US 2013 0315952A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0315952 A1 Turner et al. (43) Pub. Date: Nov. 28, 2013

(54) ADMINISTRATION OF FOR Publication Classification PROPHYLAXIS AGAINST OR TREATMENT OF PATHOGENIC INFECTION (51) Int. C. A638/2I (2006.01) Applicant: Defyrus, Inc., Toronto (CA) A639/2 (2006.01) (71) A6M I5/00 (2006.01) A6M 16/14 (2006.01) (72) Inventors: Jeffrey D. Turner, Toronto (CA); Jane A6M II/02 (2006.01) E. Ennis, Toronto (CA) CI2N 5/86 (2006.01) A619/00 (2006.01) (52) U.S. C. (73) Assignee: Defyrus, Inc., Toronto (CA) CPC ...... A61 K38/212 (2013.01): CI2N 15/86 (2013.01); A61 K39/12 (2013.01); A61 K 9/0073 (2013.01); A61M 16/14 (2013.01); (21) Appl. No.: 13/675,897 A61M II/02 (2013.01); A61M 15/00 (2013.01) USPC ... 424/204.1: 435/320.1: 514/44 R; 424/93.2: 128/203.12; 128/200.21; 128/203.15 (22) Filed: Nov. 13, 2012 (57) ABSTRACT The invention provides compositions and methods for the prophylaxis or treatment of diseases or disorders in a subject Related U.S. Application Data (e.g., a mammal. Such as a human) including, e.g., diseases or (63) Continuation of application No. 12/797.575, filed on disorders caused by biological agents, autoimmune diseases, Jun. 9, 2010, now Pat. No. 8,309,531. and cancer. The compositions include a delivery vector (e.g., a viral vector, Such as an Ad5 vector) encoding an interferon (60) Provisional application No. 61/185.261, filed on Jun. (e.g., IFN-O.), and are provided to the Subject by, e.g., intra 9, 2009. nasal or pulmonary administration. Patent Application Publication Nov. 28, 2013 Sheet 1 of 12 US 2013/0315952 A1

Figure 1

girlap. Stitt

*?,*;***$.§

. . . . . T : s , ...... ; F s . . . .

-kai is ... 8 IF - 18, 5. $8, F : ...... E. E. F ...... f : ......

5 (4)

: ,

8 S. | M. R. S. f : . S...... , , ; ; ; ; ; , , , , ...... R. S. F. S. L & E R I, E.

Patent Application Publication Nov. 28, 2013 Sheet 2 of 12 US 2013/0315952 A1

Figure 2

conINF-0.

Patent Application Publication Nov. 28, 2013 Sheet 3 of 12 US 2013/0315952 A1

Figure 3

FN Gene Ad5 Vector IFN polypeptide

/

0 /

/

Air of Nasal Cavity Epithelial Cells BOOdstream D Patent Application Publication Nov. 28, 2013 Sheet 4 of 12 US 2013/0315952 A1

Figure 4

Patent Application Publication Nov. 28, 2013 Sheet 5 of 12 US 2013/0315952 A1

Figure 5

Viral Family Virus No. Groups; Formulation(s); Treatment Challenge Significant Number/Group Dilution levels) Route; Route; Findings Volume; Level; Schedule Schedule Arenavirus Pichinde 10; Liquid DEF201; IN; IP; 100%. Survival Syrian Hamsters 10, 10, 10 100ul; LD95; Prophylaxis Single dose; Single dose -4.hr (d0) Bunyavirus Punta 10; Liquid DEF201; IN; IN; 100% Toro Syrian hamsters 10, 10, or 10 10Oul; LD95; Survival PFU/animal Single dose; Single dose Prophylaxis -4.hr (d0) Bunyavirus Punta 10; Liquid mDEF201; IN; IN; Significant Toro 10 Balb/c/group 5 x 10 PFU/animal 5Oul LD95; reduction in Single dose; Single dose viraltiters & -21, -14, -7, or - (d0) Serum ALT 1d Coronavirus SARS 4; Liquid mDEF201; IN; IN; 100% 10 Balb/c/group 10° or 10 5Oul, LD95; Survival PFU/animal Single dose; Single dose Prophylaxis -24hr dO) Coronavirus SARS 5, Liquid mDEF201; IN; IN; 90% 10 Balb/c/group 10 or 10 50ul; LD95; Treatment PFU/animal Single dose; Single dose Survival +6, 12, or 24hr dO Flavivirus Yellow 15-2O Liquid DEF201; IN; IP; 100% Survival Fewer Syrian Hamsters 108,5x10, 5x10, 100ul; 10 CCIDso; Prophylaxis 5x10 Single dose; Single dose PFU/animal -4.hr dO) Flavivirus Yellow 15-20 Liquid DEF201; IN; IP; 100% Fewer Syrian Hamsters 5x10' PFU/animal 100ul; 10 CCIDso Treatment Single dose; Single dose Survival +1d, +2d or +3d dO) Filovirus Ebola -- 3; Liquid mDEF201; IN or IM; IP; 100% aire 10B10.BR/group 10'PFU/animal 5Oul; 1000LD50; Treatert Single dose; Single dose Survival +3Omir dO) Filovirus Ebola - 5, Liquid mDEF201; IN or IM; IP; 100% Zaire 3 Hartley Guinea 2x10 PFU/animal 25Cul; 1OOLD50; Treatment pigs/group Single dose; Single dose Survival +3Omir dO) Togavirus WEE 5; Liquid mDEF201; IN; IN; 100% 10 Balb/c/group 10' PFU/animal 5Oul; 43LD50 Survival Single dose; Single dose Prophylaxis d -21, -14, -A, or - dO) 1. Togavirus WEE 3; Liquid mDEF201; IN; IN; 100% 10 Balb/c/group 10' PFU/animal 5Oul 43LD50 Treatment Single dose; +6h Single dose Survival (d0) Togavirus WEE 3; Liquid mDEF201; M; Sub O; 100% 8 Balb/c/group 10' PFU/animal 50ul 10 LD50; Survival Single dose; Single dose Prophylaxis -24hr (d0) Patent Application Publication Nov. 28, 2013 Sheet 6 of 12 US 2013/0315952 A1

Figure 6

- DEF201108 pfu -- DEF2011 07 pfu - - - DEF201106 pfu - EV 108 pfu - Ribavirin 50 mg/kg/day •oe Placebo

1. 3 5. 7 9 11 13 1517, 1921 Days post infection Patent Application Publication Nov. 28, 2013 Sheet 7 of 12 US 2013/0315952 A1

Figure 7

A DEF201 against WEEV Calif.

H Group 1 c -- Group 2 -v- Group 3 -- Group 4 E -O Group 5 9 - Group 6 : - A Group 7

O 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Time to death (Days)

DEF201 against WEEV CBA87 B g H Group 1 80 -- Group 2 70 A Group 3 60 -o- Group 4 E 50 -v- Group 5 s - Group 6 20 -O Group 7 10 O O 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Time to Death (Days) Patent Application Publication Nov. 28, 2013 Sheet 8 of 12 US 2013/0315952 A1

Figure 8

1.

::::::

-

ar

2.

s reorr r , or error son's rero - or rr ; r. s r. s r. s r. s r. r * r * r s - : s sm o t roamy Fo s Time 2 s 8 8. 22 Post Virus Exposure

-- PSS (-14 days PWE) -- mDEF201 (-14 days PWE) -- PSS (-7 days PWE) or mDEF201 (-7 Days PWE) - a PSS (-5 days PWE) -- mdeF201 (-5 Days PWE) -v- PSS (-3 days PWE) -- mDEF201 (-3 Days PWE) w Poly CLC (1 mg/kg/day

B 0 58:

s 8.

50

o

3

14 Post virus exposure

wn. PSS (+6 h) -- moF201 (106 PFU, +6 h) *** PC0.001 vs. Pss (+6h) -- PSS (+12 h) - moeF201 (106 PFU, +12 h) re PSS (24 h) -- moeF201 (106 PFU, +24 h) -- meF201 (1 OPFU, +6 h) * P-0.05 vs. PSS (+6h) -- moF201 (105PFU, +12h) - moeF201 (105PFU, +24 h) -- Poly ICLC (1 mg/kg/day; -24h, +8h) * PK0.001 vs. all PSS Patent Application Publication Nov. 28, 2013 Sheet 9 of 12 US 2013/0315952 A1

Figure 9

e

E.

day of death

...

i 8.

is of dest Patent Application Publication Nov. 28, 2013 Sheet 10 of 12 US 2013/0315952 A1

Figure 10

O SO O8. O3, O O.

3O8. O8. O.

9 13 5 Days Post-Exsie

A. ------Control

memFM-0 Protein --DEF2O

------6 - 8 1 C 11 12 13, 14 15, 16 Days Post-Exposure Patent Application Publication Nov. 28, 2013 Sheet 11 of 12 US 2013/0315952 A1

Figure 11

:

s: .

SS -

SS -

.

s «Sixswoxsw8wixos.

: S & 3 a & 3 3. ay Patent Application Publication Nov. 28, 2013 Sheet 12 of 12 US 2013/0315952 A1

Figure 12

isis

&. x3x sists 73: x83 is Li's: its - 3 x is3 is ::iii. 3. 63: sis g: is W X. is . . . iss3six $x'8'tiii ;88 is& 33m. s:

33s... 8 & 3:3 E33.

3. i. 2 : 3 x s 3 s : 3 2 is is Tirisays Post-infection US 2013/03 15952 A1 Nov. 28, 2013

ADMINISTRATION OF INTERFERON FOR response. It is directly responsible for NK and respon PROPHYLAXIS AGAINST OR TREATMENT siveness, which drives the Subsequent immune response. OF PATHOGENIC INFECTION Because of the early response of IFN-C. in the immune cas cade, its primary role is suggested to be to induce a priming CROSS REFERENCE TO RELATED state during the initial response to infection, and it has been APPLICATIONS shown that low dose IFN-O. results in increased protection from a viral challenge. 0001. This application is a continuation of U.S. Ser. No. 0007 IFN-O, as a recombinant human therapeutic agent, 12/797.575, filed on Jun. 9, 2010, now U.S. Pat. No. 8,309, is expensive to manufacture by c0MP is hindered by its short 531, which claims priority to U.S. Provisional Application half-life in Vivo, and is produced in a non-glycosylated form. No. 61/185,261, filed on Jun. 9, 2009. IFN-O. has an initial distributive half-life of 7 minutes and a beta half-life of 2 to 5 hours. This rapid decay requires mul FIELD OF THE INVENTION tiple injections, usually three times weekly, to maintain thera 0002 The invention is directed to the treatment of or pro peutic levels. Thus, at $2,500 per dose retail, the cost of using phylaxis against diseases or disorders caused by biological or recombinant human IFN-O. as a broad-spectrum antiviral in chemical agents in a subject (e.g., a mammal. Such as a counter bioterrorism or military operations is prohibitive. human). 0008. In order to mitigate this rapid in vivo degradation, PEGylated forms of IFN-O. have been developed that have BACKGROUND OF THE INVENTION half-lives that are on the order of days instead of hours, thus 0003. There is a suite of emerging viruses that are reducing the number of injections to once per week. None endemic, pandemic, engineered, or weaponized. To date, theless, the PEGylation process has been shown to reduce the there is no broad-spectrum antiviral therapy that can effec activity of the IFN-O, and PEG-IFN-C. is even more expensive tively prevent infection or treat illness resulting from these to manufacture than IFN-O. viruses. According to the U.S. Centers for Disease Control 0009 Currently, there is a need for a broad-spectrum anti and Prevention (CDC: Rotz et al. CDC Emerging Infectious viral that could be administered for pre- or post-exposure Diseases Vol. 8, No. 2, 2002) there are six Category A threats, prophylaxis to guard against or in response to, respectively, which includes Smallpox, which is caused by, e.g., variola infectious diseases, such as viral threats (e.g., a viral bio virus (Smallpox), and viral hemorrhagic fever, which is weapon used during a terrorist event or in the event of pan caused by, e.g., filoviruses, such as Ebola virus, bunyaviruses, demic disease). Such as hantavirus, and arenaviruses, such as Lassa virus. Category A agents have the greatest potential for adverse SUMMARY OF THE INVENTION public health impact with mass casualties. Biological agents 0010. In a first aspect, the invention features a composition that have potential for large-scale dissemination with result that includes a vector having a nucleic acid molecule encod ant illness but generally fewer fatalities are classified as Cat ing an interferon (IFN) and a pharmaceutically acceptable egory B threats. Several viral threats are identified as Cat excipient, in which the composition is formulated as a dry, egory B threats; these include viral encephalitis, such as, e.g., lyophilized powder, gel, or liquid, and in which the compo Venezuelan equine encephalitis virus (VEEV), eastern sition is stable at room temperature for at least one week. In an equine encephalitis virus (EEEV), and western equine embodiment, the interferon is IFN-alpha (IFN-C.; e.g., con encephalitis virus (WEEV), which are all alphaviruses. There sensus IFN-C (conIFN-C.; set forth in, e.g., SEQID NO: 11) are also many emerging Category C threats, which include or that is substantially identical (e.g., at least about 75%, 80%, diseases caused by Nipah virus and hantavirus. 85%, 90%. 95%, 97%, or 99% or more identical) to the 0004. In addition to the CDC list, the U.S. Department of sequence set forth in SEQ ID NO: 11). In another embodi Health and Human Services (HHS) has released a list of ment, the vector is a viral vector (e.g., an adenoviral vector viruses under their Public Health Emergency Medical Coun (e.g., an adenoviral Strain 5 (Ad5) vector)). In another termeasures Enterprise (PHEMCE) program that lists embodiment, the adenoviral vector (e.g., the Ad5 vector) Arenaviridae (e.g., Junin and Lassa viruses), Filoviridae (e.g., includes a deletion of all or part of the E1 and E3 genes, which Ebola and Marburg viruses), Poxyiridae (Smallpox and mon makes it replication deficient. In yet another embodiment, the key pox viruses), and Orthomyxoviridae (e.g., Influenzavirus vector is a non-viral vector. A, such as H5N1 and H1N1 viruses). Clearly it is not feasible 0011. In another embodiment of the first aspect of the to vaccinate an entire population againstall viral strains of all invention, in vivo expression of the IFN upon administration of these viral agents. Indeed, the large-scale vaccination of of the composition of the first aspect of the invention produces the public against bioterrorist threats, e.g., anthrax, was a a protective immune response against a pathogen (e.g., a failure. bacterium, virus, fungus, or parasite) in a mammal (e.g., a 0005 Interferon-alpha (IFN-C.) has been used clinically human) to which the composition is administered or treats and commercially (e.g., Roferon AR, IntronAR), PegasyS(R), infection by the pathogen in the mammal. In another embodi Peglintron R etc) to Successfully treat various cancers, includ ment, in vivo expression of the IFN upon administration of ing, e.g., malignant melanoma, hairy cell leukemia, non the composition of the first aspect of the invention produces a Hodgkin’s lymphoma, AIDS-related Kaposi's sarcoma, as protective response againstan in a mam well as infectious diseases, such as severe acute respiratory mal (e.g., a human) to which the composition is administered. syndrome (SARS), chronic Hepatitis B, and chronic Hepatitis 0012. In other embodiments of the first aspect of the inven C. IFN-Cl is a type I interferon, which binds to the IFN-C. tion, the nucleic acid molecule of the vector is operably linked receptor. to a promoter selected from an SV40 promoter, CMV pro 0006 IFN-C. is one of the earliest released by moter, adenovirus early and late promoter, metallothioneine antigen presenting cells as part of the innate immune gene (MT-1) promoter, Rous sarcoma virus (RSV) promoter, US 2013/03 15952 A1 Nov. 28, 2013 and human Ubiquitine C (UbC) promoter, or the vector fur minutes following exposure to the pathogen or at least about ther includes one or more of a signal sequence, a polyadeny 1, 2, 4, 6, 8, 10, 15, 20, 24, 48, or 72 hours, or more, after lation sequence, and enhancer, an upstream activation exposure to the pathogen. In other embodiments, the patho sequence, and a transcription termination factor that facili gen is a bacterium, virus, fungus, or parasite. tates expression of the nucleic acid molecule encoding the 0017. In other embodiments, the subject receives the com interferon. In yet other embodiments, the excipient, which is position of the first aspect of the invention prior to or after present in the composition in an amount in the range of from development of autoimmune disease or cancer, or symptoms 1% to 90% by weight (e.g., in an amount in the range of from thereof. 5% to 30% by weight), is selected from one or more of In still other embodiments of the second aspect of the inven fructose, maltose, galactose, glucose, D-mannose, Sorbose, tion, the composition can be inhaled as a lyophilized powder lactose, Sucrose, trehalose, cellobiose, raffinose, melezitose, (e.g., as an unreconstituted powder) or admixed with a phar maltodextrins, dextrans, starches, mannitol. Xylitol. Xylose, maceutically acceptable liquid (e.g., water or saline) and maltitol, lactitol, xylitol sorbitol, sorbitose, pyranosyl sorbi inhaled as an aerosolized mist. In other embodiments, the tol, myoinositol, glycine, CaCl2, hydroxyectoine, ectoine, aerosolized mist includes droplets having a diameter of gelatin, di-myo-inositol phosphate (DIP), cyclic 2.3 diphos greater than 2 Jum. In yet another embodiment, prior to admin phoglycerate (cDPG), 1,1-di-glycerol phosphate (DGP), istration of the composition of the first aspect of the invention, B-mannosylglycerate (firoin), B-mannosylglyceramide the subject is tested to determine whether the subject has been (firoin A), and proline betaine. exposed to the pathogen, exhibits symptoms of autoimmune 0013. In a preferred embodiment, the excipient is one that disease, or has cancer. In another embodiment, following is capable of stabilizing the IFN-encoding delivery vehicle administration of the composition of the first aspect of the (e.g., the Ad5-IFN delivery vehicle) for an extended period of invention, the method further includes determining the level time (e.g., greater than 1 week, and preferably greater than 1 of IFN in the Subjects serum and administering a Subsequent year or more) at room temperature with a loss of less than dose of the composition if the level of IFN in the serum is less 20% of the viraltiter or biological activity (e.g., if the delivery than about 1000 IU/ml, preferably less than about 500 IU/ml, vehicle is non-viral). Non-limiting examples of Such excipi more preferably less than 100 IU/ml, e.g., in the range of ents include, e.g., trehalose, Sorbitol. Sucrose, mannitol, gly about 0.0001 to about 250 IU/ml. In other embodiments, the cine, CaCl2, hydroxiectoin, ectoin, firoin and gelatine. level of IFN in the serum, following administration of a 0014. In still other embodiments, the composition can be composition of the invention is in the range of about 100 formulated for aerosolized delivery; is stable at room tem IU/ml to about 5.0x10 IU/ml, preferably in the range of perature for at least one month (e.g., 1 year or more); and can about 200 to 10,000 IU/ml, more preferably in the range of be admixed with a pharmaceutically acceptable liquid to form about 250 to 5,000 IU/ml. In other embodiments, the subject the liquid or gel. is administered at least 2 doses (e.g., 3, 4, 5, 6,7,8,9, and 10 0015. In a second aspect, the invention features a method doses) of the composition. Preferably, the composition pro for prophylaxis or treatment of infection by a biological agent tects the subject from infection by the pathogen for at least (e.g., an infectious pathogen, such as a bacteria, virus, fungus, about 24 hours, 36 hours, 48 hours, or 72 hours, preferably for or parasite), autoimmune disease, or cancer in a Subject in at least about 1, 2, 3, 4, or 5 weeks, and more preferably for at need thereof (e.g., a mammal. Such as a primate, dog, cat, cow, least about 2, 6, 12, 18 or 24 months or more. In other horse, pig, goat, rat, mouse, or human, or a bird) by admin embodiments, administration of the composition of the first istering an amount of the composition of the first aspect of the aspect of the invention reduces or dimishes symptoms asso invention to the pulmonary or nasal mucosa of a Subject (e.g., ciated with autoimmune disease or results in a decrease of 20, a mammal. Such as a primate, dog, cat, cow, horse, pig, goat, 40, 60, 80, or 100% in the size of a tumor or in the number of rat, mouse, or human, or a bird) one or more times (e.g., 2, 3, cancerous cells, as determined using standard methods (for 4, 5, 6, 7, 8, 9, or 10 times, e.g., within the course of one or example, at least 20, 40, 60, 80, 90, or 95% of the treated more months or one or more years, or as needed). In an Subjects have a complete remission in which all evidence of embodiment, the vector targets pulmonary or nasal epithelial the tumor or cancer disappears). Desirably, the tumor or can cells upon said administration. In yet another embodiments, cer does not reappear or reappears after at least 5, 10, 15, or 20 transfection of the vector into the targeted cells results in years. expression of the interferon (IFN: e.g., IFN-O, such as con 0018. In other embodiments, the composition is adminis sensus IFN-C (conIFN-C.; set forth in, e.g., SEQID NO: 11)) tered as a liquid or a gel. The composition may be adminis in the cells of the subject and the IFN acts locally and/or is tered by the Subjector by another person, Such as an attending secreted by the cells into the subject’s bloodstream. In other physician. embodiments, the composition includes an adenovirus strain 0019. In other embodiments of the second aspect of the 5 (Ad5) vector encoding the IFN and the composition invention, following administration of the composition of the includes the Ad5 vector in an amount in the range of at least first aspect of the invention, the method further includes about 1x10 to about 1x10" viral particles per dose. determining the level of an IFN-induced response as a corre 0016. In still other embodiments of the second aspect of late for the activity of IFN in the subject. For example, the the invention, the Subject receives the composition prior to method can include determining or measuring the upregula exposure to the pathogen (e.g., at least about 15 to 30 minutes tion or activity of the double-stranded RNA (dsRNA)-depen prior to exposure to the pathogen, preferably at least about 1, dent protein kinase R (PKR), the 2'-5'-oligoadenylate syn 2, 4, 6, 8, 10, 15, 20, or 24 hours prior to exposure to the thetase (2'-5'-OAS), IFN-inducible MX proteins, a pathogen, and more preferably at least about 1-2 weeks prior tryptophan-degrading enzyme (see, e.g., Pfefferkorn, Proc. to exposure to the pathogen) or the Subject receives the com Natl. Acad. Sci. USA 81:908-912, 1984), adenosine deami position following exposure to the pathogen (e.g., immedi nase (ADAR1), IFN-stimulated gene 20 (ISG20), p 56, ately after exposure to the pathogen or at least about 15-30 ISG15, mGBP2, GBP-1, the APOBEC proteins, viperin, or US 2013/03 15952 A1 Nov. 28, 2013

other factors (see, e.g., Zhang et al., J. Virol. 81:11246 virus, Zika virus, Banzi virus, Boubouivirus, Edge Hill virus, 11255, 2007, and U.S. Pat. No. 7,442,527, which is incorpo Jugra virus, Saboya virus, Sepik virus, Uganda S virus, Wes rated by reference herein in its entirety). selsbron virus, yellow fever virus; and viruses with no known 0020. A third aspect of the invention features a device that arthropod vector, such as the Entebbe bat virus, Yokose virus, contains the composition of any embodiments of the first Apoi virus, Cowbone Ridge virus, Jutiapa virus, Modoc aspect of the invention. Preferably, the device includes a) a virus, Sal Vieja virus, San Perlita virus, Bukalasa bat virus, container that includes the composition; b) a nozzle for Carey Island virus, Dakarbat virus, Montanamyotis leukoen directing the composition to the pulmonary or nasal mucosa cephalitis virus, Phnom Penh bat virus, Rio Bravo virus, of a subject; c) a mechanical delivery pump for delivering the Tamanabat virus, and the Cell fusing agent virus. composition to the nozzle. Such that activation of the pump 0024. In another embodiment of all aspects of the inven results in a fluid connection between the nozzle and the con tion, the virus is selected from a member of the Arenaviridae tainer, and d) an actuation mechanism for activating the family, which includes the Ippy virus, Lassa virus (e.g., the mechanical delivery pump (e.g., a trigger capable of actuating Josiah, LP, or GA391 strain), lymphocytic choriomeningitis the delivery pump at a predeterminable pressure or flow rate). virus (LCMV), Mobala virus, Mopeia virus, Amapari virus, The delivery pump can also include a liquid delivery pump for Flexal virus, Guanarito virus, Junin virus, Latino virus, delivering a metered Volume of the composition in liquid Machupo virus, Oliveros virus, Paraná virus, Pichinde virus, form or a powder delivery pump for delivering a metered Pirital virus, Sabia virus, Tacaribe virus, Tamiami virus, amount of the composition in powder form. In an embodi Whitewater Arroyo virus, Chapare virus, and Lujo virus. ment, the nozzle can be configured to deliver an aerosol (e.g., 0025. In yet other embodiments of all aspects of the inven a mist) or a jet. Devices for use in the third aspect of the tion, the virus is selected from a member of the Bunyaviridae invention are described herein. family (e.g., a member of the Hantavirus, Nairovirus, 0021. A fourth aspect of the invention features a that Orthobunyavirus, and Phlebovirus genera), which includes includes a first container having the composition of any the Hantaan virus, Sin Nombre virus, Dugbe virus, Bunyam embodiments of the first aspect of the invention, a second wera virus, Rift Valley fever virus, La Crosse virus, Punta container having a pharmaceutically acceptable liquid, and Toro virus (PTV), California encephalitis virus, and the device of any embodiments of the third aspect of the Crimean-Congo hemorrhagic fever (CCHF) virus. invention, and, optionally, instructions for using the device to 0026. In still other embodiments of all aspects of the deliver the contents of the first container, or for combining the invention, the virus is selected from a member of the Filov contents of the first and second containers to form a combined iridae family, which includes the Ebola virus (e.g., the Zaire, composition and then using the device to deliver the com Sudan, Ivory Coast, Reston, and Uganda Strains) and the bined composition, e.g., to a subject for treating or inhibiting Marburg virus (e.g., the Angola, Ció7, Musoke, Popp, Ravn infection by a pathogen, autoimmune disease or symptoms and Lake Victoria strains); a member of the Togaviridae fam thereof, or cancer. In an embodiment of all aspects of the ily (e.g., a member of the Alphavirus genus), which includes invention, the vector is a recombinant viral vector (e.g., an the Venezuelan equine encephalitis virus (VEE), Eastern adenoviral vector, such as Ad5) that includes a nucleic acid equine encephalitis virus (EEE), Western equine encephalitis molecule encoding a (e.g., interferon-alpha (IFN virus (WEE), Sindbis virus, rubella virus, Semliki Forest C.), such as consensus IFN-C); the composition can be admin virus, Ross River virus, Barmah Forest virus, Onyongnyong istered to a subject (e.g., a mammal. Such as a primate, dog, virus, and the chikungunyavirus; a member of the Poxyiridae cat, cow, horse, pig, goat, rat, mouse, or human, or a bird) to family (e.g., a member of the Orthopoxvirus genus), which protect against challenge from, or to treat infection by, a includes the Smallpox virus, monkeypox virus, and vaccinia biological agent. The biological agent can be an infectious virus; a member of the Herpesviridae family, which includes pathogen, such as a bacterium, virus, fungus, or parasite. the herpes simplex virus (HSV; types 1, 2, and 6), human 0022. In an embodiment of all aspects of the invention, the herpes virus (e.g., types 7 and 8), cytomegalovirus (CMV), bacterium is selected from Pseudomonas aeruginosa, Salmo Epstein-Barr virus (EBV), Varicella-Zoster virus, and Kapo nella typhimurium, Escherichia coli, Klebsiella pneumoniae, si's sarcoma associated-herpesvirus (KSHV); a member of Bruscella, Burkholderia mallei, Yersinia pestis, and Bacillus the Orthomyxoviridae family, which includes the influenza anthracis. virus (A, B, and C), such as the H5N1 avian influenza virus or 0023. In an embodiment of all aspects of the invention, the H1N1 Swine flu; a member of the Coronaviridae family, virus is selected from a member of the Flaviviridae family which includes the severe acute respiratory syndrome (e.g., a member of the Flavivirus, Pestivirus, and Hepacivirus (SARS) virus; a member of the Rhabdoviridae family, which genera), which includes the hepatitis C virus, Yellow fever includes the rabies virus and vesicular stomatitis virus virus; Tick-borne viruses, such as the Gadgets Gully virus, (VSV): a member of the Paramyxoviridae family, which Kadam virus, Kyasanur Forest disease virus, Langat Virus, includes the human respiratory syncytial virus (RSV), New Omsk hemorrhagic fever virus, Powassan virus, Royal Farm castle disease virus, hendravirus, nipahvirus, measles virus, virus, Karshi virus, tick-borne encephalitis virus, Neudoerfl rinderpest virus, canine distemper virus, Sendai virus, human virus, Sofin virus, Louping ill virus and the Negishi virus; parainfluenza virus (e.g., 1, 2, 3, and 4), rhinovirus, and seabird tick-borne viruses, such as the Meaban virus, Sau mumps virus; a member of the Picornaviridae family, which marez, Reef virus, and the Tyuleniy virus; mosquito-borne includes the poliovirus, human enterovirus (A, B, C, and D). viruses, such as the Aroa virus, dengue virus, Kedougou hepatitis A virus, and the coxsackievirus; a member of the virus, Cacipacore virus, Koutango virus, Japanese encepha Hepadnaviridae family, which includes the hepatitis B virus: litis virus, Murray Valley encephalitis virus, St. Louis a member of the Papillamoviridae family, which includes the encephalitis virus. Usutu virus, West Nile virus, Yaounde human papillomavirus; a member of the Parvoviridae family, virus, Kokobera virus, BagaZa virus, Ilheus virus, Israel tur which includes the adeno-associated virus; a member of the key meningoencephalo-myelitis virus, Ntaya virus, TembuSu Astroviridae family, which includes the astrovirus; a member US 2013/03 15952 A1 Nov. 28, 2013

