DOCSLIB.ORG

Mouse Mkx Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Mkx Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Mkx Knockout Project (CRISPR/Cas9) Objective: To create a Mkx knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Mkx gene (NCBI Reference Sequence: NM_177595 ; Ensembl: ENSMUSG00000061013 ) is located on Mouse chromosome 18. 7 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 7 (Transcript: ENSMUST00000079788). Exon 2~4 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit thin, hypoplastic tendons with reduced tensile strength. Exon 2 starts from the coding region. Exon 2~4 covers 47.55% of the coding region. The size of effective KO region: ~9846 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 7 Legends Exon of mouse Mkx Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 1998 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 404 bp section downstream of Exon 4 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(1998bp) | A(20.12% 402) | C(25.13% 502) | T(25.48% 509) | G(29.28% 585) Note: The 1998 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(404bp) | A(28.22% 114) | C(18.32% 74) | T(36.39% 147) | G(17.08% 69) Note: The 404 bp section downstream of Exon 4 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 1998 1 1998 1998 100.0% chr18 - 7002545 7004542 1998 browser details YourSeq 101 790 902 1998 94.3% chr10 + 72481976 72482084 109 browser details YourSeq 80 790 870 1998 100.0% chr10 - 77250442 77250526 85 browser details YourSeq 58 790 850 1998 98.4% chr1 + 29180866 29180934 69 browser details YourSeq 55 786 842 1998 98.3% chr2 + 19308266 19308322 57 browser details YourSeq 52 791 842 1998 100.0% chr11 - 46316700 46316751 52 browser details YourSeq 51 789 842 1998 98.2% chr1 + 118723764 118723819 56 browser details YourSeq 50 790 841 1998 98.1% chr10 + 25446216 25446267 52 browser details YourSeq 48 791 838 1998 100.0% chr1 + 133733926 133733973 48 browser details YourSeq 45 798 845 1998 98.0% chr6 + 72192228 72192277 50 browser details YourSeq 32 790 824 1998 97.2% chr1 - 130453610 130453657 48 browser details YourSeq 26 1 47 1998 63.0% chr10 - 22311295 22311321 27 browser details YourSeq 22 1629 1651 1998 100.0% chr10 - 47956145 47956170 26 browser details YourSeq 20 1854 1873 1998 100.0% chr10 + 80992085 80992104 20 Note: The 1998 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 404 1 404 404 100.0% chr18 - 6992374 6992777 404 browser details YourSeq 24 130 156 404 96.3% chr13 + 110097608 110097636 29 browser details YourSeq 23 269 294 404 96.0% chr10 + 76263593 76263627 35 browser details YourSeq 22 11 32 404 100.0% chr4 - 57318906 57318927 22 browser details YourSeq 22 126 147 404 100.0% chr12 - 69803921 69803942 22 browser details YourSeq 20 266 285 404 100.0% chr17 - 23961006 23961025 20 browser details YourSeq 20 277 296 404 100.0% chr15 - 30177566 30177585 20 browser details YourSeq 20 9 30 404 95.5% chr13 + 114965261 114965282 22 Note: The 404 bp section downstream of Exon 4 is BLAT searched against the genome. No significant similarity is found. Page 5 of 8 https://www.alphaknockout.com Gene and protein information: Mkx mohawk homeobox [ Mus musculus (house mouse) ] Gene ID: 210719, updated on 12-Aug-2019 Gene summary Official Symbol Mkx provided by MGI Official Full Name mohawk homeobox provided by MGI Primary source MGI:MGI:2687286 See related Ensembl:ENSMUSG00000061013 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Irxl1; 9430023B20Rik Expression Biased expression in limb E14.5 (RPKM 9.5), cortex adult (RPKM 5.3) and 8 other tissues See more Orthologs human all Genomic context Location: 18 A1; 18 4.53 cM See Mkx in Genome Data Viewer Exon count: 7 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 18 NC_000084.6 (6934966..7004779, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 18 NC_000084.5 (6934964..7004777, complement) Chromosome 18 - NC_000084.6 Page 6 of 8 https://www.alphaknockout.com Transcript information: This gene has 4 transcripts Gene: Mkx ENSMUSG00000061013 Description mohawk homeobox [Source:MGI Symbol;Acc:MGI:2687286] Gene Synonyms 9430023B20Rik, Irxl1 Location Chromosome 18: 6,934,518-7,004,780 reverse strand. GRCm38:CM001011.2 About this gene This gene has 4 transcripts (splice variants), 257 orthologues, 6 paralogues, is a member of 1 Ensembl protein family and is associated with 3 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Mkx-201 ENSMUST00000079788.6 3650 354aa ENSMUSP00000078718.3 Protein coding CCDS37728 B2RQ30 TSL:1 GENCODE basic APPRIS P1 Mkx-202 ENSMUST00000176608.1 722 101aa ENSMUSP00000157351.1 Protein coding - A0A3Q4EH75 CDS 3' incomplete TSL:3 Mkx-204 ENSMUST00000188926.1 684 No protein - Retained intron - - TSL:3 Mkx-203 