- reticulocytes, we used ribosome profiling to globally monitor translation in vivo (138, 139). This allowed us to map the exact position of the ribosome on the messenger RNA (mRNA) transcript without perturbing the cellular environment with labeled amino acids. The vast majority of ribosome occupancy was on the a- and b-globin mRNAs, as globin is the major translational output in reticulocytes (Figure 5). When we mapped out the ribosome occupancy on these two genes, we found that there was reduced occupancy of both a- and b-globin mRNAs in Ube2o-/- reticulocytes. The attenuated translation of globin was consistent with the phosphorylation of eIF2a and the hypochromic, microcytic anemia of the null mutant. In Ube2o-/- and wild type reticulocytes, we observed a peak of ribosome occupancy near the start codon, which we termed an initiation peak. We next quantified the ribosome-protected fragments across the a- and b-globin mRNAs, and in the initiation peak and in the remainder of the open reading frame (ORF). We confirmed that there is reduced occupancy across the entire mRNAs of a- and b-globin in Ube2o-/- reticulocytes compared to wild type cells. Based on ribosome

31 occupancy in the ORF, the translation of a-globin mRNA is differentially reduced in comparison to that of b-globin mRNA. Therefore, using ribosome profiling, we confirmed that Ube2o-/- reticulocytes have globally reduced translation, which may explain the Ube2o-/- phenotype of hypochromic, microcytic anemia.

3.3 Loss of UBE2O mitigates phenotypes of excess globin In Nguyen et al., we previously showed that multiple ubiquitin conjugate species are depleted in Ube2o-/- reticulocytes without affecting free ubiquitin levels (13). Since there are hundreds of ubiquitinating enzymes expressed, it is unusual that a single factor could produce such profound changes in ubiquitin conjugate profiles. This observation led to the hypothesis that UBE2O is a dominant E2 (ubiquitin-conjugating) enzyme in late stage erythropoiesis. To better understand the function of UBE2O, we purified the individual ubiquitin conjugates that are depleted in Ube2o-/- reticulocytes, from wild type reticulocytes, and identified them by liquid chromatography-tandem mass spectrometry (LCMS/MS) analysis (12). We identified both a- and b-globin in their ubiquitinated form, suggesting that globin may be a direct substrate of UBE2O. In an orthogonal approach, we reconstituted ubiquitination activity in Ube2o-/- reticulocyte lysate using recombinant UBE2O (13). While the predominant target was RPs, we also identified a- and b-globin, which supported the hypothesis that UBE2O is a globin E3 (ubiquitin ligase) enzyme. To test whether globin is a direct substrate of UBE2O, we reconstituted the ubiquitination of a-globin in a purified system (Figure 1A). We observed the rapid formation of ubiquitin conjugates in the presence of biotin-tagged ubiquitin, ubiquitin- activating enzyme (UBE1), and recombinant UBE2O. As a negative control, we used a catalytically inactive mutant (UBE2O-C1037A; hereafter UBE2O-CA), which did not form any ubiquitin conjugates. As a positive control, we used histone H2B, which is a model substrate for UBE2O (37). Therefore, we confirmed that a-globin is a direct substrate of UBE2O. Furthermore, UBE2O appears to function as an E2-E3 hybrid enzyme that can charge itself with ubiquitin and directly recognize a-globin without an accompanying E3. Next, we mapped the endogenous ubiquitination sites on a- and b-globin in untreated Ube2o-/- and wild type reticulocytes (Figure 1B). To this end, we used an antibody that recognizes diglycine-containing isopeptides following trypsin digestion of

32 ubiquitinated proteins (140). Using immunoaffinity purification and LC-MS/MS, we identified the full complement of ubiquitination sites in untreated Ube2o-/- and wild type reticulocytes. We observed six unique ubiquitination sites on a-globin out of 11 possible Lys residues; similarly, there were six ubiquitination sites out of 11 possible Lys residues on b-globin. However, we found that the vast majority of ubiquitination of endogenous a- and b-globin persisted in the Ube2o-/- mutant. Of note, a-globin has a modified lysine (K140) only in the presence of UBE2O, which may suggest that this ubiquitination site is specific to UBE2O. In contrast, b-globin has a modified lysine (K145) in the absence of UBE2O, which is likely UBE2O-independent and mediated by a separate ubiquitin ligase. Since globin ubiquitination persisted in Ube2o-/- reticulocytes, UBE2O may not be the only ubiquitinating enzyme that can target globin. Ube2o-/- mice have a hypochromic, microcytic anemia that is intrinsic to the hematopoietic system and is unrelated to iron metabolism (13). If a-globin is indeed a dominant substrate of UBE2O, then the Ube2o-/- phenotype can be attributed to UBE2O- depdent degradation excess a-globin (79, 85, 88, 90). We crossed the Ube2o-/- mutation to a deletion of the b-globin locus (Hbbth3 allele), which produces a β-thalassemia intermedia phenotype (92). Contrary to the expectation that it would exacerbate an excess a-globin phenotype, UBE2O deficiency actually ameliorated the anemia of the Hbbth3/+ mutant (Table 1). The double mutant had increased hemoglobin levels with an accompany erythrocytosis. These red blood cells (RBCs), however, were smaller in mean volume (MCV) than controls and contained reduced concentrations of hemoglobin (MCH). Furthermore, loss of UBE2O reduced the splenomegaly seen in the mouse model of β- thalassemia, which is a major clinical sequela caused by increased splenic erythropoiesis and increased RBC destruction. We further found that the double mutant had significantly decreased precipitated hemoglobin aggregates and an increased RBC lifespan (13). Thus, UBE2O deficiency mitigated a phenotype of excess a-globin in a mouse model of β-thalassemia intermedia. While a-globin is a direct substrate of UBE2O, it does not appear to be the dominant substrate of this enzyme, nor does it fully explain the Ube2o-/- phenotype as with RP degradation.

33 3.4 UBE2O executes a broad program of ubiquitination Using quantitative proteomics, we showed that UBE2O remodels the reticulocyte proteome during terminal erythroid differentiation. In reticulocytes, loss of UBE2O leads to the dysregulation of over 200 proteins (Figure 2). While RPs are the major class of targets of UBE2O (12, 13), it is clear that UBE2O executes a broad program of ubiquitination outside of RPs. We previously showed that Ube2o-/- reticulocytes have 183 proteins that are upregulated compared to wild type cells. The two most elevated proteins in the Ube2o-/- mutant were ferritin light chain 1 (FTL1) and ferritin heavy chain 1 (FTH1). FTL1 and FTH1 were significantly upregulated 5.85- and 3.83-fold in Ube2o-/- reticulocytes, respectively (Figure 7). Prior in vitro ubiquitination reactions do not indicate that ferritin is a direct substrate of UBE2O. Thus, elevated levels of ferritin likely reflect translational control. To this end, we first quantified the mRNAs for ferritin heavy chain 1 (Fth1) and ferritin light chain 1 (Ftl1) by quantitative PCR. We found that the levels of Ftl1 and Fth1 were reduced 0.63- and 0.95-fold in the mutant, though these values were not significant. As such, increased mRNA abundance cannot explain the elevated levels of ferritin chains. We previously used ribosome profiling to measure the translational output of Ube2o-/- and wild type reticulocytes. Using these data, we quantified the total ribosome loading on Ftl1 and Fth1 using Cufflinks (110). We observed elevated ribosome occupancy of Ftl1 and Fth1 by 1.86- and 2.10-fold in the mutant. To confirm this finding, we then mapped out the RPFs on Ftl1 and Fth1. We found significant ribosome pausing at the iron-responsive element (IRE) at the 5’-untranslated regions of the Ftl1 and Fth1 mRNAs in wild type, but not in Ube2o-/- reticulocytes. As such, Ube2o-/- reticulocytes have increased ribosome occupancy in the ORFs of Ftl1 and Fth1, which likely explains the increase protein abundance of these proteins. Moreover, decreased ribosome stalling at the ferritin IRE suggested that Ube2o-/- reticulocytes are responding to increased cytosolic iron or heme levels (141). Increased cytosolic iron or heme levels may be in response to the decreased translation of globin as previously shown (Figure 5). Therefore, the Ube2o- /- phenotype is unlikely to be caused by iron deficiency. In summary, loss of UBE2O leads to increased ferritin abundance by depression of their translation. Induction of UBE2O in HEK239-derived cells resulted in broad proteome remodeling as quantified by TMT mass spectrometry (Figure 3). Nearly 10% of the

34 quantified proteome, or 685 proteins, were downregulated after ectopic expression of UBE2O. In fact, RPs represented only a small fraction of these destabilized proteins; it appeared that UBE2O preferred to target basic protein in addition to RPs. Using these data and proteomic data from reticulocytes, we provisionally assigned a set of these proteins as putative UBE2O substrates because of their response to UBE2O expression. We selected three candidate substrates to probe in Ube2o-/- and wild type reticulocytes. RIOK1 is an atypical kinase that is overexpressed in various cancers and promotes tumor growth and invasion (142); PTRF is a protein that mediates pausing of transcription elongation to terminate RNA polymerase I and can suppress the progression of colorectal cancer (143, 144); NOP16 is a nucleolar protein that is induced by MYC protein and is associated with poor clinical outcome in breast cancer patients (145). By immunoblotting, we found elevated levels of all three candidate substrates in Ube2o-/- reticulocytes (Figure 8). As a control, we immunoblotted for GAPDH and b-spectrin, which are not eliminated during terminal erythroid differentiation (126). Strongly elevated levels of RIOK1, PTRF, and NOP16 indicated that they are true substrates of UBE2O. Moreover, in Nguyen et al., we showed that we can ubiquitinate PTRF and NOP16 using of HA-tagged ubiquitin, ubiquitin-activating enzyme (UBE1), and recombinant UBE2O (13). Therefore, immunoblot analysis validated the proteomics data and indicated that UBE2O executes a broad program of elimination. Finally, how does UBE2O recognize a broad spectrum of substrate to execute its program of ubiquitination? We showed that UBE2O functions as an E2-E3 hybrid enzyme with the inherent capability of direct substrate recognition (37, 56, 57). Unlike typical E2 enzymes which are 20 to 25 kDa, UBE2O has a molecular mass of 143 kDa. Sequence conservation analysis of UBE2O showed that it contains four distinct, evolutionarily conserved domains, conserved region 1 (CR1), conserved region (CR2), conserved region 3 (CR3), and a coiled-coil (CC) domain (Figure 9). Truncated forms of UBE2O without CR1 or CR2 were unable to ubiquitinate UBE2O substrates (13), which suggested that CR1 and CR2 are the substrate recognition domains of this enzyme. To test this hypothesis, we used a pull-down binding assay with recombinant CR1, CR2, and validated UBE2O substrates. We purified CR1 and CR2 in biotin-tagged form, bound them to streptavidin resin, and mixed the purified substrates. We then washed the resin

35 and eluted bound material for immunoblot analysis. Using this assay, we found that CR1 and CR2 bound the following UBE2O substrates: NOL12, DDX56, NOP16, H2B, and PTRF. CR1 showed a higher binding affinity for DDX56, whereas CR2 showed a higher binding affinity for NOL12 and PTRF. NOP16 and H2B bound CR1 and CR2 with equal affinity. Sequence analysis showed that CR1 and CR2 contain acidic patches, which may mediate their recognition of these basic proteins. In contrast, we previously identified the acidic protein AHSP (a-hemoglobin stabilizing protein) as a UBE2O substrate (12, 13). UBE2O could ubiquitinate AHSP without the CR1 and CR2 domains. Consistent with these data, AHSP did not show significant binding to CR1 or CR2 in the pull-down assay. In summary, UBE2O functions as an E2-E3 hybrid with multiple substrate recognition domains; moreover, UBE2O is capable of multiple modalities of substrate recognition that differs between basic and acidic substrates.

