SIX1 Regulates Aberrant Endometrial Epithelial Cell Differentiation and Cancer Latency Following Developmental Estrogenic Chemical Exposure Alisa A

Published OnlineFirst October 9, 2019; DOI: 10.1158/1541-7786.MCR-19-0475

Cancer Genes and Networks Molecular Cancer Research SIX1 Regulates Aberrant Endometrial Epithelial Cell Differentiation and Cancer Latency Following Developmental Estrogenic Chemical Exposure Alisa A. Suen1,2, Wendy N. Jefferson1, Charles E. Wood3, and Carmen J. Williams1

Abstract

þ Early-life exposure to estrogenic chemicals can increase Although DES Six1d/d mice had >10-fold fewer CK14 /18 cancer risk, likely by disrupting normal patterns of cellular basal cells within the uterine horns as compared with DES þ þ þ þ differentiation. Female mice exposed neonatally to the syn- Six1 / mice, the appearance of CK14 /18 cells remained a thetic estrogen diethylstilbestrol (DES) develop metaplastic feature of neoplastic lesions. These ﬁndings suggest that SIX1 is and neoplastic uterine changes as adults. Abnormal endome- required for normal endometrial epithelial differentiation, þ þ trial glands express the oncofetal protein sine oculis homeo- CK14 /18 cells act as a cancer progenitor population, and box 1 (SIX1) and contain cells with basal [cytokeratin (CK) SIX1 delays DES-induced endometrial carcinogenesis by pro- þ þ þ þ þ 14 /18 ] and poorly differentiated features (CK14 /18 ), moting basal differentiation of CK14 /18 cells. In human þ strongly associating SIX1 with aberrant differentiation and endometrial biopsies, 35% of malignancies showed CK14 / þ cancer. Here, we tested whether SIX1 expression is necessary 18 expression, which positively correlated with tumor stage for abnormal endometrial differentiation and DES-induced and grade and was not present in normal endometrium. carcinogenesis by using Pgr-cre to generate conditional knockout mice lacking uterine Six1 (Six1d/d). Interestingly, corn oil Implications: Aberrant epithelial differentiation is a key (CO) vehicle-treated Six1d/d mice develop focal endometrial feature in both the DES mouse model of endometrial glandular dysplasia and features of carcinoma in situ as com- cancer and human endometrial cancer. The association of þ þ þ þ pared with CO wild-type Six1 (Six1 / ) mice. Furthermore, CK14 /18 cells with human endometrial cancer provides a Six1d/d mice neonatally exposed to DES had a 42% higher novel cancer biomarker and could lead to new therapeutic þ þ incidence of endometrial cancer relative to DES Six1 / mice. strategies.

Introduction making it difficult to identify important early drivers. Exposing female mice on days 1 to 5 of life to estrogenic chemicals provides Abnormal differentiation is a key feature for many types of an established model for early-life alterations in differentiation human cancer. However, the events leading to cellular reprogram- and development that lead to carcinogenesis later in life (1). This ming and aberrant cell fate often occur long before malignancy, animal model was originally developed using the potent synthetic estrogen, diethylstilbestrol (DES), a drug widely prescribed dur- 1Reproductive and Developmental Biology Laboratory, National Institute of ing pregnancies in the 1940s to 1970s for the prevention of Environmental Health Sciences, National Institutes of Health, Research Triangle miscarriage (2.5–150 mg/day; 0.033–2 mg/kg/day; refs. 2, 3). Park, North Carolina. 2Oak Ridge Institute for Science and Education (ORISE) Human prenatal exposure resulted in reproductive tract abnor- participant in the Office of Research and Development, U.S. Environmental malities and increased cancer risk in exposed offspring (4, 5). 3 Protection Agency, Research Triangle Park, North Carolina. Office of Research Female mice neonatally exposed to 1 mg/kg/day DES develop and Development, U.S. Environmental Protection Agency, Research Triangle abnormalities of the reproductive tract and a high incidence Park, North Carolina. of endometrial cancer later in life (6). Cancer incidence is depen- Note: Supplementary data for this article are available at Molecular Cancer dent on estrogenic activity of the dose and occurs even at very low Research Online (http://mcr.aacrjournals.org/). doses (0.0001 mg/kg/day), suggesting that weaker estrogenic Current address for C.E. Wood: Boehringer Ingelheim Pharmaceuticals, Inc., chemicals could also cause cancer (7). In fact, many environmen- fi Ridge eld, CT. tal estrogens such as genistein (phytoestrogen), bisphenol A Note: This article has been reviewed by the U.S. Environmental Protection (plasticizer), and nonylphenol (surfactant) have been assessed Agency and approved for publication. Approval does not signify that the in this model and shown to cause endometrial cancer (7, 8). contents necessarily reflect the views of the agency and mention of trade Although this exposure model has been widely studied, the names or commercial products does not constitute endorsement or recom- mendation for use. mechanisms linking early-life exposure and carcinogenesis later in life remain unknown. Corresponding Author: Alisa A. Suen, National Institute of Environmental Health Previous work indicates that neonatal exposure to estrogenic Sciences, 111 T.W. Alexander Drive, Research Triangle Park, NC 27709. Phone: 984-287-4301; Fax: 301-480-2732; E-mail: [email protected] chemicals fundamentally alters developmental patterning of the mouse female reproductive tract (1, 9–11). One of the most Mol Cancer Res 2019;XX:XX–XX highly altered proteins is sine oculis-related homeobox 1 homo- doi: 10.1158/1541-7786.MCR-19-0475 log (SIX1), a transcription factor that regulates the development 2019 American Association for Cancer Research. of many tissues and becomes reactivated or overexpressed in

www.aacrjournals.org OF1

Suen et al.