ENSMUST00000176757.1 425 No protein - Retained intron - - TSL:2 90.26 kb Forward strand 6.94Mb 6.96Mb 6.98Mb 7.00Mb Genes Gm46633-201 >lncRNA (Comprehensive set... Contigs < AC148004.3 Genes (Comprehensive set... < Gm2350-201lncRNA < Mkx-204retained intron < Mkx-202protein coding < Mkx-201protein coding < Mkx-203retained intron Regulatory Build 6.94Mb 6.96Mb 6.98Mb 7.00Mb Reverse strand 90.26 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding RNA gene processed transcript Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000079788 < Mkx-201protein coding Reverse strand 70.26 kb ENSMUSP00000078... MobiDB lite Low complexity (Seg) Superfamily Homeobox-like domain superfamily SMART Homeobox domain Pfam Homeobox KN domain PROSITE profiles Homeobox domain PROSITE patterns Homeobox, conserved site PANTHER PTHR11211:SF3 PTHR11211 Gene3D 1.10.10.60 CDD Homeobox domain All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant stop retained variant Scale bar 0 40 80 120 160 200 240 280 354 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • An Interactive Web Application to Explore Regeneration-Associated Gene Expression and Chromatin Accessibility
    Supplementary Materials Regeneration Rosetta: An interactive web application to explore regeneration-associated gene expression and chromatin accessibility Andrea Rau, Sumona P. Dhara, Ava J. Udvadia, Paul L. Auer 1. Table S1. List of cholesterol metabolic genes from MGI database 2. Table S2. List of differentially expressed transcripts during optic nerve regeneration in zebrafish using the MGI cholesterol metabolic gene queries in the Regeneration Rosetta app 3. Table S3. List of transcription factor encoding genes from brain cell bodies following spinal cord injury in lamprey over a course of 12 weeKs 4. Table S4. List of transcription factor encoding genes from spinal cell bodies following spinal cord injury in lamprey over a course of 12 weeks Ensembl ID MGI Gene ID Symbol Name ENSMUSG00000015243 MGI:99607 Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 ENSMUSG00000026944 MGI:99606 Abca2 ATP-binding cassette, sub-family A (ABC1), member 2 ENSMUSG00000024030 MGI:107704 Abcg1 ATP binding cassette subfamily G member 1 ENSMUSG00000026003 MGI:87866 Acadl acyl-Coenzyme A dehydrogenase, long-chain ENSMUSG00000018574 MGI:895149 Acadvl acyl-Coenzyme A dehydrogenase, very long chain ENSMUSG00000038641 MGI:2384785 Akr1d1 aldo-keto reductase family 1, member D1 ENSMUSG00000028553 MGI:1353627 Angptl3 angiopoietin-like 3 ENSMUSG00000031996 MGI:88047 Aplp2 amyloid beta (A4) precursor-like protein 2 ENSMUSG00000032083 MGI:88049 Apoa1 apolipoprotein A-I ENSMUSG00000005681 MGI:88050 Apoa2 apolipoprotein A-II ENSMUSG00000032080 MGI:88051 Apoa4
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Construction of a Cerna Network Combining Transcription Factors in Eutopic Endometrial Tissue of Tubal Factor Infertility and Endometriosis-Related Infertility
    Construction of a ceRNA network combining transcription factors in eutopic endometrial tissue of tubal factor infertility and endometriosis-related infertility Junzui Li ( [email protected] ) Xiamen University https://orcid.org/0000-0002-6640-8215 Lulu Ren Xiamen University Medical College Cui Yang Xiamen University Medical College Rongfeng Wu Xiamen University Medical College Zhixiong Huang Xiamen University School of Life Sciences Qionghua Chen Xiamen University Medical College Research article Keywords: TFI, endometriosis-related infertility, DEGs, ceRNA network, TFs Posted Date: December 19th, 2019 DOI: https://doi.org/10.21203/rs.2.19312/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/27 Abstract Purpose Although tubal factor infertility (TFI) and endometriosis-related infertility all can result in female infertility, the pathogenesis of TFI and endometriosis-related infertility were different. The pathophysiologic mechanisms of TFI and endometriosis-related infertility have not been investigated thoroughly. Thus, the aim of the study is to identify the potential crucial genes, pathways, transcription factors (TFs) and long non-coding RNAs (lncRNAs) associated with TFI and endometriosis-related infertility, and further analyze the molecular mechanism implicated in genes. Methods 3 patients with TFI and 3 patients with endometriosis-related infertility were recruited, and microarray hybridization of the eutopic endometrial tissue during the window of implantation (WOI) was performed to examine the expression of mRNAs and lncRNAs. First, differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) were screened out based on P < 0.05 and fold change (FC) ≧ 2. Second, gene ontology, pathway and TFs enrichment analyses and PPI network construction of DEGs were performed.