36 4 DISCUSSION AND CONCLUSION 4.1 Implications for the treatment of b-thalassemia One of the most important findings of this thesis is that loss of UBE2O strongly suppresses b-thalassemia. The unexpected genetic interaction between Ube2o and deletion of the b-globin loci indicates that UBE2O is a potent and specific therapeutic target for the treatment of b-thalassemia, one of the most prevalent inherited diseases worldwide (62, 63). As a ubiquitinating enzyme with the well-defined active site cysteine (35), UBE2O is likely amenable to small molecule inhibition. Previous studies identified arsenite as an irreversible inhibitor of UBE2O (36), which is promising for the development of small molecule inhibitors. Moreover, UBE2O is expressed primarily in the reticulocyte lineage during terminal erythroid differentiation (33, 48-50). Therefore, broad inhibition of this enzyme should produce minimal off-target side effects. As proof of principle, the Ube2o-/- line does not have any gross phenotype outside of the hematopoietic system (a mild hypochromic, microcytic anemia) (13). Studies from other groups have shown that UBE2O may play a therapeutic role in the treatment of mixed lineage leukemia (58) and in broad cancer initiation and metastasis through AMPKa2 (59). Thus, inhibiting UBE2O may also treat mixed lineage leukemia and other cancers, in addition to b-thalassemia. We believe that this work carries global implications for the management of a variety of inherited diseases and cancer. We plan to conduct small molecule inhibitor screens of UBE2O, and to validate these compounds in vitro and in vivo. How does loss of UBE2O suppress the b-thalassemia phenotype and mitigate the anemia? First, deletion of UBE2O further worsened the microcytosis and hypochromia of b-thalassemia. These findings indicated a reduction of total hemoglobin per RBC. Using ribosome profiling, we found evidence of attenuated translation of globin. As such, loss of UBE2O reduces the synthesis of excess a-globin that can precipitate in RBCs. Second, UBE2O deficiency had improved ineffective erythropoiesis in b-thalassemia. Improved splenomegaly is consistent with decreased extramedullary hematopoiesis, a prominent sequela of b-thalassemia. On ribosome profiling, we observed a differential reduction of a-globin synthesis, which would correct the globin chain imbalance in b-thalassemia.

37 Accordingly, there were decreased amounts of precipitated a-globin aggregates within RBCs of the double mutant (13). Therefore, loss of UBE2O appears to ameliorate b-thalassemia by two mechanisms: by downregulating the synthesis of total globin and by differentially reducing a-globin synthesis. In total, these mechanisms address b-thalassemia at its core by correcting globin imbalance. We observed these effects in the double mutant, which had less anemia, but exacerbated microcytosis and hypochromia. Other groups have proposed to use iron restriction or increased hepcidin levels to treat b-thalassemia (97, 99-101). However, iron restriction is impractical from a clinical perspective and hepcidin- based treatments require gene therapy and regular infusinos. Here, we present a highly novel and effective approach to treating b-thalassemia by leveraging the broad regulatory role of the ubiquitin proteasome system (UPS). We anticipate that inhibiting UBE2O will attenuate globin synthesis and ameliorate b-thalassemia in an identical manner.

4.2 Crosstalk between protein translation and protein degradation To date, there are few human diseases caused directly by mutations in ubiquitinating enzymes. Limited examples include ubiquilin-2 in amyotrophic lateral sclerosis, and Parkin in Parkinson’s disease (146, 147). In this thesis, we presented a new disease linked to a single loss-of-function mutation in Ube2o. We propose to identify mutations in Ube2o in humans, using high throughput sequencing of patients with hypochromic, microcytic anemia. We suspect that a fraction of these patients will harbor mutations in Ube2o that present similarly to an iron deficiency anemia. Furthermore, in this thesis, we presented mechanistic insight into this novel hypochromic, microcytic anemia. First, we ruled out any involvement of the iron metabolism pathway. Ube2o-/- animals are iron replete and have elevated ferritin levels, which is consistent with elevated cytosolic iron and heme. Moreover, deletion of HRI, the dominant iron in the erythroid lineage, does not perturb the Ube2o-/- anemia. Second, we showed that ribosome occupancy of the globin genes is downregulated in the Ube2o-/- mutant, secondary to activation of the integrated stress response. Lastly, we found that deletion of the GCN2-encoding gene, eif2ak4, modified the anemic phenotype of the Ube2o-/- animal, indicating a strong genetic interaction between these alleles. We did not

38 observe a complete mitigation of the anemia, which we anticipated since GCN2 does not replenish depleted amino acid pools in reticulocytes. However, the double mutant has a significant increase in hemoglobin, providing a clinically objective response. This was accompanied by a profound erythrocytosis, consistent with improved ineffective erythropoiesis and heightened RBC formation. Therefore, the anemic phenotype is dependent on attenuation of globin translation, in part through GCN2. Protein degradation has been linked to protein synthesis by regulating amino acid homeostasis (129, 130). These studies showed that proteasome inhibition can deplete intracellular amino acids, impair translation, and cause cell death. Here, we found that deletion of UBE2O is sufficient to perturb free amino acid homeostasis in reticulocytes. It is unprecedented that a single enzyme could exert such broad impact on the metabolic state of a cell. This finding further supports the hypothesis that UBE2O is the dominant ubiquitinating enzyme in terminally differentiating reticulocytes. It also suggests that the majority of proteasomal degradation in reticulocytes may be dependent on UBE2O. This finding also suggests that proteasome-dependent protein degradation in reticulocytes may not only function to eliminate proteins, but to support late-stage globin synthesis by providing amino acids. Reticulocytes have eliminated their amino acid transporters during erythroid maturation (49, 131), and may be dependent on the proteasome for amino acids. Consistent with this proposed link, Ube2o-/- mice have attenuated translation of globin that is responsive to deletion of GCN2, an amino acid sensor. Lys and Arg are two basic amino acids that are depleted in these cells, as UBE2O appears to prefer basic substrates such as ribosomal proteins. Therefore, based on these data, we propose that UBE2O-dependent substrate degradation is critical to generating intracellular amino acids to support globin translation.

4.3 UBE2O broadly remodels the proteome Reticulocytes must eliminate the vast majority of cytosolic proteins in order to saturate themselves with hemoglobin. Scientific interest in this question led to the discovery of the UPS in reticulocytes (8, 10, 11). However, the function of the UPS in the developmental context has been unanswered for the past four decades. In this thesis, we showed that the UPS is responsible for remodeling the erythroid proteome during late

39 stage erythroid differentiation. In fact, not only is the UPS highly active during maturation, the induction of UBE2O reconfigures the specificity of the UPS during a critical stage of maturation. In Ube2o-/- reticulocytes, nearly 15% of all proteins are elevated in abundance and may represent direct UBE2O substrates. Similarly, in HEK293-derived cells, nearly 10% of the proteome is directly affected by the induction of UBE2O. It is unusual to find a single ubiquitinating enzyme that exerts such broad impact on protein homeostasis. The predominant class of UBE2O substrates are ribosomal proteins, which are highly basic and normally incredibly stable in the 80S ribosome complex. The elimination of ribosomes is the hallmark of the transition between reticulocytes and erythrocytes. Using proteomics, we found that not all ribosomal proteins are eliminated at the same rate. This is consistent with step-wise degradation by the proteasome, rather than by bulk autophagy. These data also imply that ubiquitination may also function to disassemble the ribosome and to allow access to buried subunits. We propose to dissect the exact mechanism of 80S ribosome disassembly by UBE2O using purified components. We anticipate that UBE2O is sufficient to disassemble the ribosome without additional cofactors. We also believe that high-affinity substrates of UBE2O are likely the first subunits to be removed from the 80S ribosome. Lastly, we found that ferritin is elevated in Ube2o-/- reticulocytes due to derepression of ferritin synthesis. Thus, UBE2O appears to impact protein abundance through non-degradation pathways. This further highlights the importance of UBE2O in regulating protein homeostasis during erythropoiesis beyond targeting substrates to the proteasome. By proteomic analysis, we found that UBE2O executes a broad program of ubiquitination. We found that substrates of UBE2O are not only limited to ribosomal proteins, but many non-ribosomal proteins like RIOK1, PTRF, and NOP16. Moreover, UBE2O functions in a purified system as a hybrid E2-E3 enzyme that can both charge itself with ubiquitin and recognize its substrates. How does UBE2O carry out its broad program of ubiquitination? We used a pulldown assay to identify substrate recognition domains within this large protein. We found that UBE2O contains two conserved, N- terminal domains that recognize a majority of its substrates. Sequence analysis revealed that these domains are highly acidic, which may explain why UBE2O has a strong preference for ubiquitinating basic proteins (i.e. ribosomal proteins). In fact, these N-

40 terminal domains appear to bind substrates with different affinities, which indicates that these are not simply acidic-basic interactions. The pulldown experiment also showed that AHSP, a non-basic substrate, does not bind to either of the conserved N-terminal domains. This suggests that UBE2O contains a third substrate recognition domain within its C-terminus. It appears that UBE2O is able to recognize a wide variety of substrates through multiple substrate recognition domains that utilize different recognition motifs. For future directions, it would be mechanistically valuable to identify the third substrate recognition domain by deletion analysis. This would allow us to better understand how UBE2O recognizes substrates like AHSP that are not basic proteins. Furthermore, we would like to determine a specific degron sequence that is recognized by UBE2O. We propose to use phage display of a large peptide library and high throughput sequencing to identify sequences that bind to UBE2O with high affinity. We are confident that we will be able to identify a degron for UBE2O, which would allow us to target specific proteins for degradation during erythroid development.