multiple types of human cancer. In the mouse female repro- mice were provided by Dr. Pascal Maire, Universite Paris- ductive tract, Six1 transcript and protein expression is normally Descartes, Paris, France (23). The fifth-generation FVB/NJ back- fl þ þ þ fl fl present in the cervical and vaginal stratified squamous epithe- cross Six1 / animals were inbred to generate Six1 / and Six1 / lium but is absent from the endometrial glandular epitheli- founder lines, which were then used to generate experimental um (9, 11, 12). Following neonatal exposure to DES, SIX1 groups. FVB/NJ mice containing Cre-recombinase under the con- is stably upregulated in the mouse endometrium, further trol of the endogenous progesterone receptor promoter (Pgr-cre) induced by endogenous estrogen exposure, and localized with- were provided by Drs. Franco DeMayo, National Institutes of in dysplastic and neoplastic glandular lesions that develop in Health, Research Triangle Park, NC, and John Lydon, Baylor adulthood (9, 11–13). These findings suggest that aberrant College of Medicine, Houston, TX (28). The Pgr-cre line uterine expression of SIX1 following neonatal estrogenic chem- induces CRE expression as early as postnatal day 3 (PND3) ical exposure serves as a functional link between early disrup- in Pgr-expressing cell types including the uterine luminal epithe- fl fl tion of cellular differentiation and later development of endo- lium, stroma, and myometrium (29). Male Six1 / , Pgr-cre mice fl fl metrial carcinomas in this model. were bred to female Six1 / mice to generate the experimental Six1 SIX1 is a homeodomain-containing transcription factor that conditional knockout line (Six1d/d). þ þ plays essential roles in organogenesis and tissue maintenance by Female Six1 / and Six1d/d pups were given daily subcutaneous regulating cell proliferation, differentiation, survival, migration, injections (0.02 mL) of 1 mg/kg diethylstilbestrol (DES) in corn and invasion (14–16). SIX1 can function as a transcriptional oil or corn oil (CO) alone as a vehicle control on the day activator or repressor (14, 17) and regulates a diverse network of birth (postnatal day 1, PND1) through PND5, consistent with of downstream pathways through interaction with cofactors such the previously described DES exposure model (6, 13, 30). DES as dachshund (DACH) and eyes absent (EYA; refs. 14, 18, 19). (1 mg/kg/day) on PND1-5 is an established dose with high Six1-null mice and pigs display numerous developmental abnor- efficacy (90% uterine cancer), which we used to reduce vari- malities, collectively resulting in perinatal lethality (14, 20, 21). In ability in our endpoints to understand the molecular mechanisms adult mice, SIX1 mediates muscle and kidney tissue regeneration underlying endometrial carcinogenesis. Sample sizes were calcu- through stem cell maintenance and differentiation (22, 23). In lated on the basis of previously published studies showing that humans, loss-of-function mutations in SIX1 disrupt kidney and 45% of FVB/N mice exposed neonatally to DES develop cancer by inner ear development resulting in progressive renal failure and 8 months of age (31, 32). We estimated that using 12 mice per hearing loss characterized as branchio-oto-renal syndrome (24). exposure group and genotype would allow us to detect a 45% In addition to normal developmental and maintenance func- difference in cancer incidence (one-sided 0.05 level of significance tions, SIX1 dysregulation and inappropriate reactivation is impli- with 80% power) beginning at 6 months. cated in several cancer hallmarks and enabling characteris- Mice were euthanized by decapitation on PND5 or CO2 tics (19, 25, 26). In animal models and in vitro studies, SIX1 asphyxiation at 6 and 12 months and uteri were collected and overexpression induces genomic instability, malignant transfor- processed for molecular and histopathologic analysis as described mation, and metastasis (15, 16, 19, 26). Upregulation of SIX1 previously (12, 13). In 6- and 12-month groups, the cranial half of expression has also been described in multiple human cancers, each right uterine horn was frozen for molecular analyses (micro- including breast, cervical, and ovarian cancers, and is associated array and RT-PCR) and thus not available for histopathology. The with tumor resistance and poor survival (15). We and others remaining tract, including left uterine horn, uterine body, cervix, previously showed that aberrant SIX1 expression is present in a and cranial vagina, was used for histopathology and histopathol- subset of human endometrial cancers (13, 27). However, the role ogy and immunohistochemistry (IHC). of SIX1 in endometrial cancer remains unclear. Collectively, these findings indicate that aberrant uterine SIX1 may have dual roles in Human endometrial tissue both cellular differentiation and carcinogenesis. Human endometrial tissue microarrays (TMA) containing nor- Here, we used a conditional knockout mouse model to inves- mal, nonneoplastic, normal cancer-adjacent, and malignant tigate the role of SIX1 in normal endometrial epithelial differen- biopsies were purchased from a commercial vendor (U.S. Biomax, tiation and carcinogenesis following neonatal DES exposure. We Inc.; TMA# UT1501, UT803, UT721, EMC961, EMC962). All also tested human endometrial tissue biopsies for the presence of tissue specimens were obtained with written informed consent molecular changes similar to those observed in our mouse model. according to U.S. federal law. TMAs were prepared from formalin- The findings reported here may inform cancer biomarker devel- fixed, paraffin-embedded tissue specimens and freshly cut for IHC opment, therapeutic strategies, and risk assessment for estrogenic staining. Tissue cores from 223 patients across 5 TMAs were þ þ chemicals. assessed for CK14 /18 cell labeling (normal: 29, normal cancer adjacent: 8, hyperplasia: 5, malignant: 181). Two to three tissue cores were assessed for 211 patients. Four to five cores were Materials and Methods assessed for the 12 patients who had redundant tissue cores Animals present on more than one TMA (6 patients overlapped on UT803 All animal studies were conducted following the recommenda- and UT1501, 6 patients overlapped on UT803 and UT721). tions of the NIH Guide for the Care and Use of Laboratory Pathologic diagnoses and descriptions, including FIGO or Animals. All procedures involving animals were performed at tumor–node–metastasis (TNM) stage and grade, were provided the National Institute of Environmental Health Sciences (NIEHS) for most patients. Cancer stage information was provided for according to an approved Institutional Animal Care and Use 180 of 181 endometrial cancer patients (63/63 patients with þ þ þ þ Committee protocol. All genetic mouse founders were bred to CK14 /18 cells and 117/118 patients lacking CK14 /18 cells). FVB/NJ mice for five generations to obtain the lines on an FVB/NJ Cancer patients ranged from stage I–III. There were no stage IV fl fl background. Mice containing loxP sites flanking Six1 (Six1 / ) patients. For consistency, TNM scores were converted to FIGO

OF2 Mol Cancer Res; 2019 Molecular Cancer Research

SIX1 in Endometrial Metaplasia and Carcinogenesis

stage based on previously described guidelines (33). Cancer uterus was read as a single organ for manual H&E and IHC grade, ranging from grade 1 to 3 (G1–3), was provided for 159 evaluation and was not divided into uterine horn and body of 181 patients with endometrial cancer (55/63 patients with regions as in the digital image analysis described below. All þ þ þ þ CK14 /18 cells and 104/118 patients lacking CK14 /18 cells). pathology data, tabulations, and observations were recorded by a board-certified veterinary pathologist (C.E. Wood). Histopathology, IHC, and immunofluorescence Female mouse reproductive tract tissues were processed using Imaging standard histologic procedures, paraffin-embedded, sectioned Brightfield and fluorescent slides were scanned using the Aperio longitudinally at 6 mm, and either stained with hematoxylin and AT2 Scanner and the Aperio Scanscope FL Scanner, respectively eosin (H&E) or left unstained for IHC. IHC analysis was per- (Leica Biosystems Inc.). All fluorescent slides were scanned using formed on serial sections from the same mice used for histopa- the same exposure. Representative brightfield or fluorescent thology. Reproductive tracts were sectioned until the central images were captured from digital slides using Aperio ImageScope uterine lumen could be observed in plane with the cervicovaginal v. 12.4.0.5043 (Leica Biosystems Inc.). IF staining included CK14 epithelium. This procedure provided a continuous view of the (Alexa 568), CK18 (Alexa 488), and DAPI, but CK14 and CK18 epithelium from the uterus to the cranial vagina. Histology was colors were artificially inverted during imaging. performed by the Histology Core Laboratory of the NIEHS/ National Toxicology Program (NTP). Mouse tissue digital image analysis IHC and immunofluorescence (IF) labeling were performed The Aperio Colocalization Algorithm (Leica Biosystems Inc.) þ þ at the NIEHS/NTP IHC core facility using standard proto- was used to quantitate CK14 or CK18 labeled area within cols (34). Reagent preparations for both mouse and human different reproductive tract regions of interest (ROI) in slides tissue are listed in Supplementary Table S1. Detailed staining stained individually for CK14 or CK18. The uterine body ROI methods are provided elsewhere (12). Brightfield IHC was was defined as the area from the squamocolumnar junction (but performed on serial sections of uterus from each mouse for above visible stratified squamous epithelium) up to the horn the following markers: SIX1 as a developmental differentiation bifurcation (outlined in Fig. 2). In most CO mice, the uterine þ factor and cancer cell marker; CK14 and tumor protein 63 body region included a small CK14 area indicating basal/reserve (P63) as a marker of basal cells; CK18 as a marker of glandular cells typically present in endometrial glands within the transition cells; and dual CK14/18 as a marker of poorly differentiated zone. The uterine horn ROI was defined as the area above the left mixed basal/glandular cells. CK14/18 IF was also performed horn bifurcation up to the utero-tubal junction. Region-specific þ þ to highlight colocalization of CK14 and 18 labeling. Dual quantification of CK14 or CK18 labeled area was based on the CK14/18 IHC was performed on human endometrial TMAs total area containing strong positive pixels per ROI. To account for using the same protocol as described for mice. Appropriate variability in overall organ size due to epithelial, stromal, and positive and negative control tissues (mouse skin and intestine) myometrial development, all of which are impacted by neonatal þ þ were stained with each experiment. DES exposure, the CK14 or CK18 labeled area was represented as a percent of total epithelial area (as determined by adding the þ þ Histopathologic analysis CK14 and CK18 tissue area on serial sections) rather than a raw For mouse histopathologic assessment, a certified study positively stained area or as a percentage of the total tissue area. pathologist examined three H&E-stained sections spaced This method determines the proportion of epithelium that is þ approximately 30 mm apart for each mouse. Where applicable, "normal" glandular/simple columnar (CK14 /18 ) or squa- þ histopathologic diagnoses were based on standard criteria and mous/basaloid (CK14 /18 ) and how this ratio is altered by nomenclature for neoplastic and nonneoplastic lesions pre- treatment and genotype. Section variability between animals sented by the International Harmonization of Nomenclature could also contribute to variability; therefore, serial sections were and Diagnostic Criteria for Lesions in Rats and Mice (INHAND) used for CK14 and CK18 IHC in this analysis. Project (35). Any discrepancies with INHAND terminology are Despite several attempts to digitally quantitate independent described in the results section. Severity of nonneoplastic and colocalized CK14 and 18 staining within dual CK14/18 þ þ lesions was qualitatively scored using a generic 0–4scale(0 labeled mouse slides, an accurate estimate of CK14 /18 labeled þ þ ¼ absent, 1 ¼ minimal, 2 ¼ mild, 3 ¼ moderate, 4 ¼ severe) area could not be generated (CK14 /18 labeled area was grossly þ based on lesion extent and complexity. overestimated, whereas CK14 /18 area was underestimated; Immunolabeling for dual CK14 and 18 within mouse and parameter editing led to significant data loss of either group). þ þ human epithelial cells was also evaluated by a pathologist and For this reason, CK14 /18 cells were assessed only by manual assigned a qualitative labeling score. For mice, the score ranged analysis. þ þ from 0 to 4 based on the estimated percentage of CK14 /18 labeled cells (0 ¼ absent, 1 ¼ minimal, 2 ¼ mild, 3 ¼ moderate, 4 Human tissue digital image analysis ¼ severe); corresponding H&E-stained sections were used as The Definiens Tissue Studio TMA Colocalization Algorithm þ þ needed to confirm lesion- or cell-specific labeling. For humans, (Definiens, Inc.) was used to quantitate CK14 /18 , CK14 /18 , þ þ the score ranged from 0 to 4 based on the approximate number of or CK14 /CK18 labeled area within dual CK14/CK18 stained þ þ CK14 /18 cells present within the core biopsy (0 ¼ absent, 1 ¼ slides. The percent area of tissue that contained positive labeling þ 1–5 cells, 2 ¼ 6–10 cells, 3 ¼ 11–15 cells, 4 15 cells). CK14 / was calculated for each core biopsy from a single patient and þ 18 cell labeling was represented by a discrete forest green color averaged to create a score for each stain per patient. Note that (IHC; mouse and human) and evaluated as for a single label; it multiple core biopsies assessed for a single patient showed similar was not possible to visually distinguish intensities of the com- tissue pathologies (e.g., multiple biopsies taken from a cancer ponent markers in dual-stained areas. To avoid potential bias, the lesion or lesions) and that staining scores from biopsies of