of the Polyomaviridae family, which includes the JC virus, a hormone, a clotting factor, a drug resistance or anti-viral BK virus, and SV40 virus; a member of the Calciviridae resistance polypeptide, an anti-venom agent, an antioxidant, family, which includes the Norwalk virus; a member of the a receptor or ligand, an immunomodulatory factor, a detect Reoviridae family, which includes the rotavirus; and a mem able label, a cellular factor, or a vaccine. In other embodi ber of the Retroviridae family, which includes the human ments, the antibody or antibody fragment can be a single immunodeficiency virus (HIV: e.g., types 1 and 2), and chain antibody (sclv), Fab, Fab'2, scFv, SMIP, diabody, human T-lymphotropic virus Types I and II (HTLV-1 and nanobody, aptamer, or domain antibody. In yet other embodi HTLV-2, respectively). ments, the cytokine or can be tumor necrosis 0027. In still other embodiments of all aspects of the factor alpha (TNF-C.), TNF-B, IFN-?3. IFN-Y, 1 invention, the fungus can be Aspergillus, Blastomyces der (IL-1), IL-1B, -14, granulocyte matitidis, Candida, Coccidioides immitis, Cryptococcus neo colony-stimulating factor (GM-CSF), granulocyte colony formans, Histoplasma capsulatum var. capsulatum, Paracoc stimulating factor (G-CSF), RANTES, MIP-1C), transform cidioides brasiliensis, Sporothrix schenckii, Zygomycetes ing growth factor-beta (TGF-B), platelet derived growth fac spp., Absidia corymbifera, Rhizomucorpusillus, or Rhizopus tor (PGDF), insulin-like growth factor (IGF), epidermal arrhizus. growth factor (EGF), vascular endothelial growth factor 0028. In another embodiment of all aspects of the inven (VEGF), keratinocyte growth factor (KGF), tion, the parasite is selected from Toxoplasma gondii, Plas (EPO), or (TPO). The hormone can be angio modium falciparum, P. vivax, P ovale, P. malariae, Trypano tensinogen, angiotensin, parathyroid hormone (PTH), basic Soma spp., and Legionella spp. fibroblast growth factor-2, luteinizing hormone, follicle 0029. In another embodiment of all aspects of the inven stimulating hormone, adrenocorticotrophic hormone tion, the autoimmune disease includes systemic autoimmune (ACTH), vasopressin, oxytocin, Somatostatin, gastrin, chole diseases and organ-specific autoimmune diseases. Typical cystokinin, leptin, atrial-natriuretic peptide, epinephrine, examples of autoimmune diseases include insulin-dependent norephinephrine, dopamine, calcitonin, or insulin. The clot diabetes (also known as type 1 diabetes), Systemic lupus ting factor can be factor VII, factor VIII, factor IX, or fibrino erythematosus, chronic rheumatoid arthritis, Hashimoto's gen. The enzyme can be can be butyrylcholinesterase disease, alopecia greata, ankylosing spondylitis, antiphos (BChE), adenosine deaminase, glucocerebrosidase, alpha-1 pholipid syndrome, autoimmune Addison's disease, autoim antitrypsin, a viral thymidine kinase, hypoxanthine phospho mune hemolytic anemia, autoimmune hepatitis, Behcet’s dis ribosyl transferase, manganese Superoxide dismutase (Mn ease, bullous pemphigoid, cardiomyopathy, celiac sprue SOD), catalase, copper-zinc-superoxide dismutase (CuZn dermatitis, chronic fatigue immune dysfunction syndrome SOD), extracellular superoxide dismutase (EC-SOD), (CFIDS), chronic inflammatory demyelinating polyneuropa glutathione reductase, phenylalanine hydroxylase, nitric thy, Churg-Strauss syndrome, cicatricial pemphigoid, oxide synthetase, or paraoxinase. The receptor or ligand can CREST syndrome, cold agglutinin disease, Crohn's disease, be a T-cell receptor (TCR), LDL receptor, surface-bound discoid lupus, ulcerative colitis, psoriatic arthritis, essential immunoglobulin, Soluble CD4, cystic fibrosis transmem mixed cryoglobulinemia, fibromyalgia-fibromyositis, brane conductance receptor (CFTR), or a F receptor. The Graves disease, Guillain-Barré, hypothyroidism, idiopathic immunomodulatory factor can be CTLA-4, VCP, PLIF, LSF pulmonary fibrosis, idiopathic thrombocytopenia purpura 1, Nip, CD200, uromodulin, CD40L (CD154), FasL, CD27L, (ITP), IgA nephropathy, juvenile arthritis, lichen planus, CD3OL, 4-1BBL, CD28, CD25, B7.1, B7.2, or OX40L. The lupus, Méniere's disease, mixed connective tissue disease, detectable label can be green fluorescent protein (GFP). The multiple Sclerosis, myasthenia gravis, pemphigus Vulgaris, cellular factor can be cytochrome b, ApoE, ApoC, ApoAI, pernicious anemia, polyarteritis nodosa, polychondritis, MDR, tissue plasminogenactivator (tPA), urokinase, hirudin, polyglandular syndromes, polymyalgia rheumatica, poly B-globin, C.-globin, HbA, ras, Src, or bc1. The polypeptide can myositis and dermatomyositis, primary agammaglobuline be a cellular protein that acts as an antigen, thereby generating mia, primary biliary cirrhosis, psoriasis, Raynaud's phenom an immune response in the Subject against a biological or enon, Reiter's syndrome, rheumatic fever, sarcoidosis, chemical agent. The vaccine can be, e.g., a bacterial, viral, Scleroderma, Sjögren's syndrome, Stiff-Man syndrome, fungal, or parasite vaccine known in the art for treating one or Devic's disease, Takayasu arteritis, temporal arteritis/giant more of the bacterial, viral, fungal, or parasitic agents cell arteritis, ulcerative colitis, uveitis, vasculitis, vitiligo, and described herein. For example, the vaccine may be directed Wegener's granulomatosis. against a bacterium selected from Pseudomonas aeruginosa, 0030. In another embodiment of all aspects of the inven Salmonella typhimurium, Escherichia coli, Klebsiella pneu tion, the cancer include Such cancers as melanoma, clear cell moniae, Bruscella, Burkholderia mallei, Yersinia pestis, and sarcoma, head and neck cancer, bladder cancer, breast cancer, Bacillus anthracis; a virus selected from a member of the colon cancer, ovarian cancer, endometrial cancer, gastric can Flaviviridae family (e.g., a member of the Flavivirus, Pestivi cer, pancreatic cancer, renal cancer, prostate cancer, salivary rus, and Hepacivirus genera), which includes the hepatitis C gland cancer, lung cancer, liver cancer, skin cancer, and brain virus, Yellow fever virus; Tick-borne viruses, such as the CaCC. Gadgets Gully virus, Kadam virus, Kyasanur Forest disease 0031. In yet another embodiment of all aspects of the virus, Langat virus, Omsk hemorrhagic fever virus, Powassan invention, the compositions and methods of the first, second, virus, Royal Farmvirus, Karshi virus, tick-borne encephalitis third, and fourth aspects of the invention further include virus, Neudoerfl virus, Sofin virus, Louping ill virus and the administering with, or expressing in, the vector (e.g., viral Negishi virus; seabird tick-borne viruses, such as the Meaban vector), a Supplemental therapeutic agent or regimen, e.g., a virus, Saumarez Reef virus, and the Tyuleniy virus; mos polypeptide. Such as an antibody or antibody fragment (e.g., quito-borne viruses, such as the Aroa virus, dengue virus, recombinant, humanized, chimeric, or monoclonal antibody Kedougou virus, Cacipacore virus, Koutango virus, Japanese or fragment), a microbial antigen, a cytokine or growth factor, encephalitis virus, Murray Valley encephalitis virus, St. Louis US 2013/03 15952 A1 Nov. 28, 2013

encephalitis virus. Usutu virus, West Nile virus, Yaounde BK virus, and SV40 virus; a member of the Calciviridae virus, Kokobera virus, BagaZa virus, Ilheus virus, Israel tur family, which includes the Norwalk virus; a member of the key meningoencephalo-myelitis virus, Ntaya virus, TembuSu Reoviridae family, which includes the rotavirus; and a mem virus, Zika virus, Banzi virus, Boubouivirus, Edge Hill virus, ber of the Retroviridae family, which includes the human Jugravirus, Saboya virus, Sepik virus, Uganda S virus, Wes immunodeficiency virus (HIV: e.g., types 1 and 2), and selsbron virus, yellow fever virus; and viruses with no known human T-lymphotropic virus Types I and II (HTLV-1 and arthropod vector, such as the Entebbe bat virus, Yokose virus, HTLV-2, respectively); or a fungus selected from Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides immitis, Apoi virus, Cowbone Ridge virus, Jutiapa virus, Modoc Cryptococcus neoformans, Histoplasma capsulatum var. virus, Sal Vieja virus, San Perlita virus, Bukalasa bat virus, capsulatum, Paracoccidioides brasiliensis, Sporothrix Carey Island virus, Dakarbat virus, Montanamyotis leukoen schenckii, Zygomycetes spp., Absidia corymbifera, Rhizomu cephalitis virus, Phnom Penh bat virus, Rio Bravo virus, corpusillus, and Rhizopus arrhizus; or parasite selected from Tamana bat virus, and the Cell fusing agent virus; a virus Toxoplasma gondii, Plasmodium falciparum, P. vivax, P selected from a member of the Arenaviridae family, which ovale, P. malariae, Trypanosoma spp., and Legionella spp. includes the Ippy virus, Lassa virus (e.g., the Josiah, LP, or GA391 strain), lymphocytic choriomeningitis virus 0032. In yet other embodiments of all aspects of the inven (LCMV), Mobala virus, Mopeia virus, Amapari virus, Flexal tion, the vector (e.g., viral vector) can be modified to express virus, Guanarito virus, Junin virus, Latino virus, Machupo one or more oligonucleotides, e.g., an RNA interference virus, Oliveros virus, Paraná virus, Pichinde virus, Pirital (RNAi) molecule capable of inhibiting viral replication or virus, Sabia virus, Tacaribe virus, Tamiami virus, Whitewater infection. The RNAi molecule can be a small inhibitory RNA Arroyo virus, Chapare virus, and Lujo virus; a virus selected (siRNA) or short hairpin RNA (shRNA) molecule. from a member of the Bunyaviridae family (e.g., a member of 0033. In another embodiment of all aspects of the inven the Hantavirus, Nairovirus, Orthobunyavirus, and Phlebovi tion, the Subject has been or is Suspected to have been exposed rus genera), which includes the Hantaan virus, Sin Nombre to a biological or chemical agent prior to receiving a pharma virus, Dugbe virus, Bunyamwera virus, Rift Valley fever ceutical composition of the invention. In another embodiment virus, La Crosse virus, Punta Toro virus (PTV), California of all aspects of the invention, the Subject has been diagnosed encephalitis virus, and Crimean-Congo hemorrhagic fever with or exhibits symptoms of autoimmune disease or cancer (CCHF) virus; a virus selected from a member of the Filov prior to receiving a pharmaceutical composition of the inven iridae family, which includes the Ebola virus (e.g., the Zaire, tion. The Subject can be administered single or multiple doses Sudan, Ivory Coast, Reston, and Uganda strains) and the of the pharmaceutical composition of the invention. In Marburg virus (e.g., the Angola, Ció7, Musoke, Popp, Ravn another embodiment of all aspects of the invention, the phar and Lake Victoria strains); a member of the Togaviridae fam maceutical composition of the invention can be administered ily (e.g., a member of the Alphavirus genus), which includes to a subject (e.g., a mammal, Such as a human) as a prophy the Venezuelan equine encephalitis virus (VEE), Eastern lactic, e.g., as a vaccine-type preventative, prior to exposure equine encephalitis virus (EEE), Western equine encephalitis to a biological or chemical agent to protect the Subject (e.g., virus (WEE), Sindbis virus, rubella virus, Semliki Forest immediately prior to exposure, e.g., at least about 5, 10, or 30 virus, Ross River virus, Barmah Forest virus, Onyongnyong minutes prior to exposure, or, preferably, at least about 1,2,3, virus, and the chikungunyavirus; a member of the Poxyiridae 4, or 5 hours prior to exposure, more preferably at least about family (e.g., a member of the Orthopoxvirus genus), which 6, 24, 36, 48, or 72 hours prior to exposure, and more prefer includes the Smallpox virus, monkeypox virus, and vaccinia ably at least about 1, 2, 3, or 4 weeks or more prior to virus; a member of the Herpesviridae family, which includes exposure) or prior to the diagnosis of, or development of the herpes simplex virus (HSV; types 1, 2, and 6), human symptoms of autoimmune disease or cancer. The pharma herpes virus (e.g., types 7 and 8), cytomegalovirus (CMV), ceutical composition of the invention can be administered to Epstein-Barr virus (EBV), Varicella-Zoster virus, and Kapo a subject intravenously, intramuscularly, orally, by inhalation, sis sarcoma associated-herpesvirus (KSHV); a member of parenterally, intraperitoneally, intraarterially, transdermally, the Orthomyxoviridae family, which includes the influenza Sublingually, nasally, transbuccally, liposomally, adiposally, virus (A, B, and C), such as the H5N1 avian influenza virus or opthalmically, intraocularly, Subcutaneously, intrathecally, H1N1 Swine flu; a member of the Coronaviridae family, topically, or locally. In a preferred embodiment, the pharma which includes the severe acute respiratory syndrome ceutical composition is administered to the pulmonary or (SARS) virus; a member of the Rhabdoviridae family, which intranasal mucosa of a subject. If the IFN-encoding delivery includes the rabies virus and vesicular stomatitis virus vehicle composition is a viral vector, the Subject can be (VSV): a member of the Paramyxoviridae family, which administered at least about 1x10 viral particles (vp)/dose or includes the human respiratory syncytial virus (RSV), New between 1x10' and 1x10" vp/dose, preferably between castle disease virus, hendravirus, nipahvirus, measles virus, 1x10 and 1x10' vp/dose, and more preferably between rinderpest virus, canine distemper virus, Sendai virus, human 1x10 and 1x10" vp/dose. If the IFN-encoding delivery parainfluenza virus (e.g., 1, 2, 3, and 4), rhinovirus, and vehicle composition is a non-viral vector, the Subject can be mumps virus; a member of the Picornaviridae family, which administered at least about 1x10" molecules/dose, e.g., includes the poliovirus, human enterovirus (A, B, C, and D). between 1x10" and 1x10" molecules/dose, preferably hepatitis A virus, and the coxsackievirus; a member of the between 1x10 and 1x10" molecules/dose, and more prefer Hepadnaviridae family, which includes the hepatitis B virus: ably between 1x10' and 1x10 molecules/dose, of the non a member of the Papillamoviridae family, which includes the viral delivery vector. human papilloma virus; a member of the Parvoviridae family, 0034. In other embodiments of all aspects of the invention, which includes the adeno-associated virus; a member of the expression of the heterologous protein (e.g., IFN. Such as a Astroviridae family, which includes the astrovirus; a member consensus IFN-O.) in a Subject (as determined by measuring of the Polyomaviridae family, which includes the JC virus, serum levels) occurs for greater than one week, one month, US 2013/03 15952 A1 Nov. 28, 2013

two months, or six months. In yet other embodiments, the ment in the subject is considered sufficient to achieve treat effects of expression of interferon (e.g., IFN-C., such as a ment. Preferably, an amount Sufficient to treat is an amount consensus IFN-C) occurs for greater than one week, one that reduces, inhibits, or prevents the occurrence or one or month, two months, six months or 1-2 years (as determined more symptoms of a viral infection (e.g., symptoms that by using Surrogate markers for interferon expression, as is result from infection by at least one and preferably two or discussed herein). more viruses or viral strains) or is an amount that reduces the 0035. In another embodiment of all aspects of the inven severity of, or the length of time during which a subject tion, the pharmaceutical composition of the invention can be Suffers from, one or more symptoms of the infection (e.g., by administered to a subject in combination with one or more at least 10%, 20%, or 30%, more preferably by at least 50%, Supplemental agents that enhance or prolong the prophylactic 60%, or 70%, and most preferably by at least 80%,90%,95%, or therapeutic effect of the interferon (e.g., consensus IFN-O.) 99%, or more, relative to a control subject that is not treated treatment. The Supplemental agent can be, e.g., a cytokine, with a composition of the invention). A Sufficient amount of antiviral agent, anti-bacterial agent, anti-fungal agent, anti the pharmaceutical composition used to practice the methods parasitic agent, immunostimulant, or immunization vaccine. described herein (e.g., the treatment of viral infection(s)) In another embodiment, the pharmaceutical composition of varies depending upon the manner of administration and the the invention includes an IFN expression vector (e.g., an Ad5 age, body weight, and general health of the Subject being vector that encodes IFN-C), a vaccine, and a pharmaceuti treated. A physician or researcher can decide the appropriate cally acceptable carrier, in which the composition is fast amount and dosage regimen. acting (e.g., exhibiting >80% (e.g., 85%, 90%. 95%, or 99% 0040. By “host, “subject' or “patient' is meant any organ or more (e.g., 100%)) treatment efficacy (e.g., as measured by ism, Such as a mammal (e.g., a primate, dog, cat, cow, horse, Survival) when administered within at least 24 hours (e.g., 1, pig, goat, rat, and mouse) or a bird; preferably the organism is 2, 4, 6, 8, 10, 12, 15, or 18 hours) post-exposure or even within a human. A host may also be a domestic animal (e.g., a farm as little as 15-30 minutes post-exposure. In another embodi animal) or a companion animal (e.g., a pet). ment, the vaccine is a viral vaccine (e.g., an Ebola vaccine 0041. By “inducing an immune response' is meant elicit (e.g., the Ebola Zaire vaccine Ad-CAGoptZGP; see Richard ing a humoral response (e.g., the production of antibodies) or son et al. (PloS 4:e5308, 2009)). In another embodiment, the a cellular response (e.g., the activation of T cells, macroph pharmaceutical composition of the invention includes an IFN ages, neutrophils, and natural killer cells) directed againstone expression vector (e.g., an Ad5 vector that encodes IFN-O.) or more viruses or viral strains (e.g., two, three, four, or more and a pharmaceutically acceptable carrier, which is adminis viruses or viral strains) in a subject to which the pharmaceu tered separately or in combination with a vaccine (e.g., a viral tical composition (e.g., a vaccine) has been administered. vaccine, Such as an Ebola vaccine (e.g., the Ebola Zaire vac 0042. As used here, “interferon” or “IFN' refers to a pep cine Ad-CAGoptZGP; see Richardson et al. (PLoS 4.e5308, tide or protein having an amino acid sequence Substantially 2009)). For example, the pharmaceutical composition of the identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, invention is administered within 15-30 minutes of the vaccine 96%, 97%, 98%, 99%, or even 100% identical) to all or a or within 1, 2, 4, 8, 10, 12, 24, 48, or 72 hours of the vaccine portion of the sequence of an interferon (e.g., a human inter or within 1-2 weeks after the vaccine. feron), such as IFN-C. (e.g., IFN-C-1a; see U.S. Patent Appli 0036. In yet another embodiment of all aspects of the cation No. 20070274950, incorporated herein by reference in invention, the vector (e.g., viral vector, Such as Ad5 vector) is its entirety), IFN-C-1b (SEQID NOs: 1 and 2), IFN-O-2a (see administered with a pharmaceutically acceptable carrier or PCT Application No. WO 07/044,083, hereinincorporated by excipient. reference in its entirety) and IFN-C-2b (SEQID NOs: 3 and 4)), consensus IFN-Cl (SEQ ID NO: 11), IFN-B (e.g., DEFINITIONS described in U.S. Pat. No. 7,238.344, incorporated by refer 0037. The term “about” is used hereinto mean a value that ence in its entirety; IFN-B-1a, as described in U.S. Pat. No. is +10% of the recited value. 6,962.978; incorporated by reference in its entirety) and IFN 0038. As used herein, by “administering is meant a |B-1b (as described in U.S. Pat. Nos. 4,588,585; 4.959,314; method of giving a dosage of a pharmaceutical composition 4.737.462; and 4.450,103; incorporated by reference in their to a subject. The compositions utilized in the methods entirety; see also SEQID NOs: 5 and 6), IFN-Y (see, e.g., SEQ described herein can be administered by a route selected ID NOs: 7 and 8), and IFN-T (as described in U.S. Pat. No. from, e.g., parenteral, dermal, transdermal, ocular, inhalation, 5,738,845 and U.S. Patent Application Publication Nos. buccal, Sublingual, perilingual, nasal, rectal, topical, and oral. 20040247565 and 20070243163; incorporated by reference Parenteral administration includes intra-arterial, intravenous, in their entirety; see also SEQID NOs: 9 and 10). intraperitoneal, Subcutaneous, and intramuscular administra 0043. The term “interferon alpha” or “IFN-C” as used tion. The preferred method of administration can vary herein means the family of highly homologous species-spe depending on various factors (e.g., the components of the cific proteins that inhibit viral replication and cellular prolif composition being administered and the severity of the con eration and modulate immune response. Typical Suitable dition being treated). interferon-alphas include, but are not limited to, recombinant 0039. By “an amount sufficient to treat’ is meant the interferon alpha-2a, recombinant interferon alpha-2b, recom amount of a composition administered to improve, inhibit, or binant interferon alpha-2c, alpha 2 interferon, and a consen ameliorate a condition of a Subject, or a symptom of a disor sus alpha interferon, such as those described in U.S. Pat. Nos. der, in a clinically relevant manner (e.g., improve, inhibit, or 4,897,471 and 4,695,623 (especially Examples 7, 8 or 9 ameliorate infection, e.g., by one or more viruses or viral thereof), which are incorporated herein by reference. strains, or one or more symptoms that occur following infec 0044. By “pharmaceutical composition' is meant any tion, or to improve, treat, or ameliorate autoimmune disease composition that contains a therapeutically or biologically or cancer, or one or more symptoms thereof). Any improve active agent (e.g., at least one nucleic acid molecule that US 2013/03 15952 A1 Nov. 28, 2013 encodes all or part of a cytokine (e.g., an interferon, Such as or BLAST 2.0 sequence comparison algorithms with default IFN-O. (e.g., consensus IFN-C) either incorporated into a viral parameters, or by manual alignment and visual inspection vector or independent of a viral vector (e.g., incorporated into (see, e.g., NCBI web site). a liposome, microparticle, or nanoparticle)) that is suitable for administration to a Subject and that is capable of inducing 0049. By “treating is meant administering a pharmaceu an immune response against at least one virus (e.g., at least tical composition of the invention for prophylactic and/or two, three, four, or more different viruses or viral strains) or therapeutic purposes. Prophylactic treatment may be admin that treats autoimmune disease or cancer or reduces or ame istered, for example, to a subject who is not yet ill, but who is liorates one or more symptoms of autoimmune disease or Susceptible to, or otherwise at risk of a particular biological cancer. For the purposes of this invention, pharmaceutical condition, e.g., infection by a bacteria, virus, fungus, or para compositions Suitable for delivering a therapeutic or biologi site (e.g., the Subject may already have been exposed to the cally active agent can include, e.g., tablets, gelcaps, capsules, infectious agent but is asymptomatic or the level of exposure pills, powders, granulates, Suspensions, emulsions, Solutions, to the infectious agent is unknown), or the development of gels, hydrogels, oral gels, pastes, eye drops, ointments, autoimmune disease or cancer. Therapeutic treatment may be creams, plasters, drenches, delivery devices, Suppositories, administered, for example, to a subject already suffering from enemas, injectables, implants, sprays, or aerosols. Any of contact with a biological agent in order to improve or stabilize these formulations can be prepared by well-known and the Subjects condition (e.g., a patient already infected with a accepted methods of art. See, for example, Remington. The pathogenic virus) or a subject already Suffering from an Science and Practice of Pharmacy (21 ed.), ed. A. R. autoimmune disease or cancer. Thus, in the claims and Gennaro, Lippincott Williams & Wilkins, 2005, and Encyclo embodiments described herein, treating is the administration pedia of Pharmaceutical Technology, ed. J. Swarbrick, to a subject either for therapeutic or prophylactic purposes. In Informa Healthcare, 2006, each of which is hereby incorpo rated by reference. Some instances, as compared with an equivalent untreated 0045. By “pharmaceutically acceptable diluent, excipient, control, treatment may ameliorate a disorder (e.g., infection carrier, or adjuvant” is meant a diluent, excipient, carrier, or by a pathogen, Such as a virus, autoimmune disease, and adjuvant which is physiologically acceptable to the Subject cancer) or a symptom of the disorder, or reduce the progres while retaining the therapeutic properties of the pharmaceu Sion, severity, or frequency of one or more symptoms of the tical composition with which it is administered. One exem disorderby, e.g.,5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, plary pharmaceutically acceptable carrier is physiological 80%, 90%, 95%, or 100% as measured by any standard tech saline. Other physiologically acceptable diluents, excipients, nique. For example, for measuring symptoms of infection, carriers, or adjuvants and their formulations are known to one one may use, e.g., blood tests to check for antibodies directed skilled in the art. against the pathogen or for the antigens themselves; cultures 0046 By “recombinant with respect to a vector, such as for samples of blood, bodily fluid, or other material taken a viral vector, is meant a vector (e.g., a viral genome that has from the infected area; spinal tap to examine cerebrospinal been incorporated into one or more delivery vehicles (e.g., a fluid; polymerase chain reaction (PCR) techniques to amplify plasmid, cosmid, etc.)) that has been manipulated in vitro, nucleic acid material from the pathogen; magnetic and reso e.g., using recombinant nucleic acid techniques, to introduce nance imaging (MRI) to detect increased Swelling in the changes to the vector (e.g., to include heterologous nucleic temporal lobes). Symptoms of pathogenic infection, which acid sequences (such as IFN (e.g., conIFN-O.) in a viral may vary from mild to severe and may depend on what part of genome (e.g., a replication deficient Ad5 genome)). An the body is affected, the type of pathogen, and the age and example of a recombinant viral vector of the invention is a overall health of the affected person, include, e.g., fever, vector that includes all or part of the adenovirus (e.g., aden muscle aches, coughing, Sneezing, runny nose, Sore throat, ovirus strain 5 (Ad5)) genome and that includes the nucleic headache, chills, diarrhea, vomiting, rash, weakness, dizzi acid sequence for all or part of e.g., a cytokine gene sequence, ness, bleeding under the skin, in internal organs, or from body Such as an interferon-C. gene (e.g., the consensus IFN-O. orifices like the mouth, eyes, or ears, shock, nervous system sequence). malfunction, delirium, seizures, renal (kidney) failure, per 0047. By “room temperature' is meant a temperature of Sonality changes, neck stiffness, dehydration, seizures, leth about 5° C. to about 30°C., in particular from about 10°C. to argy, paralysis of the limbs, confusion, back pain, loss of about 27°C. (e.g., about 23-27°C.). sensation, impaired bladder and bowel function, and sleepi 0048. The term “substantial identity” or “substantially ness that can progress into coma or death. In some instances, identical, when used in the context of comparing a poly treating can result in the inhibition of the pathogenic infec nucleotide or polypeptide sequence to a reference sequence, tion, the treatment of the infection, and/or the amelioration of means that the polynucleotide or polypeptide sequence has symptoms of the infection (e.g., hemorrhagic fever). Detect the same sequence as the reference sequence or has a speci ing an improvement in, or the absence of, one or more symp fied percentage of nucleotides or amino acid residues that are toms of the infection, indicates Successful treatment. Treat the same at the corresponding locations within the reference ment can also be confirmed by the absence of, or the inability sequence when the two sequences are optimally aligned. For to detect the presence of the pathogen (e.g., a virus) in the instance, an amino acid sequence that is “substantially iden treated subject. tical to a reference sequence has at least about 60% identity, 0050 For the treatment or prophylaxis of autoimmune preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, disease, one can measure, e.g., decreased levels of autoanti 93%, 94%, 95%,96%.97%.98%, 99%, or higher percentage bodies, decreased levels of autoreactive T cells, increase of identity (up to 100%) to the reference sequence when com targeted cells (e.g., pancreatic B-islet cells), and improve pared and aligned for maximum correspondence over the full ments in fatigue, depression, sensitivity to cold, weight gain, length of the reference sequence as measured using a BLAST muscle weakness, constipation, insomnia, irritability, weight US 2013/03 15952 A1 Nov. 28, 2013