4.4 Role of UBE2O in other terminally differentiated cells Given the broad ubiquitinating activity of UBE2O, it is clear why this enzyme is expressed only in late stage RBC development. Its dominant target, ribosomal proteins, are incredibly stable in normal cells, as 80S ribosomes are necessary for cell growth and survival. In fact, we found that UBE2O abundantly autoubiquitinates itself in the absence of substrate. Autoubiquitination may allow for the stringent expression of UBE2O in the reticulocyte stage and rapid elimination in a mature erythrocyte. However, we hypothesize that UBE2O may function in other terminally differentiated cell types. UBE2O is also expressed at elevated levels in the lens of the eye, sperm, and platelets (unpublished data). Given its proposed role as a quality control ligase for orphan proteins (61), UBE2O may play an important role in the differentiation of these cells. For example, the human lens achieves optical clarity by saturating itself with one class of proteins, crystallins. The differentiation of lens cells closely resembles that of erythrocytes, and necessitates the elimination of virtually all non-crystallin protein. UBE2O may also play a role in the normalization of the crystalline subunits. UBE2O is indeed highly induced during lens fiber cell differentiation (148-150). We propose to study

41 how UBE2O functions during lens development using the Ube2o-/- mouse. We anticipate that these lens cells will have a severe defect in ribosomal protein elimination, which may affect the optical clarity of the mouse lens. Mature sperm are another differentiated cell type that are thought to be largely translationally inactive. In the limited protein synthesis capacity of these cells, sperm were shown to use 55S mitochondrial ribosomes instead of 80S cytosolic ribosomes (151). These mitochondrial ribosomes were used to translate nuclear-encoded proteins, which affect motility and fertilization rates. UBE2O may play an important role in the elimination of cytosolic 80S ribosomes from sperm. Finally, platelets are terminally differentiated cells that arise from megakaryocytes. Platelets do not have nucleus and function to release clotting factors for coagulation. Since these cells do not actively translate proteins, UBE2O may function to eliminate ribosomes among other non-essential proteins. Therefore, we will use the Ube2o-/- mutant to look for broad defects of protein elimination in these cell types.

4.5 UPS in late erythroid differentiation Although reticulocytes have a highly active UPS, the vast majority of UPS genes are downregulated during terminal erythroid differentiation (48-50). Erythrocytes do not require a robust UPS, and thus conserve energy by downregulating this system in reticulocytes. UBE2O and UBE2H were the first ubiquitinating enzymes that were found to be upregulated in reticulocytes in parallel with globin (33). In fact, UBE2O appears to be controlled by the GATA1 master erythroid transcription factor (47). By analyzing RNA- sequencing data from human and mouse erythropoiesis (48-50), we found a subset of ubiquitinating enzymes that were also upregulated in addition to UBE2O (Figure 10). First, we found an ensemble of nine ubiquitinating enzymes, including UBE2O, that were induced contemporaneously with hemoglobin from the proerythroblast to reticulocyte stage. These enzymes include TRIM10, TRIM58, RNF11, FBXO30, CISH, MKRN1, and SOCS3. TRIM58 is an E3 ligase that was shown to ubiquitinate dynein for proteasomal degradation (152). Knockdown of TRIM58 prevented maturation of late-stage nucleated erythroblasts and inhibited enucleation.

42 We then compared expression of 1070 UPS genes in both mouse and human erythropoiesis. We found a subset of E2 and E3 enzymes that were upregulated in both mice and human terminal erythroid differentiation, including UBE2O. Other enzymes identified were UBE2H, UBE2B, CALCOCO, MKRN1, TBCEL, FBXO30, TRIM58, DCAF12, and EGR1. Given the importance of UBE2O on erythroid differentiation, we propose to study these additional genes by knocking them out in mice. To select which mutants to study, we would first screen for a hematologic phenotype. We would then use proteomics to identify candidate substrates, and follow them up with biochemistry. We have generated the UBE2H and TRIM10 knockout mice and are in the process of identifying substrates. Based on these data, we propose that the these ubiquitinating enzymes reconfigure the specificity of the UPS during erythroid differentiation. Finally, the induction of ubiquitinating enzymes may facilitate the transition from complex to simple proteomes during terminal differentiation.

43 5 SUMMARY In this thesis, we showed that UBE2O is a broad spectrum ubiquitinating enzyme that remodels the proteome. In reticulocytes, loss of UBE2O altered the relative abundance of hundreds of proteins. Furthermore, overexpression of UBE2O in non- erythroid cells perturbed nearly 15% of the quantified proteome. UBE2O has a strong preference for basic substrates, including ribosomal proteins (RPs). Therefore, induction of UBE2O broadly reconfigures the specificity of the ubiquitin proteasome system during terminal erythroid differentiation and promotes extensive proteome remodeling. Since UBE2O is a dominant ubiquitinating enzyme, we performed metabolomic analysis of Ube2o-/- reticulocytes and found depleted pools of amino acids. Accordingly, we found strong genetic interaction between Ube2o and the gene encoding GCN2, an amino acid sensor. By ribosome profiling analysis, we found attenuated translation of hemoglobin in Ube2o-/- reticulocytes. Reduced globin translation likely underlies the phenotype of hypochromic, microcytic anemia. Furthermore, UBE2O deficiency ameliorated a mouse model of b-thalassemia by reducing the amount of excess a-globin that can precipitate. As such, UBE2O is a novel and potent therapeutic target for treating b-thalassemia, among other diseases. Lastly, we evaluated non-RP UBE2O-dependent substrates. Ferritins are elevated in Ube2o-/- reticulocytes due to derepression of their translation. UBE2O can ubiquitinate a-globin, but does not appear to be the only globin ligase. Lastly, RIOK1, PTRF, and NOP16 are confirmed as basic substrates that bind to acid conserved regions in the N- terminus of UBE2O. Therefore, UBE2O executes a broad program of ubiquitination through multiple substrate recognition domains. In conclusion, UBE2O facilitates the transition between a complex and simple proteome in reticulocytes and possibly other differentiated cell types.

44 REFERENCES 1. Finley D. Recognition and processing of ubiquitin-protein conjugates by the proteasome. Annu Rev Biochem. 2009;78:477-513. doi: 10.1146/annurev.biochem.78.081507.101607. PubMed PMID: 19489727; PubMed Central PMCID: PMCPMC3431160.

2. Dikic I. Proteasomal and Autophagic Degradation Systems. Annu Rev Biochem. 2017;86:193-224. doi: 10.1146/annurev-biochem-061516-044908. PubMed PMID: 28460188.

3. Komander D, Rape M. The ubiquitin code. Annu Rev Biochem. 2012;81:203-29. doi: 10.1146/annurev-biochem-060310-170328. PubMed PMID: 22524316.

4. Goldstein G. Isolation of bovine thymin: a polypeptide hormone of the thymus. Nature. 1974;247(5435):11-4. PubMed PMID: 4128781.

5. Finley D, Ulrich HD, Sommer T, Kaiser P. The ubiquitin-proteasome system of Saccharomyces cerevisiae. Genetics. 2012;192(2):319-60. doi: 10.1534/genetics.112.140467. PubMed PMID: 23028185; PubMed Central PMCID: PMCPMC3454868.

6. Ciechanover A. Tracing the history of the ubiquitin proteolytic system: the pioneering article. Biochem Biophys Res Commun. 2009;387(1):1-10. doi: 10.1016/j.bbrc.2009.06.065. PubMed PMID: 19539608.

7. Etlinger JD, Goldberg AL. A soluble ATP-dependent proteolytic system responsible for the degradation of abnormal proteins in reticulocytes. Proc Natl Acad Sci U S A. 1977;74(1):54- 8. PubMed PMID: 264694; PubMed Central PMCID: PMCPMC393195.

8. Ciehanover A, Hod Y, Hershko A. A heat-stable polypeptide component of an ATP- dependent proteolytic system from reticulocytes. Biochem Biophys Res Commun. 1978;81(4):1100-5. PubMed PMID: 666810.

9. Wilkinson KD, Urban MK, Haas AL. Ubiquitin is the ATP-dependent proteolysis factor I of rabbit reticulocytes. J Biol Chem. 1980;255(16):7529-32. PubMed PMID: 6249803.

10. Ciechanover A, Heller H, Elias S, Haas AL, Hershko A. ATP-dependent conjugation of reticulocyte proteins with the polypeptide required for protein degradation. Proc Natl Acad Sci U S A. 1980;77(3):1365-8. PubMed PMID: 6769112; PubMed Central PMCID: PMCPMC348495.

11. Hershko A, Ciechanover A, Heller H, Haas AL, Rose IA. Proposed role of ATP in protein breakdown: conjugation of protein with multiple chains of the polypeptide of ATP-dependent proteolysis. Proc Natl Acad Sci U S A. 1980;77(4):1783-6. PubMed PMID: 6990414; PubMed Central PMCID: PMCPMC348591.

12. Nguyen AT. A Novel Program of Ubiquitination Remodels the Erythroid Proteome During Terminal Differentiation [Doctoral dissertation]: Harvard University; 2016.

13. Nguyen AT, Prado MA, Schmidt PJ, Sendamarai AK, Wilson-Grady JT, Min M, et al. UBE2O remodels the proteome during terminal erythroid differentiation. Science. 2017;357(6350). doi: 10.1126/science.aan0218. PubMed PMID: 28774900.

45 14. Ciechanover A, Heller H, Katz-Etzion R, Hershko A. Activation of the heat-stable polypeptide of the ATP-dependent proteolytic system. Proc Natl Acad Sci U S A. 1981;78(2):761-5. PubMed PMID: 6262770; PubMed Central PMCID: PMCPMC319882.

15. Ciechanover A, Elias S, Heller H, Hershko A. "Covalent affinity" purification of ubiquitin- activating enzyme. J Biol Chem. 1982;257(5):2537-42. PubMed PMID: 6277904.

16. Finley D, Ciechanover A, Varshavsky A. Thermolability of ubiquitin-activating enzyme from the mammalian cell cycle mutant ts85. Cell. 1984;37(1):43-55. PubMed PMID: 6327059.

17. Hershko A, Heller H, Elias S, Ciechanover A. Components of ubiquitin-protein ligase system. Resolution, affinity purification, and role in protein breakdown. J Biol Chem. 1983;258(13):8206-14. PubMed PMID: 6305978.

18. Deshaies RJ, Joazeiro CA. RING domain E3 ubiquitin ligases. Annu Rev Biochem. 2009;78:399-434. doi: 10.1146/annurev.biochem.78.101807.093809. PubMed PMID: 19489725.

19. Zheng N, Wang P, Jeffrey PD, Pavletich NP. Structure of a c-Cbl-UbcH7 complex: RING domain function in ubiquitin-protein ligases. Cell. 2000;102(4):533-9. PubMed PMID: 10966114.