www.aacrjournals.org Mol Cancer Res; 2019 OF3

Suen et al.

þ þ malignant and normal adjacent tissue from a single patient were CO Six1 / sample that did not cluster with other groups and was not averaged. excluded from further analysis. The resulting significantly altered The average percent area of tissue that defined a single cell for genes were subjected to a 1.5-fold change cutoff that were used þ þ þ þ each label (CK14 /18 , CK14 /18 , and CK14 /18 ) was cal- to generate heatmaps in Partek and then uploaded into NextBio culated to establish minimum labeling cutoffs. TMA cores with Correlation Engine (Illumina Inc.) for pathway enrichment and positively labeled areas that were less than the average size of one correlation to published studies (37). Microarray data were also cell for that respective label were considered negative. It was evaluated for patterns using the extracting patterns and identify- necessary to define an average cell size for each respective label ing coexpressed genes (EPIG) analysis method (38). Microarray þ to account for differences across labeling groups (e.g., CK14 /18 data have been deposited in the Gene Expression Omnibus þ basal cells were often larger than CK14 /18 luminal or poorly (GEO) database (accession number GSE138501). þ þ differentiated CK14 /18 cells). Average cell sizes were 87, 49, and 41 mm2 and average percentages of core area per single Immunoblots þ cell were 0.0080%, 0.0045%, and 0.0037% for CK14 /18 , As described previously, nuclear protein was extracted from þ þ þ CK14 /18 , and CK14 /18 labeling, respectively. uterine horn tissue and SIX1 immunoblotting was performed on PND5 and 6 months tissue (Suen and colleagues, 2016). Blots Transmission electron microscopy were scanned using the HP Scanjet 7650 (Hewlett-Packard). The right anterior uterine horn (near the oviductal– Images were desaturated in Adobe Photoshop Elements (Adobe) endometrial junction) was collected from two CO Six1d/d mice to remove color without altering the brightness value of the pixels. at 6 months. Tissues were fixed in McDowell and Trump 4F:1G fixative overnight and processed using the automated Leica Elec- Statistical analysis tron Microscopy Tissue Processor (Leica Biosystems Inc.). Sam- Statistical analyses were performed using GraphPad Prism, ples were rinsed with phosphate buffer, postfixed in 1% osmi- version 7.0. Data were analyzed using two-way ANOVA, two- um tetroxide, rinsed in water, and dehydrated in an ethanolic tailed Fisher exact test or c2 test, Mann–Whitney test, and appro- series culminating in acetone. The samples were then infiltrated priate post hoc tests for multiple comparisons. Tests used are with Poly/Bed 812 epoxide resin. Following polymerization, indicated in the figure legends. Error bars show the SEM for all blocks were trimmed and semithin sections (0.5 mmthick) graphs. were cut, mounted on glass slides, and stained with 1% Tolu- idine Blue O in 1% sodium borate. Slides were examined with a light microscope to select a ROI and trimmed. Ultrathin sec- Results tions (80–90 nm thick) were cut, placed onto 200 mesh copper Conditional uterine Six1 deletion results in uterine glandular grids, and stained with uranyl acetate and lead citrate per dysplasia and carcinoma in situ standard protocol. Digital images were captured with a Gatan SIX1 is robustly expressed in the vagina and ectocervix, but the Orius SC1000/SC600 camera (Gantan Inc.) attached to a FEI protein is not normally detectable in the neonatal or adult uterus, Tecnai T12 Transmission Electron Microscope (FEI Company). despite low levels of transcript expression, unless the mice are TEM evaluation was performed by the NIEHS Electron Micros- exposed neonatally to estrogenic chemicals (9, 11, 13). The copy Support Laboratory. neonatal lethal phenotype of the global knockout mice precludes determination of whether SIX1 has a role in perinatal uterine Real time RT-PCR development. To determine whether SIX1 is involved in postnatal RNA was isolated from frozen uterine horn tissue and real uterine differentiation or function, Six1 was conditionally deleted time RT-PCR was performed as described previously using Six1 in the female reproductive tract during neonatal development þ þ primers (F: CTGCCGTCGTTTGGTTTTAC; R: TTGTAGAGCTCG- (Supplementary Fig. S1A; refs. 23, 28). Treatment of Six1 / and CGGAAGTT) and normalized to cyclophilin A (Ppia; ref. 13). Six1d/d mice with CO on PND1-5 served as a vehicle control for d/d Transcript expression levels were calculated using the DCt DES treatment. Successful Six1 deletion in CO and DES Six1 method (9, 36). mice was documented at both PND5 and 6 months by real-time þ þ PCR, immunoblotting, and IHC; tissues from Six1 / mice Microarray analysis exposed neonatally to DES served as positive controls (Supple- Gene expression analysis was conducted on uterine horn tissue mentary Fig. S1B–S1D). There were no overt morphologic differ- þ þ from four independent biological replicates for each exposure ences observed in uteri or vagina between CO Six1 / and Six1d/d group and genotype at 6 months of age using Agilent Whole mice and, although a formal breeding study was not done, CO Mouse Genome 4 44 multiplex format oligo arrays as described Six1d/d female mice were fertile. Together, these data indicated previously (Agilent Technologies; ref. 9). Data were obtained that the Six1 knockout model could be used to achieve selective using Agilent Feature Extraction software (version 12.0), which Six1 ablation in the female reproductive tract during neonatal performed error modeling adjusting for additive and multiplica- development without causing gross alterations in tissue morphol- tive noise. The resulting data were processed using Partek Geno- ogy or function. mics Suite (Version 7.0) software (Partek Inc.). To identify dif- Despite the overall normal uterine tissue morphology, adult d/d ferentially expressed probes, a raw data cutoff <10 and log2 CO Six1 mice had unexpected changes in cell morphology transformed ANOVA with unadjusted P < 0.05 was applied to within some endometrial glands. At both 6 and 12 months, determine whether there was a statistical difference between the glandular dysplasia was observed in approximately 60% of þ þ means of groups. Principal Component Analysis was performed Six1d/d mice but never in Six1 / mice (Fig. 1A, Table 1). The to assess variability present in the data. Samples separated into predominant location of dysplastic glands was at the tip of the distinct groups based on exposure and genotype except for a single uterine horn near the endometrial–oviductal junction and to a