loss, bulging eyes, muscle tremors, skin rashes, painful or 0056. The term “virus,” as used herein, is defined as an Swollen joints, sensitivity to the Sun, loss of coordination, and infectious agent that is unable to grow or reproduce outside a paralysis. host cell and that infects mammals (e.g., humans) or birds. 0051. For the treatment or reduction of cancer, one can 0057. Other features and advantages of the invention will measure reductions in the size of a tumor or in the number of be apparent from the detailed description and from the claims. cancer cells, the slowing or prevention of an increase in the size of a tumor or cancer cell proliferation, an increase in the BRIEF DESCRIPTION OF THE FIGURES disease-free survival time between the disappearance of a tumor or other cancer and its reappearance, the prevention of 0.058 FIG. 1 is a table providing comparative amino acid an initial or Subsequent occurrence of a tumor or other cancer, sequences of human leukocyte interferon Subtypes and a con or the reduction of an adverse symptom associated with a sensus human leukocyte interferon. tumor or other cancer. In a desired embodiment, the percent of 0059 FIG. 2 is a schematic showing insertion of the tumor or cancerous cells Surviving the treatment is at least 20, nucleic acid molecule encoding consensus interferon-alpha 40, 60, 80, or 100% lower than the initial number of tumor or (conINF-C.) into an adenoviral vector. cancerous cells, as measured using any standard assay (e.g., 0060 FIG. 3 is a schematic showing delivery of an Ad5 caspase assays, TUNEL and DNA fragmentation assays, cell conIFN-C construct of the invention to the nasal epithelial permeability assays, and Annexin V assays). Desirably, the cells of a patient, expression of the conIFN-O. nucleic acid decrease in the number of tumor or cancerous cells induced molecule in the cells, and release of IFN polypeptide into the by administration of an agent of the invention is at least 2, 5. bloodstream of the patient. 10, 20, or 50-fold greater than the decrease in the number of 0061 FIG. 4 is a diagram showing the benefits of an Ad5 non-tumor or non-cancerous cells. Desirably, the methods of conIFN-C construct of the invention. the present invention result in a decrease of 20, 40, 60, 80, or 100% in the size of a tumor or in the number of cancerous 0062 FIG. 5 is a table summarizing the results of experi cells, as determined using standard methods. Desirably, at ments (in the indicated animal model) using compositions of least 20, 40, 60, 80,90, or 95% of the treated subjects have a the invention to treat or prevent infection by the indicated complete remission in which all evidence of the tumor or virus. cancer disappears. Desirably, the tumor or cancer does not 0063 FIG. 6 is a graph showing the effect of intranasal reappear or reappears after at least 5, 10, 15, or 20 years. (IN) Ad5-IFNC. treatment on survival outcome in hamsters 0052 A subject to be treated according to the methods challenged with Punta Toro virus (PTV). Animals in each described herein (e.g., a subject infected with, or at risk of group were treated once 24 hours prior to IN instillation with being infected with, a bacterium, virus, fungus, or parasite) PTV with the indicated amount of Ad5-IFNC. or empty vector may be one who has been diagnosed by a medical practitioner virus particles. Ribavirin treatment was i.p. once daily for 6 as having Such a condition. Diagnosis may be performed by days starting 4 hours prior to PTV infection.*P<0.05, *P<0. any suitable means. A subject in whom the development of an 01 compared to PBS vehicle placebo-treated animals. '<0. infection is being prevented may or may not have received 001 as compared to EV-treated animals. Such a diagnosis. One skilled in the art will understand that a 0064 FIGS. 7A and 7B are graphs showing the effect of Subject to be treated according to the present invention may IN Ad5-IFNC. treatment on survival outcome in mice chal have been subjected to standard tests or may have been iden lenged with WEE virus. Animals in each group were treated tified, without examination, as one at high risk due to the with 107 PFU Ad5-IFNC, as per the groups outlined in presence of one or more risk factors (e.g., exposure to a Example 9 below, and challenged with WEE virus via IN biological agent, Such as a virus). instillation. IFNC. B/D was given daily as a positive control group. 0053. By “viral vector is meant a composition that includes one or more genes from a viral species, such as an 0065 FIGS. 8A and 8B are graphs showing the effect of adenoviral species (e.g., Ad5), that is able to transmit one or IN Ad5-IFNC. treatment on survival outcome in mice chal more heterologous genes from a viral or non-viral source to a lenged with SARS virus. FIG. 8A shows the results of pro host or subject. The nucleic acid material of the viral vector phylyaxis: Animals in each group were treated with 10° PFU may be encapsulated, e.g., in a lipid membrane or by struc Ad5-IFNC, as per the groups outlined in Example 10 below, tural proteins (e.g., capsid proteins), that may include one or and challenged with SARS virus via IN instillation. FIG. 8B more viral polypeptides (e.g., a glycoprotein). The viral vec shows the results of treatment: Animals in each group were tor can be used to infect cells of a Subject (e.g., nasal epithe treated with 10° or 10 PFU Ad5-IFNC. as per the groups lium), which, in turn, promotes the translation of the heter outlined in Example 10 below, and challenged with SARS ologous gene(s) of the viral vector into a protein product (e.g., virus via IN instillation Poly IC/LC was used as a positive IFN-C). control group, with saline as negative control. 0066 FIGS. 9A and 9B are graphs showing the effect of 0054 Alternatively, the viral vector can be administered to IN Ad5-IFNC. treatment on survival outcome in mice chal a subject so that it infects one or more cells of the subject, lenged withYF virus. FIG.9A shows the results of dose range which then promotes expression of the one or more heterolo prophylyaxis: Animals were treated with Ad5-IFNC. as per gous genes of the viral vector and stimulates an immune the groups outlined in Example 11 below, and challenged response (directly or indirectly) that is protective against with YF virus via IN instillation. Complete protection was infection by a pathogen (e.g., bacteria, virus, fungus, or para observed at the two highest doses, with a dose response curve site) or that treats infection by the pathogen. for the lower doses. FIG. 9B shows the results of treatment: 0055. The term “vaccine,” as used herein, is defined as Animals in each group were treated with 5x107 PFU Ad5 material used to provoke an immune response and confer IFNC, as per the groups outlined in Example 11 below, and immunity after administration of the vaccine to a subject. challenged with SARS virus via IN instillation Complete US 2013/03 15952 A1 Nov. 28, 2013

survival was observed for the -4hr and +1 dpi groups with a platform)) that is capable of delivering a nucleic acid mol drop in survival correlated with delayed treatment in other ecule encoding IFN, which drives the continuous in situ pro groups. duction of IFN (e.g., human IFN-O, such as consensus IFN-C. 0067 FIGS. 10A and 10B are graphs showing the effect of (con IFN-C)) by cells transduced or transfected with the IN Ad5-IFNC. treatment on Survival outcome in mice chal delivery vector. The production of IFN continues in the trans lenged with ZEBOV. FIG. 10A shows the results of mouse duced or transfected cell (e.g., for the life of the cell). treatment: Animals were challenged with 100 LD50 EBOV 0073 For example, a nucleic acid molecule encoding and 30 minutes later treated with Ad5-IFNC by either the 1M IFN-Cl is inserted into the replication defective Ad5 virus, and or 1N route. Complete protection was observed with 107 PFU the Ad5-IFN-O. vector is then delivered to a subject (e.g., a with both routes of administration. FIG. 10B shows the mammal, such as a human). In an embodiment, delivery of the results of guinea pig treatment: Animals were challenged viral vector is intranasal. Intranasal administration of the with 100 LD50 EBOV and 30 minutes later treated with compositions of the invention prevents the host immune sys Ad5-IFNC, IN. Complete protection was observed with 2x10 tem from recognizing the Ad5 vector, thereby bypassing any PFU. pre-existing immunity the Subject might typically present 0068 FIG. 11 is a graph showing the effect of IN Ad5 against the delivery vector itself. In addition, intranasal IFNC. treatment on survival outcome in mice challenged with administration avoids the use of needles, which allows for Pichinde virus. Animals were treated with Ad5-IFNC, as per easier, less invasive administration in the event mass admin the groups outlined in Example 13 below, and challenged istration to the public is needed in response to, e.g., a bioter with PCV via IN instillation. Complete protection was rorist attack, or in the absence of ready access to a medical observed at the highest dose, with a dose response curve at facility. Compositions of the invention can also be delivered lower doses. to the pulmonary system (e.g., the upper and/or lower respi 0069 FIG. 12 is a graph showing the effect of IN Ad5 ratory tract) by delivery to the lungs through the mouth. IFNC. treatment in conjunction with Ad-EBOV vaccine on 0074 The compositions of the invention also provide ben survival outcome in mice challenged with EBOV. Animals efit due to their long-term storage potential and extended shelf were treated with Ad5-IFNC, as per the groups outlined in life. The compositions of the invention can be stored at room Example 14 below, and challenged with PCV via IN instilla temperature for significant periods of time (e.g., for at least 1 tion. Complete protection was observed at the highest dose, week and up to 1 year or more). Alternatively, the composi with a dose response curve at lower doses. tions of the invention can be stored at temperatures in the range of 30°-55°C. (e.g., at 45°C.) for significant periods of DETAILED DESCRIPTION OF THE INVENTION time (e.g., for at least 2-3 days, 1-3 week, 1-6 months, and up 0070 The invention features compositions and methods to 1 year or more). In an embodiment, the compositions of the for the prophylaxis (pre- or post-exposure) and treatment of invention are in powder form when stored attemperatures in diseases or disorders caused by an infectious pathogen (e.g., the range of 30°-55°C. In yet other embodiments, the com infectious agents, such as viruses, bacteria, fungi, and para positions of the invention can be stored frozen (e.g., at tem sites) in a subject (e.g., a mammal. Such as a human). The peratures below at least 4°C. (e.g., in the range of 0° to -20° infectious pathogen may be naturally occurring or it may be C.)), either in a powder or liquid form. For example, the formulated for, or adapted to, use as a biological agent. The compositions can be stored frozen as a non-stabilized, liquid invention also features the use of the compositions of the formulation (e.g., without any or with only one or a few invention to treat or reduce one or more symptoms of autoim stabilizing agents, such as, e.g., trehalose, Sorbitol. Sucrose, mune disease and cancer in a subject (e.g., a mammal, such as mannitol, glycine, CaCl2, hydroxiectoin, ectoin, firoin and a human). gelatin). 0071. The compositions of the invention can be used as, 0075. In an embodiment, the compositions of the inven e.g., a broad-spectrum prophylaxis or treatment to guard tion are stored as a stable lyophilized powder. The powder can against or treat infection by several different infectious patho be used directly (e.g., in powder form without reconstitution gens, in particular, viral agents. Of particular note, the com of any kind) or reconstituted just before use (e.g., using a positions of the invention can be administered for pre-expo hydration medium, Such as Saline or water, preferably steril Sure prophylaxis (e.g., 1-30 minutes (e.g., 15-30 minutes) ized, or any other pharmaceutically acceptable hydration before exposure, preferably 1, 2, 3, 4, 5, 6-12, 24-72 hours medium) and administered as, e.g., an aqueous mist. Recon before exposure, or 1-6 weeks or more (e.g., at least 2 weeks) stitution of powderforms of the compositions of the invention before exposure to an infectious agent), as well as for post is possible where clean water is available. Such as a medical exposure prophylaxis or treatment (e.g., immediately after facility or rear echelons in the military. Alternatively, the exposure, e.g., 1-30 minutes (e.g., 15-30 minutes) after expo powder compositions of the invention can be reconstituted in sure, or within 1, 2, 3, 4, 5, 6-12, 24, 48, or 72 hours or 1-2 a gel form. Nasal gels are high-viscosity thickened solutions weeks after exposure to an infectious agent). Thus, the com or Suspensions. The advantages of a nasal gel includes the positions of the invention provide benefits in the prophylaxis reduction of post-nasal drip due to high viscosity, reduction of or treatment, respectively, of a Subject in anticipation of, or taste impact due to reduced Swallowing, reduction of anterior following, e.g., exposure to an infectious pathogen (e.g., a leakage of the formulation, reduction of irritation by using virus, such as during a bioterrorist attack). The benefits Soothing/emollient excipients, and target to mucosa for better include both long-lasting protection as well as rapid protec absorption. tion, as needed. 0076. The powder form of compositions of the invention 0072. In order to circumvent the fast decay of traditional can be provided in a kit with a vial of sterile hydrating IFN-O. protein-based drugs in vivo, the compositions of the medium (e.g., water or saline) that can be used to reconstitute invention utilize a delivery vector (e.g., a viral vector, such as the powder (e.g., to form a liquid or gel). If water is to be used an adenoviral vector (e.g., an adenovirus 5 (Ad5) delivery as the hydrating medium, the composition of the invention US 2013/03 15952 A1 Nov. 28, 2013

can but need not be formulated to include reagents (e.g., having anamino acid sequence Substantially identical (e.g., at buffers) that adjust the conditions of the composition in its least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, final form (e.g., the pH, osmolarity, or ionic concentration) so 99%, or even 100% identical) to the sequence of a human that it is suitable for, or tolerable to, a subject administered the IFN-O. (e.g., IFN-C-1a, IFN-C-1b, IFN-C-2a, IFN-C-2b, and composition. consensus IFN-C (conIFN-C.); FIG. 1), a human IFN-B (e.g., 0077 Administration of the compositions of the invention IFN-B-1a and IFN-B-1b), a human IFN-Y), or an IFN-T or a in powder form is more likely in, e.g., emerging economies, polypeptide that demonstrates the same or similar biological expeditionary military operations, and in rapid response situ activity to an interferon (e.g., at least 50%, 60%, 70%, 75%, ations. For those compositions of the invention that are not 80%, 85%, 90%. 95%, or 100% of the activity of a human formulated to exhibit an extended shelf life at room tempera IFN-O, a human IFN-B, a human IFN-Y, an IFN-T, or a con ture or at higher temperatures (e.g., those compositions of the IFN-Cl (SEQID NOS: 2, 4, 6, 8, 10, and 11, respectively). The invention that exhibit a shelf life of less than 1 week when nucleic acid molecule may have the sequence set forth in any stored at room temperature), it is preferable that the compo one of SEQID NOs: 1, 3, 5, 7, or 9 corresponding to a human sitions bestored at a temperature in the range of about -20°C. IFN-O, a human IFN-?3, a human IFN-Y, or an IFN-T, respec to about 20°C. to extend shelf life. These compositions may tively, or the nucleic acid molecule may have a sequence be formulated with an excipient that does not stabilize the having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, Ad5-IFN delivery vehicle such that it can only remain at room 98%, 99%, or even 100% identity to one of SEQID NOs: 1, temperature for periods of less than, e.g., 1 week to 1 month, 3, 5, 7, or 9. unless refrigerated. I0081. The biological activity of an interferon of the inven 0078 Compositions of the invention (e.g., an Ad5-IFNC. tion can be confirmed using, e.g., a virus-plaque-reduction construct) have been tested Successfully to date in animal assay, assays that measure the inhibition of cell proliferation, models of human disease, such as mouse, Guinea pig, and the regulation of functional cellular activities, the regulation hamster models, against challenges from representative of cellular differentiation, and immunomodulation mediated viruses from important viral families, e.g., Filoviridae (Ebola by IFN, as well as a reporter gene assay, in which the promoter virus, Zaire strain), Flaviviridae (Yellow Fever), Arenaviridae region of IFN responsive genes is linked with a heterologous (Pichinde), Bunyaviridae (Punta Toro), Coronaviridae reporter gene, for example, firefly luciferase or alkaline phos (SARS), Togaviridae (VEEV and WEEV); see FIG. 5. The phatase, and transfected into an IFN-sensitive cell line such compositions of the invention have an excellent treatment that stably transfected cell lines exposed to IFN increase profile and a good prophylactic window with data indicating expression of the reporter gene product in direct relation to full protection to 21 days with partial protection at further the dose of IFN (see, e.g., Balducci et al., Appl. Microbiol. time points. Compositions of the invention are fast acting, and 11:310-314, 1963; McNeil, J. Immunol. Methods 46:121 impart both therapeutic and prophylactic benefits to the 127, 1981; and Meager et al., J. Immunol. Methods 261:21 recipient within minutes to hours; the benefits of the compo 36, 2002). Other assays for measuring the activity of IFN sitions of the invention remain effective for days and even include measuring the upregulation or activity of the double months after administration. stranded RNA (dsRNA)-dependent protein kinase R (PKR), the 2'-5'-oligoadenylate synthetase (2'-5'-OAS), IFN-induc Compositions of the Invention ible MX proteins, a tryptophan-degrading enzyme (see, e.g., Pfefferkorn, Proc. Natl. Acad. Sci. USA 81:908-912, 1984), 007.9 The compositions of the invention include a deliv adenosine deaminase (ADAR1), IFN-stimulated gene 20 ery vector containing a nucleic acid molecule encoding a (ISG20), p 56, ISG15, mGBP2, GBP-1, the APOBEC pro cytokine (e.g., an IFN. Such as conIFN-C). The compositions teins, viperin, or other factors (see, e.g., Zhang et al., J. Virol. of the invention may be formulated for any route of adminis 81:11246-11255, 2007, and U.S. Pat. No. 7,442,527, which is tration (e.g., the administration routes described herein, Such incorporated by reference herein in its entirety). as by nasal inhalation and/or inhalation through the mouth for I0082 Interferon alpha (IFN-C), as used herein, refers to a delivery to the upper and/or lower respiratory tract). The cytokine with multiple biological activities that include anti compositions may be administered in a single dose or in viral activity, regulation of cell proliferation and differentia multiple doses to a subject in need thereof, either pre- or tion and immunomodulation, as exemplified in, e.g., Pfeffer post-exposure to an infectious pathogen or prior to the diag et al. (Cancer Res. 58:2489-2499, 1998). In an embodiment nosis of, or after development of symptoms of autoimmune of the invention, the IFN-C. may be selected from, e.g., IFN disease or cancer. The compositions of the invention may also C2a, IFN-C2b. IFN-O.2c, and consensus IFN-C (conIFN-O.) further include secondary agents (either as a nucleic acid (see FIG. 4 and, e.g., U.S. Pat. No. 4,695,623, incorporated molecule to be expressed by a cell of the subject or as a herein by reference). In an embodiment, the IFN-C. is con polypeptide or drug) or they may be administered in combi IFN-O. nation with one or more additional therapeutic regimens (e.g., I0083. Unlike the compositions of the invention, recombi vaccines), as is discussed below. nant human IFN, in particular rhconIFN-O, which is fully approved and marketed as InfergenR) for the treatment of chronic Hepatitis C, is made via prokaryotic fermentation, 0080. The compositions of the invention for use in the pre and thus lacks glycosylation. Moreover, Infergen R is formu or post-exposure prophylaxis or treatment, respectively, of a lated for administration via injection into patients. pathogenic infection (e.g., a viral, bacterial, fungal, or para Viral Vectors sitic infection) or for use in the treatment of autoimmune disease or cancer (or one or more symptoms thereof) include 0084. In the invention described herein, the interferon a delivery vector containing a nucleic acid molecule encoding (e.g., IFN-O, such as conIFN-O.) can be formulated for deliv an IFN. The nucleic acid molecule encodes an interferon ery using a viral vector that includes a nucleic acid molecule US 2013/03 15952 A1 Nov. 28, 2013 encoding the interferon. Any suitable viral vector system can delivery of the heterologous gene can be readily determined be used including, e.g., adenoviruses (e.g., Ad2, Ad5, Ad9. by one of skill in the art based on the information provided Ad15, Ad17, Ad 19, Ad20, Ad22, Ad26, Ad27, Ad28, Ad30, or herein. Ad39; see, e.g., FIG. 2), rhabdoviruses (e.g., vesicular stoma I0088. The delivery of IFN-O. using an adenoviral vector is titis virus), retroviruses (see, e.g., Miller, Curr. Top. Micro described in, e.g., Ahmed et al. (J. Interferon Cytokine Res. biol. Immunol. 158:1-24, 1992; Salmons and Gunzburg, 21: 399408, 2001), Zhang et al. (Proc. Natl. Acad. Sci. USA Human Gene Therapy 4: 129-141, 1993; and Miller et al., 93:4513-4518, 1996), Ahmed (Hum. Gene Ther. 10:77-84, Methods in Enzymology 217:581-599, 1994), adeno-associ 1999), and Santodonato et al. (Cancer Gene Ther. 8:63-72, ated vectors (reviewed in Carter, Curr. Opinion Biotech. 2001). The delivery of IFN-O. using a retroviral vector is 3:533-539, 1992; and Muzcyzka, Curr. Top. Microbiol. described in, e.g., Tuting et al. (Gene Ther. 4:1053-1060, Immunol. 158:97-129, 1992), poxviruses, herpes viral vec 1997) and Mecchia et al. (Gene Ther. 7:167-179, 2000). tors, and Sindbis viral vectors (see viral vectors discussed 0089. In an embodiment, the Ad5 vector contains a nucleic generally in, e.g., Jolly, Cancer Gene Therapy 1:51-64, 1994: acid molecule encoding human interferon alpha consensus Latchman, Molec. Biotechnol. 2: 179-195, 1994; Johanning sequence under the transcriptional regulation of the interme et al., Nucl. Acids Res. 23:1495-1501, 1995; Berencsi et al., J. diate-early promoter of CMV and Simian virus 40 (SV40) Infect. Dis. 183:1171-1179, 2001; Rosenwirth et al., Vaccine polyadenylation sequence. In another embodiment, the 19:1661-1670, 2001; Kittlesen et al., J. Immunol. 164:4204 human Ad5 vector includes E1 and E3 deletions to render it 4211, 2000; Brown et al., Gene Ther. 7:1680-1689, 2000; replication deficient. The Ad5-IFN-O. vector can be further Kanesa-thasan et al., Vaccine 19:483-491, 2000; and Sten stabilized with an excipient of polysaccharides and electro Drug 60:249-271, 2000. Compositions comprising such vec lytes during lyophilization and storage, as is described herein. tors and an acceptable excipient are also a feature of the As adenoviruses are fragile to thermal stress and maintenance invention. of the cold chain in the field is onerous, the temperature 0085 Ad5 is a virus of the family Adenoviridae, species C, stability of the compositions of the invention impart a signifi Subtype 5. This virus is naturally occurring and causes mild cant advantage. We have developed a systematic process for upper respiratory infections, usually in children. Ad5 can be the stabilization of viral-based vaccines, including adenovi used as a delivery platform to deliver the genetic information ruses, based on a novel eigenvector approach (see, e.g., to make human interferon in situ. Typically, the Ad5 is ren Kueltzo et al., J. Pharm. Sci. 92: 1805-1820, 2003; Fan et al., dered replication defective (by specific gene deletion; e.g., all J. Pharm. Sci.94:1893-1911, 2005; Ausaret al., Mol. Pharm. or a portion of the E1 or E3 genes). Ad5 vectored vaccines 2:491–499, 2005; and Rexroad et al., J. Pharm. Sci. 95:237 have been approved for clinical studies widely in the past. 247, 2005). Multiple assays are then used to identify a number Ad5 is widely used in clinical trials as a vector delivery of potential excipients that are tested for their ability to sta system. As of June 2010, there are currently 29 clinical trials bilize the virus against physical and chemical degradation that are currently active using Ad5 vectored delivery of bio pathways that result in loss of activity (e.g. physicochemical logics/drugs. Adenovirus 5 based vectors exhibit an excellent integrity, biological activity, etc.). safety profile. The Ad5 vector has additional benefits over 0090. An increase in the expression level of a transfected conventional vaccines Such as live-attenuated vaccines, a type nucleic acid molecule (e.g., the con IFN-C sequence) in a host of vaccine where pathogenic viruses are partially crippled via cell (e.g., an epithelial cell. Such as a nasal or pulmonary chemical or heat treatment prior to injection, in that there is no epithelial cell) can be promoted by operably linking the risk the Ad5 system could revert and cause illness. Further, nucleic acid molecule to an open frame expression control Ad5 is a live vaccine which has been shown to provide prompt sequence, which can work in the selected expression host. immunologic protection. Ad5-based vectors for delivery of Expression control sequences useful for eukaryotic host cells cytokine genes for providing protection against biological can be a native or foreign to the nucleic acid molecule to be weapons is described in, e.g., U.S. Pat. Nos. 6,565,853 and expressed, as well as to the delivery vector. Examples of 6,936,257, both of which are incorporated herein by refer expression control sequences include, but are not limited to, CCC. leader sequences, polyadenylation sequences, propeptide 0.086 Intravenous or intramuscular administration of sequences, promoters, enhancers, upstream activation agents for biodefense medical counter measure indications sequences, signal peptide sequences, and transcription termi using the Ad5 system have previously failed because the nation factors. Expression control sequences include those body's immune system recognizes this viral vector and derived from, e.g., SV40 (e.g., early and late promoters of destroys the vector before the gene has been delivered to a SV40), bovine papilloma virus, adenovirus (e.g., early and host cell. This occurred most recently with Merck’s HIV-1 late promoters of adenovirus), cytomegalovirus (CMV; e.g., vaccine clinical trial, which resulted in the study being halted the human cytomegalovirus early gene promoter), MT-1 early on the grounds of futility (see Robb, Lancet 372, 2008). (metallothioneine gene) promoter, Rous sarcoma virus Intranasal administration of compositions of the invention (RSV) promoter, and human Ubiquitine C (UbC) promoter. (e.g., an Ad5-vector encoding IFN) circumvents this problem In order to further improve expression in mammalian cells, by avoiding the body's immune targeting of the Ad5 vector, as synthetic intron sequences can be inserted into a non-tran is discussed herein. Scription region of a nucleotide sequence encoding the IFN-O. 0087. The viral vector may be constructed using conven polypeptide. tional techniques knownto one of skill in the art. For example, 0091. Other vector components that can be used in prac the viral vector may contain at least one sequence encoding a ticing the present invention include a signal peptide. This heterologous gene (e.g., consensus IFN-C), which is under sequence is typically located at the 5' of a gene encoding a the control of regulatory sequences that direct its expression protein and is thus added to the amino terminus of the protein in a cell (e.g., an epithelial cells. Such as a nasal or pulmonary during expression. The presence or absence of a signal pep epithelial cell). Appropriate amounts for vector-mediated tide varies depending on the expression host cell to be used in US 2013/03 15952 A1 Nov. 28, 2013 production of the IFN-Cl polypeptide and the preference of genera), which includes the hepatitis C virus, Yellow fever producing a secreted product (i.e., according to whether the virus; Tick-borne viruses, such as the Gadgets Gully virus, IFN-O. polypeptide is to be expressed intra-cellularly or extra Kadam virus, Kyasanur Forest disease virus, Langat Virus, cellularly). In an embodiment, the IFN-C. (e.g., the conIFN-O.) Omsk hemorrhagic fever virus, Powassan virus, Royal Farm is secreted from the host cell during expression. The signal virus, Karshi virus, tick-borne encephalitis virus, Neudoerfl peptide can be homologous or heterologous to either the virus, Sofin virus, Louping ill virus and the Negishi virus; IFN-O. polypeptide or the host cell. seabird tick-borne viruses, such as the Meaban virus, Sau 0092. A nucleic acid molecule is “operably linked to marez, Reef virus, and the Tyuleniy virus; mosquito-borne another nucleic acid molecule when they are arranged in a viruses, such as the Aroa virus, dengue virus, Kedougou functional relationship. This means that an appropriate mol virus, Cacipacore virus, Koutango virus, Japanese encepha ecule (for example, a transcription activator) binds to a regu litis virus, Murray Valley encephalitis virus, St. Louis latory sequence(s), a gene, or a regulatory sequence(s) linked encephalitis virus. Usutu virus, West Nile virus, Yaounde in Such away that the expression of the nucleic acid molecule virus, Kokobera virus, BagaZa virus, Ilheus virus, Israel tur is modulated. For example, when a pre-sequence or secretory key meningoencephalo-myelitis virus, Ntaya virus, TembuSu leader participates in secretion of a mature protein, they are virus, Zika virus, Banzi virus, Boubouivirus, Edge Hill virus, operably linked to the promoter. When a promoter affects Jugra virus, Saboya virus, Sepik virus, Uganda S virus, Wes transcription of a coding sequence, the promoter is operably selsbron virus, yellow fever virus; and viruses with no known linked to the coding sequence. When a ribosomal binding site arthropod vector, such as the Entebbe bat virus, Yokose virus, is located at a place capable of being read as a coding Apoi virus, Cowbone Ridge virus, Jutiapa virus, Modoc sequence, the ribosomal binding site is operably linked to the virus, Sal Vieja virus, San Perlita virus, Bukalasa bat virus, coding sequence. Generally "operably linked' means in con Carey Island virus, Dakarbat virus, Montanamyotis leukoen tact with a linked nucleic acid molecule and a secretory leader cephalitis virus, Phnom Penh bat virus, Rio Bravo virus, and to be in a reading frame. Tamanabat virus, and the Cell fusing agent virus; a member of the Arenaviridae family, which includes the Ippy virus, Non-Viral Vectors Lassa virus (e.g., the Josiah, LP, or GA391 strain), lympho 0093. Non-viral approaches can also be employed to intro cytic choriomeningitis virus (LCMV), Mobala virus, Mopeia duce a therapeutic nucleic acid molecule (e.g., an IFN-C- virus, Amapari virus, Flexal virus, Guanarito virus, Junin encoding nucleic acid molecule) into cells to treat or prevent virus, Latino virus, Machupo virus, Oliveros virus, Paraná pathogenic infection (e.g., viral infection) or to treat or reduce virus, Pichinde virus, Pirital virus, Sabia virus, Tacaribe the symptoms of autoimmune disease or cancer. For example, virus, Tamiami virus, Whitewater Arroyo virus, Chapare a heterologous gene (e.g., an interferon, such as IFN-C. (e.g., virus, and Lujo virus; a member of the Bunyaviridae family consensus IFN-C) can be introduced into a cell (e.g., an (e.g., a member of the Hantavirus, Nairovirus, Orthobunyavi epithelial cell. Such as a nasal or pulmonary epithelial cell) by rus, and Phlebovirus genera), which includes the Hantaan lipofection (see, e.g., Felgner et al., Proc. Natl. Acad. Sci. virus, Sin Nombre virus, Dugbe virus, Bunyamwera virus, USA 84:7413, 1987: Ono et al., Neuroscience Letters 17:259, Rift Valley fever virus, La Crosse virus, Punta Toro virus 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989: Staub (PTV), California encephalitis virus, and Crimean-Congo inger et al., Methods in Enzymology 101:512, 1983), asia hemorrhagic fever (CCHF) virus; a member of the Filoviridae loorosomucoid-polylysine conjugation (see, e.g., Wu et al., family, which includes the Ebola virus (e.g., the Zaire, Sudan, Journal of Biological Chemistry 263:14621, 1988; Wu et al., Ivory Coast, Reston, and Uganda Strains) and the Marburg Journal of Biological Chemistry 264:16985, 1989), or, less virus (e.g., the Angola, Ci67, Musoke, Popp, Ravn and Lake preferably, micro-injection under Surgical conditions (see, Victoria Strains); a member of the Togaviridae family (e.g., a e.g., Wolff et al., Science 247: 1465, 1990). Gene transfer can member of the Alphavirus genus), which includes the Ven also be achieved by the use of calcium phosphate, DEAE eZuelan equine encephalitis virus (VEE), Eastern equine dextran, electroporation, and protoplast fusion. Liposomes, encephalitis virus (EEE), Western equine encephalitis virus microparticles, or nanoparticles can also be potentially ben (WEE), Sindbis virus, rubella virus, Semliki Forest virus, eficial for delivery of a nucleic acid molecule (e.g., an IFN Ross River virus, Barmah Forest virus, Onyongnyong virus, C-encoding nucleic acid molecule) or a protein into a cell or and the chikungunya virus; a member of the Poxyiridae fam into a patient in order to stimulate an immune response ily (e.g., a member of the Orthopoxvirus genus), which against a pathogen (e.g., a virus). Other non-viral methods of includes the Smallpox virus, monkeypox virus, and vaccinia delivering IFN-O. are described in, e.g., Coleman et al., Hum. virus; a member of the Herpesviridae family, which includes Gene Ther. 9:2223-2230, 1998, and Horton et al., Proc. Natl. the herpes simplex virus (HSV; types 1, 2, and 6), human Acad. Sci. USA 96:1553-1558, 1999). herpes virus (e.g., types 7 and 8), cytomegalovirus (CMV), Epstein-Ban virus (EBV), Varicella-Zoster virus, and Kapo Methods of Prophylaxis or Treatment of Pathogenic si's sarcoma associated-herpesvirus (KSHV); a member of the Orthomyxoviridae family, which includes the influenza Infection Using Compositions of the Invention virus (A, B, and C), such as the H5N1 avian influenza virus or H1N1 Swine flu; a member of the Coronaviridae family, 0094. The pharmaceutical compositions of the invention which includes the severe acute respiratory syndrome can be used as gene therapy and/or genetic vaccines for treat (SARS) virus; a member of the Rhabdoviridae family, which ing or inhibiting infection by pathogens, such as bacteria, includes the rabies virus and vesicular stomatitis virus viruses, fungus, and parasites. In particular, the compositions (VSV): a member of the Paramyxoviridae family, which of the invention can be used to treat (pre- or post-exposure) includes the human respiratory syncytial virus (RSV), New infection by viruses (e.g., a member of the Flaviviridae family castle disease virus, hendravirus, nipahvirus, measles virus, (e.g., a member of the Flavivirus, Pestivirus, and Hepacivirus rinderpest virus, canine distemper virus, Sendai virus, human US 2013/03 15952 A1 Nov. 28, 2013 parainfluenza virus (e.g., 1, 2, 3, and 4), rhinovirus, and nasal or pulmonary epithelial cells) by administering the vec mumps virus; a member of the Picornaviridae family, which tor in a dosage and form discussed herein (e.g., as an aero includes the poliovirus, human enterovirus (A, B, C, and D). Solized powder, liquid mist, or gel) to the Subject (e.g., via hepatitis A virus, and the coxsackievirus; a member of the intranasal or pulmonary administration) to provide prophy Hepadnaviridae family, which includes the hepatitis B virus: laxis and/or treatment of pathogenic infection. Alternatively, a member of the Papillamoviridae family, which includes the cells can be removed from the subject and transduced or human papilloma virus; a member of the Parvoviridae family, transfected ex vivo with the vector encoding IFN and those which includes the adeno-associated virus; a member of the cells can be returned to the subject to provide prophylaxis Astroviridae family, which includes the astrovirus; a member of the Polyomaviridae family, which includes the JC virus, and/or treatment of pathogenic infection. In an embodiment, BK virus, and SV40 virus; a member of the Calciviridae cells of the subject are removed and treated ex vivo with the family, which includes the Norwalk virus; a member of the Ad5-IFN-O. vector of the invention. The cells are then admin Reoviridae family, which includes the rotavirus; and a mem istered to the patient, pre- or post-exposure, to treat or inhibit ber of the Retroviridae family, which includes the human pathogenic infection. Preferably at least about 1x10" to about immunodeficiency virus (HIV: e.g., types 1 and 2), and 10x10 cells are treated and reintroduced to the subject. human T-lymphotropic virus Types I and II (HTLV-1 and 0101. In an embodiment, a sufficient amount of the phar HTLV-2, respectively)). maceutical composition is administered to a subject to 0095. The pharmaceutical compositions include vectors achieve a peak blood level of IFN-Cl due to expression from encoding IFN (e.g., IFN-O, such as conIFN-O.) that can be the transfected/transduced cells of at least between about administered in vivo or ex vivo. 0.0001 to 5.0x10 IU/ml, preferably between about 0.0002 to 0096. IFN-C. is one of the earliest cytokines released by the 2.0x10 IU/mL, and most preferably between about 0.0005 to antigen-presenting cell as part of the innate immune response and is directly responsible for NK and T cell responsiveness, 10x10 IU/mL (see, e.g., NIBSC code: 94/784 and 94/786; which drives the subsequent immune response. NK cells are WHO International Standard for INTERFERON ALPHA, one of the first professional killing cells to arrive in the early (Human leukocyte-derived); dated 14 Feb. 2008; Meager et antiviral immune response. In addition, IFN-Cl appears to be al., J. Immunol. Methods 257:17-33, 2001; and Mire-Sluis et the principle cytokine mediating expansion of CD8+ T cells. al., J. Interferon Cytokine Res. 16:637-643, 1996). In another Because of the early response of IFN-C. in the immune cas embodiment, the amount of circulating IFN-C. is between cade, its primary role is suggested to be to induce a priming about 100 IU/ml and 1,000 IU/ml (e.g., about 250 IU/ml). state during the initial response to infection, and it has been Preferably, the circulating levels of IFN-O. remain within this shown that low dose IFN-O. results in increased protection range for at least 1 to 15 days, or at least 1, 2, 3, or 4 weeks, from a viral challenge (see, e.g., Brassard et al., J. Leuk. Biol. or at least 2-6 months. The expression levels of IFN-C can be 71:565-581, 2002). determined by measuring the amount of IFN-C. in, e.g., the 0097. In addition, interferon induces the expression of MX subject’s serum (see, e.g., Forti et al., J. Clin. Microbiol. proteins, which are 7-80 kDa proteins with GTPase activity 21:689-693, 1985). In other embodiments, the anti-viral that affect viral replication by interfering with transcription effects of IFN-C. remain evident in the subject for at least 1, 2, (i.e., they inhibit viral RNA polymerases) of influenza and 3, or 4 weeks, more preferably for at least 2, 4, or 6 months, other negative strand RNA viruses (Acheson, In “Fundamen and most preferably for 1 year or more. The anti-viral effects tals of Molecular Virology.” J. Wiley and Sons, Hoboken N.J., of IFN-C. can be determined by measuring the upregulation or 2007). activity of the double-stranded RNA (dsRNA)-dependent 0098 Interferon also induces the expression of ribonu protein kinase R (PKR), the 2'-5'-oligoadenylate synthetase clease L, which degrades viral (and host) mRNA, and thus (2'-5'-OAS), IFN-inducible MX proteins, a tryptophan-de leads to an inhibition of viral replication by suppression of grading enzyme (see, e.g., Pfefferkorn, Proc. Natl. Acad. Sci. viral protein synthesis. (Acheson, 2007). Thus, the expres USA 81:908-912, 1984), adenosine deaminase (ADAR1), sion of IFN-C. in the transduced/transfected cells (e.g., epi IFN-stimulated gene 20 (ISG20), p 56, ISG15, mGBP2, thelial cells) of a subject provides prophylaxis and/or treat GBP-1, the APOBEC proteins, viperin, or other factors (see, ment of pathogenic infection by, in part, activating these and e.g., Zhang et al., J. Virol. 81:11246-11255, 2007). Assays other pathways that stimulate the Subjects immune response for measuring the anti-viral effects of IFN-C. can be found in, and protect the Subject, pre- and post-exposure, against e.g., U.S. Pat. No. 7,442,527, which is incorporated by refer pathogenic (e.g., viral) infection. ence herein in its entirety. 0099. The pharmaceutical compositions of the invention 0102. Upon administration of the pharmaceutical compo act via a two-step process: administration and expression. For sition including the IFN-O. delivery vector (e.g., an Ad5 deliv example, after intranasal administration, the Ad5 virus enters ery vector), e.g., to nasal or pulmonary epithelial cells, the the epithelial cells of the upper and/or lower respiratory tract nucleic acid molecule encoding IFN-C. incorporates into the and transports the IFN-O. nucleic acid molecule to the cells. These cells then produce IFN-C. during the course of nucleus. Next, the IFN-O. nucleic acid molecule is transcribed their lifespan until death or apoptosis, thereby allowing for and the resulting mRNA is translated, post-translationally expression of human IFN-C. lasting for several hours, days, or modified with glycosylation, expressed as a mature IFN-C. weeks or more (e.g., about 1-15 days, 1-4 weeks, or 2-6 cytokine on the cell surface. The adenovirus itself does not months) compared to hours for exogenously administered replicate as it has been rendered replication deficient. Once rhIFN-C. Furthermore, the IFN produced from, e.g., an Ad5 the IFN-C. is expressed on the cell surface, it functions in the hIFN vector will be fully glycosylated unlike the rhIFN-O. same manner as naturally in situ-produced IFN-C. currently being commercially prepared by eukaryotic fer 0100. Accordingly, the vectors can be used to transduce or mentation (i.e., InfergenR (Alfacon; DIN 2239832)). In addi transfect a subject’s cells in Vivo (e.g., epithelial cells, such as tion, the therapeutic effects (e.g., anti-viral effects) of IFN-C. US 2013/03 15952 A1 Nov. 28, 2013