20. Ozkan E, Yu H, Deisenhofer J. Mechanistic insight into the allosteric activation of a ubiquitin-conjugating enzyme by RING-type ubiquitin ligases. Proc Natl Acad Sci U S A. 2005;102(52):18890-5. doi: 10.1073/pnas.0509418102. PubMed PMID: 16365295; PubMed Central PMCID: PMCPMC1316884.

21. Huang L, Kinnucan E, Wang G, Beaudenon S, Howley PM, Huibregtse JM, et al. Structure of an E6AP-UbcH7 complex: insights into ubiquitination by the E2-E3 enzyme cascade. Science. 1999;286(5443):1321-6. PubMed PMID: 10558980.

22. Spratt DE, Walden H, Shaw GS. RBR E3 ubiquitin ligases: new structures, new insights, new questions. Biochem J. 2014;458(3):421-37. doi: 10.1042/BJ20140006. PubMed PMID: 24576094; PubMed Central PMCID: PMCPMC3940038.

23. Meyer HJ, Rape M. Enhanced protein degradation by branched ubiquitin chains. Cell. 2014;157(4):910-21. doi: 10.1016/j.cell.2014.03.037. PubMed PMID: 24813613; PubMed Central PMCID: PMCPMC4028144.

24. Ziv I, Matiuhin Y, Kirkpatrick DS, Erpapazoglou Z, Leon S, Pantazopoulou M, et al. A perturbed ubiquitin landscape distinguishes between ubiquitin in trafficking and in proteolysis. Mol Cell Proteomics. 2011;10(5):M111 009753. doi: 10.1074/mcp.M111.009753. PubMed PMID: 21427232; PubMed Central PMCID: PMCPMC3098606.

25. Braten O, Livneh I, Ziv T, Admon A, Kehat I, Caspi LH, et al. Numerous proteins with unique characteristics are degraded by the 26S proteasome following monoubiquitination. Proc Natl Acad Sci U S A. 2016;113(32):E4639-47. doi: 10.1073/pnas.1608644113. PubMed PMID: 27385826; PubMed Central PMCID: PMCPMC4987823.

26. Shabek N, Herman-Bachinsky Y, Buchsbaum S, Lewinson O, Haj-Yahya M, Hejjaoui M, et al. The size of the proteasomal substrate determines whether its degradation will be mediated by mono- or polyubiquitylation. Mol Cell. 2012;48(1):87-97. doi: 10.1016/j.molcel.2012.07.011. PubMed PMID: 22902562.

46 27. Dimova NV, Hathaway NA, Lee BH, Kirkpatrick DS, Berkowitz ML, Gygi SP, et al. APC/C-mediated multiple monoubiquitylation provides an alternative degradation signal for cyclin B1. Nat Cell Biol. 2012;14(2):168-76. doi: 10.1038/ncb2425. PubMed PMID: 22286100; PubMed Central PMCID: PMCPMC3278798.

28. Waxman L, Fagan JM, Goldberg AL. Demonstration of two distinct high molecular weight proteases in rabbit reticulocytes, one of which degrades ubiquitin conjugates. J Biol Chem. 1987;262(6):2451-7. PubMed PMID: 3029081.

29. Hough R, Pratt G, Rechsteiner M. Ubiquitin-lysozyme conjugates. Identification and characterization of an ATP-dependent protease from rabbit reticulocyte lysates. J Biol Chem. 1986;261(5):2400-8. PubMed PMID: 3003114.

30. Groll M, Ditzel L, Lowe J, Stock D, Bochtler M, Bartunik HD, et al. Structure of 20S proteasome from yeast at 2.4 A resolution. Nature. 1997;386(6624):463-71. doi: 10.1038/386463a0. PubMed PMID: 9087403.

31. Finley D, Chen X, Walters KJ. Gates, Channels, and Switches: Elements of the Proteasome Machine. Trends Biochem Sci. 2016;41(1):77-93. doi: 10.1016/j.tibs.2015.10.009. PubMed PMID: 26643069; PubMed Central PMCID: PMCPMC4706478.

32. Unverdorben P, Beck F, Sledz P, Schweitzer A, Pfeifer G, Plitzko JM, et al. Deep classification of a large cryo-EM dataset defines the conformational landscape of the 26S proteasome. Proc Natl Acad Sci U S A. 2014;111(15):5544-9. doi: 10.1073/pnas.1403409111. PubMed PMID: 24706844; PubMed Central PMCID: PMCPMC3992697.

33. Wefes I, Mastrandrea LD, Haldeman M, Koury ST, Tamburlin J, Pickart CM, et al. Induction of ubiquitin-conjugating enzymes during terminal erythroid differentiation. Proc Natl Acad Sci U S A. 1995;92(11):4982-6. PubMed PMID: 7761435; PubMed Central PMCID: PMCPMC41831.

34. Pickart CM, Vella AT. Levels of active ubiquitin carrier proteins decline during erythroid maturation. J Biol Chem. 1988;263(24):12028-35. PubMed PMID: 2841342.

35. Yokota T, Nagai H, Harada H, Mine N, Terada Y, Fujiwara H, et al. Identification, tissue expression, and chromosomal position of a novel gene encoding human ubiquitin-conjugating enzyme E2-230k. Gene. 2001;267(1):95-100. PubMed PMID: 11311559.

36. Klemperer NS, Berleth ES, Pickart CM. A novel, arsenite-sensitive E2 of the ubiquitin pathway: purification and properties. Biochemistry. 1989;28(14):6035-41. PubMed PMID: 2550069.

37. Berleth ES, Pickart CM. Mechanism of ubiquitin conjugating enzyme E2-230K: catalysis involving a thiol relay? Biochemistry. 1996;35(5):1664-71. doi: 10.1021/bi952105y. PubMed PMID: 8634298.

38. Berleth ES, Pickart CM. Several mammalian ubiquitin carrier proteins, but not E2(20K), are related to the 20-kDa yeast E2, RAD6. Biochem Biophys Res Commun. 1990;171(2):705- 10. PubMed PMID: 2169731.

47 39. Pickart CM, Graziani LA, Dosch SF. Murine erythroleukemia cells possess an active ubiquitin- and ATP-dependent proteolytic pathway. Arch Biochem Biophys. 1989;272(1):114-21. PubMed PMID: 2544139.

40. Friend C, Scher W, Holland JG, Sato T. Hemoglobin synthesis in murine virus-induced leukemic cells in vitro: stimulation of erythroid differentiation by dimethyl sulfoxide. Proc Natl Acad Sci U S A. 1971;68(2):378-82. PubMed PMID: 5277089; PubMed Central PMCID: PMCPMC388942.

41. Volloch V, Housman D. Terminal differentiation of murine erythroleukemia cells: physical stabilization of end-stage cells. J Cell Biol. 1982;93(2):390-4. PubMed PMID: 6954153; PubMed Central PMCID: PMCPMC2112864.

42. Parker D, Housman D. Regulation of protein synthesis and accumulation during murine erythroleukemia cell differentiation. J Biol Chem. 1985;260(1):604-9. PubMed PMID: 3855300.

43. Patel VP, Lodish HF. A fibronectin matrix is required for differentiation of murine erythroleukemia cells into reticulocytes. J Cell Biol. 1987;105(6 Pt 2):3105-18. PubMed PMID: 2961771; PubMed Central PMCID: PMCPMC2114745.

44. Haldeman MT, Finley D, Pickart CM. Dynamics of ubiquitin conjugation during erythroid differentiation in vitro. J Biol Chem. 1995;270(16):9507-16. PubMed PMID: 7721879.

45. Koury MJ, Sawyer ST, Bondurant MC. Splenic erythroblasts in anemia-inducing Friend disease: a source of cells for studies of erythropoietin-mediated differentiation. J Cell Physiol. 1984;121(3):526-32. doi: 10.1002/jcp.1041210311. PubMed PMID: 6501430.

46. Sawyer ST, Koury MJ, Bondurant MC. Large-scale procurement of erythropoietin- responsive erythroid cells: assay for biological activity of erythropoietin. Methods Enzymol. 1987;147:340-52. PubMed PMID: 3670091.

47. Li L, Freudenberg J, Cui K, Dale R, Song SH, Dean A, et al. Ldb1-nucleated transcription complexes function as primary mediators of global erythroid gene activation. Blood. 2013;121(22):4575-85. doi: 10.1182/blood-2013-01-479451. PubMed PMID: 23610375; PubMed Central PMCID: PMCPMC3668490.

48. Wong P, Hattangadi SM, Cheng AW, Frampton GM, Young RA, Lodish HF. Gene induction and repression during terminal erythropoiesis are mediated by distinct epigenetic changes. Blood. 2011;118(16):e128-38. doi: 10.1182/blood-2011-03-341404. PubMed PMID: 21860024; PubMed Central PMCID: PMCPMC3204918.

49. An X, Schulz VP, Li J, Wu K, Liu J, Xue F, et al. Global transcriptome analyses of human and murine terminal erythroid differentiation. Blood. 2014;123(22):3466-77. doi: 10.1182/blood- 2014-01-548305. PubMed PMID: 24637361; PubMed Central PMCID: PMCPMC4041167.

50. Madzo J, Liu H, Rodriguez A, Vasanthakumar A, Sundaravel S, Caces DBD, et al. Hydroxymethylation at gene regulatory regions directs stem/early progenitor cell commitment during erythropoiesis. Cell Rep. 2014;6(1):231-44. doi: 10.1016/j.celrep.2013.11.044. PubMed PMID: 24373966; PubMed Central PMCID: PMCPMC3976649.

48 51. Yu J, Feng L, Wu Y, Wang H, Ba J, Zhu W, et al. Vitreous proteomic analysis of idiopathic epiretinal membranes. Mol Biosyst. 2014;10(10):2558-66. doi: 10.1039/c4mb00240g. PubMed PMID: 25014768.

52. Markson G, Kiel C, Hyde R, Brown S, Charalabous P, Bremm A, et al. Analysis of the human E2 ubiquitin conjugating enzyme protein interaction network. Genome Res. 2009;19(10):1905-11. doi: 10.1101/gr.093963.109. PubMed PMID: 19549727; PubMed Central PMCID: PMCPMC2765280.

53. Huttlin EL, Bruckner RJ, Paulo JA, Cannon JR, Ting L, Baltier K, et al. Architecture of the human interactome defines protein communities and disease networks. Nature. 2017;545(7655):505-9. doi: 10.1038/nature22366. PubMed PMID: 28514442; PubMed Central PMCID: PMCPMC5531611.