OF4 Mol Cancer Res; 2019 Molecular Cancer Research

SIX1 in Endometrial Metaplasia and Carcinogenesis

Figure 1. Endometrial tissue changes in CO vehicle-treated Six1 conditional knockout mice. A, Incidence of glandular dysplasia and/or carcinoma in situ in 6 or 12-month-old CO Six1þ/þ and Six1d/d mice. n ¼ 12–15 mice per exposure, genotype, and age group. Two-tailed Fisher exact test. , P < 0.05 compared with age-matched CO Six1þ/þ group. B and C, Normal uterine glands and primary lumen stained with H&E (B) and dual CK14/18 IHC for basal (CK14þ, aqua; no CK14þ cells present) and glandular (CK18þ, brown) markers (C)fromaCOSix1þ/þ mouse. D and E, Dysplastic uterine glands stained with H&E (D) and dual CK14/18 IHC for basal (CK14þ, aqua) and glandular (CK18þ, brown) markers (E)fromaCOSix1d/d mouse. Dysplastic glands are predominantly comprised of epithelial cells that coexpress CK14 and 18 (CK14þ/18þ, forest green) adjacent to morphologically normal glands comprised of CK14/18þ cells (brown top right corner). Images show cells within the same lesion but are not serial sections. B–E, Original objective, 20;scalebar,100mm. F and G, Carcinoma in situ with microinvasive epithelial cells that exhibit cellular processes extending into the stroma (but no clear evidence of regional spread or metastasis) from a CO Six1d/d mouse. Original objective, 40;scalebar,10mm. H–J, TEM of normal (H)and abnormal (I and J) epithelium. Epithelial cells with a distinct basement membrane along the basal margin (arrowheads) from a morphologically normal gland (H). Epithelial cells that lack a clear basement membrane (arrowheads indicate expected location of basement membrane) from a dysplastic gland (I). Epithelial cells with a discontinuous basement membrane (arrowhead) from a dysplastic gland (J).Thelumenisatthetop(H and I)ortopleftcorner(J). Original objective, 4,800 (H and J), 6,800 (I). Scale bar, 2.5 mm. K, Heatmap of 2,856 DEGs in CO Six1þ/þ versus Six1d/d mice. L, NextBio correlation engine identiﬁed overlapping DEGs between uterine Six1 cKO and Ihh cKO datasets (Venn diagram). Overlapping DEGs distributed by direction of expression change. M, Relative Ihh transcript expression at 6 months (n ¼ 5 mice/genotype). Mean SEM is plotted. Two-tailed Mann–Whitney test. , P < 0.05.

lesser extent scattered throughout the horn or near the squamo- the adjacent basement membrane (Fig. 1F and G). These micro- þ þ columnar junction. When compared with CO Six1 / mice invasive features were consistent with carcinoma but showed (Fig. 1B and C), glands in CO Six1d/d mice, particularly near the no evidence of progression or expansion with age in 6- versus tip of the uterine horn, showed variable degrees of lumen devel- 12-month-old groups. The appearance of these migrating opment in that some clusters of dysplastic cells did not have clear cells was consistent with the deﬁnition of "carcinoma in situ"or lumens while others had microlumens. Abnormal cells within "stage 0 cancer" as described in the NCI Dictionary of Cancer dysplastic glands were characterized by cytologic atypia (Fig. 1D Terms (39). and E), including abnormal cell shape and pseudopodia-like The dysplastic glands in the Six1d/d mice were further charac- appendages that extended from the basal margin and disrupted terized using dual IHC and transmission electron microscopy

www.aacrjournals.org Mol Cancer Res; 2019 OF5

Suen et al.

Table 1. Incidence of reproductive tract abnormalities in CO or DES-exposed Six1 wild-type or conditional knockout mice 6 months 12 months CO DES CO DES Site Diagnosis Six1þ/þ Six1d/d Six1þ/þ Six1d/d Six1þ/þ Six1d/d a Six1þ/þ Six1d/d Vagina Adenosis 0/15 (0%) 0/15 (0%) 4/15 (27%) 2/18 (11%) 0/13 (0%) 0/12 (0%) 0/11 (0%) 4/12b (33%) Uterusc Cystic change 0/15 (0%) 2/15 (13%) 1/15 (7%) 4/18 (22%) 1/13 (8%) 7/12b (58%) 3/11 (27%) 7/12b (58%) Adenomyosis 0/15 (0%) 0/15 (0%) 7/15b (47%) 16/18b,d,e (89%) 2/13 (15%) 0/12 (0%) 11/11b (100%) 9/12b,d (75%) Squamous metaplasia 0/15 (0%) 0/15 (0%) 8/15b (53%) 8/18b,d (44%) 0/13 (0%) 0/12 (0%) 10/11b (91%) 2/12e (17%) Avg. severity gradef 0.0 0.0 1.4 1.6 0.0 0.0 2.1 1.0 Basal cell metaplasia 2/15 (13%) 0/15 (0%) 15/15b (100%) 18/18b,d (100%) 4/13 (31%) 4/12 (33%) 11/11b (100%) 12/12b,d (100%) Avg. severity gradef 1.0 0.0 2.2 1.3 1.0 1.0 3.5 1.3 Atypical hyperplasia 0/15 (0%) 0/15 (0%) 13/15b (87%) 18/18b,d (100%) 0/13 (0%) 0/12 (0%) 10/11b (91%) 11/12b,d (92%) Glandular dysplasia/ 0/15 (0%) 9/15b (60%) 13/15b (87%) 17/18b,d (94%) 0/13 (0%) 7/12b (58%) 10/11b (91%) 11/12b (92%) carcinoma in situ Carcinoma 0/15 (0%) 0/15 (0%) 7/15b (47%) 16/18b,d,e (89%) 0/13 (0%) 0/12 (0%) 8/11b (73%) 8/12b,d (67%) Uterine horn (only) na na 3 2 na na 1 1 Uterine body (only) na na 0 5 na na 1 1 Uterine horn and body na na 4 9 na na 6 6

IHC Marker Site CK14þ/18þ Cervical/vaginal 9/15 (60%) 0/15 (0%) 2/15 (13%) 2/18 (11%) 9/13 (69%) 4/12 (33%) 3/11 (27%) 3/12b (25%) Endometrium: 7/15 (47%) 11/15 (73%) 15/15b (100%) 16/18b (89%) 3/13 (23%) 12/12b (100%) 11/11b (100%) 12/12b (100%) Nonneoplastic glands Endometrium: na 9/9 (100%) 12/13 (92%) 17/17 (100%) na 6/7 (86%) 10/10 (100%) 11/11 (100%) Dysplastic glands Endometrium: na na 6/7 (86%) 16/16 (100%) na na 8/8 (100%) 7/8 (88%) Neoplastic glands aOne animal from CO Six1d/d group was excluded (endometrium not in section). bTwo-tailed Fisher exact test. P < 0.05 compared with age-matched CO Six1þ/þ group. cIncidence and severity corresponds with a combined assessment of uterine body and horn and not individual regions. dTwo-tailed Fisher exact test. P < 0.05 for DES Six1d/d compared to age-matched CO Six1d/d group. eTwo-tailed Fisher exact test. P < 0.05 for DES Six1d/d compared to age-matched DES Six1þ/þ group. fValues indicate average severity grade (1–4) across animals with the phenotype. Animals lacking the phenotype and thereby assigned a 0 severity grade were not included in the average.