can extend for at least 1, 2, 3, or 4 weeks, more preferably for gen has been intentionally released (e.g., against military at least 2, 4, or 6 months, and most preferably for 1 year or personnel deployed on the frontline)). The IFN-Cl delivery O. vector of the invention provides medical personnel in the 0103 Naturally occurring IFN-C. is glycosylated. Most public sector, as well as military planners and others with the rhIFN products are not glycosylated as they are made via ability to act quickly when responding to various operational prokaryotic fermentation. Due to the location of the glycosy threat situations where there may be uncertainty as to the lation sites, there is no risk of impeding receptor binding with presence of an infectious pathogen. For example, today, mili the addition of glycosylation. However, the pharmacokinetics tary planners will not deploy into areas with endemic patho of glycosylated and unglycosylated IFN-C. may well be dif genic risks without the proper vaccinations. This delays ferent, and the stability of the protein may be influenced by greatly the ability of the military, law enforcement agents, or glycosylation, as is the case for human granulocyte-macroph local emergency coordinator (LEC) to respond promptly to age colony-stimulating factor (GM-CSF; see Adolf et al. global threats. The pharmaceutical compositions of the inven (Biochem. J. 276:51 1-518, 1991). Further, the immunogenic tion can be used to mitigate those risks and speed the response ity of rhIFN-O. might be affected by the lack of glycosylation. time against pathogenic exposure or outbreaks. Gribben et al. have reported that four out of 16 patients 0107 The compositions of the invention may be adminis receiving rhGM-CSF produced in yeast developed antibodies tered in a single dose or in multiple doses separately from or to this protein; these antibodies reacted with epitopes that coextensively with other therapies for pathogenic infection were exposed in the recombinant factor, but would have been (e.g., vaccines), or as a stand-alonetherapy. The compositions protected by glycosylation (see Gribben et al., Lancet 335: of the invention may, but need not, also include additional 434–437, 1990). Induction of antibodies to non-glycosylated therapeutic agents. These additional therapeutic agents can rhIFN-C. after prolonged treatment of patients has been also be encoded as nucleic acid molecules in the same or a described, and it has been speculated that natural IFN-C. may different delivery vector (e.g., a viral vector) and expressed as be less immunogenic than the recombinant proteins (see Fig a polypeptide with the IFN or they can be administered as lin and Itri, Semin. Hematol. 25:9-15, 1988, and Galton et al., polypeptides or drugs with the compositions of the invention, Lancet 2:572-573, 1989). e.g., as a single pharmaceutical composition or in separate 0104. Although there is evidence using all forms of IFN pharmaceutical compositions. (e.g., C, B, (), Y) that glycosylation does not appear to affect 0108. The compositions of the invention can be adminis the specific antiviral/biological activity of the protein (see tered to a subject (e.g., a human), pre- or post-exposure to a Bocci, Trends Biochem Sci 8:432-434, 1983, and Adolfetal., pathogenic infection (e.g., a viral infection), to treat, prevent, Biochem J. 276:51 1-518, 1991), it is believed that glycosy ameliorate, inhibit the progression of, or reduce the severity lation of IFN may be important for other reasons. There are of one or more symptoms of the pathogenic infection in the studies specifically working on different translational meth Subject. Examples of the symptoms of pathogenic infection, ods to manufacture fully glycosylated hIFNC. ex vivo (see, in particular, viral infection, that can be treated using the e.g., Rossmann et al., Prot. Exp. Purif. 7:335-342, 1996), and compositions of the invention include, e.g., fever, muscle patents filed protecting these methods (see, e.g., U.S. Pat. aches, coughing, Sneezing, runny nose, Sore throat, headache, Nos. 7,445,774; 7.338,654; 7,311.903; and 7,129,390). Thus, chills, diarrhea, vomiting, rash, weakness, dizziness, bleed glycosylation is clearly a desirable factor in IFN. The phar ing under the skin, in internal organs, or from body orifices maceutical compositions of the invention, which deliver a like the mouth, eyes, or ears, shock, nervous system malfunc vector that promotes expression of a fully glycosylated hiFN tion, delirium, seizures, renal (kidney) failure, personality in situ, will likely result in a protein with more stability and changes, neck stiffness, dehydration, seizures, lethargy, less immunogenic effects than currently administered rhIFN paralysis of the limbs, confusion, back pain, loss of sensation, polypeptides lacking glycosylation, while maintaining the impaired bladder and bowel function, and sleepiness that can same level of therapeutic (e.g., antiviral) activity. progress into coma or death. These symptoms, and their reso 0105 Expression of IFN-C. (e.g., conIFN-O.) in the cells of lution during treatment, may be measured by, e.g., a physician a subject transfected/transduced with the delivery vector of during a physical examination or by other tests and methods the invention provides fast acting protection to the Subject known in the art. against pathogenic infection (e.g., viral infection). The IFN-C. 0109 The dose of the compositions of the invention (e.g., delivery vector of the invention is fast acting because the Ad5 the number of IFN-encoding delivery vectors, viral or other vector incorporates into epithelial cells (e.g., nasal or pulmo wise) or the number of treatments using the compositions of nary epithelial cells), journeying from the cell Surface to the the invention may be increased or decreased based on the nucleus within 30 minutes. The IFN-C. delivery vector of the severity of occurrence of, or progression of the pathogenic invention is particularly effective when administered, e.g., infection in the patient (e.g., based on the severity of one or intranasally, because the nasal cavity has a large Surface area more symptoms of, e.g., viral infection). (100-200 cm square), which allows the Ad5 delivery vector to penetrate into millions of upper and/or lower respiratory epi Uses thelial cells. Once incorporated, the epithelial cells begin to 0110 IFN is known to be effective againstabroad range of generate the IFN-O. (e.g., conIFN-O.) as if it was endogenous pathogens, in particular, viruses. Hence the pharmaceutical to the cell; the IFN-C. is expressed on the cell surface and it is compositions of this invention are referred to as a “Broad secreted into the host circulation. Spectrum Antiviral. Viruses against which the compositions 0106 Expression of IFN-C typically occurs within 24 of the invention can be used include the following: a member hours or less (e.g., as early as 3 hours) after administration of of the Flaviviridae family (e.g., a member of the Flavivirus, the delivery vector. This result is beneficial, especially in Pestivirus, and Hepacivirus genera), which includes the hepa cases where rapid treatment response is preferable (e.g., viral titis C virus, Yellow fever virus; Tick-borne viruses, such as outbreaks in the public arena or in situations where a patho the Gadgets Gully virus, Kadam virus, Kyasanur Forest dis US 2013/03 15952 A1 Nov. 28, 2013

ease virus, Langat virus, Omsk hemorrhagic fever virus, B, C, and D), hepatitis. A virus, and the coxsackievirus; a Powassan virus, Royal Farm virus, Karshi virus, tick-borne member of the Hepadnaviridae family, which includes the encephalitis virus, Neudoerfl virus, Sofin virus, Louping ill hepatitis B virus; a member of the Papillamoviridae family, virus and the Negishi virus; seabird tick-borne viruses, such which includes the human papilloma virus; a member of the as the Meaban virus, Saumarez Reef virus, and the Tyuleniy Parvoviridae family, which includes the adeno-associated virus; mosquito-borne viruses, such as the Aroa virus, dengue virus; a member of the Astroviridae family, which includes virus, Kedougou virus, Cacipacore virus, Koutango virus, the astrovirus; a member of the Polyomaviridae family, which Japanese encephalitis virus, Murray Valley encephalitis virus, includes the JC virus, BK virus, and SV40 virus; a member of St. Louis encephalitis virus. Usutu virus, West Nile virus, the Calciviridae family, which includes the Norwalk virus; a member of the Reoviridae family, which includes the rotavi Yaounde virus, Kokobera virus, BagaZa virus, Ilheus virus, rus; and a member of the Retroviridae family, which includes Israel turkey meningoencephalo-myelitis virus, Ntaya virus, the human immunodeficiency virus (HIV: e.g., types 1 and 2), Tembusu virus, Zika virus, Banzi virus, Bouboui virus, Edge and human T-lymphotropic virus Types I and II (HTLV-1 and Hill virus, Jugra virus, Saboya virus, Sepik virus, Uganda S HTLV-2, respectively). virus, Wesselsbron virus, yellow fever virus; and viruses with no known arthropod vector, such as the Entebbe bat virus, 0111 Particular indications that are contemplated for the Yokose virus, Apoi virus, Cowbone Ridge virus, Jutiapa pharmaceutical compositions of the invention, and which are virus, Modoc virus, Sal Vieja virus, San Perlita virus, currently being or have been evaluated in conjunction with Bukalasabat virus, Carey Island virus, Dakarbat virus, Mon the Division of Microbiology and Infectious Disease tana myotis leukoencephalitis virus, Phnom Penh bat virus, (DMID), part of the National Institute of Allergy and Infec Rio Bravo virus, Tamanabat virus, and the Cell fusing agent tious Disease (NIAID), include: Dengue, Punta Toro (a virus; a member of the Arenaviridae family, which includes BSL-2 surrogate for Rift Valley Fever), monkeypox, Flu A the Ippy virus, Lassa virus (e.g., the Josiah, LP, or GA391 (H5N1 and H1N1), SARS, Yellow Fever, Pichinde (a BSL-2 strain), lymphocytic choriomeningitis virus (LCMV), surrogate for Lassa Fever), Western Equine Encephalitis, Mobala virus, Mopeia virus, Amapari virus, Flexal virus, Venezuelan Equine Encephalitis, and West Nile Virus. In Guanarito virus, Junin virus, Latino virus, Machupo virus, broader terms, the IFN-Cl delivery vector and pharmaceutical Oliveros virus, Paraná virus, Pichinde virus, Pirital virus, compositions containing it will be effective against, at least, Sabia virus, Tacaribe virus, Tamiami virus. Whitewater the following viral families: Alphaviridae, Filoviridae, Fla Arroyo virus, Chapare virus, and Lujo Virus; a member of the viviridae, Orthomyxoviridae, Bunyaviridae, Arenaviridae, Bunyaviridae family (e.g., a member of the Hantavirus, Herpesviridae, Hepadnaviridae, Coronaviridae, and Poxyiri Nairovirus, Orthobunyavirus, and Phlebovirus genera), dae (see Examples). which includes the Hantaan virus, Sin Nombre virus, Dugbe 0112 A significant proportion of the human population virus, Bunyamwera virus, Rift Valley fever virus, La Crosse has been exposed to many adenoviral Strains, including Ad5. virus, Punta Toro virus (PTV), California encephalitis virus, Thus, there is a good probability the immune system of any and Crimean-Congo hemorrhagic fever (CCHF) virus; a potential recipient of the pharmaceutical compositions of the member of the Filoviridae family, which includes the Ebola invention has “seen Ad5 before and would be able to quickly virus (e.g., the Zaire, Sudan, Ivory Coast, Reston, and Uganda mount an immune response to it. This was the case with the strains) and the Marburg virus (e.g., the Angola, Ci67, MRKAd5 HIV-1 gag/pol/nef HIV vaccine, which was tested Musoke, Popp, Ravn and Lake Victoria strains); a member of on HIV negative patients in a phase II clinical trial in 2008. the Togaviridae family (e.g., a member of the Alphavirus This trial, which utilized injections, resulted in “futility.” genus), which includes the Venezuelan equine encephalitis meaning there was no protection seen: the levels of infection virus (VEE), Eastern equine encephalitis virus (EEE), West in inoculated Subjects was the same as non-inoculated ones ern equine encephalitis virus (WEE), Sindbis virus, rubella (Buchbinder et al., Lancet 372:1881-1893, 2008). Positive virus, Semliki Forest virus, Ross River virus, Barmah Forest serostatus for Ad5 was significantly associated with acquisi virus, Onyongnyong virus, and the chikungunya virus; a tion (Robb, Lancet 372:1857-1858, 2008), and the design of member of the Poxyiridae family (e.g., a member of the the vaccine is “at the centre of the study's failure' (White, Orthopoxvirus genus), which includes the Smallpox virus, Lancet 373:805, 2009). Thus, Ad5 vectored vaccines were monkeypox virus, and vaccinia virus; a member of the Her thought to be useless due to the high probability of pre pesviridae family, which includes the herpes simplex virus existing immunity. Indeed, all military personnel are actively (HSV; types 1, 2, and 6), human herpesvirus (e.g., types 7 and vaccinated with Ad4 and Ad7 vaccines during basic training 8), cytomegalovirus (CMV), Epstein-Barr virus (EBV), Vari medical preparation following enlistment. cella-Zoster virus, and Kaposi's sarcoma associated-herpes 0113 To circumvent pre-existing immunity to the delivery virus (KSHV): a member of the Orthomyxoviridae family, vector, the IFN-O. delivery vector of the invention, and phar which includes the influenza virus (A, B, and C), such as the maceutical compositions containing it, can be administered H5N1 avian influenza virus or H1N1 Swine flu; a member of via, e.g., a pulmonary or intranasal route, which avoids prob the Coronaviridae family, which includes the severe acute lems with pre-existing immunity to the delivery vector. This respiratory syndrome (SARS) virus; a member of the Rhab is believed to be due to the lack of contact between the vector doviridae family, which includes the rabies virus and vesicu (e.g., the adenoviral vector (e.g., Ad5)) and the immune sys lar stomatitis virus (VSV): a member of the Paramyxoviridae tem (e.g., the immune components in blood), as the vector family, which includes the human respiratory syncytial virus incorporates into, e.g., epithelial cells directly upon adminis (RSV), Newcastle disease virus, hendravirus, nipahvirus, tration. These epithelial cells act as a functional barrier to the measles virus, rinderpest virus, canine distemper virus, Sen cells and antibodies of the immune system. Thus, the delivery dai virus, human parainfluenza virus (e.g., 1, 2, 3, and 4), vector is not exposed to the circulation; only the IFN is rhinovirus, and mumps virus; a member of the Picornaviridae released into the bloodstream with no traces of the vector family, which includes the poliovirus, human enterovirus (A, remaining (see FIG. 3). US 2013/03 15952 A1 Nov. 28, 2013