    [Show full text]
  • The Genetic Factors of Bilaterian Evolution Peter Heger1*, Wen Zheng1†, Anna Rottmann1, Kristen a Panfilio2,3, Thomas Wiehe1
    RESEARCH ARTICLE The genetic factors of bilaterian evolution Peter Heger1*, Wen Zheng1†, Anna Rottmann1, Kristen A Panfilio2,3, Thomas Wiehe1 1Institute for Genetics, Cologne Biocenter, University of Cologne, Cologne, Germany; 2Institute for Zoology: Developmental Biology, Cologne Biocenter, University of Cologne, Cologne, Germany; 3School of Life Sciences, University of Warwick, Gibbet Hill Campus, Coventry, United Kingdom Abstract The Cambrian explosion was a unique animal radiation ~540 million years ago that produced the full range of body plans across bilaterians. The genetic mechanisms underlying these events are unknown, leaving a fundamental question in evolutionary biology unanswered. Using large-scale comparative genomics and advanced orthology evaluation techniques, we identified 157 bilaterian-specific genes. They include the entire Nodal pathway, a key regulator of mesoderm development and left-right axis specification; components for nervous system development, including a suite of G-protein-coupled receptors that control physiology and behaviour, the Robo- Slit midline repulsion system, and the neurotrophin signalling system; a high number of zinc finger transcription factors; and novel factors that previously escaped attention. Contradicting the current view, our study reveals that genes with bilaterian origin are robustly associated with key features in extant bilaterians, suggesting a causal relationship. *For correspondence: [email protected] Introduction The taxon Bilateria consists of multicellular animals
    [Show full text]
  • Supplementary Material Computational Prediction of SARS
    Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE.
    [Show full text]
  • Transcriptional Profiling of Mesc-Derived Tendon And
    ARTICLE https://doi.org/10.1038/s41467-021-24535-5 OPEN Transcriptional profiling of mESC-derived tendon and fibrocartilage cell fate switch ✉ Deepak A. Kaji1, Angela M. Montero1, Roosheel Patel2 & Alice H. Huang 1 The transcriptional regulators underlying induction and differentiation of dense connective tissues such as tendon and related fibrocartilaginous tissues (meniscus and annulus fibrosus) remain largely unknown. Using an iterative approach informed by developmental cues and 1234567890():,; single cell RNA sequencing (scRNA-seq), we establish directed differentiation models to generate tendon and fibrocartilage cells from mouse embryonic stem cells (mESCs) by activation of TGFβ and hedgehog pathways, achieving 90% induction efficiency. Transcrip- tional signatures of the mESC-derived cells recapitulate embryonic tendon and fibrocartilage signatures from the mouse tail. scRNA-seq further identify retinoic acid signaling as a critical regulator of cell fate switch between TGFβ-induced tendon and fibrocartilage lineages. Tra- jectory analysis by RNA sequencing define transcriptional modules underlying tendon and fibrocartilage fate induction and identify molecules associated with lineage-specific differ- entiation. Finally, we successfully generate 3-dimensional engineered tissues using these differentiation protocols and show activation of mechanotransduction markers with dynamic tensile loading. These findings provide a serum-free approach to generate tendon and fibrocartilage cells and tissues at high efficiency for modeling development and
    [Show full text]
  • Downloaded from the GEO Database (GSE71390
    bioRxiv preprint doi: https://doi.org/10.1101/602987; this version posted April 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Pigeon foot feathering reveals conserved limb identity networks Authors: Elena F. Boer1, Hannah F. Van Hollebeke1, Sungdae Park2, Carlos R. Infante3, Douglas B. Menke2, MiChael D. Shapiro1* Affiliations: 1School of BiologiCal ScienCes, University of Utah, Salt Lake City, UT 84112, USA 2Department of GenetiCs, University of Georgia, Athens, GA 30602, USA 3Department of Integrative Biology, University of Colorado, Denver, CO 80217, USA *Author for correspondenCe: MiChael D. Shapiro, School of Biological SCienCes, 257 South 1400 East, Salt Lake City, UT 84112 USA; phone: +1 801 581 5690; fax: +1 801 581 4668; email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/602987; this version posted April 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Summary statement In feather-footed pigeons, mutant alleles of PITX1 and TBX5 drive the partial redeployment of an evolutionarily conserved forelimb genetic program in the hindlimb. Abstract The tetrapod limb is a stunning example of evolutionary diversity, with dramatiC variation not only among distantly related species, but also between the serially homologous forelimbs (FLs) and hindlimbs (HLs) within species.