(TEM). Dual IHC for cytokeratin markers of basal (CK14) and These phenotypic abnormalities led us to hypothesize that glandular (CK18) cells indicated that most cells comprising genes involved in normal endometrial differentiation would be þ þ dysplastic glands and all migrating cells coexpressed both markers altered in the CO Six1d/d mice as compared to CO Six1 / mice. þ þ þ þ (designated CK14 /18 cells; Fig. 1E-G) as compared with nor- Microarray analysis of uteri from CO Six1d/d versus Six1 / mice mal glandular and primary luminal epithelial cells (brown identified 2,856 differentially expressed genes (DEGs) (Fig. 1K; þ þ þ CK14 /18 ; Fig. 1C). CK14 /18 cells appeared similar to an Supplementary Table S2A). The most highly significant Gene abnormal cell population previously observed in neonatally DES- Ontology (GO) categories of the DEGs were cell division exposed mice (12). To qualitatively assess the apparent absence (99 genes; GO Score: 119, P ¼ 2.7E52), nuclear division þ þ of a basement membrane adjacent to CK14 /18 cells within (80 genes; GO Score: 116, P ¼ 6.5E51), and mitosis (80 genes; dysplastic glands, TEM was performed on two CO Six1d/d mice. GO Score: 116, P ¼ 6.5E-51); 71 of these genes were found in all Within the tissue regions processed and assessed by TEM, mor- three categories (Supplementary Table S2B). In addition, >90% phologically normal glands (H) and two dysplastic glands (I and of the DEGs in these three categories were down regulated þ þ J) were identified. TEM indicated that glandular epithelial cells in in Six1d/d versus Six1 / . Nine of the top ten down regulated morphologically normal glands had a distinct basement mem- genes from these GO categories encoded either spindle-associated brane along the basal margin (Fig. 1H). In contrast, a basement proteins (Spag5, Kif18b, Ska3, Mis18bp1, Ska1, Aurbk, Ercc6l) or membrane adjacent to morphologically abnormal cells within cell-cycle regulators (Ccnb1 and Ccna2). These findings are con- dysplastic glands was not observed (Fig. 1I and J). Abnormal sistent with the well-established role of SIX1 in regulating cell appearing epithelial cells within dysplastic glands had variably proliferation (26). shaped nuclei often containing a single prominent nucleolus, and These DEGs were also analyzed using the NextBio correlation scant heterochromatin (Fig. 1I and J). In areas where the basement engine to identify correlations with published datasets (37). membrane was disrupted, adjacent cells and cellular processes NextBio recognized 2,530 of the 2,856 DEGs initially identified extending between the glandular and stromal compartments in the CO Six1d/d model; the list of highly overlapped biosets can showed junctional complexes and intracytoplasmic structures be found in Supplementary Table S2C. Using the knockout atlas, that likely represented cytokeratin microfilaments, suggesting the top gene perturbation was indian hedgehog (Ihh). Of the epithelial cell origin and epithelial-to-mesenchymal transition. 2,856 DEGs, 443 genes overlapped with genes altered in uterine Together, these cellular changes indicate that deletion of Six1 tissue from a Ihh conditional knockout (cKO) model (Fig. 1L; disrupts epithelial cell morphology within some endometrial Supplementary Table S2D; ref. 40). Categorizing the overlapped glands. Furthermore, these data suggest that transient expression altered genes by up or down-regulation identified 216 similarly of Six1 during postnatal development is required for normal down-regulated genes (P ¼ 2.4E65), including cell cycle genes glandular differentiation. Ccnb1, Ccnd1, Cdk1 and Mcm5. These findings indicate a positive

OF6 Mol Cancer Res; 2019 Molecular Cancer Research

SIX1 in Endometrial Metaplasia and Carcinogenesis

Figure 2. Metaplastic changes in Six1 conditional knockout mice following neonatal DES exposure. A, CK14 IHC of uteri from 12-month-old CO Six1þ/þ(left), and DES- exposed Six1þ/þ(middle) and Six1d/d (right) mice (CK14þ, brown). Outline deﬁnes uterine body and horn regions used for manual and quantitative image analysis. Brown labeling indicates CK14þ basal and squamous cells in the squamocolumnar junction (SCJ) in the CO Six1þ/þ mouse (dashed arrow), and the uterine body (arrowheads) and horn (arrow) in the DES-exposed Six1þ/þ and Six1d/d mice. Original objective, 1; scale bar, 1 mm. B and C, Percentage of CK14þ uterine epithelium within the uterine body (B) or horn (C) determined by quantitative image analysis. n ¼ 11–18 mice per exposure, genotype, and age group. Mean SEM is plotted. Two-way ANOVA with Tukey test for multiple comparison across all exposure, genotype, and age groups (A–C), P < 0.05.

þ þ correlation in gene expression changes when either Six1 or Ihh are specific epithelial metaplasia between DES-exposed Six1 / and deleted in the uterus (Fig. 1L). A decrease in Ihh gene expression Six1d/d mice. þ þ was confirmed in CO Six1d/d versus Six1 / mice (Fig. 1M). The incidence of basal cell metaplasia was not different þ þ Conditional uterine deletion of Ihh and Sox17, an upstream between DES-exposed Six1 / and Six1d/d mice when the whole regulator of Ihh, alters endometrial gland development, epithelial uterus was evaluated by histopathologic analysis (combined horn differentiation, and epithelial–stromal cross-talk (40, 41). Taken and body regions; Table 1). However, the severity of basal cell together, these findings suggest that deletion of Six1 alters normal metaplasia at 6 and 12 months and the incidence and severity of uterine differentiation and response, and may function through squamous metaplasia at 12 months was decreased, prompting Ihh regulated pathways. further investigation of region-specific changes using quantitative image analysis of CK14 and CK18 labeling (Fig. 2A; and Supple- þ þ SIX1 is required for DES-induced basal cell metaplasia in the mentary Fig. S2A). Within the uterine body, DES-exposed Six1 / uterine horns and Six1d/d mice exhibited a similar percentage of metaplastic To investigate whether conditional Six1 deletion impacts char- change at both 6 and 12 months (as indicated by the percentage of þ acteristic DES-induced cellular phenotypes, histopathologic CK14 epithelium; Fig. 2B). Within the uterine horns, on average þ þ þ changes were evaluated in the reproductive tracts of CO and 30% of the epithelium in DES-exposed Six1 / mice was CK14 , þ þ DES-exposed Six1 / and Six1d/d mice. Regardless of genotype, and this percentage increased with age (Fig. 2C). However, less DES exposure resulted in a similar spectrum of morphologic than 10% of the uterine horn epithelium was CK14þ in DES- alterations relative to CO mice. These changes included an overall exposed Six1d/d mice, a percentage comparable with that in the reduction in the number of endometrial glands, as well as basal CO mice, and there was no change with age. Similar alterations in and squamous metaplasia, adenomyosis, atypical hyperplasia, region-specific metaplastic change were observed when data were þ and carcinoma (Table 1; Supplementary Fig. S2; refs. 6, 12, 42). expressed as total CK14 tissue area for either region (Supple- However, there were striking differences in the degree of region- mentary Fig. S2B). These data indicate that DES-induced SIX1 acts

www.aacrjournals.org Mol Cancer Res; 2019 OF7

Suen et al.