Methods of Prophylaxis or Treatment of Autoimmune ness, constipation, insomnia, irritability, weight loss, bulging eyes, muscle tremors, skin rashes, painful or Swollen joints, Disease or Cancer Using the Compositions of the Invention sensitivity to the Sun, loss of coordination, and paralysis. 0114. The pharmaceutical compositions of the invention These symptoms, and their resolution during treatment, may can also be used as gene therapy and/or genetic vaccines for be measured by, e.g., a physician during a physical examina treating or reducing one or more symptoms of autoimmune tion or by other tests and methods known in the art. disease and cancer. The mechanism of action of the compo 0119 The dose of the compositions of the invention (e.g., sitions of the invention described above applies equally to the number of IFN-encoding delivery vectors, viral or other their use in this context. wise) or the number of treatments using the compositions of 0115 Interferons exhibit both antiviral and antiprolifera the invention may be increased or decreased based on the tive activity. IFN-Cl is currently approved in the United States severity of occurrence of, or progression of the disease or and other countries for the treatment of hairy cell leukemia, symptoms in the patient. Venereal warts, Kaposi’s Sarcoma, and chronic non-A, non-B Additional Therapeutic Regimens hepatitis. Two variants of IFN-O. have received approval for therapeutic use: -2a, marketed under the trade I0120 If desired, the subject may also receive additional name ROFERONTM-A, and Interferon alfa-2b, marketed therapeutic regimens. For example, an additional therapeutic under the trade name INTRONTM A. The amino acid agent may be admixed into a single formulation together with sequences of ROFERONTM-A and INTRONTM A differ at a the pharmaceutical compositions described herein at concen single position but otherwise are identical to the amino acid trations known to be effective for Such therapeutic agents. sequence of alpha-interferon Subtype 2 (Subtype A). Additional therapeutic agents may also be delivered sepa 0116. In addition to the labeled indications, IFN-C. is being rately. When agents are present in different pharmaceutical used or evaluated alone or in conjunction with chemothera compositions, different routes of administration may be peutic agents in a variety of other cellular proliferation dis employed. Particularly useful therapeutic agents include, orders, including chronic myelogenous leukemia, multiple e.g., antiviral agents, immunostimulatory agents, and other myeloma, Superficial bladder cancer, skin cancers (basal cell immunization vaccines. When treating cancer with the com carcinoma and malignant melanoma), renal cell carcinoma, positions of the invention, particularly useful additional ovarian cancer, low grade lymphocytic and cutaneous T cell therapeutic agents include chemotherapeutic agents, such as, lymphoma, and glioma. IFN-C. may be effective in combina e.g., camptothecin, homocamptothecin, colchicine, thio tion with other chemotherapy agents for the treatment of solid colchicine, combretastatin, dolastatin, doxorubicin, methotr tumors that arise from lung, colorectal and breast cancer (see exate, podophyllotoxin, rhizoxin, rhizoxin D, a taxol, pacli Rosenberg et al. “Principles and Applications of Biologic taxel, CC1065, and a maytansinoid. Therapy” in Cancer: Principles and Practices of Oncology, 0121. In some instances, the pharmaceutical composition 3rd ed., Devita et al., eds. pp. 301-547 (1989), Balmer DICP. and additional therapeutic agents are administered at least Ann Pharmacother 24, 761-768 (1990)). one hour, two hours, four hours, six hours, 10 hours, 12 hours, 0117 BETASERONTM (Schering Corp's recombinant 18 hours, 24 hours, three days, seven days, fourteen days, or interferon beta-1b) was the first drug indicated specifically one month apart. The dosage and frequency of administration for the treatment of MS. In a major clinical trial, BETASE of each component can be controlled independently. The RONTM was found to be effective in reducing the number and additional therapeutic agents described herein may be severity of exacerbations, or relapses, suffered by MS admixed with additional active or inert ingredients, e.g., in patients, as well as decreasing magnetic resonance imaging conventional pharmaceutically acceptable carriers. A phar (MRI) evidence of MS activity in the brain. Importantly, the maceutical carrier can be any compatible, non-toxic Sub results of the trial pertained only to the relapsing-remitting stance Suitable for the administration of the compositions of patient group, since other forms of MS were not represented the invention to a Subject. Pharmaceutically acceptable car in the trial. Moreover, the trial demonstrated no beneficial riers include, for example, water, saline, buffers and other effect of the drug on ultimate disability of MS over the 2 to 3 compounds, described, for example, in the Merck Index, years of the study, and the effectiveness of the drug is signifi Merck & Co., Rahway, N.J. A slow release formulation or a cantly impaired by its side effects. U.S. Pat. Nos. 7,105,154; slow release apparatus may be also be used for continuous 5,372,808; 5,846,526; 6,204,022; 6,060,450; and 6,361,769 administration. The additional therapeutic regimen may also describe the use of IFN therapy for treating autoimmune involve other therapies, including modification to the lifestyle diseases and cancer; each of these publications is incorpo of the subject being treated. rated herein by reference). U.S. Pat. No. 7,442,380 describes 0.122 Antiviral Agents the treatment of autoimmune diseases caused by viral infec I0123 Antiviral agents may be used as an additional thera tion using interferons. peutic agent, either in combination with the vaccine or in a 0118. Thus, the compositions of the invention (e.g., an separate administration. Exemplary antiviral agents are aba Ad5-IFNC.) can be administered to a subject (e.g., a human) to cavir, aciclovir, acyclovir, adefovir, amantadine, amprenavir, treat or reduce one or more symptoms of autoimmune disease arbidol, atazanavir, atripla, brivudine, cidofovir, combivir, (e.g., multiple Sclerosis, type I diabetes, lupus, Addison's darunavir, delavirdine, didanosine, docosanol, edoxudine, disease, myasthenia gravis, and amyotrophic lateral Sclero efavirenz, emitricitabine, enfuvirtide, entecavir, entry inhibi sis) or cancer in the Subject. Examples of the symptoms of tors, famciclovir, fixed dose combinations, fomivirsen, fos autoimmune disease that can be treated or reduced using the amprenavir, foscarnet, foSfonet, fusion inhibitors, ganciclo compositions of the invention include, e.g., increased levels Vir, gardasil, ibacitabine, immunovir, idoxuridine, of autoantibodies, increased levels of autoreactive T cells, imiquimod, indinavir, inosine, integrase inhibitors, interferon loss of targeted cells (e.g., pancreatic B-islet cells), fatigue, type III, interferon type II, , interferon, lami depression, sensitivity to cold, weight gain, muscle weak Vudine, lopinavir, loviride, MK-0518, maraviroc, moroxy US 2013/03 15952 A1 Nov. 28, 2013 dine, nelfinavir, nevirapine, nexavir, nucleoside analogues, antel pamoate, Suramin Sodium, thiabendazole, cytarabine, oseltamivir, penciclovir, peramivir, pleconaril, podophyllo idoxuridine, trifluridine, Vidarabine, acyclovir, Zidovudine, toxin, protease inhibitors, reverse transcriptase inhibitors, ribavirin, bromovinyldeoxyuridine, fluoroiodoaracytosine, ribavirin, rimantadine, ritonavir, saquinavir, stavudine, Syn amantadine, acemannan, amphotericin B methyl, Ampligen, ergistic enhancers, tenofovir, tenofovir disoproxil, tipranavir, castanospermine, Soluble CD, dextran Sulfate, dideoxycyti trifluridine, trizivir, tromantadine, truvada, Valaciclovir, val dine, dideoxyinosine, didihydrodideoxythymidine, foscarnet ganciclovir, Vicriviroc, Vidarabine, Viramidine, Zalcitabine, Sodium, fusidic acid, HPA-23, isoprinosine, penicillamine, Zanamivir, and Zidovudine. Exemplary antiviral agents are peptide Tribavirin, rifabutin, didanosine, Zalcitabine, and the listed in, e.g., U.S. Pat. Nos. 6,093,550 and 6,894,033, hereby like. incorporated by reference. 0.126 Immunostimulatory Agents 0.124 Anti-Bacterial Agents 0127. Immunogenicity of the pharmaceutical composi 0.125. The compositions of the invention (e.g., Ad5-IFNC.) tions of the invention may be significantly improved if the can be administered with an anti-bacterial agent, Such as an compositions of the present invention (e.g., Ad5-IFNC) are antibiotic, e.g., one or more penicillins, cephalosporins, ami co-administered with an immunostimulatory agent or adju noglycosides, macrollides, sulfa compounds, fluoroquinolo vant. Exemplary immunostimulatory agents include alumi nes, or tetracyclines. Other examples of anti-bacterial agents num phosphate, aluminum hydroxide, QS21, Quil A (and include penicillin G, penicillin V, methicillin, nafcillin, derivatives and components thereof), calcium phosphate, cal oxacillin, cloxacillin, dicloxacillion, amplicillin, amoxicillin, cium hydroxide, Zinc hydroxide, glycolipid analogs, octode bacampicillin, cyclacillin, carbenicillin indanyl, ticarcillin, cyl esters of an amino acid, muramyl dipeptides, polyphosp meZlocillin, piperacillin, cephalothin, cefazolin, cephapirin, hazene, lipoproteins, ISCOM matrix, DC-Chol, DDA, cephradine, cephalexin, cefadroxil, cefamandole nafate, cytokines, and other adjuvants and derivatives thereof. cefuroxime, cefonicid, ceforanide, cefaclor, cefoxitin, 0128. Immunization Vaccines cefotetan, cefimetazole, cefataxime, ceftizoxime, ceftriaxone, I0129. In some instances, it may be desirable to combine ceftazidime, cefoperaZone, moxalactam, cefixime, erythro the compositions of the present invention with compositions mycin, Stearate, ethylsuccinate, estolate, lactobionate, glu that induce protective responses against other viruses. For ceptate, azithromycin, clarithromycin Oxytetracycline, deme example, the compositions of the present invention (e.g., clocycline, doxycycline, minocycline, amikacin Sulfate, Ad5-IFNC.) can be administered simultaneously, separately, gentamicin Sulfate, intrathecal, kanamycin Sulfate, netilmicin or sequentially with an immunization vaccine. Such as a vac sulfate, streptomycin sulfate, tobramycin sulfate, neomycin cine for, e.g., influenza, malaria, tuberculosis, Smallpox, Sulfate, Sulfadiazine, Sulfamethizole, Sulfisoxazole, SulfisoX measles, rubella, mumps, or any other vaccines known in the azole acetyl, Sulfamethoxazole, trisulfapyrimidines, art phenaZopyridine, erythromycin ethylsuccinate, Trimethop 0.130 For example, the vaccine can be, e.g., a bacterial, rim, Ciprofloxacin, Ciprofloxacin hydrochloride, enoxacin, viral, fungal, or parasite vaccine known in the art for treating Lomefloxacin hydrochloride, Norfloxacin, Ofloxacin, Vanco a bacterial, viral, fungal, or parasitic agent, respectively. The mycin hydrochloride, teicoplanin, rifampin, metronidazole, vaccine may be directed against a bacterium selected from metronidazole hydrochloride, polmyxins, bacitracin, meth Pseudomonas aeruginosa, Salmonella typhimurium, enamine, methenamine hippurate, methenamine mandelate, Escherichia coli, Klebsiella pneumoniae, Bruscella, nitrofurantoin, phenazopyridine hydrochloride, silver nitrate, Burkholderia mallei, Yersinia pestis, and Bacillus anthracis; acetic acid, Domeboro solution, m-cresyl acetate, Colymycin a virus selected from a member of the Flaviviridae family Sotic, cortisporin, tridesilon, ciclopiroXolamine, clioquinol, (e.g., a member of the Flavivirus, Pestivirus, and Hepacivirus griseofulvin, fulvicin, grisactin, grisactin ultra, grifulvin V. genera), which includes the hepatitis C virus, Yellow fever halaprogin, pyrithione Zinc, Selenium sulfide, tolnaftate, virus; Tick-borne viruses, such as the Gadgets Gully virus, undecylenic acid, naftfine, terbinafind, imidazole, econazole, Kadam virus, Kyasanur Forest disease virus, Langat Virus, ketoconazole, miconaxole nitrate, Monistat-Derm, oxicona Omsk hemorrhagic fever virus, Powassan virus, Royal Farm Zole nitrate, Sulconazole nitrate, bis-triazoles, intraconazole, virus, Karshi virus, tick-borne encephalitis virus, Neudoerfl amphotericin B, nystatin, mycolstatin, nilstat, butoconazole, virus, Sofin virus, Louping ill virus and the Negishi virus; clotrimazole, tioconazold, fluconazole, intraconazole, ter seabird tick-borne viruses, such as the Meaban virus, Sau conazole, nystatin, mycostatin, O-V Statin, cantharidin, marez, Reef virus, and the Tyuleniy virus; mosquito-borne intralesional, podophyllin resin, podofilox, Salicylic acid, viruses, such as the Aroa virus, dengue virus, Kedougou benzylbenzoate, crotamiton, lindane, malathion, permethrin, virus, Cacipacore virus, Koutango virus, Japanese encepha phrethrins, piperonyl butoxide, Sulfur, isoniazid, pyraZina litis virus, Murray Valley encephalitis virus, St. Louis mide, ethambutol, capreomycin Sulfate, cycloserine, etham encephalitis virus. Usutu virus, West Nile virus, Yaounde butol hydrochloride, ethionamide, clofazimine, dapsone, virus, Kokobera virus, BagaZa virus, Ilheus virus, Israel tur ethionamide, itraconazole, potassium iodide flucytosine, key meningoencephalo-myelitis virus, Ntaya virus, TembuSu chloroquine phosphate, hydroxychloroquine phosphate, virus, Zika virus, Banzi virus, Boubouivirus, Edge Hill virus, chloroquine hydrochloride, quinine Sulfate, pyrimethamine? Jugra virus, Saboya virus, Sepik virus, Uganda S virus, Wes Sulfadoxine, mefloquine, quinidine gluconate, dilozanide selsbron virus, yellow fever virus; and viruses with no known furoate, eflornithine hydrochloride, furazolidone, arthropod vector, such as the Entebbe bat virus, Yokose virus, iodoquinol, melarsoprol, metronidazole, nifurtimox, para Apoi virus, Cowbone Ridge virus, Jutiapa virus, Modoc momycin Sulfate, pentamidineisethionate, primaquine phos virus, Sal Vieja virus, San Perlita virus, Bukalasa bat virus, phate, quinine Sulfate, sodium Stibogluconate, meglumine Carey Island virus, Dakarbat virus, Montanamyotis leukoen antimoniate, trimetrexate glucuronate, pyrimethamine, cephalitis virus, Phnom Penh bat virus, Rio Bravo virus, albendazole, diethycicarbamazine citrate, ivermectin, Tamana bat virus, and the Cell fusing agent virus; a virus mebendazole, metrifonate, niclosamide, oxamniquine, pyr selected from a member of the Arenaviridae family, which US 2013/03 15952 A1 Nov. 28, 2013

includes the Ippy virus, Lassa virus (e.g., the Josiah, LP, or Toxoplasma gondii, Plasmodium falciparum, P. vivax, P GA391 strain), lymphocytic choriomeningitis virus ovale, P. malariae, Trypanosoma spp., and Legionella spp. (LCMV), Mobala virus, Mopeia virus, Amapari virus, Flexal I0131 Examples of vaccines known in the art that can be virus, Guanarito virus, Junin virus, Latino virus, Machupo administered in combination with the compositions of the virus, Oliveros virus, Paraná virus, Pichinde virus, Pirital present invention (e.g., the Ad5-IFNC. constructs described virus, Sabia virus, Tacaribe virus, Tamiami virus, Whitewater herein) include AVA (BioThrax) for anthrax: VAR (Varivax) Arroyo virus, Chapare virus, and Lujo virus; a virus selected and MMRV (ProQuad) for chickenpox: DTaP (Daptacel, from a member of the Bunyaviridae family (e.g., a member of Infanrix, Tripedia), Tcl (Decavaca, generic), DT (-generic-), the Hantavirus, Nairovirus, Orthobunyavirus, and Phlebovi Tdap (Boostrix, Adacel), DTaP-IPV (Kinrix), DTaP-HepB rus genera), which includes the Hantaan virus, Sin Nombre IPV (Pediarix), DTaP-IPV/Hib (Pentacel), and DTaP/Hib virus, Dugbe virus, Bunyamwera virus, Rift Valley fever (TriHIBit) for Diphtheria; HepA (HaVrix, Vaqta) and Hep A Hepb (Twinrix) for Hepatitis A: HepE (Engerix-B. Recom virus, La Crosse virus, Punta Toro virus (PTV), California bivax HB), Hib-HepE (Comvax), DTaP-HepE-IPV (Pedi encephalitis virus, and Crimean-Congo hemorrhagic fever arix), and Hep A-HepE (Twinrix) for Hepatitis B; Hib (CCHF) virus; a virus selected from a member of the Filov (Act IIB, PedvaxH1B, Hiberix), Hib-HepE (Comvax), DTaP/ iridae family, which includes the Ebola virus (e.g., the Zaire, Hib (TriHIBit), and DTaP-IPV/Hib (Pentacel) for Haemophi Sudan, Ivory Coast, Reston, and Uganda Strains) and the lus influenzae type b; HPV4 (Gardasil) and HPV2 (Cervarix) Marburg virus (e.g., the Angola, Ció7, Musoke, Popp, Ravn for Human Papillomavirus (HPV); TIV (Afluria, Agriflu, Flu and Lake Victoria strains); a member of the Togaviridae fam Laval, Fluarix, Fluvirin, FluZone) and LAIV (FluMist) for ily (e.g., a member of the Alphavirus genus), which includes Influenza; JE (Ixiaro and JE-Vax) for Japanese encephalitis the Venezuelan equine encephalitis virus (VEE), Eastern (JE); MMR (M-M-R II) and MMRV (ProQuad) for Measles: equine encephalitis virus (EEE), Western equine encephalitis MCV4 (Menactra), MPSV4 (Menomune), and MODC virus (WEE), Sindbis virus, rubella virus, Semliki Forest (Menveo) for Meningitis; MMR (M-M-R II) and MMRV virus, Ross River virus, Barmah Forest virus, Onyongnyong (ProQuad) for Mumps; DTaP (Daptacel, Infanrix, Tripedia), virus, and the chikungunyavirus; a member of the Poxyiridae Tdap (Adacel, Boostrix), DTaP-IPV (Kinrix), DTaP-HepB family (e.g., a member of the Orthopoxvirus genus), which IPV (Pediarix), DTaP-IPV/Hib (Pentacel), and DTaP/Hib includes the Smallpox virus, monkeypox virus, and vaccinia (TriHIBit) for Pertussis; PCV7 (Prevnar), PCV13 (Prev virus; a member of the Herpesviridae family, which includes nar13), and PPSV23 (Pneumovax 23) for Bacterial Pneumo the herpes simplex virus (HSV; types 1, 2, and 6), human nia; Polio (Ipol), DTaP-IPV (Kinrix), DTaP-HepE-IPV (Pe herpes virus (e.g., types 7 and 8), cytomegalovirus (CMV), diarix), and DTaP-IPV/Hib (Pentacel) for Polio; Rabies Epstein-Barr virus (EBV), Varicella-Zoster virus, and Kapo (Imovax Rabies and Rab Avert); RV1 (Rotarix) and RV5 (Ro sis sarcoma associated-herpesvirus (KSHV); a member of taTeq) for Rotavirus; MMR (M-M-R II) and MMRV (Pro the Orthomyxoviridae family, which includes the influenza Quad) for Rubella; ZOS (Zostavax) for Shingles; Vaccinia virus (A, B, and C), such as the H5N1 avian influenza virus or (ACAM2000, Dryvax) for Smallpox and Monkeypox: DTaP H1N1 Swine flu; a member of the Coronaviridae family, (Daptacel, Infanrix, Tripedia), Tod (Decavac, generic), DT which includes the severe acute respiratory syndrome (-generic-), TT (-generic-), Tclap (Boostrix, Adacel), DTaP (SARS) virus; a member of the Rhabdoviridae family, which IPV (Kinrix), DTaP-HepE-IPV (Pediarix), DTaP-IPV/Hib includes the rabies virus and vesicular stomatitis virus (Pentacel), and DTaP/Hib (TriHIBit) for Tetanus: BCG (VSV): a member of the Paramyxoviridae family, which (TICE BCG, Mycobax) for Tuberculosis (TB); Typhoid Oral includes the human respiratory syncytial virus (RSV), New (Vivotif) and Typhoid Polysaccharide (Typhim Vi) for castle disease virus, hendravirus, nipahvirus, measles virus, Typhoid; and YF (YF-Vax) for Yellow Fever. rinderpest virus, canine distemper virus, Sendai virus, human (0132 Ebola Vaccine parainfluenza virus (e.g., 1, 2, 3, and 4), rhinovirus, and 0.133 Ad-CAGoptZGP is a vaccine that uses an Adenovi mumps virus; a member of the Picornaviridae family, which rus 5 backbone and encodes the surface proteins of the Ebola includes the poliovirus, human enterovirus (A, B, C, and D). virus (see Richardson et al. (PLoS 4.e5308, 2009)). Earlier hepatitis A virus, and the coxsackievirus; a member of the versions of this vaccine have been previously shown to pro Hepadnaviridae family, which includes the hepatitis B virus: tect mice, guinea pigs and nonhuman primates from an oth a member of the Papillamoviridae family, which includes the erwise lethal challenge of Zaire Ebola virus. Ad-CAGoptZGP human papilloma virus; a member of the Parvoviridae family, incorporates three improvements: codon optimization of the which includes the adeno-associated virus; a member of the gene insert, inclusion of a consensus Kozak sequence, and Astroviridae family, which includes the astrovirus; a member reconfiguration of a CAG promoter. Transfection or transduc of the Polyomaviridae family, which includes the JC virus, tion of cells with Ad-CAGoptZGP results in high expression BK virus, and SV40 virus; a member of the Calciviridae of the Ebola glycoprotein from those cells, and allows for a family, which includes the Norwalk virus; a member of the functional dose-100 times lower than with otheradenovirus Reoviridae family, which includes the rotavirus; and a mem based Ebola vaccine constructs and with a faster time to ber of the Retroviridae family, which includes the human immunity. Finally, Ad-CAGoptZGP is capable of inducing immunodeficiency virus (HIV: e.g., types 1 and 2), and full protection to mice (partial protection to guinea pigs) human T-lymphotropic virus Types I and II (HTLV-1 and when given 30 minutes post-challenge, whereas previous HTLV-2, respectively); or a fungus selected from Aspergillus, vaccines were not functional post-exposure. The strength of Blastomyces dermatitidis, Candida, Coccidioides immitis, this vaccine is its lasting immunity. Cryptococcus neoformans, Histoplasma capsulatum var. I0134. In an embodiment, a pharmaceutical composition of capsulatum, Paracoccidioides brasiliensis, Sporothrix the invention (e.g., the Ad5-IFNC. constructs described schenckii, Zygomycetes spp., Absidia corymbifera, Rhizomu herein) can be administered simultaneously, separately, or corpusillus, and Rhizopus arrhizus; or parasite selected from sequentially with the Ad-CAGoptZGP Ebola vaccine. Pref US 2013/03 15952 A1 Nov. 28, 2013

erably, one or both of the agents are formulated for intranasal 0.139 Similar results were obtained from a guinea pig or pulmonary administration. Our experimental data shows model of fatal ZEBOV infection in which intranasaldelivery significant synergy when, e.g., Ad5-IFNC. and Ad-CA of 2x10 PFU mAd5-IFNC. resulted in 100% survival and GoptZGP are combined (whether administered in a single slightweight loss for those treated compared to 100% fatal for composition or in separate compositions; see, e.g., Example those untreated animals. 10' PFUAd-CAGoptZGP resulted 14 herein). Specifically, complete treatment efficacy is seen in 33% survival while the combination of Ad5-IFNC. and 30 min post-exposure with ZEBOV with no reduction in body Ad-CAGoptZGP resulted in 100% survival with no weight weight in both mouse and Guinea pig models. We expect to loss. These results are particularly impressive given the Sus gain the benefits of both rapid onset (3 hours) of Ad5-IFNC. ceptibility of Guinea pigs to ZEBOV. In this study the efficacy and long lasting protection of Ad-CAGoptZGP in order to of daily injections of recombinant IFNC. protein was also maximize the protective benefit of both components, as is assessed, and it was noted that Some Survival benefit was seen in Table 1. The combination of an immune stimulator observed (FIG. 10B). and Ebola vaccine contributes to a highly effective, focused therapy, and a broad spectrum antiviral makes this combina Formulation and Administration of the Pharmaceutical tion a Superior treatment option. Compositions of the Invention TABLE 1. 0140. The compositions utilized in the methods described Summary of capabilities of Ad5-IFNC, Ad-CAGoptZGP Ebola vaccine, herein can be formulated for administration by a route and their combination as a prophylactic for Ebola viruses selected from, e.g., parenteral, dermal, transdermal, ocular, Combination Fast acting AND long lasting immunity inhalation, buccal, Sublingual, perilingual, nasal, rectal, topi Prophylactic Excellent efficacy pre-and post- exposure cal administration, and oral administration. Administration Needle-free may be by, e.g., intranasal release. Parenteral administration Cost effective manufacturing Ad-CAGoptZGP Long lasting immunity includes intravenous, intraperitoneal, Subcutaneous, and Some efficacy post-exposure intramuscular administration. Parenteral, intranasal or Needle-free intraocular administration may be provided by using, e.g., Simple cost-effective manufacturing aqueous Suspensions, isotonic saline Solutions, Sterile and Ad5-IFNC. Rapid onset (3 hours) injectable solutions containing pharmacologically compat Broad spectrum protection Needle-free ible dispersants and/or solubilizers, for example, propylene Simple cost-effective manufacturing glycol or polyethylene glycol, lyophilized powder formula Efficacy pre-and post-exposure tions, and gel formulations. The preferred method of admin Known and acceptable safety profiles of all istration can vary depending on various factors (e.g., the components components of the composition being administered and the severity of the condition being treated). Formulations suitable 0135. The combination of Ad5-IFNC. and Ad-CA for oral or nasal administration may consist of liquid solu GoptZGP also provides for rapid onset of therapeutic and tions, such as an effective amount of the composition dis prophylactic effects and Sustained protection against reinfec solved in a diluent (e.g., water, saline, or PEG-400), capsules, tion. The combination of Ad5-IFNC. and Ad-CAGoptZGP Sachets, tablets, or gels, each containing a predetermined (either separately or in combination) promotes direct stimu amount of the IFN delivery vehicle composition of the inven lation of the innate immune system within 1-10 hours (e.g., tion. The pharmaceutical composition may also be anaerosol within 3 hours), which acts to counter, e.g., viral hemorrhagic formulation for inhalation, e.g., to the bronchial passage fever viruses present within the recipient. Rapid onset to ways. Aerosol formulations may be mixed with pressurized, protection is one of the many benefits of the combination pharmaceutically acceptable propellants (e.g., dichlorodif therapy. The combination of Ad5-IFNC. and Ad-CAGoptZGP luoromethane, propane, or nitrogen). In particular, adminis is also quickly fully functional with a single dose, although tration by inhalation can be accomplished by using, e.g., an multiple doses (e.g., 2, 3, 4, or 5 doses) of one or both of the aerosol containing Sorbitan trioleate or oleic acid, for agents can be administered, as needed. example, together with trichlorofluoromethane, dichlorof 0.136 Expeditionary & Shelf Stable luoromethane, dichlorotetrafluoroethane, or any other bio 0.137 To minimize logistical constraints, the combination logically compatible propellant gas. of Ad5-IFNC. and Ad-CAGoptZGP can be formulated to be 0.141. Immunogenicity of the composition of the invention shelf stable and expeditionarily rugged. Formulations may be significantly improved if it is co-administered with an described herein allow for deployment of the agent(s) at >35° immunostimulatory agent or adjuvant. Suitable adjuvants C., if necessary, for greater than, e.g., 30-90 days (e.g., at least well-known to those skilled in the art include, e.g., aluminum 60 days) and for short periods of between 30 minutes and 5 phosphate, aluminum hydroxide, QS21, Quil A (and deriva hours (e.g., at least 1 hour) at temperatures as high as 90° C. tives and components thereof), calcium phosphate, calcium Filovirus Efficacy Data hydroxide, Zinc hydroxide, glycolipid analogs, octodecyl 0138 Ad5-IFNC. and Ad-CAGoptZGP each have been esters of an amino acid, muramyl dipeptides, polyphosp tested separately and in combination in well characterized hazene, lipoproteins, ISCOM matrix, DC-Chol, DDA, cytok animal models of Filovirus infection (Zaire Ebola; ZEBOV). ines, and other adjuvants and derivatives thereof. Mouse studies showed that dosing with a range of 10 to 10° 0142. In some instances, it may be desirable to combine plaque forming units (PFU) of Ad-CAGoptZGP was fully the compositions of the invention with compositions that protective, and 107 PFU of Ad5-IFNC. treated or pre-treated induce protective responses against other viruses. For mice, resulting in complete Survival and negligible weight example, the compositions of the present invention can be loss. administered simultaneously, separately, or sequentially with US 2013/03 15952 A1 Nov. 28, 2013 20 other immunization vaccines, such as those for, e.g., influ capsules, or in a suitable dry powder inhaler (DPI) capable of enza, malaria, tuberculosis, or any other vaccines known in administering one or more doses. the art. 0148 Nasal or Pulmonary Delivery 0143 Pharmaceutical compositions according to the 014.9 There are several benefits of intranasal or pulmo invention described herein may be formulated to release the nary administration over, e.g., oral, intravascular, or intra composition immediately upon administration (e.g., targeted muscular administration. In particular, an intranasal or pull delivery) or at any predetermined time period after adminis monary administration route is less harsh for an adenoviral tration using controlled or extended release formulations. vector System. There are fewer proteolytic enzymes present Administration of the pharmaceutical composition in con in, e.g., the nasal epithelium and the environment has a more trolled or extended release formulations is useful where the neutral pH (i.e., it is less acidic). Also, the uptake of particles composition, either alone or in combination, has (i) a narrow of the viral delivery vector would be more consistent in the therapeutic index (e.g., the difference between the plasma nasal or pulmonary mucosa than in the gut where there would concentration leading to harmful side effects or toxic reac be more variation in the content of the intestinal lumen, and tions and the plasma concentration leading to a therapeutic thus greater variability in the ability of the vector to trans effect is small; generally, the therapeutic index, TI, is defined duce?transfect cells in that environment. Moreover, the nasal as the ratio of median lethal dose (LDs) to median effective mucosa is well irrigated, and is thus a permeable mucosal site. dose (EDs)); (ii) a narrow absorption window at the site of 0150. Thus, in an embodiment, the IFN-C. delivery vector release (e.g., the gastro-intestinal tract); or (iii) a short bio of the invention, and pharmaceutical compositions contain logical half-life, so that frequent dosing during a day is ing it, are delivered via an intranasal or pulmonary route in, required in order to Sustain a therapeutic level. e.g., lyophilized powder form, in an aerosolized liquid form, 0144. Many strategies can be pursued to obtain controlled or in a gel form. These routes of administration avoid recog or extended release in which the rate of release outweighs the nition of, e.g., the Ad5 vector by the host immune system, rate of metabolism of the pharmaceutical composition. For thereby bypassing any pre-existing immunity the host may example, controlled release can be obtained by the appropri have. In addition, intranasal and pulmonary delivery allow for ate selection of formulation parameters and ingredients, easy administration in the event of the need for mass distri including, e.g., appropriate controlled release compositions bution. and coatings. Suitable formulations are known to those of 0151 Pulmonary and/or intranasal administration of the skill in the art. Examples include single or multiple unit tablet compositions of the invention includes, e.g., providing a mist or capsule compositions, oil solutions, Suspensions, emul (aqueous or fine powder) to the lungs (upper and/or lower sions, microcapsules, microspheres, nanoparticles, patches, respiratory tract) or nasal epithelium, respectively. This form and liposomes. of administration has a number of benefits over conventional 0145 The compositions of the invention may be adminis needle-based injections. First, it does not involve the use of a tered to provide pre-exposure prophylaxis or after a subject needle, which means better patient compliance because it is has been exposed to a pathogen, Such as a virus. The compo "pain-free. Second, pulmonary and intranasal administra sition may be administered, e.g., 1,2,3,4,5,6,7,8,9, 10, 15, tion allows for self-administration, which saves physicians 20, 30, 35, 40, 45, 50, 55, or 60 minutes, 2, 4, 6, 10, 15, or 24 time, makes instrumentation unnecessary, and eliminates hours, 2, 3, 5, or 7 days, 2, 4, 6 or 8 weeks, or even 3, 4, or 6 apprehension for the patient. Third, the use of Sugar- or salt months pre-exposure, or may be administered to the Subject based placebo powders or solutions facilitates training for 15-30 minutes or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 20, 24, 48, 72 administration without pain. Fourth, there is no risk of medi hours, or longer post-exposure to the pathogen (e.g., a viral cal problems caused by, e.g., needle-borne contamination by pathogen). bacteria/viruses or other problems from an unclean injection site. Fifth, the distribution of the aerosol or powder results in 0146 When treating autoimmune disease or cancer, the a thorough and more even application of the vaccine. Sixth, compositions of the invention may be administered to the the particle size of the vaccine can be controlled so that subject either before the occurrence of symptoms or a defini effective deposition at, e.g., the upper and/or lower respira tive diagnosis or after diagnosis or symptoms become evi tory tract, takes place based on the characteristics of the dent. For example, the composition may be administered, administration device. Furthermore, needle-based adminis e.g., immediately after diagnosis or the clinical recognition of trations typically require a trained medical professional to symptoms or 2, 4, 6, 10, 15, or 24 hours, 2, 3, 5, or 7 days, 2. insure that the injected medication is correctly delivered to 4, 6 or 8 weeks, or even 3, 4, or 6 months after diagnosis or the right compartment of the body (i.e., intravenous versus detection of symptoms. intramuscular). The preparation of aerosolized adenoviral 0147 The compositions may be sterilized by conventional vectors is described in, e.g., U.S. Pat. No. 7,097.827, which is sterilization techniques, or may be sterile filtered. The result incorporated by reference herein. ing aqueous solutions may be packaged for use as is, or 0152 Formulations suitable for use with a nebulizer, lyophilized, the lyophilized preparation may be administered either jet or ultrasonic, will typically comprise the vector in powder form or combined with a sterile aqueous carrier (e.g., the Ad5-conIFN-C. Vector) in an aqueous medium at a prior to administration. The pH of the preparations typically concentration of, e.g., about 0.01 to 25 mg of vectorper mL of will be between 3 and 11, more preferably between 5 and 9 or solution, preferably about 0.1 to 10 mg/mL. The formulation between 6 and 8, and most preferably between 7 and 8, such may also include a buffer and a simple Sugar (e.g., for protein as 7 to 7.5. The resulting compositions in solid form may be stabilization and regulation of osmotic pressure), and/or packaged in multiple single dose units, each containing a human serum albumin ranging in concentration from 0.1 to fixed amount of the IFN delivery vector (e.g., an Ad5 con 10 mg/ml. Examples of buffers that may be used are sodium IFN-Cl delivery vector) and, if desired, one or more immuno acetate, citrate and glycine. Preferably, the buffer will have a modulatory agents, such as in a sealed package of tablets or composition and molarity Suitable to adjust the Solution to a US 2013/03 15952 A1 Nov. 28, 2013