    [Show full text]
  • Supplemental Data 5-21-18
    Supplemental Methods and Data Androgen receptor polyglutamine expansion drives age-dependent quality control defects and muscle dysfunction Samir R. Nath1,2,3, Zhigang Yu1, Theresa A. Gipson4, Gregory B. Marsh5, Eriko Yoshidome1, Diane M. Robins6, Sokol V. Todi5, David E. Housman4, Andrew P. Lieberman1 1 Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109 2 Medical Scientist Training Program, University of Michigan Medical School, Ann Arbor, MI 48109 3 Cellular and Molecular Biology Graduate Program, University of Michigan Medical School, Ann Arbor, MI 48109 4 Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139 5 Department of Pharmacology, Wayne State University School of Medicine, Detroit, MI 48201 6 Department of Human Genetics, University of Michigan Medical School, Ann Arbor, MI 48109 Supplemental Methods qPCR For Drosophila samples, total RNA was extracted from adult fly heads using TRIzol. Fifteen heads were used per sample. Extracted RNA was treated with TURBO DNAse (Ambion) to eliminate contaminating DNA, and reverse transcription was carried out as indicated above. RNA levels were quantified using StepOnePlus Real-Time PCR System with Fast SYBR Green Master Mix (Applied Biosystems). rp49 was used as the internal control. Each round of qRT-PCR was conducted in technical triplicates. A total of three independent repeats was conducted. Fly histology: For histological preparation (75, 76), wings and proboscises of adult flies were removed and bodies were fixed overnight in 2% glutaraldehyde/2% paraformaldehyde in Tris- buffered saline with 0.1% Triton X-100, rotating at 4˚C. Fixed bodies were subsequently dehydrated by using a series of 30%, 50%, 75%, and 100% ethanol/propylene oxide.
    [Show full text]
  • Multi-Factor Analysis of Differential Co- Expression
    bioRxiv preprint doi: https://doi.org/10.1101/114397; this version posted March 6, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. MultiDCoX: Multi-factor Analysis of Differential Co- expression Herty Liany1,2, Jagath C. Rajapakse4, R. Krishna Murthy Karuturi 2,3,§ 1School of Computing, National University of Singapore, Singapore (current for HL) 2Computational and System Biology, Genome Institute of Singapore, A-STAR, 60 Biopolis Street, S138672, Republic of Singapore (previous for HL and RKMK) 3The Jackson Laboratory, 10 Discovery Dr, Farmington, CT 06032, USA (current affiliation of RKMK) 4School of Computer Science and Engineering, Nanyang Technological University, Singapore. §Corresponding author. Email addresses: HL: [email protected] JCR: [email protected] RKMK: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/114397; this version posted March 6, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Background: Differential co-expression signifies change in degree of co-expression of a set of genes among different biological conditions. It has been used to identify differential co-expression networks or interactomes. Many algorithms have been developed for single-factor differential co-expression analysis and applied in a variety of studies.
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]
  • MKX (C-5): Sc-515878
    SANTA CRUZ BIOTECHNOLOGY, INC. MKX (C-5): sc-515878 BACKGROUND APPLICATIONS MKX (homeobox protein Mohawk) is a 352 amino acid nuclear protein that MKX (C-5) is recommended for detection of MKX of mouse, rat and human may act as a morphogenetic regulator of cell adhesion. Belonging to the origin by Western Blotting (starting dilution 1:100, dilution range 1:100- TALE/IRO homeobox family, MKX contains one homeobox DNA-binding 1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein (1 ml domain. The gene encoding MKX maps to human chromosome 10, which of cell lysate)], immunofluorescence (starting dilution 1:50, dilution range houses over 1,200 genes and comprises nearly 4.5% of the human genome. 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution range Defects in some of the genes that map to chromosome 10 are associated 1:30-1:3000). with Charcot-Marie-Tooth disease, Jackson-Weiss syndrome, Usher syn- Suitable for use as control antibody for MKX siRNA (h): sc-90526, MKX drome, nonsyndromatic deafness, Wolman's syndrome, Cowden syndrome, siRNA (m): sc-149461, MKX shRNA Plasmid (h): sc-90526-SH, MKX shRNA multiple endocrine neoplasia type 2 and porphyria. Plasmid (m): sc-149461-SH, MKX shRNA (h) Lentiviral Particles: sc-90526-V and MKX shRNA (m) Lentiviral Particles: sc-149461-V. REFERENCES MKX (C-5) X TransCruz antibody is recommended for Gel Supershift and ChIP 1. Alimova-Kost, M.V., et al. 1998. Assignment1 of phosphotriesterase- applications. related gene (PTER) to human chromosome band 10p12 by in situ hybridization.
    [Show full text]