Figure 3. Endometrial cancer incidence in Six1 conditional knockout mice following neonatal DES exposure. A and B, Carcinoma incidence in CO and DES-exposed Six1þ/þ and Six1d/d mice at 6 (A) and 12 (B) months of age. n ¼ 11–18 mice per treatment, genotype, and age group. Two-tailed Fisher exact test. , P < 0.05 compared with age and genotype-matched CO group. †, P < 0.05 compared with age-matched DES-exposed group. C, H&E staining and SIX1, P63, and dual CK14/18 IHC staining and CK14/18 immunoﬂuorescence (IF) staining of endometrial carcinoma lesions from 12-month-old DES-exposed Six1þ/þ(left) and Six1d/d (right) mice, as indicated. Images show cells within the same lesion but are not serial sections. CK14 and/or 18 labeling color for IHC and IF are as follows: CK14þ/18 basal cells are aqua or green, CK14/18þ luminal cells are brown or red, and CK14þ/18þ cells are forest green or yellow. CK14/18 40 IHC highlights differences in morphology of CK14þ/18 basal cells (arrow) adjacent to CK14/18þ luminal cells (arrowhead) in DES Six1þ/þ compared with CK14þ/18þ luminal cells (arrowheads) in DES Six1d/d. Original objective 20, except where 40 is indicated. Scale bar, 50 mm. CK14/18 IF images have an original objective of 20, but were zoomed in to highlight merged features. Individual IF images can be found in Supplementary Fig. S4. D, Heatmap of 993 DEGs in DES Six1þ/þ versus Six1d/d mice. E, NextBio correlation engine identiﬁed overlapping genes between uterine DES Six1 cKO and prostate Pten cKO datasets (Venn diagram). Overlapping DEGs distributed by direction of expression change.

OF8 Mol Cancer Res; 2019 Molecular Cancer Research

SIX1 in Endometrial Metaplasia and Carcinogenesis

as a differentiation factor leading to basal cell and squamous The NextBio correlation engine recognized 879 of the 993 metaplasia specifically in the uterine horns. DEGs initially identified in the DES-exposed Six1 cKO model; the list of highly overlapped biosets is in Supplementary A lack of uterine SIX1 results in earlier development of DES- Table S2G. The phosphatase and tensin homolog (PTEN) knock- induced endometrial cancer out bioset highly overlapped with the DES-exposed Six1 cKO Similar to our previous results, endometrial carcinoma was model with a gene perturbation score of 100 (Supplementary þ þ observed in approximately 40% and 70% of DES-exposed Six1 / Table S2G). Of the 879 DEGs identified in the DES-exposed Six1 mice at 6 and 12 months, respectively, but not in CO mice of either cKO model, 407 genes overlapped with genes altered in prostate genotype (Table 1; Fig. 3A and B; ref. 13). Interestingly, there was a tumor tissue from a Pten cKO model (Fig. 3E; Venn diagram; higher incidence of endometrial carcinoma in DES Six1d/d com- overlapped gene list can be found in Supplementary Table S2H; þ þ pared to DES Six1 / mice at 6 months (Fig. 3A). By 12 months, refs. 43). Categorizing altered genes by up or downregulation both genotypes had a similarly high incidence (Fig. 3B) and identified 214 genes downregulated in the Six1 cKO model that distribution of neoplastic lesions (Table 1). These findings indi- are upregulated in the Pten cKO model (P ¼ 4.1E28), indicating cate that SIX1 is not required for DES-induced carcinogenesis in a negative correlation in gene expression changes when compar- the uterus, and instead suggest that it may provide some degree of ing Six1 with Pten deletion in glandular tumors (Fig. 3E). Pten loss protection by promoting metaplastic change. leads to approximately 10-fold increase in Six1 and 1.8-fold Along with adenobasal morphologic features, all carcinomas in increase in Trp63, similar to increases of these two genes following þ þ þ þ þ DES-exposed Six1 / mice exhibited uniform epithelial SIX1 DES exposure in Six1 / mice (Supplementary Fig. S2H), suggest- þ þ þ labeling, CK14 and P63 basal cells, CK18 luminal cells, and ing PTEN pathways regulate Six1, even though Pten itself is not þ þ CK14 /18 epithelial cells within neoplastic lesions in both the differentially expressed in DES Six1d/d uteri. Trp63 appears to be uterine body and horns (Fig. 3C). Within the uterine body, no downstream of Six1 because Trp63 is significantly reduced in DES þ þ clear differences in lesion morphology and staining patterns for Six1d/d uteri compared with the DES Six1 / mice (Supplemen- CK14, CK18, CK14/18, and P63 were observed between DES- tary Fig. S3A). Pten loss is a widely recognized driver of prostate þ þ exposed Six1 / and Six1d/d mice. However, in DES-exposed and endometrial carcinogenesis (44, 45). Conditional Pten dele- Six1d/d mice, uterine horn lesions showed distinct morphologic tion in mouse prostate and endometrial cancer models results in þ patterns and IHC markers, including most notably a lack of P63 rapid tumor formation, metastasis, and death (43, 46). Interest- þ and CK14 epithelial cells with discrete basal morphology ingly, Pten loss leads to highly proliferative squamobasal meta- (Fig. 3C). Rather, abnormal glands in Six1d/d mice were com- plastic changes, indicating its role in proliferation and cell fate. prised of a single luminal cell layer that in approximately 90% of This disease contrasts with that of DES-induced endometrial þ þ cases contained CK14 /18 labeled cells. Carcinoma lesions cancer, which progresses slowly, is locally highly invasive but þ þ comprised of CK14 /18 cells in DES Six1d/d exhibited significant rarely metastatic, and appears against a background of abnor- þ expansion of atypical glands as well as stromal and myometrial mally differentiated CK14 basal and poorly differentiated þ þ invasion that distinguished them from focal glandular dysplasia/ CK14 /18 cells but not florid epithelial hyperplasia. Taken carcinoma in situ in CO Six1d/d described above. Although the together, these findings suggest that DES-induced endometrial degree of basal cell metaplasia was strikingly different between cancer functions through a Pten-independent pathway. þ þ DES Six1 / and Six1d/d groups, both exhibited neoplastic lesions To determine how many genes exhibited a pattern of "protec- þ þ containing CK14 /18 cells (Table 1). It is important to note that tion" from DES-induced gene expression changes, we performed neoplastic cells within DES-exposed Six1d/d mice were not con- EPIG analysis (38). The resulting patterns are shown in Supple- fined to a particular uterine area (i.e., uterine horn or uterine mentary Fig. S3B. Only one pattern exhibited the protection þ þ body; Table 1). This finding indicates that conditional Six1 pattern of interest: genes that were upregulated in DES Six1 / þ þ deletion does not shift the location of carcinoma development compared with CO Six1 / with DES Six1d/d having gene expres- þ þ in a way that is similar to the shift in the appearance of basal cell sion more similar to CO Six1 / (pattern outlined in red; Sup- metaplasia (i.e., tumors were not confined to the uterine body plementary Fig. S3B). A GO analysis of the 585 genes in this similar to the basal cell metaplasia). Taken together, these find- pattern revealed that the 20 most highly significant categories ings suggest that within the uterine horn, SIX1 is required were all related to mitosis/cell division (Supplementary Tables upstream of P63 for basal cell differentiation and acts as a driver S2I and S2J). These findings suggest that SIX1 mediates some of for distinct adenobasal carcinoma morphology following DES the impact of DES on cell proliferation in the uterus. exposure. þ þ Gene expression analysis of uteri from DES Six1d/d versus CK14 /18 cells are a feature of human endometrial cancer þ þ Six1 / mice identified 993 DEGs (Fig. 3D; Supplementary The Six1 knockout mouse model highlighted the potential role þ þ Table S2E). The most significantly altered GO categories were of poorly differentiated CK14 /18 cells as a progenitor popu- immune response (31 genes; GO Score: 24, P ¼ 5.10E11), lation in endometrial cancer development. To determine whether epithelial cell differentiation (19 genes; GO Score: 22, P ¼ similar cells were present in human endometrial cancer, dual 3.7E10) and epidermis development (19 genes; GO Score: 20, CK14/18 IHC was performed on human endometrial TMAs þ þ P ¼ 1.3E9; Supplementary Table S2F). The majority of genes (Table 2; Fig. 4). CK14 /18 cell labeling was assessed both in all of these categories were downregulated. Downregulation manually and by digital image analysis. Features of the human þ þ þ þ of Krt14 and Trp63 was confirmed in DES Six1d/d versus Six1 / CK14 /18 cells were similar to those identified in mice (Fig. 4A). þ þ by real-time RT-PCR (Supplementary Fig. S3A). Alterations in CK14 /18 labeled cells lacked clear luminal or basal morphol- þ immune response pathways may arise from the role of SIX1 in ogy and were often embedded within areas of CK14 /18 lumi- uterine epithelial differentiation, which if disrupted, may nal epithelium or migrating into adjacent stroma as atypical impact the epithelium's function as a mucosal immune barrier. individual cells or cell clusters. Manual and digital analyses were