pH in the range of 3 to 9. Generally, buffer molarities of from lyophilization): monosaccharides such as fructose, maltose, 1 mM to 50 mM are suitable for this purpose. Examples of galactose, glucose, D-mannose, Sorbose, and the like; disac excipients, usually in amounts ranging from 1% to 90% by charides, such as lactose, Sucrose, trehalose, cellobiose, and weight (e.g., 1% to 50% by weight, more preferably 5% to the like; polysaccharides, such as raffinose, melezitose, mal 30% by weight) of the formulation include, e.g., monosac todextrins, dextrans, starches, and the like; alditols, such as charides such as fructose, maltose, galactose, glucose, mannitol, xylitol, xylose, maltitol, lactitol, xylitol sorbitol D-mannose, Sorbose, and the like; disaccharides, such as (glucitol), Sorbitose, pyranosyl Sorbitol, myoinositol and the lactose, Sucrose, trehalose, cellobiose, and the like; polysac like; and glycine, CaCl2, hydroxyectoine, ectoine, gelatin, charides, such as raffinose, melezitose, maltodextrins, dex di-myo-inositol phosphate (DIP), cyclic 2.3 diphosphoglyc trans, starches, and the like; alditols. Such as mannitol. Xylitol, erate (cDPG), 1,1-di-glycerol phosphate (DGP), B-manno xylose, maltitol, lactitol, xylitol sorbitol (glucitol), sorbitose, sylglycerate (firoin), 3-mannosylglyceramide (firoin A), pro pyranosyl Sorbitol, myoinositol and the like; and glycine, line betaine and/or derivatives as well as combinations CaCl, hydroxyectoine, ectoine, gelatin, di-myo-inositol thereof. The amount added to the formulation can range from phosphate (DIP), cyclic 2.3 diphosphoglycerate (cDPG), 1,1- about 0.01 to 200% (w/w), preferably from approximately 1 di-glycerol phosphate (DGP), B-mannosylglycerate (firoin), to 50% (w/w), and more preferably from about 5 to 30% B-mannosylglyceramide (firoin A), proline betaine and/or (w/w) of the vector present. Such formulations are then lyo derivatives as well as combinations thereof. philized and milled to the desired particle size. The particles 0153. The nebulizer formulation may also contain a sur of the powder shall have aerodynamic properties in the nasal factant to reduce or prevent Surface induced aggregation of cavities and lung corresponding to particles with a density of the composition components caused by atomization of the about 1 g/cm having a median diameter less than 50 um, Solution in forming the aerosol. Various conventional Surfac preferably between 1.5 and 10 um, more preferably of tants can be employed, Such as polyoxyethylene fatty acid between 1.8 and 7.0 um, and most preferably from about 2.0 esters and alcohols, and polyoxyethylene Sorbitan fatty acid to 4 um. The mean particle diameter can be measured using esters. Amounts will generally range between 0.001% and conventional equipment. Such as a Cascade Impactor (Ander 4% by weight of the formulation. An especially preferred sen, Ga.). Surfactant for purposes of this invention is polyoxyethylene 0157. The dry powder formulations of the present inven Sorbitan monooleate. tion may conveniently be formulated by first Suspending the 0154 Specific formulations and methods of generating vector (e.g., an adenoviral vector that includes a nucleic acid suitable dispersions of liquid particles of the invention are molecule encoding an interferon (e.g., Ad5-conIFN-O.) or described in, e.g., WO 94/20069, U.S. Pat. No. 5,915,378, other nucleic acid construct of the invention) in an aqueous U.S. Pat. No. 5,960,792, U.S. Pat. No. 5,957,124, U.S. Pat. solution. The relative amounts of vector and any added No. 5,934,272, U.S. Pat. No. 5,915,378, U.S. Pat. No. 5,855, excipient material will depend on the desired final ratio of 564, U.S. Pat. No. 5,826,570, and U.S. Pat. No. 5,522,385, vector to excipient. Conveniently, the ratio of vector to excipi each of which is hereby incorporated by reference. ent will be in the range from about 2:1 to 1:100 (vector: 0155 The compositions of the invention (e.g., an adenovi excipient), preferably from 1:1 to 1:10, with a total solids ral vector that includes a nucleic acid molecule encoding an concentration in the aqueous Suspension being usually less interferon (e.g., Ad5-conIFN-C)) are preferentially adminis than 5% by weight, more usually being less than 3% by tered intranasally. The Ad5 virus is highly efficient in deliv weight. ering genes to the epithelial cells of the nasal membranes. 0158. The powder may be suspended in a propellant with Mucosal dosing is efficient because it stimulates both the the aid of a Surfactant. The propellant may be any conven systemic and mucosal immunity at the portal of entry (see, tional material employed for this purpose, such as a chlorof e.g., Gutierro et al., Vaccine 20:2181-2190, 2002; and Patelet luorocarbon, a hydrochlorofluorocarbon, a hydrofluorocar al., J. Infect. Dis. 196:S413-420, 2007). In addition, utilizing bon, or a hydrocarbon, including trichlorofluoromethane, live Ad5 virus to deliver the IFN provides an additional route dichlorodifluoromethane, dichlorotetrafluoroethanol, and of immune stimulation, thereby acting as an adjuvant in 1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable ensuring maximum effect is achieved. Thus, delivering the surfactants include sorbitan trioleate and soya lecithin. Oleic compositions of the invention to a site where the infectious acid may also be useful as a Surfactant. This mixture is then agent (e.g., a virus) enters will likely resultina lower required loaded into the delivery device. dose. Specific instrumentation has been developed to effec tively deliver aerosol droplets (diameters-2 um) to this com 0159. In the case of compositions of the invention that partment (see, e.g., the Mucosal Atomization Device include viral vectors, it is usually desirable that the aqueous (MAD300), Wolfe Tory Medical). Droplet (or powdered par solution be buffered in order to enhance the activity of the ticle) size is important as aerosols<1 um penetrate further viral vectors after drying. Buffers or pH-adjusting agents down the respiratory tract and can cause adverse effects. typically include a salt prepared from, e.g., an organic acid or 0156 The compositions of the invention can also be deliv base. Representative buffers include organic acid salts of ered in powder form using, e.g., a metered dose inhaler citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric device. This powder may be produced by lyophilization and acid, Succinic acid, acetic acid, or phthalic acid, Tris, may also contain a stabilizer Such as human serum albumin tromethamine hydrochloride, or phosphate buffers. (HSA). Typically, more than 0.5% (w/w) HSA is added. 0160 Additional polymeric excipients/additives that can Additionally, one or more of the following may be added as an be included in the formulations of the compositions of the excipient to the preparation, if necessary, to enhance one or invention include, e.g., polyvinylpyrrolidones, derivatized more features (e.g., to facilitate dispersal of the powder from celluloses such as hydroxymethylcellulose, hydroxyethylcel a device, to increase the shelf-life of the vaccine composition, lulose, and hydroxypropylmethylcellulose, Ficols (a poly or to improve the stability of the vaccine composition during meric Sugar), hydroxyethylstarch, dextrates (e.g., cyclodex US 2013/03 15952 A1 Nov. 28, 2013 22 trins, such as 2-hydroxypropyl-3-cyclodextrin and into a fabric material, such as gauze, that can be applied to the Sulfobutylether-B-cyclodextrin), polyethylene glycols, and nasal mucosal surfaces to allow for penetration of the delivery pectin. vehicles therein. 0164. Examples of gel formulations that can be used to 0161 The powder compositions of the invention for use in prepare compositions of the invention are also described in, these devices may be generated and/or delivered by methods e.g., U.S. Pat. Nos. 7,538,122; 7,387,788; 7,166.575; 6,413, disclosed in WO 96/32149, WO 97/41833, and WO 539; and 6,004,583; each of which is incorporated herein by 98/29096, and in U.S. Pat. Nos. 7,482,024; 7,481,212; 7,371, reference. The gel formulations of the invention may also 373; 6,303,582; 6,001,336; 5,997,848; 5,993,783; 5,985,248; further include a permeation enhancer (penetration 5,976,574; 5,922,354; 5,785,049; and U.S. Pat. No. 5,654, enhancer). Permeation enhancers include, but are not limited 007, each of which is incorporated by reference herein. The to, sulfoxides such as dimethylsulfoxide and decylmethylsul powder form can also be administered using, e.g., a prefilled foxide: Surfactants such as sodium laurate, Sodium lauryl administration device. Such as the devices described in, e.g., Sulfate, cetyltrimethylammonium bromide, benzalkonium U.S. Pat. Nos. 5,437,267; 6,068, 199: 6,715,485; 5,994,314: chloride, poloxamer (231, 182, 184), tween (20, 40, 60, 80) 7,235,391; and 6.398,774, each of which is incorporated by and lecithin; the 1-substituted azacycloheptan-2-ones, par reference herein. The powders will generally have moisture ticularly 1-n-dodecylcyclazacycloheptan-2-one; fatty alco contents below about 20% by weight, usually below about hols such as lauryl alcohol, myristyl alcohol, oleyl alcohol 10% by weight, and preferably below about 6% by weight. and the like; fatty acids such as lauric acid, oleic acid and Such low moisture-containing Solids tend to exhibit a greater Valeric acid; fatty acid esters such as isopropyl myristate, Stability upon packaging and storage. isopropyl palmitate, methylpropionate, and ethyl oleate; 0162 Mechanical devices designed for pulmonary and/or polyols and esters thereof Such as propylene glycol, ethylene nasal delivery of the compositions of the invention include glycol, glycerol, butanediol, polyethylene glycol, and poly but are not limited to nebulizers, metered dose inhalers, and ethylene glycol monolaurate, amides and other nitrogenous powder inhalers, all of which are familiar to those of skill in compounds such as urea, dimethylacetamide (DMA), dim the art. Specific examples of commercially available devices ethylformamide (DMF), 2-pyrrolidone, 1-methyl-2-pyrroli suitable for the practice of this invention are the Ultravent done, ethanolamine, diethanolamine and triethanolamine, nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, terpenes; alkanones, and organic acids, particularly salicylic Mo., USA; the Mucosal Atomization Device (e.g., acid and salicylates, citric acid and Succinic acid. The perme MAD300), Wolfe Tory Medical; the Acorn II nebulizer, ation enhancer may be present from about 0.1 to about 30% manufactured by Marquest Medical Products, Englewood, w/w. Preferred permeation enhancers are fatty alcohols and Colo., USA; the Ventolin metered dose inhaler, manufactured fatty acids. The gel compositions may also include a buffering by Glaxo Inc., Research Triangle Park, N.C., USA; the Opti agent, for example, carbonate buffers, citrate buffers, phos Nose device, manufactured by OptiNose, Oslo, Norway; the phate buffers, acetate buffers, hydrochloric acid, lactic acid, Spinhaler powder inhaler, manufactured by Fisons Corp., tartaric acid, inorganic and organic bases. The buffering agent Bedford, Mass., USA the “standing cloud' device of Nektar may be present in a concentration of about 1 to about 10 Therapeutics, Inc., San Carlos, Calif., USA; the AIR inhaler weight percent, more preferred is a concentration of about 2 manufactured by Alkermes, Cambridge, Mass., USA; and the to about 5 weight percent, depending on the type of buffering AERX pulmonary drug delivery system manufactured by Ara agent(s) used, as known by the one skilled in the art. Concen digm Corporation, Hayward, Calif., USA. See also the deliv trations of the buffering agent(s) may vary, however, and the ery devices described in, e.g., U.S. Pat. Nos. 5,522.378: buffering agent may replace up to 100% of the water amount 5,775,320; 5,934.272; and 5.960,792; the OptiNose devices within the composition. in U.S. Pat. Nos. 6,715,485; 7,347,201; and 7,481,218; and U.S. Patent Application Publication Nos. 2004/01 12378: Dosage 2005/0072430, 2004/01 12379; 2004/0149289; 2005/ 0.165. The pharmaceutical compositions of the invention 0028812; 2008/0163874; 2008/0161771; 2008/0223363; can be administered in a therapeutically effective amount that 2005/0235992; 2006/0096589; 2006/0169278; 2007/ provides an immunogenic and/or protective effect against 0039614; and 2007/0186927); and the device in U.S. Pat. No. infection by a pathogen, Such as a virus. For example, when 7,669,597. the compositions include a viral vector (e.g., an Ad5-based 0163 The compositions of the invention can also be for vector) that encodes an IFN (e.g., IFN-O, such as conIFN-C), mulated as intranasal carriers in the form of nasal gels, at least about 1x10 viral particles (vp)/dose or between creams, pastes or ointments that provide a more Sustained 1x10' and 1x10" vp/dose, preferably between 1x10 and contact with the nasal mucosal Surfaces. These formulations 1x10" vp/dose, and more preferably between 1x10 and can have a viscosity of, e.g., from about 10 to about 250,000 1x1011 vp/dose (e.g., 1.5-3.0x10 vp/ml, of the viral vector centipoise (cps), or from about 2500 to 100,000 cps, or from provides a therapeutically effective amount of the IFN fol about 5,000 to 50,000 cps or greater. Such carrier viscous lowing expression in host cells. A single viral particle formulations may be based upon, simply by way of example, includes one or more nucleic acid molecules (either DNA or alkylcelluloses and/or other biocompatible carriers of high RNA) encoding viral and non-viral proteins (e.g., viral struc Viscosity well known to the art (see e.g., Remington, cited tural and non-structural proteins and including a non-endog Supra. A preferred alkylcellulose is, e.g., methylcellulose in a enous IFN) and Surrounded by a protective coat (e.g., a lipid concentration ranging from about 5 to about 1000 or more mg based envelope or a protein-based capsid) that includes per 100 ml of carrier. A more preferred concentration of protein subunits. Viral particle number can be measured methyl cellulose is, simply by way of example, from about 25 based on, e.g., lysis of vector particles, followed by measure to about mg per 100 ml of carrier. The carrier containing the ment of the absorbance at 260 nm (see, e.g., Steel, Curr. Opin. IFN delivery vehicle of the invention can also be, e.g., soaked Biotech. 10:295-297, 1999). US 2013/03 15952 A1 Nov. 28, 2013

0166 When the composition is a non-viral vector that a single dose administered directly post-exposure (e.g., includes a nucleic acid molecule that encodes an IFN (e.g., within 24 hrs) to a viral or other infectious agent can function IFN-O, such as conIFN-C), the subject should be adminis as a treatment according to the present invention. The effec tered at least about 1x10" molecules/dose, e.g., between tiveness of a single dose of the compositions of the invention 1x10" and 1x10" molecules/dose, preferably between 1x10 eliminates the need to track people to be treated and to retreat and 1x10" molecules/dose, and more preferably between or revaccinate them, which is a difficult problem in a pan 1x10" and 1x10 molecules/dose, of the non-viral delivery demic or bioterrorist attack where general panic typically vector. A single nucleic acid molecule of a non-viral vector CSU.S. includes one or more nucleic acid molecules (e.g., DNA or 0171 A single intranasal dose of the compositions of the RNA) in the form of, e.g., a plasmid, cosmid, yeast or bacte invention can also be used to achieve therapy in Subjects being rial artificial chromosome, and bacteriaphage that is admin treated for autoimmune disease or cancer. Multiple doses istered in a naked form or that has been surrounded by or (e.g., 2, 3, 4, 5, or more doses) can also be administered, in complexed with a protective substance (e.g., lipids or a lipid necessary, to these subjects. based envelope, peptides, and polymers). 0167. The dosage administered depends on the subject to Shelf Stability be treated (e.g., the age, body weight, capacity of the immune 0172 Pharmaceutical formulations of the compositions of system, and general health of the Subject being treated), the the invention (e.g., a formulation that includes an Ad5-con form of administration (e.g., as a Solid or liquid), the manner IFN-Cl delivery vector) demonstrate a significant shelf life, of administration (e.g., by injection, inhalation, dry powder which provides an advantage over other adenoviral, antiviral, propellant), and the cells targeted (e.g., epithelial cells, such or vaccine products. In particular, the Ad5-based IFN-C. as blood vessels epithelial cells, nasal epithelial cells, or delivery vector of the invention, which can be manufactured pulmonary epithelial cells). The composition is preferably and lyophilized (freeze-dried), exhibits a shelf-life of at least administered in an amount that provides a sufficient level of about 1, 2, 3, or 4 weeks, preferably at least about 1, 2, 3, 4, 5, expression of IFN that elicits an immune response without 6, 12, or 18 months, more preferably at least 20 months, still undue adverse physiological effects in the host caused by the more preferably at least about 22 months, and most preferably treatment. at least about 24 months when stored at room temperature. 0.168. In addition, single or multiple administrations of the This is mission critical for the military and in developing compositions of the present invention may be given (pre- or countries where public health departments cannot guarantee post-exposure) to a Subject (e.g., one administration or refrigeration of medications. The shelf life of the composi administration two or more times). For example, Subjects tions of the invention can be extended by storage at 4°C. who are particularly Susceptible to, e.g., viral infection may 0173 The shelf life of the adenoviral vector-containing require multiple treatments to establish and/or maintain pro compositions of the invention can be assessed by, e.g., deter tection against the virus. Levels of induced immunity pro mining adenoviral vector titers (see, e.g., Croyle et al., Gene vided by the pharmaceutical compositions described herein Therapy 8:1281-1290, 2001) or by assessing the biological can be monitored by, e.g., measuring amounts of neutralizing activity (e.g., the ability to transfect a cell and express bio secretory and serum antibodies. The dosages may then be logically active IFN) of the IFN-containing delivery vehicle adjusted or repeated as necessary to maintain desired levels of (e.g., viral or non-viral delivery vehicle). In an embodiment, protection against, e.g., a viral infection. the compositions of the invention exhibit a loss of less than 0169. Alternatively, the efficacy of treatment can be deter 20% of the original titer (or biological activity), more prefer mined by monitoring the level of IFN-Cl expressed in a subject ably less than 10%, and most preferably less than 5%, after (e.g., a human) following administration of the compositions storage at room temperature for at least 12 months. In other of the invention (e.g., Ad5-IFN-O. vectors). For example, the embodiments, the compositions of the invention exhibit a loss blood or lymph of a subject can be tested for IFN-C. levels of less than 40% of the original titer (or biological activity), using, e.g., standard assays known in the art (see, e.g., Human more preferably less than 30%, and most preferably less than Interferon-Alpha Multi-Species ELISA kit (Product No. 20%, after storage at room temperature for at least 24 months. 41 105) and the Human Interferon-Alpha Serum Sample kit 0.174 Pharmaceutical formulations of the compositions of (Product No. 41110) from Pestka Biomedical Laboratories the invention also exhibit a shelf-life of at least about 1-15 (PBL), Piscataway, N.J.). The efficacy of treatment can also days or 2-4 weeks or even at least about 2-6 months when be determined by monitoring the level of expression or acti stored at temperatures in the range of about 30° C. to about vation of IFN-O. upregulated factors, such as the double 55° C. (e.g., ~45° C.). In an embodiment, the composition is stranded RNA (dsRNA)-dependent protein kinase R (PKR), stored is a dry, unreconstituted powder form. Preferably, a the 2'-5'-oligoadenylate synthetase (2'-5'-OAS), IFN-induc composition of the invention that is stored at a temperature in ible MX proteins, a tryptophan-degrading enzyme (see, e.g., the range of about 30°C. to about 55° C. exhibits a loss of less Pfefferkorn, Proc. Natl. Acad. Sci. USA 81:908-912, 1984), than 40% (more preferably less than 30%, 20%, or 10%, and adenosine deaminase (ADAR1), IFN-stimulated gene 20 most preferably less than 5%) of the original titer (or biologi (ISG20), p 56, ISG15, mGBP2, GBP-1, the APOBEC pro cal activity) when stored for a period of time in the range of 1 teins, viperin, or other factors (see, e.g., Zhang et al., J. Virol. week to 2 months. 81:11246-11255, 2007, and U.S. Pat. No. 7,442,527, which is 0.175. In another embodiment, pharmaceutical formula incorporated by reference herein in its entirety). tions of the compositions of the invention exhibit a shelf-life 0170 A single intranasal dose of the compositions of the of at least about 1, 2, 3, or 4 weeks, preferably at least about invention achieve protection, pre-exposure, from infectious 1, 2, 3, 4, 5, 6, 12, or 18 months, more preferably at least 20 agents (e.g., viral agents). This is a dramatic improvement months, still more preferably at least about 22 months, and from the several doses per week or even multiple daily doses most preferably at least about 24 months when stored frozen that are required with current IFN-C treatments. In addition, (e.g., at a temperature in the range of less than 4°C. (e.g., 0° US 2013/03 15952 A1 Nov. 28, 2013 24