54. Hao YH, Doyle JM, Ramanathan S, Gomez TS, Jia D, Xu M, et al. Regulation of WASH- dependent actin polymerization and protein trafficking by ubiquitination. Cell. 2013;152(5):1051- 64. doi: 10.1016/j.cell.2013.01.051. PubMed PMID: 23452853; PubMed Central PMCID: PMCPMC3640276.

55. Zhang X, Zhang J, Zhang L, van Dam H, ten Dijke P. UBE2O negatively regulates TRAF6-mediated NF-kappaB activation by inhibiting TRAF6 polyubiquitination. Cell Res. 2013;23(3):366-77. doi: 10.1038/cr.2013.21. PubMed PMID: 23381138; PubMed Central PMCID: PMCPMC3587711.

56. Zhang X, Zhang J, Bauer A, Zhang L, Selinger DW, Lu CX, et al. Fine-tuning BMP7 signalling in adipogenesis by UBE2O/E2-230K-mediated monoubiquitination of SMAD6. EMBO J. 2013;32(7):996-1007. doi: 10.1038/emboj.2013.38. PubMed PMID: 23455153; PubMed Central PMCID: PMCPMC3616286.

57. Mashtalir N, Daou S, Barbour H, Sen NN, Gagnon J, Hammond-Martel I, et al. Autodeubiquitination protects the tumor suppressor BAP1 from cytoplasmic sequestration mediated by the atypical ubiquitin ligase UBE2O. Mol Cell. 2014;54(3):392-406. doi: 10.1016/j.molcel.2014.03.002. PubMed PMID: 24703950.

58. Liang K, Volk AG, Haug JS, Marshall SA, Woodfin AR, Bartom ET, et al. Therapeutic Targeting of MLL Degradation Pathways in MLL-Rearranged Leukemia. Cell. 2017;168(1-2):59- 72 e13. doi: 10.1016/j.cell.2016.12.011. PubMed PMID: 28065413.

59. Vila IK, Yao Y, Kim G, Xia W, Kim H, Kim SJ, et al. A UBE2O-AMPKalpha2 Axis that Promotes Tumor Initiation and Progression Offers Opportunities for Therapy. Cancer Cell. 2017;31(2):208-24. doi: 10.1016/j.ccell.2017.01.003. PubMed PMID: 28162974; PubMed Central PMCID: PMCPMC5463996.

60. Xu Y, Zhang Z, Li J, Tong J, Cao B, Taylor P, et al. The ubiquitin-conjugating enzyme UBE2O modulates c-Maf stability and induces myeloma cell apoptosis. J Hematol Oncol. 2017;10(1):132. doi: 10.1186/s13045-017-0499-7. PubMed PMID: 28673317; PubMed Central PMCID: PMCPMC5496436.

61. Yanagitani K, Juszkiewicz S, Hegde RS. UBE2O is a quality control factor for orphans of multiprotein complexes. Science. 2017;357(6350):472-5. doi: 10.1126/science.aan0178. PubMed PMID: 28774922; PubMed Central PMCID: PMCPMC5549844.

49 62. Weatherall DJ. The inherited diseases of hemoglobin are an emerging global health burden. Blood. 2010;115(22):4331-6. doi: 10.1182/blood-2010-01-251348. PubMed PMID: 20233970; PubMed Central PMCID: PMCPMC2881491.

63. Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived service indicators. Bull World Health Organ. 2008;86(6):480-7. PubMed PMID: 18568278; PubMed Central PMCID: PMCPMC2647473.

64. Cao A, Galanello R. Beta-thalassemia. Genet Med. 2010;12(2):61-76. doi: 10.1097/GIM.0b013e3181cd68ed. PubMed PMID: 20098328.

65. Nathan DG, Gunn RB. Thalassemia: the consequences of unbalanced hemoglobin synthesis. Am J Med. 1966;41(5):815-30. PubMed PMID: 5332176.

66. Fessas P, Loukopoulos D, Kaltsoya A. Peptide analysis of the inclusions of erythroid cells in beta-thalassemia. Biochim Biophys Acta. 1966;124(2):430-2. PubMed PMID: 5968918.

67. Fessas P, Loukopoulos D, Thorell B. Absorption Spectra of Inclusion Bodies in Beta- Thalassemia. Blood. 1965;25:105-9. PubMed PMID: 14255967.

68. Shinar E, Rachmilewitz EA. Oxidative denaturation of red blood cells in thalassemia. Semin Hematol. 1990;27(1):70-82. PubMed PMID: 2405497.

69. Schrier SL. Pathophysiology of thalassemia. Curr Opin Hematol. 2002;9(2):123-6. PubMed PMID: 11844995.

70. Schrier SL, Centis F, Verneris M, Ma L, Angelucci E. The role of oxidant injury in the pathophysiology of human thalassemias. Redox Rep. 2003;8(5):241-5. doi: 10.1179/135100003225002835. PubMed PMID: 14962357.

71. Rund D, Rachmilewitz E. Beta-thalassemia. N Engl J Med. 2005;353(11):1135-46. doi: 10.1056/NEJMra050436. PubMed PMID: 16162884.

72. Vento S, Cainelli F, Cesario F. Infections and thalassaemia. Lancet Infect Dis. 2006;6(4):226-33. doi: 10.1016/S1473-3099(06)70437-6. PubMed PMID: 16554247.

73. Rahav G, Volach V, Shapiro M, Rund D, Rachmilewitz EA, Goldfarb A. Severe infections in thalassaemic patients: prevalence and predisposing factors. Br J Haematol. 2006;133(6):667- 74. doi: 10.1111/j.1365-2141.2006.06082.x. PubMed PMID: 16704445.

74. Rachmilewitz EA, Giardina PJ. How I treat thalassemia. Blood. 2011;118(13):3479-88. doi: 10.1182/blood-2010-08-300335. PubMed PMID: 21813448.

75. Taher AT, Musallam KM, Karimi M, El-Beshlawy A, Belhoul K, Daar S, et al. Overview on practices in thalassemia intermedia management aiming for lowering complication rates across a region of endemicity: the OPTIMAL CARE study. Blood. 2010;115(10):1886-92. doi: 10.1182/blood-2009-09-243154. PubMed PMID: 20032507.

76. Galanello R, Origa R. Beta-thalassemia. Orphanet J Rare Dis. 2010;5:11. doi: 10.1186/1750-1172-5-11. PubMed PMID: 20492708; PubMed Central PMCID: PMCPMC2893117.

50 77. Flint J, Harding RM, Boyce AJ, Clegg JB. The population genetics of the haemoglobinopathies. Baillieres Clin Haematol. 1993;6(1):215-62. PubMed PMID: 8353314.

78. Taher AT, Musallam KM, Cappellini MD, Weatherall DJ. Optimal management of beta thalassaemia intermedia. Br J Haematol. 2011;152(5):512-23. doi: 10.1111/j.1365- 2141.2010.08486.x. PubMed PMID: 21250971.

79. Hunter AR, Jackson RJ. Control of haemoglobin synthesis: coordination of alpha and beta chain synthesis. Hamatol Bluttransfus. 1972;10:95-108. PubMed PMID: 4668010.

80. Rabinovitz M, Fisher JM. Characteristics of the Inhibition of Hemoglobin Synthesis in Rabbit Reticulocytes by Threo-Alpha-Amino-Beta-Chlorobutyric Acid. Biochim Biophys Acta. 1964;91:313-22. PubMed PMID: 14240649.

81. Carrell RW, Lehmann H. The unstable haemoglobin haemolytic anaemias. Semin Hematol. 1969;6(2):116-32. PubMed PMID: 4890092.

82. Huehns ER, Bellingham AJ. Diseases of function and stability of haemoglobin. Br J Haematol. 1969;17(1):1-10. PubMed PMID: 4896986.

83. Etlinger JD, Goldberg AL. Control of protein degradation in reticulocytes and reticulocyte extracts by hemin. J Biol Chem. 1980;255(10):4563-8. PubMed PMID: 7372594.

84. Haas AL, Rose IA. Hemin inhibits ATP-dependent ubiquitin-dependent proteolysis: role of hemin in regulating ubiquitin conjugate degradation. Proc Natl Acad Sci U S A. 1981;78(11):6845-8. PubMed PMID: 6273891; PubMed Central PMCID: PMCPMC349148.

85. Shaeffer JR. ATP-dependent proteolysis of hemoglobin alpha chains in beta-thalassemic hemolysates is ubiquitin-dependent. J Biol Chem. 1988;263(27):13663-9. PubMed PMID: 2843527.

86. Shaeffer JR. Monoubiquitinated alpha globin is an intermediate in the ATP-dependent proteolysis of alpha globin. J Biol Chem. 1994;269(35):22205-10. PubMed PMID: 8071345.

87. Shaeffer JR. Heterogeneity in the structure of the ubiquitin conjugates of human alpha globin. J Biol Chem. 1994;269(47):29530-6. PubMed PMID: 7961937.

88. Shaeffer JR, Cohen RE. Ubiquitin aldehyde increases adenosine triphosphate- dependent proteolysis of hemoglobin alpha-subunits in beta-thalassemic hemolysates. Blood. 1997;90(3):1300-8. PubMed PMID: 9242565.

89. Shaeffer JR, Cohen RE. Differential effects of ubiquitin aldehyde on ubiquitin and ATP- dependent protein degradation. Biochemistry. 1996;35(33):10886-93. doi: 10.1021/bi9530705. PubMed PMID: 8718881.

90. Shaeffer JR, Cohen RE. Enhancement by ubiquitin aldehyde of proteolysis of hemoglobin alpha-subunits in beta-thalassemic hemolysates. Ann N Y Acad Sci. 1998;850:394- 7. PubMed PMID: 9668565.

91. Shaeffer JR, Kania MA. Degradation of monoubiquitinated alpha-globin by 26S proteasomes. Biochemistry. 1995;34(12):4015-21. PubMed PMID: 7696267.

51 92. Yang B, Kirby S, Lewis J, Detloff PJ, Maeda N, Smithies O. A mouse model for beta 0- thalassemia. Proc Natl Acad Sci U S A. 1995;92(25):11608-12. PubMed PMID: 8524813; PubMed Central PMCID: PMCPMC40451.

93. Khandros E, Thom CS, D'Souza J, Weiss MJ. Integrated protein quality-control pathways regulate free alpha-globin in murine beta-thalassemia. Blood. 2012;119(22):5265-75. doi: 10.1182/blood-2011-12-397729. PubMed PMID: 22427201; PubMed Central PMCID: PMCPMC3369615.

94. Ganz T. Hepcidin, a key regulator of iron metabolism and mediator of anemia of inflammation. Blood. 2003;102(3):783-8. doi: 10.1182/blood-2003-03-0672. PubMed PMID: 12663437.