www.aacrjournals.org Mol Cancer Res; 2019 OF9

Suen et al.

Table 2. Presence of CK14þ/18þ cells in endometrial cancer patients categorized by histopathologic diagnosis # Patients with # Patients without % Patients with Category Diagnosis # Patients CK14þ/18þ CK14þ/18þ CK14þ/18þ Normal Normal 29 0 29 0% Nonneoplastic Normal cancer-adjacent 8 0 8 0% Hyperplasia 4 0 4 0% Preneoplastic Atypical hyperplasia 1 0 1 0% Neoplastic Endometrioid adenocarcinoma 157 51 106 32% Clear cell carcinoma 2 1 1 50% Mucinous carcinoma 1 1 0 100% Adenosquamous carcinoma 7 4 3 57% Squamous carcinoma 4 3 1 75% Undifferentiated carcinoma 1 1 0 100% Stromal sarcoma 5 0 5 0% Mixed Mullerian tumor 2 1 1 50% Chorionic carcinoma 2 1 1 50%

þ þ generally consistent in the identification of CK14 /18 labeling, endometrial glands, as was observed in much larger sections from þ þ þ þ and neither analyses identified any CK14 /18 labeling in CO Six1 / mice. Both manual and digital techniques identified þ þ patients with normal or nonneoplastic endometrial tissue. It CK14 /18 neoplastic cells as a feature in approximately 30% of should be noted that this analysis, using small TMA cores, cannot endometrial cancers, although the manual analysis identified 17 þ þ þ þ þ þ rule out the possibility of rare CK14 /18 cells in normal human more patients with CK14 /18 cells (Fig. 4B and C). CK14 /18

Figure 4. Incidence of CK14þ/18þ cells within normal, cancer adjacent normal, hyperplastic, and neoplastic human endometrial tissue. A, Dual CK14/18 IHC of normal luminal epithelium comprised of CK14/18þ cells (top; CK14/18þ, brown), neoplastic tissue comprised of distinct luminal CK14/18þ and basal CK14þ/18 cells (middle; CK14/18þ, brown; CK14þ/18, aqua), and neoplastic tissue comprised of mixed CK14þ/18þ cells embedded within luminal CK14/18þ cells (bottom; CK14/18þ, brown; CK18þ/14þ, forest green). Original objective, 20; scale bar, 25 mm. B and C, Incidence of normal and cancer patients with CK14þ/18þ cells as determined by manual evaluation (B, manual) and quantitative image analysis (C, digital). n ¼ 29 normal patients and n ¼ 181 cancer patients. Two-tailed Fisher exact test. , P < 0.05. D and E, Percentage of cancer patients with CK14þ/18þ cells identiﬁed by manual evaluation and separated by stage (D; stage I: n ¼ 134, 2 stage II: n ¼ 32, stage III: n ¼ 14) or grade (E;G1:n ¼ 30, G2: n ¼ 72, and G3: n ¼ 57). c test for trend. , P < 0.05 compared with stage I or G1, respectively.

OF10 Mol Cancer Res; 2019 Molecular Cancer Research

SIX1 in Endometrial Metaplasia and Carcinogenesis

Figure 5. Model for aberrant epithelial differentiation and carcinogenesis in DES-induced endometrial cancer. During normal endometrial epithelial development, SIX1 is required for complete differentiation of CK14þ/18þ cells. When Six1þ/þ mice are neonatally exposed to DES, poorly differentiated CK14þ/18þ cells are initiated, serving as a pool of progenitor cells that are transformed and promoted to become neoplastic by endogenous estrogens over time. However, SIX1 overexpression directs most CK14þ/18þ cells down a differentiation pathway (uniformly SIX1þ basal or luminal cells within metaplastic glands), thereby decreasing the pool of CK14þ/18þ available to continue transformation. This process delays, but does not prevent, the transformation of poorly differentiated CK14þ/18þ progenitor cells or fully differentiated basal CK14þ/18 or luminal CK14/18þ cells that will eventually form a heterogenous tumor morphology. In the absence of SIX1 in CO Six1d/d mice, poorly differentiated CK14þ/18þ cells fail to fully differentiate, leading to glandular dysplasia and/or carcinoma in situ. When Six1d/d mice are neonatally exposed to DES, SIX1 is not present to direct initiated CK14þ/18þ cells to a more differentiated state. As a result, there is an increased opportunity for the pool of CK14þ/18þ cells to continue down the transformation trajectory, leading to decreased cancer latency.

þ þ cells comprised only a small portion of cells present within the CK14 /18 cell size and core area). The manual assessment was core; the manual average severity score was 1.7 (6–10 cells based likely more accurate because visual inspection of biopsies from þ þ þ þ on scoring criteria) and the average percent area of CK14 /18 – the 17 patients considered negative for CK14 /18 labeling by þ þ labeled core tissue was 0.12% (20 cells based on average digital image analysis clearly indicated CK14 /18 labeling in at

www.aacrjournals.org Mol Cancer Res; 2019 OF11

Suen et al.