C. to about -1900°C.)). In this embodiment, the composition inoculated with 107 PFU of Ad5-mIFNC. by intramuscular can be stored as a non-stabilized, frozen liquid. Preferably, a injection and challenged with various WEEV strains at a composition of the invention that is stored at a temperature of range of timepoints. The Ad5-mIFNC showed complete pro less than 4°C. (e.g., 0°C. to about -20°C.) exhibits a loss of tection when administered 24 hr, 48 hr, and 1 week pre less than 40% (more preferably less than 30%, 20%, or 10%, exposure, and 38% protection when treated 13 weeks pre and most preferably less than 5%) of the original titer (or exposure. A single inoculation at 6 hr after the challenge biological activity) when stored for a period of time in the delayed the progress of WEEV infection and provided about range of 2 months to 2 years. 60% protection. 0176 Benefits of the long-term stability and shelf-life of 0181. A study using Venezuelan Equine Encephalitis the compositions of the invention include: a) ease of storage Virus (VEEV) yields similar results. VEEV is a more infec of the compositions as no cold chain is required, which tions virus, and intramuscular administration of Ad5-IFN-O. increases the ability to disseminate and store the composi resulted in complete protection to 10LD50 when adminis tions in areas of the world that lack consistent access to tered 24 hr pre-exposure (other time points were not tested), electricity (e.g., third world economies and disaster or war and 75% survival to 100LD50. In this case, Ad5-IFN did not Zones) and improves military operational tempo as less protect when administered post-exposure (O'Brien et al., J. “stuff must be carried or used in areas without refrigeration; Gen. Virol. 90:874-882, 2009). b) forward deployment is possible when the drug can be thrown in a soldier's backpack or in the back of a WHO Example 2 disaster vehicle; c) less drug waste as losses due to thawing are mitigated; and d) more cost effective use of Strategic Uses for the Compositions of the Invention National Stockpile (SNS) storage space warehouse, which need not include refrigeration for storage of the compositions. 0182 Pre-exposure (post-event) prophylaxis: The compo sitions of the invention can be used as a single administration (0177. Other benefits of the Ad5-based IFN-O. delivery vec broad-spectrum antiviral prophylactic medical countermea tor of the invention are shown in FIG. 4. Sure against, e.g., viral-based bioweapon threats or risk from Kits exposure to endemic viral threats. 0183 Military or Law Enforcement Operations 0.178 The invention also provides kits including the 0.184 The compositions of the invention can be used as a IFN-Cl delivery vector of the invention, in lyophilized powder prophylaxis for military, law enforcement agents, or local form, and a vial of hydration medium (e.g., sterile water or emergency coordinator (LEC) personnel who, during opera saline) that can be used to reconstitute the powder. In another tions, are exposed to viral-based biological weapons threats. embodiment, the kit includes a container of the IFN-O. deliv The decision to administer a composition of the invention ery vector of the invention, in lyophilized powderform, and a (e.g., an Ad5 delivery vector that contains a nucleic acid separate delivery device that can be combined with the con molecule encoding conIFN-C, and that is formulated as a tainer to allow release of the contents of the container during lyophilized powder for delivery to the nasal mucosa) to warf administration. The kit may also include a container of the ighters will be based on, e.g., a) the presence of identifiable IFN-Cl delivery vector of the invention, in lyophilized powder biowarfare agents as measured by biosensors (as aerosols or form, a vial of hydration medium (e.g., Sterile water or saline) Surface contamination on equipment), b) intelligence that that can be used to reconstitute the powder, if desired, and a such viral-based weapons have been deployed or may be delivery device that can be used to release the IFN-Cl delivery deployed by adversaries, or c) diseased sentinel animals, ord) vector as a powder or reconstituted liquid in an aerosolized contact by the warfighter with victims expected to present form (e.g., via pulmonary or intranasal administration). Kits symptoms of viral disease. of the invention optionally include instructions for practicing 0185. Exposure During Research any method described herein, including a therapeutic or pro 0186. A similar scenario is presented by researchers or phylactic method, instructions for using any composition manufacturers who, by the very nature of their jobs, come in identified herein, and/or instructions for operating any appa regular contact with pathogenic viruses or other biological ratus, System, device, or component described herein, as well threats and for which an additional precaution against equip as packaging materials. ment or protocol failure. The compositions of the invention can be used as a prophylaxis (pre- or post-exposure) for these EXAMPLES individuals, as well. 0179 The following examples are to illustrate the inven tion. They are not meant to limit the invention in any way. Example 3 Example 1 Medical Chain Efficacy for Pre- and Post-Exposure Protection 0187. The compositions of the invention can be adminis Against Western Equine Encephalitis Virus and tered prophylactically to medical chain personnel, e.g., phy Venezuelan Equine Encephalitis Virus sicians, nurses, cleaning staff, and others who come into contact with patients suffering from viral or bacterial infec 0180. The use of an Ad5-IFN-Cl delivery vector has been tious diseases or who may have infectious diseases. The shown to provide both pre- and post-exposure protection broad-spectrum nature of the compositions of the invention against Western Equine Encephalitis virus (WEEV; Wu et al., allows for administration to the subject before knowledge of Virology 369:206-213, 2007), an arthropod (mosquito) borne the biological pathogen is available and in cases where there alphavirus classified as a Category B pathogen by the U.S. is no time to positively identify the viral pathogen. The com Centers for Disease Control (CDC). In this study, mice were positions of the invention are also beneficial in cases where a US 2013/03 15952 A1 Nov. 28, 2013 virus mutates during a pandemic leaving the established vac intentionally. The treatment or prevention in this context pre cine ineffective or less protective. vents or mitigates the potential catastrophic loss of animals within the food chain. Example 4 Example 6 Public Health 0188 Ring and Immediate Post Exposure Treatment Ad5-VEE/WEE/EEE Equine Vaccine 0189 If a patient is known to have come in contact with a 0196. To date, vaccination is the only means of combating viral threat in the preceding 24 hrs, a composition of the highly infectious, mosquito borne encephalitis alphaviruses. invention (e.g., an Ad5 delivery vector that contains a nucleic All horses in North America are at risk and vaccination is acid molecule encoding IFN-O. (e.g., conIFN-C), and that is recommended. Currently marketed trivalent vaccines manu formulated for nasal or pulmonary delivery, e.g., as an aero factured via traditional technology require multiple yearly Solized powder or liquid mist) can be administered as a post injections and boosters to provide protection. A “live vac exposure treatment. If necessary, a composition of the inven cine' approach using adenoviruses provides a safe means of tion can be administered, e.g., as a “ring treatment to all producing a rapid and persistent protection using just a single Susceptible individuals in a prescribed area around an out intranasal administration. break of an infectious disease. Ring treatment controls an outbreak by treating and monitoring a ring of people around Example 7 each infected individual. 0190. Suspected Exposure Treatment CoAdministration of Ad5-IFN with One or More 0191) Even if exposure to a biological threat is not con Secondary Anti-Viral Drugs firmed, a composition of the invention can be administered to those people thought to be exposed (the “worried well”), as 0197) The Ad5-IFN delivery vehicle (e.g., encoding con the side effects of IFN are minimal. For example, a cranberry IFN-O. or another IFN described herein) can be formulated growerin Massachusetts is bitten by a mosquito and gets sick. with a pharmaceutically acceptable excipient for intranasal For example, because there is an endemic risk of Eastern dosing in combination with an antihistamine and a equine encephalitis (EEE), the person can be administered a neuraminidase inhibitor. This composition can be adminis composition of the invention, for example, by nasal or pull tered to a subject either prior to viral exposure or within 48 monary delivery (e.g., as an aerosolized powder or liquid hours of exposure. The antihistamine helps to reduce any mist) and monitored for signs of improvement prior to agri nasal congestion, e.g., stuffed or blocked nasal passages, cultural work near cranberry bogs. caused by viral infection or rhinitis, thereby maximizing the (0192 Post-Exposure Prophylaxis distribution of the Ad5-IFN and neuraminidase inhibitor and 0.193) On a population level, if dissemination of a viral their absorption by the epithelium of the upper and/or lower threat is known or believed to have occurred, a composition of respiratory tract. An example of Such an antihistamine would the invention can be administered, for example, by nasal or be H1 antagonists, such as fexofenadine or loratadine. A pulmonary delivery (e.g., as an aerosolized powder or liquid neuraminidase inhibitor, such as Zanamivir (Relenza R, GlaxoSmithKline), is a potent selective inhibitor of the viral mist), stop the spread of the viral threat. In this case, the neuraminidase glycoprotein that is important for viral repli invervention is administered without knowing the infection cation of, e.g., influenza A and B and other viruses. The net status of the recipient, and thus the function of prophylaxis effect of this three drug combination is improved viral pro and treatment would likely be applied. phylaxis where the IFN initiates a broad spectrum immune Example 5 response, the neuraminidase inhibitor blocks viral release from infected cells, and the antihistamine ensures or Veterinary Indications of Ad5-Vectored IFN improves delivery of the drugs to the nasal epithelium. (0198 Alternatively, the Ad5-IFN delivery vector can be 0194 The broad spectrum anti-viral capabilities of inter administered intransally as a separate composition and the feron polypeptide have been well recognized in veterinary antihistamine and neuraminidase inhibitor (e.g., Oseltamivir medicine. Indeed, the oral administration of IFN is an effec phosphate (TamifluR), Roche Pharma)) can be administered tive treatment for shipping fever in thoroughbred racehorses orally in separate compositions or in a single composition (Akai et al., J. Equine Sci. 19:91, 2008) and cattle experienc ing bovine respiratory disease (BRDC; Cummins etal, J. Inf. (see, e.g., U.S. Pat. No. 6,605.302, which is incorporated & Cyto. Res. 19:907, 1999), and in the general treatment of herein by reference). respiratory illness in horses (Moore et al., Can. Vet.J. 45:594, Example 8 2004). Intranasal or pulmonary delivery of an Ad5-IFN could overcome the current limitations of repeated dosing and high Prophylaxis or Treatment of Punta Toro Virus cost. An intranasal delivery system for horses that could be (Family: Bunyaviridiae) used to administer compositions of the present invention is described in, e.g., U.S. Pat. No. 6,398.774, which is incorpo (0199 Rift Valley fever virus (RVFV) is an arthropod rated herein by reference. The use of an Ad5-IFN production borne viral fever that causes direct infection in humans and system has been shown to be safe and effective in lab animals livestock. The mode of transmission is via the bite of an (see, e.g., Wu et al, Virology 369:206, 2007). infective Aedes or Culex mosquito. Mechanical infection via 0.195 Other veterinary indications include the treatment aerosols or infected blood has been reported in humans that or prevention of pandemics by pathogens. Such as Rift Valley work with, handle, or process livestock or contaminated car Fever, the treatment or prevention of endemic pathogens, and casses. Humans of both sexes and all ages are susceptible and the treatment or prevention of pathogens that are released when infected with RVFV may develop retinitis, encephalitis, US 2013/03 15952 A1 Nov. 28, 2013 26 or hepatitis associated with haemorrhages that may be fatal for the Department of Defense by The US. Army Medical (Heyman, Amercian Public Health Association, Washington Research Institute of Infectious Disease, Fort Detrick, Fred D.C., 2008). Recent outbreaks in Kenya resulted in 118 erick Md., 1998). The ongoing concern of these viruses as an deaths and a case fatality rate of 29% (CDC, Morb. Motal. existing biological weapon and the lack of a safe and effica Wkly. Rep. 56:73-76, 2007). There are no approved vaccines cious vaccine orantiviral has prompted public health concern, or effective therapies for RVFV. Reflecting the concern of and these viruses are listed as a Category B Bioterrorist threat public health officials, RVFV has been classified as a Cat with the CDC (CDC, Centers for Disease Control and Pre egory A pathogen by the National Institute for Allergic and vention; Public Health Assessment of Potential Biological Infectious Diseases and has received Dual Agent status by Terrorsm Agents Vol. 8, 2010). the Department of Health and Human Services and the US (0205 Onehundred forty (140) female Balb/c mice (10 per Department of Agriculture. group) were used in this study and divided into two studies; 0200 Effective countermeasures that are highly stable, each used a total of 70 mice. The first study tested the efficacy easily administered, and elicit long lasting protective immu against WEEV California strain and the second study against nity are much needed. Because direct work with RVFV is WEEV CBA87 strain. The following treatment groups were highly restricted and requires enhanced BSL-3+ facilities, we used in both studies: have recently established an intranasal (IN) respiratory route Punta Toro virus (PTV) infection model in Syrian Hamsters. 0206 Groups 1-5: Single IN treatment with 107 PFU PTV is a BSL-2 surrogate for RVFV, and produces disease in Ad5-IFNC. at Day (-21, -14, -7, -1 or +4 hrs respec hamsters that models RVFV infection and disease progres tively) sion in humans (Gowen et al., Antiviral Res. 77:215-224, 0207 Group 6 IFNC. B/D (recombinant mouse) 2008). 2x10 IU/kg once daily at Days 0 to 8, starting 4 hrs prior 0201 The purpose of this experiment was to evaluate Ad5 to challenge IFNC. as a prophylactic agent to counterexposure to PTV. The route of Ad5-IFNC. exposure was by intranasal (IN) to simu 0208 Group 7 Control: untreated and challenged late respiratory mucosal Surface delivery—a proposed route 0209 All mice were challenged intranasally on Day 0 with of administration in humans. Doses of 10, 107, and 10° PFU lethal dose of 2.5x10 pfu of WEEV California strain in study of Ad5-IFNC. (n=15) were administered 24hrs prior to infec 1 and 500 pful of WEEV CBA87 strainin study 2 and followed tious challenge with PTV. The doses selected were based for 14 days for clinical signs of disease and euthanized at upon previous studies demonstrating high-level protection moribundity/morbidity. Administration of Ad5-IFNC. (mu and were scaled to the hamster model based on typical dosing rine) resulted in complete protection of all animals in the extrapolation equations using body Surface area. As is shown prophylactic window, and 100% (California) & 70% in FIG. 6, administration of Ad5-IFNC. at the indicated doses (CBA87) survival in the +4 hrs treatment groups (FIGS. 7A at least 24 hours prior to challenge with PTV resulted in 100% and 7B). Survival as compared to the ribavarin treated, empty-vector treated, and placebo controls. Example 10 0202 In addition, we have demonstrated significant pro tection against both respiratory and subcutaneous PTV chal lenge infections in mice treated with Ad5-IFNC.: a) prior to Prophylaxis or Treatment of Severe Acute challenge as a prophylactic (up to 21 days before challenge) Respiratory Syndrome (Family: Coronaviridae) and b) as a treatment given up to +48 hr post-exposure. 0210 SARS has recently emerged in the human popula Example 9 tion as a fatal respiratory disease. Severely affected patients develop acute respiratory distress syndrome, which corre Prophylaxis or Treatment of Western Equine sponds with diffuse alveolar damage at autopsy. A newly Encephalitis (Family: Togaviridae) discovered Coronavirus, SCV. has been identified as the pri mary cause of SARS. SARS patients have been treated 0203 Western Equine Encephalitis belongs to the empirically with a combination of Ribavirin, Oseltamivir, Alphavirus genus of the Togavirus family which represents a antibiotics and corticosteroids, with mixed results. Treatment group of mosquito borne, severely neuropathogenic, emerg with recombinant human interferon (Alfacon R) has shown ing pathogens in domestic animals and humans. WEEV is clinical promise. endemic to the Western portion of North America and is maintained in nature through a cycle involving wildbirds as 0211 Groups of 10 mice were administered 50 ul of Ad5 reservoir hosts and Culex tarsalis mosquitoes as vectors (Wu IFNC. (murine, 10° PFU) IN once at 14, 7, 5, or 3 days et al., Virology 369: 206-213, 2007) and have an overall case pre-virus exposure (PVE). In addition, groups of 10 mice fatality rate of 3%-8% depending on age. were administered 50 ul of Ad5-IFNC. (murine) (10 PFU or 0204 As a weapon, WEEV can be easily transmitted 10 PFU) IN one time at 6, 12, 24 hours post virus exposure. through the aerosol route with fatality rates as high as 40% in In both experiments Poly-ICLC was given at 1 mg/kg by the laboratory accidents (Hanson et al., Science 158: 1283-1286, IN route at 24 h before virus exposure and 8 h after exposure 1967). A closely allied virus Venezuelan Equine Encepha to virus and served as a positive control for controlling the litis virus—was weaponized by the U.S. and the former virus infection, and 15 mice were treated with buffered saline Soviet Union for aerosol dissemination as an incapacitating at each timepoint representing placebo controls. Animal agent on the battlefield. It was anticipated that a biological deaths were recorded for up to 21 days post virus exposure. weapons attack in a region populated by Equines and mos 0212. As shown in FIGS. 8A and 8B, treatment with Ad5 quito Vectors could initiate an epidemic (Eitzen et al., Medical IFNC. (murine) resulted in complete protection of all animals Management of Biological Casualties 3" Edition, published in the treatment groups. US 2013/03 15952 A1 Nov. 28, 2013 27

Example 11 rates and have the potential for major public health impact and require special action for public health preparedness. Prophylaxis or Treatment of Yellow Fever Virus 0218. Here, Ad5-IFNC was tested in mouse and Guinea (Family: Flaviviridae) pig models of the Ebola virus, Zaire strain (ZEBOV). Groups of 10 mice were challenged by intraperitoneal (IP) injection 0213 Yellow Fever (YF) is an acute infectious viral dis with 1000xLDs of the mouse-adapted Ebola virus. Thirty ease with a case fatality rate of 20-50% characterized by minutes later they were dosed by either the IM (50 ul per each jaundice and hemorrhagic symptoms. YF is transmitted by hindlimb) or IN (50 ul) route with a single dose of 1x107 IFU mosquitoes, typically Aede spps in urban areas and Hae (infectious units) mAd5-IFNC per mouse. Control mice were mogogus spp or Sabethes spp in forests with humans or pri injected IM with phosphate buffered saline (PBS) (50 ul per mates serving as reservoirs. YF has an endemic Zone between each hind limb). Complete survival benefit was seen with 15° N and 10° S latitude which encompasses 33 African and administration of mouse mAd5-IFNC. by either route, and nine South African and Caribbean Island with a combined there was no significant weight loss in treated groups versus population of >500 million people (Heymann, Control of control (FIG. 10A). Communicable Disease Manual, Ammercian Public Health 0219. Following the success of the mouse study, Ad5 Association, Washington, D.C., 2008). While an effective IFNC. was tested in a Guinea Pig (GP) model of Ebola virus, vaccine is available, immunization coverage is variable, rang Zaire strain (ZEBOV). The GP model more closely mimics ing from 30-95% in Africa. No approved treatment exists. the pathophysiology of the disease in humans, and the ani 0214 Hamsters were injected (15-20/group) intraperito mals are more Susceptible to challenge, thus making it a more neally (IP) with 0.1 ml of the diluted virus (10 CCIDs/ difficult model to achieve positive results. Eight Hartley animal). Ad5-IFNC. was administered by IN instillation at guinea pigs were challenged by IP injection with 100xLDso doses of 1x10, 5x107, 5x10, or 5x10 1.25x10 PFU/ani of guinea pig-adapted ZEBOV. 30 minutes later two animals mal one time at -4 h. Mortality was observed daily for 21 were dosed IN with 2x10 PFUAd5-IFNC per guinea pig. In days, and weight was recorded on 0, 3, and 6 dpi. Liver tissue addition, recombinant IFN protein was administered to three was taken at necropsy from 5 animals from each group for GPs daily for six days to assess the therapeutic potential of the virus titration on 4 dpi. In a second study, animals were protein alone, while three animals were untreated and served administered 5x107 PFU INAd5-IFNC. at-4 hr, or +1, +2 or as a negative control group. All of the animals treated with +3 days post infection (dpi) using the same controls as in the Ad5-IFNC. Survived, compared to 66% in the interferon pro previous experiment. tein group, whereas all the control animals perished (FIG. 0215 Complete protection of hamsters was observed at 10B). the top two doses of 1x10 pfu and 5x107 pfu of Ad5-IFNC. (FIG.9A). A dose response was seen with increasing mortal Example 13 ity occurring at lower doses, although survival was signifi cantly improved in these groups over controls as well as a Prophylaxis for Pichinde Virus (Family: delay in the mortality curve. Overall, all of the Ad5-IFNC. Arenaviridae) doses offered significant protection as compared with the 0220 Arenaviruses produce an acute viral illness which empty adenovirus vector control with efficacy similar to or progresses in 20% of patients to severe multisystem disease greater than that of the positive control. Using a dose of 5x107 with hospitalized case fatality rate up to 15%. The disease is PFU of Ad5-IFNC. complete survival was seen with treatment severe in pregnancy with fetal loss rates approaching 80% and at +1 d and 90% survival at +2 dpi (FIG.9B). associated frequent maternal death. Arenaviruses are sero logically divided into Old World (e.g. Lassa fever) and New Example 12 World (e.g. Machupo or Junin). Lassa fever has had the great est impact on public health by hemorrhagic fever, with more Treatment of Ebola Virus (Family: Filoviridae) than 100,000 endemic infections in West Africa and 5,000 deaths annually (Fischer-Hochet al., J. Virol. 74.6777-6783, 0216 Ebola hemorrhagic fever was first recognized in 2000). The mode of transmission is through aerosol or direct 1976 in two simultaneous outbreaks in Sudan and Zaire contact with contaminated rodent excreta or via person-to which affected >600 people with case fatality rates of 55% person by pharyngeal Secretions, semen or urine. and 90% respectively. Person-to-person contact does occur 0221) Arenaviruses are considered a Category Abioterror through direct contact with blood, secretions, organs, or ism agent by the CDC(CDC, 2010, supra) and a priority semen from infected humans. Nosocomial infections are fre public health biological weapons threat (PHEMCE, 2007, quent, and virtually all persons infected from contaminated Supra). Such agents pose a risk to national security because needles died. Despite extensive study, the natural animal res they can be easily disseminated or transmitted from person to ervoir for Ebola remains unknown. There are no approved person; result in high mortality rates and have the potential for vaccines or effective treatments for Filovirus infections (Hey major public health impact and require special action for mann, Control of Communicable Disease Manual, Ammer public health preparedness. Pichinde virus (PCV) is a New cian Public Health Association, Washington, D.C., 2008). World Arenavirus that is highly pathogenic in hamsters but is 0217 Ebola virus is considered a Category Abioterrorism non-pathogenic in humans (Buchmeier et al., Infect. Immun. agent by the CDC(CDC, 2010, supra) and top priority public 9:821-823, 1974). PCV infection in hamsters is a well char health biological threat (PHEMCE, Public Health Emergency acterized animal model that produces a fulminating disease Medical Countermeasures Enterprise, Health & Human Ser that ends in terminal shock via vascular leakage syndrome vices, Washington D.C., 2007). Such agents pose a risk to with high systemic viral titers. The distribution of viral anti national security because they can be easily disseminated or gens within the infected host (Connolly et al., A.J. Trop. Med. transmitted from person to person; result in high mortality Hyg. 4: 10-24, 1993) mimics the disease manifestations US 2013/03 15952 A1 Nov. 28, 2013 28 reported in human Arenavirus cases (Walker et al., Am. J. tion 30 minutes after a 1000LD50 challenge with ZEBOV. Path. 107:349-356, 1982) but can be utilized safely under These combined treatments resulted in 100% survival of the BSL-2 conditions (Gowen and Holbrook, Antiviral Res. animals (FIG. 12). Ad5-IFNC. alone was able to save 50% of 78:79-90, 2007). the challenged animals and the vaccine alone was only able to 0222 Ad5-IFNC was tested in a hamster model of save 30% in a model with /10" the challenge. Thus, the two Pichinde virus infection. One day prior to challenge, groups components work synergistically to save animals that each of 10 animals were dosed via the IN route (200 ul) with a component could not save separately from challenge with single dose of either: 10, 107, or 10 PFU Ad5-IFNC per Ebola. hamster. Animals were challenged by intraperitoneal (IP) 0227 Given this data, Ad5-IFNC. has tremendous poten injection with LDs of the hamster-adapted PCV. Control tial to serve as a vaccine adjuvant for a wide range of vaccines, mice were dosed IN with phosphate buffered saline (PBS) thereby speeding the time to protection in either a prophylac (100 ul per nostril). Complete survival benefit was seen with tic or treatment model. administration of Ad5-IFNC. at the highest dose, with a dose dependent decline in survival seen at lower levels (FIG. 11). Example 15 Example 14 Vaccine Stability 0228. We have developed a rugged, shelf stable formula Treatment with a Combination “Instant Acting tion of the combination therapy, Ad5-IFNC.+Ad-CA Vaccine” for Ebola (Family: Filovirus) GoptZGP Our preliminary data illustrates Ad5 vector stabil 0223) Ad5-IFNC. Administered in Conjuction with a Vac ity with no appreciable loss in activity at 37°C. for 84 days, cine and at 100° C. for at least an hour (ASM 2010). 0224. Vaccines have been a cornerstone for effective infectious disease prevention since Jenner in 1796. Vaccines Example 16 are cost-effective, easily administered, generally safe and long lasting. However, when facing bioweapons threats, broad Safety Data nation-wide vaccine campaigns have met with considerable 0229. There is a wealth of clinical data showing that the opposition. The bias against vaccination arises from the pub Ad5 vector system and recombinant human IFN, separately, lic's balancing of the risk from a low-probability bioweapons are safe (including when administered using multiple repeat threats vs the certainty of adverse vaccine effects in a few dosing). In addition, Ad-CAGoptZGP alone has been used patients. Indeed, even the Smallpox vaccination campaign successfully to treat a suspected Ebola infection of a lab which boasted the first and only infectious disease ever irradi worker in Germany. The patient experienced a fever and cated, was discontinued some 30 years ago despite Presiden headache commonly associated with antiviral vaccines, but tial Support for police and healthcare worker vaccination. A made a full recovery. second public health issue is the time delay. Vaccines work 0230. The doses of Ad5-IFNC+Ad-CAGoptZGP as evalu slowly—often requiring 7 to 21 days—for a vaccination and ated in the mouse and guinea pig ZEBOV models discussed boosters to achieve protection. This time delay has lethal above demonstrate safety at even the highest expected doses. consequences for most pathogenic viral bioweapon infec Our experience to date indicates Superior efficacy even at tions. As such, current public health vaccination strategies lower doses of Ad5-IFNC. (as low /1000th) used in animal and stockpiles are directed toward disease mitigation and models of other diseases (e.g. Punta Toro, WEE, and SARS). prevention of secondary infection and disease spread. This result, coupled with the synergistic relationship of the 2 Infected individuals at ground Zero receive only Supportive components (Ad5-IFNC.+Ad-CAGoptZGP) indicates that a care. We propose the use of Ad5-IFNC. AND a vaccine to lower dose should be substantially effective against infection radically change this disease management paradigm to by a pathogen, Such as, e.g., an Ebola infection. include treatment AND prophylaxis. Further, existing vac 0231. To date, more than 60 clinical trials have been con cine stockpiles can now be repurposed and utilized as part of ducted with Ad5 as the gene delivery vector, thus providing a an “instant acting vaccine'. solid toxicology framework for Ad5-IFNC-containing com 0225. It is clear that Ad5-IFNC. can act as a both a prophy positions of the invention (including, e.g., the combination of lactic and a treatment. In this example, we combine Ad5 Ad5-IFNC. and Ad-CAGoptZGP). For example, in humans a IFNC.-acting as a type of adjuvant—with a standard vaccine dosage in the range of 1.0x10 to 1.0x10' (e.g., 1.6x10 to form an “Instant Acting Vaccine”. The benefits of this PFU) for a 70kg person for the combination of Ad5-IFNC. and approach are significant. Ad5-IFNC. functions as an immune Ad-CAGoptZGP is expected to provide therapeutic and pro system stimulant, with the following benefits; a) administra phylactic benefit against challenge or exposure to a pathogen tion of Ad5-IFNC. with a vaccine can protect the host against (e.g., a viral agent). In our animal model studies, we have the viral insult until the vaccine is functional and b) Ad5 tested the combination of Ad5-IFNC. and Ad-CAGoptZGP at IFNC. can stimulate the immune system to respond to the a viral particle (vp) to PFU ratio of 10:1 with success. For vaccine faster or more vigorously and thus establish protec example, with regard to a viral particle (vp) to PFU ratio of tive antibody levels faster. 50:1, which is expected to be at the higher end of the admin 0226. In the case of Ebola, we administered an Ad5-IFNC. istration spectrum, the dose will be 8x10" vp. in conjuction with an Ad5 vectored Ebola glycoprotein vac 0232 Safety of Replication Defective Ad5 Vectors cine (Ad-CAGoptZGP; vaccine described Richardson et al. 0233. The safety of replication defective Ad5 vectors has 2009, supra: Croyle et al, PLoS 3:1-9, 2008) to demonstrate been confirmed during a dose escalation study involving 12 the method and benefit of the instant acting vaccine. Six patients where the Ad5 was delivered intranasally (2x10'-2x Guinea pigs were administered the vaccine (10 or 10' infec 10' PFU/patient; see Knowles et al., N.E. J. Med. 333:823 tious units) with Ad5-IFNC (2x10 PFU) via IN administra 831, 1995). At the highest dose, adverse effects were deemed US 2013/03 15952 A1 Nov. 28, 2013 29 moderate (ear ache and mucosal sensitivity) and were 206-213, 2007). Again, this comparison illustrates that our resolved within three weeks. More recently, a pilot Phase I maximum expected dose produces a serum IFN level that is safety study noted dose limiting toxicology at 2x10" vp, with consistent with those found in patients undergoing antiviral repeated doses of the Ad5 vector being well tolerated (see therapy. Keedy et al., J. Clin. Oncol. 26:4166-4171, 2008). The NIH Recombinant DNA Advisory Committee (NIH Report, Hum. Other Embodiments Gene Ther. 13:3-13, 2002) reports the upper safe limit before toxicology of replication defective Ad5 vectors as 7x10" vp. 0236 While the invention has been described in connec Using these studies as precedents, we expect the effective tion with specific embodiments thereof, it will be understood dose of a combination therapy, such as Ad5-IFNC. and Ad that it is capable of further modifications and this application CAGoptZGP, would be at least 1-2 orders of magnitude lower is intended to cover any variations, uses, or adaptations of the than the low safe dose threshold for Ad5 administration. invention following, in general, the principles of the invention 0234 Safety of Interferons and including Such departures from the present disclosure 0235 Interferons are safely used clinically to treat Hepa that come within known or customary practice within the art titis C and SARS, where the high dose side effects can be flu to which the invention pertains and may be applied to the like symptoms such as increased body temperature, head essential features hereinbefore set forth. ache, muscle pain, convulsion, and dizziness. In some cases 0237 All publications and patent applications mentioned hair thinning and depression has also been observed. In cases in this specification are herein incorporated by reference to of high risk melanoma the maximum tolerated dose was used the same extent as if each independent publication or patent (4.5x10U/kg) daily for one month (see Jonasch et al., Can application was specifically and individually indicated as cer J. 6:1390145, 2000), followed by a half dose three times a being incorporated by reference in their entirety. Also incor week for 48 weeks. The resultant level of IFN in the blood porated by reference is PCT/CA2010/000844, entitled stream for 12 hours post injection can be extrapolated as ADMINISTRATION OF INTERFERON FOR PROPHY approximately 230 U/mL (see Cantell et al., J. Gen. Virol. LAXIS AGAINST OR TREATMENT OF PATHOGENIC 22:453-455, 1974). The level of serum IFN measured in our INFECTION,” which was filed on Jun. 9, 2010, naming Jef mouse model was 250 U/mL (see Wu et al., Virology 369: frey D. Turner and Jane E. Ennis as inventors. APPENDIX Interferon Alpha 1b - IFNA1 Nucleotide: NCBI Reference Sequence: NM 024013. 1 Homo sapiens (SEQ ID NO: 1) agalacctaga gcc caaggitt cagagt cacc Catct cagca agcc.ca.gaag tatctgcaat 61 atctacgatg gcct cocct ttgctttact gatggtcCtg gtggtgctica gctgcaagtic 121 aagctgct ct ctgggctgtg at CtcCctga gacccacagc ctggatalaca ggaggacctt 181 gatgct cotg gcacaaatga gcagaatc to tcc titcc toc tdtctgatgg acaga catga 241 Ctttggattt CCC caggagg agtttgatgg caaccagttc Cagaaggct C Cagc.cat ct c 301 tdtcct coat gagctgat co agcagat citt caacct ctitt accacaaaag attcatctgc 361 tottgggat gaggacct Co tagacaaatt Ctgcaccgala Ctctaccagc agctgaatga 421 Cttggaagcc ttgttgatgc aggaggagag ggtgggagaa act cocctga tigaatgcgga 481 ctic catcttg gctgtgaaga aatact tccg aagaat cact ct citatctga cagagaagaa 541 atacagcc ct tdtgcc tiggg aggttgtcag agcagaaatc atgagat coc tot ctittatc 6O1 aacaaacttg Caagaaagat taaggaggaa ggaataa.cat Ctggit coaac atgaaaacaa 661 ttct tattga ct catacacic agg to acgct tt catgaatt ctdt catttic aaagact ct c 721 accc.ctgcta taactatogac catgctgata aactgattta t ct atttaaa tatttattta 781 actatt cata agatttaa at tattitttgtt catataacgt catgtgcacc titt acactgt 841 gottagtgta ataaaacatgttc ctitat at titactic Amino Acid : NCBI Reference Sequence: NP 076918. 1 Homo sapiens (SEQ ID NO: 2) maspfallmv livvlsckssc slgcdlpeth sldnrirtlml laqms risps sclmdrhdfg 61 fpqeefdgno folkapais vl heliqqifnl fittkdissaaw dedlldkfict elyqqlindle 121 acvmdeervg etplmnad si lavkkyfirri tlyltekkys pcawev Vrae imir slsilstn 181 ligerlrirke Interferon Alpha 2b-IFNA2 Nucleotide: NCBI Reference Sequence: NM 000605.3 Homo sapiens (SEQ ID NO : 3) 1 gagaacctgg agccta aggt ttaggct cac ccatttcaac Cagtictagda gcatctgcaa. 61 catctacaat ggccttgacc tittgctttac toggtggc cct cotggtgctic agctgcaagt 121 Caagctgctic titgggctgt gatctgcctic aaacccacag cctgggtagc aggaggacct 181 tatgctic ct ggcacagatg aggagaat ct ct ctitttctic ctgcttgaag gacagacatg 241 actittggatt tocc caggag gagtttggca accagttcca aaaggctgaa accatcc ctg 301 toctic catga gatgat coag cagat citt.ca atctott cag cacaaaggac to atctgctg 3 61 cittgggatga gaccct cota gacaa attct acactgaact ctaccagcag ctgaatgacc 421 tigaagcctg tdtgatacag ggggtggggg tacagagac toccctgatg aaggaggact 481 ccattctggc tigtgaggaaa tact tccaaa gaat cactict citatctgaaa gagaagaaat 541 acagoc ctitg tdoctdggag gttgtcagag cagaaat cat gagat cittitt totttgtcaa 601 caaacttgca agaaagttta agaagtaagg aatgaaaact ggttcaa.cat ggaaatgatt 661 tt cattgatt cqtatgccag ct caccittitt tatgatctgc catttcaaag act catgttt 721 ctgctatogac catgacacga tittaaatc.tt ttcaaatgtt tttaggagta ttaatcaa.ca 781 ttg tatt cag ct cittaaggc act agtcc ct tacagaggac catgctgact gatcc attat 841 ctatttaaat atttittaaaa tattattt at ttalactattt ataaaacaac ttattitttgt