95. Papanikolaou G, Tzilianos M, Christakis JI, Bogdanos D, Tsimirika K, MacFarlane J, et al. Hepcidin in iron overload disorders. Blood. 2005;105(10):4103-5. doi: 10.1182/blood-2004- 12-4844. PubMed PMID: 15671438; PubMed Central PMCID: PMCPMC1895089.

96. Origa R, Galanello R, Ganz T, Giagu N, Maccioni L, Faa G, et al. Liver iron concentrations and urinary hepcidin in beta-thalassemia. Haematologica. 2007;92(5):583-8. PubMed PMID: 17488680.

97. Gardenghi S, Ramos P, Marongiu MF, Melchiori L, Breda L, Guy E, et al. Hepcidin as a therapeutic tool to limit iron overload and improve anemia in beta-thalassemic mice. J Clin Invest. 2010;120(12):4466-77. doi: 10.1172/JCI41717. PubMed PMID: 21099112; PubMed Central PMCID: PMCPMC2993583.

98. Finberg KE, Heeney MM, Campagna DR, Aydinok Y, Pearson HA, Hartman KR, et al. Mutations in TMPRSS6 cause iron-refractory iron deficiency anemia (IRIDA). Nat Genet. 2008;40(5):569-71. doi: 10.1038/ng.130. PubMed PMID: 18408718; PubMed Central PMCID: PMCPMC3104019.

99. Nai A, Pagani A, Mandelli G, Lidonnici MR, Silvestri L, Ferrari G, et al. Deletion of TMPRSS6 attenuates the phenotype in a mouse model of beta-thalassemia. Blood. 2012;119(21):5021-9. doi: 10.1182/blood-2012-01-401885. PubMed PMID: 22490684; PubMed Central PMCID: PMCPMC3426375.

100. Schmidt PJ, Toudjarska I, Sendamarai AK, Racie T, Milstein S, Bettencourt BR, et al. An RNAi therapeutic targeting Tmprss6 decreases iron overload in Hfe(-/-) mice and ameliorates anemia and iron overload in murine beta-thalassemia intermedia. Blood. 2013;121(7):1200-8. doi: 10.1182/blood-2012-09-453977. PubMed PMID: 23223430; PubMed Central PMCID: PMCPMC3655736.

101. Guo S, Casu C, Gardenghi S, Booten S, Aghajan M, Peralta R, et al. Reducing TMPRSS6 ameliorates hemochromatosis and beta-thalassemia in mice. J Clin Invest. 2013;123(4):1531-41. doi: 10.1172/JCI66969. PubMed PMID: 23524968; PubMed Central PMCID: PMCPMC3613931.

102. Schmidt PJ, Racie T, Westerman M, Fitzgerald K, Butler JS, Fleming MD. Combination therapy with a Tmprss6 RNAi-therapeutic and the oral iron chelator deferiprone additively diminishes secondary iron overload in a mouse model of beta-thalassemia intermedia. Am J

52 Hematol. 2015;90(4):310-3. doi: 10.1002/ajh.23934. PubMed PMID: 25557851; PubMed Central PMCID: PMCPMC4403964.

103. Casu C, Aghajan M, Oikonomidou PR, Guo S, Monia BP, Rivella S. Combination of Tmprss6- ASO and the iron chelator deferiprone improves erythropoiesis and reduces iron overload in a mouse model of beta-thalassemia intermedia. Haematologica. 2016;101(1):e8- e11. doi: 10.3324/haematol.2015.133348. PubMed PMID: 26405152; PubMed Central PMCID: PMCPMC4697899.

104. Han AP, Yu C, Lu L, Fujiwara Y, Browne C, Chin G, et al. Heme-regulated eIF2alpha kinase (HRI) is required for translational regulation and survival of erythroid precursors in iron deficiency. EMBO J. 2001;20(23):6909-18. doi: 10.1093/emboj/20.23.6909. PubMed PMID: 11726526; PubMed Central PMCID: PMCPMC125753.

105. Donnelly N, Gorman AM, Gupta S, Samali A. The eIF2alpha kinases: their structures and functions. Cell Mol Life Sci. 2013;70(19):3493-511. doi: 10.1007/s00018-012-1252-6. PubMed PMID: 23354059.

106. Han AP, Fleming MD, Chen JJ. Heme-regulated eIF2alpha kinase modifies the phenotypic severity of murine models of erythropoietic protoporphyria and beta-thalassemia. J Clin Invest. 2005;115(6):1562-70. doi: 10.1172/JCI24141. PubMed PMID: 15931390; PubMed Central PMCID: PMCPMC1136998.

107. Kile BT, Hentges KE, Clark AT, Nakamura H, Salinger AP, Liu B, et al. Functional genetic analysis of mouse chromosome 11. Nature. 2003;425(6953):81-6. doi: 10.1038/nature01865. PubMed PMID: 12955145.

108. Munn DH, Sharma MD, Baban B, Harding HP, Zhang Y, Ron D, et al. GCN2 kinase in T cells mediates proliferative arrest and anergy induction in response to indoleamine 2,3- dioxygenase. Immunity. 2005;22(5):633-42. doi: 10.1016/j.immuni.2005.03.013. PubMed PMID: 15894280.

109. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25(9):1105-11. doi: 10.1093/bioinformatics/btp120. PubMed PMID: 19289445; PubMed Central PMCID: PMCPMC2672628.

110. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 2010;28(5):511-5. doi: 10.1038/nbt.1621. PubMed PMID: 20436464; PubMed Central PMCID: PMCPMC3146043.

111. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26(6):841-2. doi: 10.1093/bioinformatics/btq033. PubMed PMID: 20110278; PubMed Central PMCID: PMCPMC2832824.

112. Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nat Biotechnol. 2011;29(1):24-6. doi: 10.1038/nbt.1754. PubMed PMID: 21221095; PubMed Central PMCID: PMCPMC3346182.

53 113. Beckett D, Kovaleva E, Schatz PJ. A minimal peptide substrate in biotin holoenzyme synthetase-catalyzed biotinylation. Protein Sci. 1999;8(4):921-9. doi: 10.1110/ps.8.4.921. PubMed PMID: 10211839; PubMed Central PMCID: PMCPMC2144313.

114. Gell D, Kong Y, Eaton SA, Weiss MJ, Mackay JP. Biophysical characterization of the alpha-globin binding protein alpha-hemoglobin stabilizing protein. J Biol Chem. 2002;277(43):40602-9. doi: 10.1074/jbc.M206084200. PubMed PMID: 12192002.

115. Shi L, Lin YH, Sierant MC, Zhu F, Cui S, Guan Y, et al. Developmental transcriptome analysis of human erythropoiesis. Hum Mol Genet. 2014;23(17):4528-42. doi: 10.1093/hmg/ddu167. PubMed PMID: 24781209; PubMed Central PMCID: PMCPMC4119405.

116. Paulo JA, O'Connell JD, Gaun A, Gygi SP. Proteome-wide quantitative multiplexed profiling of protein expression: carbon-source dependency in Saccharomyces cerevisiae. Mol Biol Cell. 2015;26(22):4063-74. doi: 10.1091/mbc.E15-07-0499. PubMed PMID: 26399295; PubMed Central PMCID: PMCPMC4710237.

117. McAlister GC, Nusinow DP, Jedrychowski MP, Wuhr M, Huttlin EL, Erickson BK, et al. MultiNotch MS3 enables accurate, sensitive, and multiplexed detection of differential expression across cancer cell line proteomes. Analytical chemistry. 2014;86(14):7150-8. doi: 10.1021/ac502040v. PubMed PMID: 24927332; PubMed Central PMCID: PMC4215866.

118. Paulo JA, O'Connell JD, Gygi SP. A Triple Knockout (TKO) Proteomics Standard for Diagnosing Ion Interference in Isobaric Labeling Experiments. J Am Soc Mass Spectrom. 2016;27(10):1620-5. doi: 10.1007/s13361-016-1434-9. PubMed PMID: 27400695; PubMed Central PMCID: PMCPMC5018445.

119. Huttlin EL, Jedrychowski MP, Elias JE, Goswami T, Rad R, Beausoleil SA, et al. A tissue-specific atlas of mouse protein phosphorylation and expression. Cell. 2010;143(7):1174- 89. doi: 10.1016/j.cell.2010.12.001. PubMed PMID: 21183079; PubMed Central PMCID: PMCPMC3035969.

120. Paulo JA, O'Connell JD, Everley RA, O'Brien J, Gygi MA, Gygi SP. Quantitative mass spectrometry-based multiplexing compares the abundance of 5000 S. cerevisiae proteins across 10 carbon sources. J Proteomics. 2016;148:85-93. doi: 10.1016/j.jprot.2016.07.005. PubMed PMID: 27432472; PubMed Central PMCID: PMCPMC5035620.

121. Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, et al. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 2016;44(W1):W90-7. doi: 10.1093/nar/gkw377. PubMed PMID: 27141961; PubMed Central PMCID: PMCPMC4987924.

122. Chen EY, Tan CM, Kou Y, Duan Q, Wang Z, Meirelles GV, et al. Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics. 2013;14:128. doi: 10.1186/1471-2105-14-128. PubMed PMID: 23586463; PubMed Central PMCID: PMCPMC3637064.

123. Huttlin EL, Ting L, Bruckner RJ, Gebreab F, Gygi MP, Szpyt J, et al. The BioPlex Network: A Systematic Exploration of the Human Interactome. Cell. 2015;162(2):425-40. doi: 10.1016/j.cell.2015.06.043. PubMed PMID: 26186194; PubMed Central PMCID: PMCPMC4617211.

54 124. Sandoval H, Thiagarajan P, Dasgupta SK, Schumacher A, Prchal JT, Chen M, et al. Essential role for Nix in autophagic maturation of erythroid cells. Nature. 2008;454(7201):232-5. doi: 10.1038/nature07006. PubMed PMID: 18454133; PubMed Central PMCID: PMCPMC2570948.

125. Geminard C, de Gassart A, Vidal M. Reticulocyte maturation: mitoptosis and exosome release. Biocell. 2002;26(2):205-15. PubMed PMID: 12240554.

126. Liu J, Guo X, Mohandas N, Chasis JA, An X. Membrane remodeling during reticulocyte maturation. Blood. 2010;115(10):2021-7. doi: 10.1182/blood-2009-08-241182. PubMed PMID: 20038785; PubMed Central PMCID: PMCPMC2837329.

127. McAlister GC, Huttlin EL, Haas W, Ting L, Jedrychowski MP, Rogers JC, et al. Increasing the multiplexing capacity of TMTs using reporter ion isotopologues with isobaric masses. Anal Chem. 2012;84(17):7469-78. doi: 10.1021/ac301572t. PubMed PMID: 22880955; PubMed Central PMCID: PMCPMC3715028.