US 2013/03 15952 A1 Nov. 28, 2013 32

- Continued

&211s LENGTH: 189 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 2 Met Ala Ser Pro Phe Ala Lieu. Leu Met Val Lieu Val Val Lieu. Ser Cys 1. 5 1O 15 Llys Ser Ser Cys Ser Lieu. Gly Cys Asp Lieu Pro Glu Thir His Ser Lieu. 2O 25 3O Asp Asn Arg Arg Thr Lieu Met Lieu. Lieu Ala Glin Met Ser Arg Ile Ser 35 4 O 45 Pro Ser Ser Cys Lieu Met Asp Arg His Asp Phe Gly Phe Pro Glin Glu SO 55 6 O Glu Phe Asp Gly Asn Glin Phe Glin Lys Ala Pro Ala Ile Ser Val Lieu. 65 70 7s 8O His Glu Lieu. Ile Glin Glin Ile Phe Asn Lieu. Phe Thr Thr Lys Asp Ser 85 90 95 Ser Ala Ala Trp Asp Glu Asp Lieu. Lieu. Asp Llys Phe Cys Thr Glu Lieu. 1OO 105 11 O Tyr Glin Glin Lieu. Asn Asp Lieu. Glu Ala Cys Wal Met Glin Glu Glu Arg 115 12 O 125 Val Gly Glu Thr Pro Lieu Met Asn Ala Asp Ser Ile Lieu Ala Wall Lys 13 O 135 14 O Llys Tyr Phe Arg Arg Ile Thr Lieu. Tyr Lieu. Thr Glu, Llys Llys Tyr Ser 145 150 155 160 Pro Cys Ala Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser Lieu. Ser 1.65 17O 17s Lieu. Ser Thr Asn Lieu. Glin Glu Arg Lieu. Arg Arg Lys Glu 18O 185

<210s, SEQ ID NO 3 &211s LENGTH: 1143 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 3 gaga acctgg agcctalaggt ttaggct cac ccatttcaac Cagtictago a gcatctgcaa. 6 O catctacaat ggccttgacc tittgctttac tdgtggc cct c ct ggtgctic agctgcaagt 12 O Caagctgctic ttgggctgt gatctgcctic aaacccacag cctgggtagc aggaggacct 18O tgatgctic ct ggcacagatg aggagaatct Ctcttittctic ctgcttgaag gacagacatg 24 O actittggatt tocc Caggag gagtttggca accagttcca aaaggctgaa accatcCctg 3OO t cct coatga gatgat coag cagat citt.ca atctgttcag cacaaaggac to atctgctg 360 cittgggatga gaccct cota gacaa attct acactgaact citaccagcag ctgaatgacc 42O tggaagcctg ttgatacag ggggtggggg tacagagac toccctgatg aaggaggact 48O c cattctggc tigtgaggaaa tact tccaaa gaat cactict citatctgaaa gagaagaaat 54 O acagcc ctitg tdoctggag gttgtcagag cagaaat cat gagat Cttitt totttgtcaa 6OO caaacttgca agaaagttta agaagitalagg aatgaaaact ggttcaa.cat ggaaatgatt 660 tt cattgatt cqtatgccag ct caccittitt tatgatctgc catttcaaag act catgttt 72 O ctgctatogac catgacacga tittaaatctt ttcaaatgtt tittaggagta ttaatcaa.ca 78O ttgt attcag ct cittaaggc act agt ccct tacagaggac catgctgact gatcc attat 84 O US 2013/03 15952 A1 Nov. 28, 2013 33

- Continued ctatttaaat atttittaaaa tattattt at ttalactattt ataaaacaac ttattitttgt 9 OO t cat attatgtcatgtgcac ctittgcacag tdgittaatgt aataaaatat gttctttgta 96.O tittggtaaat ttattttgtg ttgttcattgaacttittgct atggaaactt ttgtacttgt 1 O2O ttatt ctitta aaatgaaatt coaa.gc.ctaa ttgtgcaa.cc tdattacaga ataactggta 108 O cactitcattt atc cat caat attatatt ca agatataagt aaaaataaac tittctgtaaa 114 O

C Ca 1143

<210s, SEQ ID NO 4 &211s LENGTH: 166 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 4 Met Cys Asp Lieu Pro Glin Thr His Ser Lieu. Gly Ser Arg Arg Thr Lieu. 1. 5 1O 15 Met Lieu. Lieu Ala Glin Met Arg Arg Ile Ser Lieu. Phe Ser Cys Lieu Lys 2O 25 3O Asp Arg His Asp Phe Gly Phe Pro Glin Glu Glu Phe Gly Asn Glin Phe 35 4 O 45 Gln Lys Ala Glu Thir Ile Pro Val Lieu. His Glu Met Ile Glin Glin Ile SO 55 6 O Phe ASn Lieu. Phe Ser Thr Lys Asp Ser Ser Ala Ala Trp Asp Glu. Thr 65 70 7s 8O Lieu. Lieu. Asp Llys Phe Tyr Thr Glu Lieu. Tyr Glin Glin Lieu. Asn Asp Lieu. 85 90 95 Glu Ala Cys Val Ile Glin Gly Val Gly Val Thr Glu Thr Pro Leu Met 1OO 105 11 O Lys Glu Asp Ser Ile Lieu Ala Val Arg Llys Tyr Phe Glin Arg Ile Thr 115 12 O 125 Lieu. Tyr Lieu Lys Glu Lys Llys Tyr Ser Pro Cys Ala Trp Glu Val Val 13 O 135 14 O Arg Ala Glu Ile Met Arg Ser Phe Ser Lieu. Ser Thr Asn Lieu. Glin Glu 145 150 155 160 Ser Lieu. Arg Ser Lys Glu 1.65

<210s, SEQ ID NO 5 &211s LENGTH: 84 O &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 5 acattctaac togcaac ctitt cqaagcctitt gctctggcac aac agg tagt aggcgacact 6 O gttcgtgttgtcaiacatgac caacaagtgt citcct coaaa ttgct ct colt gttgttgcttic 12 O tccact acag ct ctitt coat gagctacaac ttgcttggat tcc tacaaag aag cagdaat 18O titt Cagtgtc. agaagctic ct gtggcaattgaatgggaggc titgaatact.g. cct Caaggac 24 O aggatgaact ttgacatc.cc taggagatt aag cagotgc agcagttcca gaaggaggac 3OO gcc.gcattga ccatctatga gatgct coag alacat ctittg ctattitt cag acaagattica 360 tctago actg gctggaatga gactattgtt gagaacct Co totaatgt Citat cat cag 42O ataaac catc talagacagt cctggaagaa aaactggaga aagaagattt Caccagggga 48O US 2013/03 15952 A1 Nov. 28, 2013 34

- Continued aaact catga gcagtctgca Cctgaaaaga tatt atggga ggattctgca ttacctgaag 54 O gccalaggagt acagt cactg. tcctggacc at agt cagag tigaaatcct aaggaactitt 6OO tact tcatta acagacittac aggttacctic cqaaactgaa gat ct cotag cctdtgcctic 660 tgggactgga caattgct tc aag cattctt Calaccagcag atgctgttta agtgactgat 72 O ggctaatgta citgcatatga aagga cacta gaagattittgaaatttittat taaattatga 78O gttatttitta tittatttaaa titt tattittg gaaaataaat tatttittggit gcaaaagttca 84 O

<210s, SEQ ID NO 6 &211s LENGTH: 1.87 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 6 Met Thr Asn Lys Cys Lieu. Lieu. Glin Ile Ala Lieu Lleu Lieu. Cys Phe Ser 1. 5 1O 15 Thir Thr Ala Leu Ser Met Ser Tyr Asn Lieu. Leu Gly Phe Leu Glin Arg 2O 25 3O Ser Ser Asn. Phe Glin Cys Glin Llys Lieu. Lieu. Trp Glin Lieu. Asn Gly Arg 35 4 O 45 Lieu. Glu Tyr Cys Lieu Lys Asp Arg Met Asn. Phe Asp Ile Pro Glu Glu SO 55 6 O Ile Lys Gln Lieu. Glin Glin Phe Gln Lys Glu Asp Ala Ala Lieu. Thir Ile 65 70 7s 8O Tyr Glu Met Leu Glin Asn Ile Phe Ala Ile Phe Arg Glin Asp Ser Ser 85 90 95 Ser Thr Gly Trp Asn. Glu Thir Ile Val Glu Asn Lieu. Lieu Ala Asn. Wall 1OO 105 11 O Tyr His Glin Ile Asn His Lieu Lys Thr Val Lieu. Glu Glu Lys Lieu. Glu 115 12 O 125 Lys Glu Asp Phe Thr Arg Gly Lys Lieu Met Ser Ser Lieu. His Lieu Lys 13 O 135 14 O Arg Tyr Tyr Gly Arg Ile Lieu. His Tyr Lieu Lys Ala Lys Glu Tyr Ser 145 150 155 160 His Cys Ala Trp Thir Ile Val Arg Val Glu Ile Lieu. Arg Asin Phe Tyr 1.65 17O 17s Phe Ile Asn Arg Lieu. Thr Gly Tyr Lieu. Arg Asn 18O 185

<210s, SEQ ID NO 7 &211s LENGTH: 124 O &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OO > SEQUENCE: 7 cacattgttctgat catctgaagat cagct attagaagag aaagat cagt taagt cctitt 6 O ggacct gatc agcttgatac aagaactact gatttcaact tctittggctt aattct citcg 12 O gaaacgatga aatatacaag titatat cittg gcttitt cago totgcatcgt tittgggttct 18O cittggctgtt act gcc agga cccatatgta aaagaagicag aaaac cittaa gaaat attitt 24 O aatgcagg to attcagatgt agcggataat ggaact ctitt tottagg cat tittgaagaat 3OO tggaaagagg agagtgacag aaaaataatg cagagccaaa ttgtc. tcct t t tact tcaaa 360 US 2013/03 15952 A1 Nov. 28, 2013 35

- Continued Ctttittaaaa actittaaaga tigaccagagc atccaaaaga gtgtggagac Cat Caaggaa 42O gacatgaatgtcaagtttitt Caatagdaac aaaaagaaac gagatgactt Caaaagctg 48O actaattatt cqgtaactga cittgaatgtc. caacgcaaag caatacatga act catccaa 54 O gtgatggctgaactgtc.gcc agcagctaala acagggaagc gaaaaaggag ticagatgctg 6OO titt.cgagg to gaagagcatc ccagtaatgg ttgtc.ctgcc togcaatattt gaattittaaa 660 tctaaatcta titt attaata tittaa catta tittatatggg gaatatattt ttagact cat 72 O caatcaaata agtatttata at agdaactt ttgtgtaatgaaaatgaata t ct attaata 78O tatgtatt at ttataatticc tatat cotgt gactgtc. tca cittaatcctt tdttittctga 84 O Ctaattaggc aaggctatgt gattacaagg Ctttatct ca ggggccaact aggcagccala 9 OO cctaagcaag atcc catggg ttgttgttgttt attt cacttig atgatacaat gaacactitat 96.O aagtgaagtg atact atcca gtt actgc.cg gtttgaaaat atgcctgcaa tictgagc.ca.g 1 O2O tgctittaatg gcatgtcaga Cagaacttga atgtgtcagg taccCtgat gaaaacatag 108 O catcto agga gattt catgc ctdgtgctitc caaat attgt togacaactgt gactgtaccc 114 O aaatggaaag taact cattt gttaaaatta t caataticta atatatatga ataaagtgta 12 OO agttcacaac aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 124 O

<210s, SEQ ID NO 8 &211s LENGTH: 166 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 8 Met Lys Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Lieu. Cys Ile Val Lieu. 1. 5 1O 15 Gly Ser Lieu. Gly Cys Tyr Cys Glin Asp Pro Tyr Val Lys Glu Ala Glu 2O 25 3O Asn Lieu Lys Llys Tyr Phe Asn Ala Gly His Ser Asp Wall Ala Asp Asn 35 4 O 45 Gly. Thir Lieu. Phe Lieu. Gly Ile Lieu Lys Asn Trp Llys Glu Glu Ser Asp SO 55 6 O Arg Lys Ile Met Glin Ser Glin Ile Val Ser Phe Tyr Phe Llys Lieu. Phe 65 70 7s 8O Lys Asn. Phe Lys Asp Asp Glin Ser Ile Glin Llys Ser Val Glu Thir Ile 85 90 95 Lys Glu Asp Met Asn Val Llys Phe Phe Asn. Ser Asn Llys Llys Lys Arg 1OO 105 11 O Asp Asp Phe Glu Lys Lieu. Thir Asn Tyr Ser Val Thr Asp Lieu. Asn Val 115 12 O 125 Glin Arg Lys Ala Ile His Glu Lieu. Ile Glin Val Met Ala Glu Lieu. Ser 13 O 135 14 O Pro Ala Ala Lys Thr Gly Lys Arg Lys Arg Ser Glin Met Lieu. Phe Arg 145 150 155 160 Gly Arg Arg Ala Ser Glin 1.65

<210s, SEQ ID NO 9 &211s LENGTH: 1033 &212s. TYPE: DNA &213s ORGANISM: Bos taurus US 2013/03 15952 A1 Nov. 28, 2013 36

- Continued <4 OOs, SEQUENCE: 9 gatcc.ccgga aactagaatt cacctgaagg ttcacccaga ccc catcto a gcc agcc cag 6 O cago agccac atctitc.ccca toggcc titcgt gct ct ct cta citgatggc.cc tdgtgctggit 12 O CagctacggC Cagggacgat Ctctgggttgttacctgtct gaggaccaca totaggtgc 18O cagggagaac ct caggct co toggc.ccgaat gaacagactic tict cotcatc cctdtctgca 24 O ggacagaaaa gactittggtc titcct cagga gatggtggag ggcaiaccagc ticcagaagga 3OO t caggctato tctgtgct co acgagatgct c cagoagtgc ct caacct ct tctacacaga 360 gcacticgt.ct gctgcctgga acaccaccCt c Ctggagcag Ctctgcactg ggctic caa.ca 42O gcagctggag gacctggacg cct gcctggg CCC agtgatg ggagagaaag actctgaCat 48O gggaaggatg ggc.cccattctgactgttgaa gaagtacttic Cagggitatcc atgtctacct 54 O gaaagaaaaa gaatacagtg actg.cgc.ctg ggaaatcatC agagtggaga tigatgagagc 6OO cct ct citt catcaiaccacct togcaaaaaag gttaagaaag atgggtggag atctgaactic 660 actittgagat gactict cqct gactalagatg cca catcacc titcgtacact cacctgttgtt 72 O cattt cagaa gacitctgatt totgcttcag ccaccgaaat cattgaatta ctittaactga 78O tactttgtca gcagtaataa gCaagtagat ataaaagtact cagctgtag gggcatgagt 84 O ccittaagtga tigcctg.ccct gatgttatct gttgttgatt tatgt attcc ttcttgcatc 9 OO taac at actt aaaat attag gaaatttgta aagttacatt to atttgtac atct attaaa 96.O atttctaaaa catgtttacc attttgttgtt attaaatttg tcc tttgttc tattt attaa 1 O2O atcaaagaaa atc 1033

<210s, SEQ ID NO 10 &211s LENGTH: 166 212. TYPE: PRT &213s ORGANISM: Bos taurus

<4 OOs, SEQUENCE: 10 Met Lys Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Lieu. Cys Ile Val Lieu. 1. 5 1O 15 Gly Ser Lieu. Gly Cys Tyr Cys Glin Asp Pro Tyr Val Lys Glu Ala Glu 2O 25 3O Asn Lieu Lys Llys Tyr Phe Asn Ala Gly His Ser Asp Wall Ala Asp Asn 35 4 O 45 Gly. Thir Lieu. Phe Lieu. Gly Ile Lieu Lys Asn Trp Llys Glu Glu Ser Asp SO 55 6 O Arg Lys Ile Met Glin Ser Glin Ile Val Ser Phe Tyr Phe Llys Lieu. Phe 65 70 7s 8O Lys Asn. Phe Lys Asp Asp Glin Ser Ile Glin Llys Ser Val Glu Thir Ile 85 90 95 Lys Glu Asp Met Asn Val Llys Phe Phe Asn. Ser Asn Llys Llys Lys Arg 1OO 105 11 O Asp Asp Phe Glu Lys Lieu. Thir Asn Tyr Ser Val Thr Asp Lieu. Asn Val 115 12 O 125 Glin Arg Lys Ala Ile His Glu Lieu. Ile Glin Val Met Ala Glu Lieu. Ser 13 O 135 14 O Pro Ala Ala Lys Thr Gly Lys Arg Lys Arg Ser Glin Met Lieu. Phe Arg 145 150 155 160

Gly Arg Arg Ala Ser Glin US 2013/03 15952 A1 Nov. 28, 2013 37

- Continued

1.65

SEQ ID NO 11 LENGTH: 166 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Construct <4 OOs, SEQUENCE: 11

Cys Asp Lieu Pro Glin Thir His Ser Lieu. Gly ASn Arg Arg Ala Lieu. Ile 1. 5 1O 15

Lieu. Luell Ala Glin Met Arg Arg Ile Ser Pro Phe Ser Luell Asp 25

Arg His Asp Phe Gly Phe Pro Glin Glu Glu Phe Asp Gly Asn Glin Phe 35 4 O 45

Glin Lys Ala Glin Ala Ile Ser Wall Lieu. His Glu Met Ile Glin Glin Arg SO 55 6 O

Phe Asn Luell Phe Ser Thir Asp Ser Ser Ala Ala Trp Asp Glu Ser 65 70 7s

Lieu. Luell Glu Phe Tyr Thr Glu Lieu. Tyr Glin Gln Leu Asn Asp Lieu. 85 90 95

Glu Ala Wall Ile Glin Glu Val Gly Val Glu Glu Thr Pro Luell Met 105 11 O

Asn Wall Asp Ser Ile Lell Ala Wall Lys Lys Phe Glin Arg Ile Thr 115 12 O 125

Lieu. Tyr Lieu. Thr Glu Lys Tyr Ser Pro Ala Trp Glu Wall Wall 13 O 135 14 O

Arg Ala Glu Ilie Met Arg Ser Phe Ser Luell Ser Thir Asn Luell Glin Glu 145 150 155 160 Arg Lieu. Arg Arg Lys Glu 1.65

What is claimed is: selected from an SV40 promoter, CMV promoter, adenovirus 1. A composition comprising a vector comprising a nucleic early and late promoter, metallothioneine gene (MT-1) pro acid molecule encoding an interferon (IFN), wherein said moter, Rous sarcoma virus (RSV) promoter, and human composition is formulated as: Ubiquitine C (UbC) promoter. a) a dry, lyophilized powder, gel, or liquid, wherein said 9. The composition of claim 1, wherein said vector further composition is stable at room temperature for at least comprises one or more of a signal sequence, a polyadenyla one week; or tion sequence, and enhancer, an upstream activation b) a frozen, non-stabilized liquid, wherein said composi sequence, and a transcription termination factor that facili tion, once thawed, is stable at room temperature for at tates expression of said nucleic acid molecule encoding said least 24 hours. interferon. 2. The composition of claim 1, wherein said interferon is 10. The composition of claim 3, wherein said conIFN-C. IFN-alpha (IFN-C). encoded by said nucleic acid molecule has a polypeptide 3. The composition of claim 2, wherein said IFN-Cl is sequence comprising the sequence set forth in SEQID NO: consensus IFN-C (conIFN-O.). 11. 4. The composition of claim 1, wherein said vector is a viral 11. The composition of claim 1, wherein said composition or non-viral vector. further comprises a pharmaceutically acceptable excipient 5. The composition of claim 4, wherein said viral vector is selected from one or more of fructose, maltose, galactose, an adenoviral vector. glucose, D-mannose, Sorbose, lactose, Sucrose, trehalose, cel 6. The composition of claim 5, wherein said adenoviral lobiose, raffinose, melezitose, maltodextrins, dextrans, vector is an adenoviral 5 (Ad5) vector. starches, mannitol. Xylitol. Xylose, maltitol, lactitol. Xylitol 7. The composition of claim 6, wherein said Ad5 vector is Sorbitol, Sorbitose, pyranosyl Sorbitol, myoinositol, glycine, a replication deficient vector that comprises deletions of the CaCl2, hydroxyectoine, ectoine, gelatin, di-myo-inositol E1 and E3 genes. phosphate (DIP), cyclic 2.3 diphosphoglycerate (cDPG), 1,1- 8. The composition of claim 1, wherein said nucleic acid di-glycerol phosphate (DGP), B-mannosylglycerate (firoin), molecule of said vector is operably linked to a promoter B-mannosylglyceramide (firoin A), and proline betaine. US 2013/03 15952 A1 Nov. 28, 2013

12. The composition of claim 1, wherein said composition iv) said parasite is selected from Toxoplasma gondii, Plas is formulated for aerosolized delivery. modium falciparum, P. vivax, P ovale, P. malariae, Try 13. The composition of claim 1, wherein said composition panosoma spp., and Legionella spp. is stable at room temperature for at least one month to at least 27. The method of claim 26, wherein said virus is selected 1 year. from hepatitis C virus, Yellow fever virus, Gadgets Gully 14. The composition of claim 1, wherein said composition virus, Kadam virus, Kyasanur Forest disease virus, Langat is admixed with a pharmaceutically acceptable liquid to form virus, Omsk hemorrhagic fever virus, Powassan virus, Royal said liquid or gel. Farm virus, Karshi virus, tick-borne encephalitis virus, Neu 15. The composition of claim 1, further comprising an doerfl virus, Sofin virus, Louping ill virus, Negishi virus, additional therapeutic agent selected from an anti-viral agent, Meaban virus, Saumarez Reef virus, Tyuleniy virus, Aroa an anti-bacterial agent, an anti-fungal agent, an anti-parasitic virus, dengue virus, Kedougou virus, Cacipacore virus, Kou agent, an immunostimulatory agent, a vaccine, and a chemo tango virus, Japanese encephalitis virus, Murray Valley therapeutic agent. encephalitis virus, St. Louis encephalitis virus, Usutu virus, West Nile virus, Yaounde virus, Kokobera virus, Bagaza 16. The composition of claim 15, wherein said vaccine is virus, Ilheus virus, Israel turkey meningoencephalo-myelitis an Ebola virus vaccine. virus, Ntaya virus, Tembusu virus, Zika virus, Banzi virus, 17. A method for treating or reducing the effects of an Bouboui virus, Edge Hill virus, Jugra virus, Saboya virus, infection, autoimmune disease, or cancer in a Subject in need Sepik virus, Uganda S virus, Wesselsbron virus, yellow fever thereof comprising administering an amount of the composi virus, Entebbe bat virus, Yokose virus, Apoi virus, Cowbone tion of claim 1 to the pulmonary or nasal mucosa of the Ridge virus, Jutiapa virus, Modoc virus, Sal Vieja virus, San Subject one or more times. Perlita virus, Bukalasa bat virus, Carey Island virus, Dakar 18. The method of claim 17, whereinadministration of said bat virus, Montana myotis leukoencephalitis virus, Phnom composition results in expression of said interferon (IFN) in Penh bat virus, Rio Bravo virus, Tamanabat virus, Cell fusing pulmonary or nasal epithelial cells of said mucosa. agent virus, Ippy virus, Lassa virus, lymphocytic choriomen 19. The method of claim 17, wherein said composition ingitis virus (LCMV), Mobala virus, Mopeia virus, Amapari comprises an adenoviral 5 (Ad5) vector encoding said IFN virus, Flexal virus, Guanarito virus, Junin virus, Latino virus, and said method comprises administering said Ad5 vector in Machupo virus, Oliveros virus, Paraná virus, Pichinde virus, an amount in the range of at least about 1x10 to about 1x10' Pirital virus, Sabia virus, Tacaribe virus, Tamiami virus, viral particles per dose. Whitewater Arroyo virus, Chapare virus, Lujo virus, Hantaan 20. The method of claim 17, wherein said IFN is IFN-O. virus, Sin Nombre virus, Dugbe virus, Bunyamwera virus, 21. The method of claim 20, wherein said IFN-Cl is con Rift Valley fever virus, La Crosse virus, Punta Toro virus sensus IFN-C (conIFN-O.). (PTV), California encephalitis virus, Crimean-Congo hem orrhagic fever (CCHF) virus, Ebola virus, Marburg virus, 22. The method of claim 17, wherein said subject receives Venezuelan equine encephalitis virus (VEE), Eastern equine said composition prior to or after exposure to said pathogen or encephalitis virus (EEE), Western equine encephalitis virus diagnosis of said autoimmune disease or cancer. (WEE), Sindbis virus, rubella virus, Semliki Forest virus, 23. The method of claim 22, wherein said subject receives Ross River virus, Barmah Forest virus, Onyongnyong virus, said composition at least 15 minutes to at least 1 week prior to chikungunya virus, Smallpox virus, monkeypox virus, vac exposure to said pathogen. cinia virus, herpes simplex virus (HSV), human herpesvirus, 24. The method of claim 22, wherein said subject receives cytomegalovirus (CMV), Epstein-Barr virus (EBV), Vari said composition immediately after exposure to said patho cella-Zoster virus, Kaposi's sarcoma associated-herpesvirus gen or diagnosis of said autoimmune disease or cancer or at (KSHV), influenza virus, severe acute respiratory syndrome least 15 minutes to at least 48 hours after exposure to said (SARS) virus, rabies virus, vesicular stomatitis virus (VSV), pathogen or diagnosis of said autoimmune disease or cancer. human respiratory syncytial virus (RSV), Newcastle disease 25. The method of claim 17, wherein said pathogen is a virus, hendravirus, nipahvirus, measles virus, rinderpest bacterium, virus, fungus, or parasite. virus, canine distemper virus, Sendai virus, human parainflu 26. The method of claim 25, wherein: enza virus, rhinovirus, mumps virus, coxsackievirus, hepati i) said bacterium is selected from Pseudomonas aerugi tis B virus, human papilloma virus, adeno-associated virus, nosa, Salmonella typhimurium, Escherichia coli, Kleb astrovirus, JC virus, BK virus, SV40 virus, Norwalk virus, siella pneumoniae, Bruscella, Burkholderia mallei, rotavirus, human immunodeficiency virus (HIV), and human Yersinia pestis, and Bacillus anthraci; T-lymphotropic virus (HTLV). ii) said virus is selected from a member of the Flaviviridae, 28. The method of claim 17, wherein said composition is Arenaviridae, Bunyaviridae, Filoviridae. Togaviridae, inhaled as a lyophilized powder. Poxyiridae, Herpesviridae, Orthomyxoviridae, Coro 29. The method of claim 17, wherein said composition is naviridae, Rhabdoviridae, Paramyxoviridae, Picor admixed with a pharmaceutically acceptable liquid and naviridae, Hepadnaviridae, Papillamoviridae, Par inhaled as an aerosolized mist. voviridae, Astroviridae, Polyomaviridae, Calciviridae, 30. The method of claim 29, wherein said pharmaceuti Reoviridae, and the Retroviridae family; cally acceptable liquid is water or saline. iii) said fungus is selected from Aspergillus, Blastomyces 31. The method of claim 17, wherein said subject is a dermatitidis, Candida, Coccidioides immitis, Crypto human. coccus neoformans, Histoplasma capsulatum var. Cap 32. The method of claim 17, wherein said subject is admin sulatum, Paracoccidioides brasiliensis, Sporothrix istered at least 2 doses of said composition. schenckii, Zygomycetes spp., Absidia corymbifera, Rhi 33. The method of claim 17, wherein said composition is ZOmucor pusillus, and Rhizopus arrhizus; or administered as a gel. US 2013/03 15952 A1 Nov. 28, 2013 39

34. The method of claim 17, wherein said method further 40. The device of claim 38, wherein the delivery pump comprises administering an additional therapeutic agent comprises a liquid delivery pump for delivering a metered selected from an anti-viral agent, an anti-bacterial agent, an Volume of said composition in liquid or powder form. anti-fungal agent, an anti-parasitic agent, an immunostimu 41. The device of claim 38, wherein the nozzle is config latory agent, a vaccine, and a chemotherapeutic agent. ured to deliver an aerosol or a jet. 35. The method of claim 34, wherein said vaccine is an 42. A kit comprising Ebola virus vaccine. i) a first container comprising a composition comprising a 36. The method of claim34, wherein said therapeutic agent vector comprising a nucleic acid molecule encoding an is administered separately or concurrently with said compo interferon (IFN), wherein said composition is formu sition. lated as: 37. The method of claim34, wherein said therapeutic agent a) a dry, lyophilized powder, gel, or liquid, wherein said is admixed with said composition. composition is stable at room temperature for at least 38. A device comprising the composition of claim 1, one week; or wherein said device comprises: b) a frozen, non-stabilized liquid, wherein said compo a) a container comprising said composition; sition, once thawed, is stable at room temperature for b) a nozzle for directing said composition to the pulmonary at least 24 hours; or nasal mucosa of a Subject; ii) a second container comprising a pharmaceutically c) a mechanical delivery pump for delivering the compo acceptable liquid; and sition to the nozzle, wherein activation of said pump iii) the device of claim 38 and, optionally, instructions for results in a fluid connection between said nozzle and using the device to deliver the contents of said first said container; and container, or for combining the contents of said first and d) an actuation mechanism for activating said mechanical second containers to form a combined composition and delivery pump. then using the device to deliver the combined composi 39. The device of claim 38, wherein the actuation mecha tion, to a Subject for treating or inhibiting infection by a nism comprises a trigger for actuating the delivery pump at a pathogen. predeterminable pressure or flow rate.