128. Roux-Dalvai F, Gonzalez de Peredo A, Simo C, Guerrier L, Bouyssie D, Zanella A, et al. Extensive analysis of the cytoplasmic proteome of human erythrocytes using the peptide ligand library technology and advanced mass spectrometry. Mol Cell Proteomics. 2008;7(11):2254-69. doi: 10.1074/mcp.M800037-MCP200. PubMed PMID: 18614565.

129. Vabulas RM, Hartl FU. Protein synthesis upon acute nutrient restriction relies on proteasome function. Science. 2005;310(5756):1960-3. doi: 10.1126/science.1121925. PubMed PMID: 16373576.

130. Suraweera A, Munch C, Hanssum A, Bertolotti A. Failure of amino acid homeostasis causes cell death following proteasome inhibition. Mol Cell. 2012;48(2):242-53. doi: 10.1016/j.molcel.2012.08.003. PubMed PMID: 22959274; PubMed Central PMCID: PMCPMC3482661.

131. Benderoff S, Blostein R, Johnstone RM. Changes in amino acid transport during red cell maturation. Membr Biochem. 1978;1(1-2):89-106. PubMed PMID: 756486.

132. Dever TE, Feng L, Wek RC, Cigan AM, Donahue TF, Hinnebusch AG. Phosphorylation of initiation factor 2 alpha by protein kinase GCN2 mediates gene-specific translational control of GCN4 in yeast. Cell. 1992;68(3):585-96. PubMed PMID: 1739968.

133. Acharya P, Engel JC, Correia MA. Hepatic CYP3A suppression by high concentrations of proteasomal inhibitors: a consequence of endoplasmic reticulum (ER) stress induction, activation of RNA-dependent protein kinase-like ER-bound eukaryotic initiation factor 2alpha (eIF2alpha)-kinase (PERK) and general control nonderepressible-2 eIF2alpha kinase (GCN2), and global translational shutoff. Mol Pharmacol. 2009;76(3):503-15. doi: 10.1124/mol.109.056002. PubMed PMID: 19520899; PubMed Central PMCID: PMCPMC2730383.

134. Jiang HY, Wek RC. Phosphorylation of the alpha-subunit of the eukaryotic initiation factor-2 (eIF2alpha) reduces protein synthesis and enhances apoptosis in response to proteasome inhibition. J Biol Chem. 2005;280(14):14189-202. doi: 10.1074/jbc.M413660200. PubMed PMID: 15684420.

55 135. Neznanov N, Dragunsky EM, Chumakov KM, Neznanova L, Wek RC, Gudkov AV, et al. Different effect of proteasome inhibition on vesicular stomatitis virus and poliovirus replication. PLoS One. 2008;3(4):e1887. doi: 10.1371/journal.pone.0001887. PubMed PMID: 18382670; PubMed Central PMCID: PMCPMC2268745.

136. Harding HP, Zhang Y, Bertolotti A, Zeng H, Ron D. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell. 2000;5(5):897-904. PubMed PMID: 10882126.

137. Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, et al. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol Cell. 2003;11(3):619-33. PubMed PMID: 12667446.

138. Ingolia NT, Ghaemmaghami S, Newman JR, Weissman JS. Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science. 2009;324(5924):218-23. doi: 10.1126/science.1168978. PubMed PMID: 19213877; PubMed Central PMCID: PMCPMC2746483.

139. Ingolia NT, Brar GA, Rouskin S, McGeachy AM, Weissman JS. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments. Nat Protoc. 2012;7(8):1534-50. doi: 10.1038/nprot.2012.086. PubMed PMID: 22836135; PubMed Central PMCID: PMCPMC3535016.

140. Kim W, Bennett EJ, Huttlin EL, Guo A, Li J, Possemato A, et al. Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 2011;44(2):325-40. doi: 10.1016/j.molcel.2011.08.025. PubMed PMID: 21906983; PubMed Central PMCID: PMCPMC3200427.

141. Pantopoulos K. Iron metabolism and the IRE/IRP regulatory system: an update. Ann N Y Acad Sci. 2004;1012:1-13. PubMed PMID: 15105251.

142. Weinberg F, Reischmann N, Fauth L, Taromi S, Mastroianni J, Kohler M, et al. The Atypical Kinase RIOK1 Promotes Tumor Growth and Invasive Behavior. EBioMedicine. 2017;20:79-97. doi: 10.1016/j.ebiom.2017.04.015. PubMed PMID: 28499923; PubMed Central PMCID: PMCPMC5478185.

143. Mason SW, Sander EE, Grummt I. Identification of a transcript release activity acting on ternary transcription complexes containing murine RNA polymerase I. EMBO J. 1997;16(1):163- 72. doi: 10.1093/emboj/16.1.163. PubMed PMID: 9009277; PubMed Central PMCID: PMCPMC1169623.

144. Wang F, Zheng Y, Orange M, Yang C, Yang B, Liu J, et al. PTRF suppresses the progression of colorectal cancers. Oncotarget. 2017;8(30):48650-9. doi: 10.18632/oncotarget.9424. PubMed PMID: 27203393; PubMed Central PMCID: PMCPMC5564714.

145. Kundel DW, Stromquist E, Greene AL, Zhdankin O, Regal RR, Rose-Hellekant TA. Molecular characterizations of Nop16 in murine mammary tumors with varying levels of c-Myc. Transgenic Res. 2012;21(2):393-406. doi: 10.1007/s11248-011-9529-3. PubMed PMID: 21863248; PubMed Central PMCID: PMCPMC4043839.

56 146. Deng HX, Chen W, Hong ST, Boycott KM, Gorrie GH, Siddique N, et al. Mutations in UBQLN2 cause dominant X-linked juvenile and adult-onset ALS and ALS/dementia. Nature. 2011;477(7363):211-5. doi: 10.1038/nature10353. PubMed PMID: 21857683; PubMed Central PMCID: PMCPMC3169705.

147. Lucking CB, Durr A, Bonifati V, Vaughan J, De Michele G, Gasser T, et al. Association between early-onset Parkinson's disease and mutations in the parkin gene. N Engl J Med. 2000;342(21):1560-7. doi: 10.1056/NEJM200005253422103. PubMed PMID: 10824074.

148. Chauss D, Basu S, Rajakaruna S, Ma Z, Gau V, Anastas S, et al. Differentiation state- specific mitochondrial dynamic regulatory networks are revealed by global transcriptional analysis of the developing chicken lens. G3 (Bethesda). 2014;4(8):1515-27. doi: 10.1534/g3.114.012120. PubMed PMID: 24928582; PubMed Central PMCID: PMCPMC4132181.

149. Hoang TV, Kumar PK, Sutharzan S, Tsonis PA, Liang C, Robinson ML. Comparative transcriptome analysis of epithelial and fiber cells in newborn mouse lenses with RNA sequencing. Mol Vis. 2014;20:1491-517. PubMed PMID: 25489224; PubMed Central PMCID: PMCPMC4225139.

150. Matsui M, Yamamoto A, Kuma A, Ohsumi Y, Mizushima N. Organelle degradation during the lens and erythroid differentiation is independent of autophagy. Biochem Biophys Res Commun. 2006;339(2):485-9. doi: 10.1016/j.bbrc.2005.11.044. PubMed PMID: 16300732.

151. Gur Y, Breitbart H. Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes. Genes Dev. 2006;20(4):411-6. doi: 10.1101/gad.367606. PubMed PMID: 16449571; PubMed Central PMCID: PMCPMC1369042.

152. Thom CS, Traxler EA, Khandros E, Nickas JM, Zhou OY, Lazarus JE, et al. Trim58 degrades Dynein and regulates terminal erythropoiesis. Dev Cell. 2014;30(6):688-700. doi: 10.1016/j.devcel.2014.07.021. PubMed PMID: 25241935; PubMed Central PMCID: PMCPMC4203341.

57 RBC HGB MCV MCH RETIC ABS CHr Eif2ak4 Ube2o (x106/µl) (g/dl) (fl) (pg) (x106/µl) (pg)

+/+ +/+ 8.29 ± 0.34 12.3 ± 0.4 56.5 ± 1.5 14.8 ± 0.2 0.28 ± 0.06 15.2 ± 0.2 +/+ -/- 9.58 ± 0.76* 9.4 ± 0.6* 41.7 ± 1.0* 9.9 ± 0.2* 0.30 ± 0.02 11.1 ± 0.3* -/- +/+ 7.97 ± 0.26† 11.9 ± 0.3† 58.4 ± 1.8† 14.9 ± 0.4† 0.24 ± 0.06 14.6 ± 0.2*† -/- -/- 10.48 ± 0.23*†‡ 10.3 ± 0.3*†‡ 41.1 ± 0.2*‡ 9.8 ± 0.2*‡ 0.33 ± 0.05* 11.2 ± 0.1*‡

Table 1. Eif2ak4-/- mutation increases hemoglobin levels in Ube2o-/- mice. Erythropoietic parameters in compound Ube2o-/- and Eif2ak4-/- mutants. Eif2ak4-/- induced elevated hemoglobin levels and erythrocytosis in the Ube2o-/- background. RBC, red blood cells; HGB, hemoglobin; MCV, mean cell volume; MCH, mean corpuscular hemoglobin; RETIC ABS, absolute reticulocytes; CHr, mean reticulocyte hemoglobin content. All studies were performed in 8-week-old female littermates, with n = 6 animals in each group. Significance was calculated by one-way ANOVA with Tukey multiple- comparisons test. *P < 0.05 versus wild type; †P < 0.05 versus Eif2ak4+/+ Ube2o-/-; ‡P < 0.05 versus Eif2ak4-/- Ube2o+/+. Values are means ± SD.

58 Spleen:BW RBC HGB MCV MCH RETIC ABS CHr Hbb Ube2o (mg/g) (x106/µl) (g/dl) (fl) (pg) (x106/µl) (pg) th3/+ +/+ 22.4 ± 1.1 6.86 ± 0.4 6.6 ± 0.2 48.5 ± 1.1 9.8 ± 0.6 1.66 ± 0.35 12.9 ± 0.3 th3/+ -/- 9.8 ± 4.0* 11.53 ± 0.86* 8.3 ± 0.8* 34.0 ± 1.1* 7.1 ± 0.4* 1.19 ± 0.22* 9.7 ± 0.2*

Table 2. Ube2o-/- mutation ameliorates a mouse model of β-thalassemia. Genetic interaction between Ube2o-/- and the β-globin deficient Hbbth3 (th3) allele. Ube2o- /- increased hemoglobin levels and reduced splenomegaly in the Hbbth3/+ mutant, which causes a β-thalassemia intermedia phenotype. Spleen:BW, ratio of spleen weight to body weight. RBC, red blood cells; HGB, hemoglobin; MCV, mean cell volume; MCH, mean corpuscular hemoglobin; RETIC ABS, absolute reticulocytes; CHr, mean reticulocyte hemoglobin content. All studies were performed in 8-week-old female littermates, with n = 6 animals in each group. Significance was calculated by one-way ANOVA with Tukey multiple-comparisons test. *P < 0.05 versus Hbbth3/+ Ube2o+/+. Values are means ± SD. Table adapted from Nguyen et al. (13).

59

+/+ −/− Ube2o 0 24 48 72 0 24 48 72 Time (hr) α-RPL29 α-RPL23A α-RPL37 α-UBE2O α-GAPDH α-β-spectrin

Figure 1. Ribosomal protein clearance is delayed in Ube2o-/- reticulocytes. Ube2o-/- and wild type reticulocytes were differentiated ex vivo and analyzed by immunoblotting. UBE2O deficient reticulocytes showed a severe retardation of ribosomal protein elimination compared to wild type reticulocytes. GAPDH and b-spectrin were used as loading controls. 100 µg of protein was loaded per lane for analysis. Figure adapted from Nguyen et al. (13).

60 2.5

Otub2 Zc3h15 Edf1 Dnaja1 2.0 Ybx3 Cacybp Rnf114 Rpl29 Apobec3 Dtx3l Prune Copa Rpl35a ) Ahcy

e Vsx2 Bpgm Snca Ftl1 u Fga Hgs Fth1 1.5 Alas2 Bnip3l Tyms Upf1 Ribosome (14) val Cmpk2 Dtymk Lgals9 Irgm1 Fgg Adj. p-value = 0.05 p- Endocytosis (12)

Protein export (9) dj.

A Protein processing in (4) ( 1.0 endoplasmic reticulum 10 0 2 4 6 g -log10 (Adj. p-value) lo -

0.5

0.0 -3 -2 -1 0 1 2 3 log (Ube2o−/−/Ube2o+/+) 2

Figure 2. Candidate substrates of UBE2O are identified by quantitative proteomics.

Left: Volcano plot of proteomic analysis representing log2 of the fold change of protein -/- +/+ [log2 (Ube2o /Ube2o )] and log10 of the P value adjusted using Benjamini-Hochberg correction [log10 (adj. P value)]. Highlighted proteins have significant (adj. P value < 0.05) upregulation or downregulation by at least 25%, in red and blue, respectively. Right: KEGG pathway enrichment analysis of significantly upregulated proteins showed high enrichment of ribosomes (adj. P value = 3.23 x 10-6). Number of proteins per group are indicated in the parentheses. Figure adapted from Nguyen et al. (13).

61 0 h 12 h 24 h 48 h 72 h RPL36AL RPS23 0 RPL35A RPL36A r RPL35 1.0 0.9 RPS2 -2 0.8 0.7 RPL31 0.6 <0.5 RPL34 RPS18 -4 RPL5

(UBE2O-WT/UBE2O-CA) RPL29 2 RPL18A

log 0 12 24 48 72 RPS3 hours post UBE2O induction RPS9 Ribosome (18) RPS5 Ribosome biogenesis (16) RPL10 Fanconi anemia pathway (10) RPL19 0 2 4 6 RPL18 -log10 (Adj. p-value) 2 1.5 1 0.5 0 -0.5 -1 -1.5 -2 log (WT/CA) 2

Figure 3. UBE2O drives the elimination of ribosomes in non-erythroid cells. Left: Quantitative mass spectrometry of 7807 proteins after induction of UBE2O-WT or UBE2O-CA for 0, 12, 24, 48, and 72 hours. 685 total proteins were down-regulated more than 50% after 72 hours of UBE2O-WT induction, in comparison to UBE2O-CA. Line coloring represents Pearson correlation (r) to the median pattern from low (black) to high (red). KEGG pathway enrichment analysis of down-regulated proteins showed highly significant enrichment of ribosomes (adj. P value = 2.77 x 10-6). Number of proteins per group are indicated in parentheses. Right: Heat map of all 18 ribosomal proteins that are down-regulated more than 50% after 72 hours of UBE2O-WT induction, in comparison to UBE2O-CA. Coloring represents the log2 of the fold change of protein between UBE2O-WT and UBE2O-CA [log2 (WT/CA)]. Figure adapted from Nguyen et al. (13).

62 Ser **

Trp ** Lys

Arg ** Gln Tyr Ala Asn Met Pro Glu * His Val Leu-Ile Thr Cys Gly * Phe

Asp **

-1.0 -0.5 0.0 0.5 1.0 log (Ube2o-/-/Ube2o+/+) 2

Figure 4. Free amino acid pools are depleted in Ube2o-/- reticulocytes. Quantitative metabolomic profiling was performed on wild type and Ube2o-/- reticulocytes in triplicate. Values were normalized to total red blood cell mass, as calculated by mean cellular volume and red blood cell count per µl of blood. Ube2o-/- reticulocytes showed a depletion of multiple amino acids, including Ser, Trp, and Arg. Significance was calculated by two-sample t test. *P < 0.05, **P < 0.01.

63 A B Start codon Stop codon Ube2o+/+ Null/WT Hba Hbb RPM Initiation 0.94 0.56 Ube2o−/− ORF 0.58 0.67 RPM Total 0.83 0.61

ex1 ex2 ex3 Hba

Start codon Stop codon Ube2o+/+ RPM

Ube2o−/− RPM

ex1 ex2 Hbb ex3

Figure 5. Ube2o-/- reticulocytes have attenuated translation of globin. (A) Ribosome profile of a-globin (Hba, upper panel) and b-globin (Hbb-b1, lower panel) mRNAs in Ube2o-/- and wild type reticulocytes. Ube2o-/- reticulocytes have decreased ribosome occupancy of both globin mRNAs. (B) Quantification of ribosome-protected fragments across the a-globin (Hba) and b- globin (Hbb) mRNAs. Distribution at the peak of accumulation (Initiation), remainder of the open reading frame (ORF), and across the whole mRNA (total). Values expressed as the ratio of Ube2o-/- to wild type. Figure adapted from Nguyen et al. (13).

64

Figure 6. Globin is a UBE2O substrate (A) Purified a-globin was ubiquitinated in a purified system using recombinant UBE2O, biotin-tagged ubiquitin, and ubiquitin activating enzyme (UBE1). The reaction was incubated for 45 min at 37°C, the samples were resolved by SDS-PAGE, and then electroblotted and visualized with streptavidin-HRP. A catalytically inactive mutant (UBE2O-CA) was used as a negative control, and histone H2B (H2B), a model substrate for UBE2O, was used as a positive control. (B) Mapping of ubiquitination sites of a-globin (HBA-A1) and β-globin (HBB-B1) from Ube2o-/- and wild type reticulocytes by mass spectrometry. Unmodified lysines are represented. HBB-B1 has a modified lysine only in the absence of UBE2O. Figure adapted from Nguyen et al. (13) .

65

Figure 7. Translational control of ferritin mRNA is derepressed in Ube2o-/- mutants. (A) mRNAs for ferritin heavy chain 1 (Fth1) and ferritin light chain 1 (Ftl1) were quantified in Ube2o-/- and wild type reticulocytes by quantitative PCR. Ribosome occupancy of the Fth1 and Ftl1 mRNAs was determined by ribosome profiling and quantified using Cufflinks (110). Protein levels of FTH1 and FTL1 were quantified by TMT-based mass spectrometry. Values are expressed as the ratio of Ube2o-/- to wild type. (B) Ribosome profile of Fth1 (upper panel) and Ftl1 (bottom panel) mRNAs in Ube2o-/- and wild type reticulocytes. Ribosomes do not stall at the iron-responsive element (IRE) of the 5’ end of the Fth1 and Ftl1 mRNAs in Ube2o-/- reticulocytes. Figure adapted from Nguyen et al. (13).

66 +/+ −/− Ube2o

α-RIOK1

α-PTRF

α-NOP16

α-UBE2O

α-β-spectrin

α-GAPDH

Figure 8. Additional substrates of UBE2O are elevated in Ube2o-/- reticulocytes. Immunoblot analysis of Ube2o-/- and wild type reticulocytes showed elevated levels of putative UBE2O substrates. These three non-ribosomal proteins were identified by unbiased, global proteomics of the E2O cell line (see Fig. 7). GAPDH and b-spectrin were used as loading controls. 100 µg of protein was loaded per lane. Figure adapted from Nguyen et al. (13).

67 Input Eluate UBE2O-CR 1 2 − 1 2 1 2 − 1 2 Substrate − − + + + − − + + + NOL12 CR1 CR2 CC UBC CR3 (50-361) (532-706) (845-879)(953-1110) (1243-1277) DDX56 WT NOP16 T1 H2B T2 CA PTRF AHSP CR1 CR2

Figure 9. UBE2O contains multiple substrate recognition domains. Left: Schematic representation of UBE2O domains. UBE2O contains three conserved regions (CRs), CR1 and CR2 in the N-terminus and CR3 in the C-terminus. The UBE2O- CA mutant contains an active site cysteine 1037 to alanine mutation, indicated by white asterisk. Finally, UBE2O contains a coiled coil (CC) domain. Right: CR1 and CR2 were recombinantly expressed in biotin-tagged form and bound to streptavidin beads. Purified UBE2O substrates were mixed with the loaded resin at 20- fold excess; the resin was washed; and bound material was eluted with 25% of eluate analyzed by immunoblotting. 2.5% of input loaded for immunoblot analysis. Rows 6-8 were from the same experiment. Figure adapted from Nguyen et al. (13).

68

6 Hba Hbb Ube2o 4 Ube2h Trim10 Trim58 2 (fold induction) Rnf11 2 Fbxo30 log Cish 0 Mkrn1 1 2 3 4 Erythroid differentiation stage Socs3

Figure 10. Multiple ubiquitinating enzymes are induced in late erythropoiesis. Left: An ensemble of ubiquitin-conjugating enzymes and ubiquitin ligases is induced in late stage erythroid differentiation in parallel with globin (Hba and Hbb). Stages are arranged by temporal progression. Stage 1, proerythroblasts and early basophilic erythroblasts; stage 2, early and late basophilic erythroblasts; stage 3, polychromatophilic and orthochromatophilic erythroblasts; stage 4, late orthochromatophilic erythroblasts and reticulocytes. Raw RNA-sequencing data was obtained from (48).

Right: Scatter plot of the log2 of the fold induction, between polychromatic and proerythroblast stages, of all UPS-related genes quantified (1070 genes) in human and mouse erythropoiesis. Highlighted in red are genes that induced in both human and mouse erythropoiesis, which includes Ube2o. Gene expression data was obtained from (49). Figure adapted from Nguyen et al. (13).

69