þ þ þ þ least one discrete cell. Further analysis of CK14 /18 cores of the CK14 /18 population either directly (e.g. via ER identified by manual assessment showed that the presence of activation) or indirectly (e.g., via increased response to endog- þ þ CK14 /18 –labeled cells positively correlated with both increas- enous estrogen levels after puberty; refs. 6, 50). The initiated þ þ ing cancer stage and grade (Fig. 4D and E). These findings are CK14 /18 cells that may ultimately become transformed þ þ consistent with the idea that poorly differentiated CK14 /18 serve as a pool of cancer cells-of-origin (51, 52). Persistent þ þ cells could serve both as progenitor cells that may become upregulation of SIX1 enables many of the CK14 /18 cells to þ þ transformed in the human endometrium and as a biomarker of differentiate into mature CK14 /18 /SIX1 basal cells or þ þ more aggressive disease. CK14 /18 /SIX1 luminal cells. These basal cells surround luminal cells and may in some cases progress to squamous þ metaplasia (12). SIX1 cell types that exhibit more mature þ þ Discussion basal (CK14 /18 )orluminal(CK14/18 ) differentiation þ We previously identified basal CK14 /18 and poorly differ- patterns may be inherently less susceptible to transformation þ þ entiated CK14 /18 epithelial cell populations associated with because of their more advanced differentiation state (53, 54). neoplastic lesions developing after neonatal DES exposure and In our model, the absence of SIX1 results in a differentiation þ þ showed that SIX1 overexpression precedes and localizes to these blockade of CK14 /18 epithelial cells, leading to dysplastic abnormal cell populations. These findings led us to hypothesize endometrial glands and a larger pool of progenitor cells that that SIX1 is a driver of these aberrant differentiation path- may be later promoted to neoplasia following DES exposure. ways (12). Here, we show that SIX1 mediates development of Treatment strategies for human endometrial cancer are cur- þ CK14 /18 basal cells specifically in the uterine horns, but it is rently driven by surgical staging and tumor histology (55, 56). þ þ not required for the development of CK14 /18 cells or endo- Endometrial cancers are commonly separated into two subtypes metrial cancer. In the absence of SIX1, epithelial cells coexpressing characterized by aggressiveness, hormone responsiveness, and both CK14 and CK18 become a prominent feature of atypical and histology. Type I tumors are the most common (85% preva- neoplastic lesions in the uterine horns, and DES-induced endo- lence) and are typically less aggressive, dependent upon estrogen, metrial carcinomas develop more rapidly. These results suggest and endometrioid by histopathology. In contrast, type II tumors that SIX1 may act as a cancer-protective factor that facilitates basal are less common (15%), generally more aggressive, and estro- þ þ differentiation of poorly differentiated CK14 /18 progenitor gen independent with serous, clear cell, or undifferentiated mor- cells, preventing or decreasing their transformation. Importantly, phology (57, 58). Early-stage endometrioid disease has a favor- these results also provide a mechanistic link between develop- able (95%) 5-year survival rate, but the survival rate decreases mental exposure to an estrogenic chemical, altered transcription rapidly for later stage disease (III: 67% and IV: 16%; ref. 59). High- factor expression, and disease phenotype. stage and/or grade tumors with endometrioid histology have a Although SIX1 has been studied primarily as a developmen- less favorable outcome and demonstrate molecular characteristics tal driver and oncoprotein, our findings clearly demonstrate that overlap between both type I and II (60). Morphologic and that SIX1 also serves as an epithelial differentiation factor in the molecular subclassification to identify key tumor signaling path- endometrium. This findingisconsistentwithpreviousstudies ways will provide information to help develop and guide tissue- investigating SIX1 as a regulator of specific stem cell popula- agnostic therapeutic strategies in combination with surgery, che- þ þ tions. For example, increased expression of SIX1 promotes motherapy, and radiation. Here, we show that the CK14 /18 cell differentiation in muscle stem cells, whereas ablation of Six1 labeling is a feature of 32% of endometrioid tumors and corre- during muscle regeneration results in an increased number of lates with increasing cancer stage and grade, suggesting its use as a muscle stem cells and diminished capacity of muscle stem cells biomarker for less differentiated, high stage or grade type I þ þ to regenerate functional muscle (23, 47). SIX1 is also one of tumors. We propose that CK14 /18 labeling is a novel combi- several transcription factors that promote differentiation of nation biomarker for endometrial cancer that may support cur- mesenchymal stem cells into brown adipocytes (48). Human rent classification protocols of poorly differentiated and/or more embryonic stem cells can be induced to differentiate into aggressive disease. Identification of clinically actionable biomar- lacrimal gland epithelial-like cells by simultaneous overexpres- kers will continue to improve treatment strategies and disease sion of three transcription factors, SIX1, PAX6, and FOXC1 (49). outcomes and may provide insights into how environmental Notably, lacrimal gland cells have certain features similar to exposures can impact health and disease. that of the endometrial epithelium, including their glandular morphology and expression of characteristic genes, including Disclosure of Potential Conflicts of Interest CK15, aquaporin 5, and lactoferrin (49). Together with our No potential conflicts of interest were disclosed. findings, these data demonstrate the dynamic and tissue- fi speci c role of SIX1 in regulating progenitor cell populations Authors' Contributions and promoting differentiation. Conception and design: A.A. Suen, W.N. Jefferson, C.E. Wood, C.J. Williams We propose the following model for the role of SIX1 in Development of methodology: A.A. Suen, C.E. Wood carcinogenesis following neonatal DES exposure (Fig. 5). Dur- Acquisition of data (provided animals, acquired and managed patients, ing normal uterine development, a population of poorly provided facilities, etc.): A.A. Suen, W.N. Jefferson, C.E. Wood, C.J. Williams þ þ differentiated CK14 /18 epithelial cells arise in the endome- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, trial glands. Under normal conditions (no DES exposure) computational analysis): A.A. Suen, W.N. Jefferson, C.E. Wood, C.J. Williams Writing, review, and/or revision of the manuscript: A.A. Suen, W.N. Jefferson, transient SIX1 expression mediates differentiation of these þ C.E. Wood, C.J. Williams cells into mature luminal CK14 /18 cells in the presence Administrative, technical, or material support (i.e., reporting or organizing of endogenous estrogen. Neonatal exposure to DES results data, constructing databases): C.E. Wood in epigenetic alterations that lead to initiation and promotion Study supervision: C.J. Williams

OF12 Mol Cancer Res; 2019 Molecular Cancer Research

SIX1 in Endometrial Metaplasia and Carcinogenesis

Acknowledgments and the Oak Ridge Institute for Science and Education program The authors would like to thank Elizabeth Padilla-Banks, Min Shi, (A.A. Suen). Norris Flagler, and the NIEHS Histology, Immunohistochemistry, Electron Microscopy, Genomics, Imaging, and Graphics Cores for technical expertise and support. The authors would also like to thank The costs of publication of this article were defrayed in part by the payment of Drs. Franco DeMayo and Harriet Kinyamu for their detailed critiques page charges. This article must therefore be hereby marked advertisement in of this article. This work was supported by the Intramural Research accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Program of the NIH, National Institutes of Environmental Health Sciences, 1ZIAES102405 (C.J. Williams), the U.S. Environmental Received May 6, 2019; revised August 8, 2019; accepted September 27, 2019; Protection Agency Ofﬁce of Research and Development (C.E. Wood), published ﬁrst October 9, 2019.

References 1. Newbold RR, Jefferson WN, Grissom SF, Padilla-Banks E, Snyder RJ, 19. Kingsbury TJ, Kim M, Civin CI. Regulation of cancer stem cell properties by Lobenhofer EK. Developmental exposure to diethylstilbestrol alters uter- SIX1, a member of the PAX-SIX-EYA-DACH network. Adv Cancer Res 2019; ine gene expression that may be associated with uterine neoplasia later in 141:1–42. life. Mol Carcinog 2007;46:783–96. 20. Laclef C, Souil E, Demignon J, Maire P. Thymus, kidney and craniofacial 2. Herbst AL, Poskanzer DC, Robboy SJ, Friedlander L, Scully RE. Prenatal abnormalities in Six1 deficient mice. Mech Dev 2003;120:669–79. exposure to stilbestrol. A prospective comparison of exposed female 21. Wang J, Liu M, Zhao L, Li Y, Zhang M, Jin Y, et al. Disabling of nephrogen- offspring with unexposed controls. N Engl J Med 1975;292:334–9. esis in porcine embryos via CRISPR/Cas9-mediated SIX1 and SIX4 gene 3. O'Brien PC, Noller KL, Robboy SJ, Barnes AB, Kaufman RH, Tilley BC, targeting. Xenotransplantation 2019;26:e12484. et al. Vaginal epithelial changes in young women enrolled in the 22. Swetha G, Chandra V, Phadnis S, Bhonde R. Glomerular parietal epithelial National Cooperative Diethylstilbestrol Adenosis (DESAD) project. cells of adult murine kidney undergo EMT to generate cells with traits of Obstet Gynecol 1979;53:300–8. renal progenitors. J Cell Mol Med 2011;15:396–413. 4. Herbst AL, Ulfelder H, Poskanzer DC. Adenocarcinoma of the vagina. 23. Le Grand F, Grifone R, Mourikis P, Houbron C, Gigaud C, Pujol J, et al. Six1 Association of maternal stilbestrol therapy with tumor appearance in regulates stem cell repair potential and self-renewal during skeletal muscle young women. N Engl J Med 1971;284:878–81. regeneration. J Cell Biol 2012;198:815–32. 5. Hoover RN, Hyer M, Pfeiffer RM, Adam E, Bond B, Cheville AL, et al. 24.RufRG,XuPX,SilviusD,OttoEA,BeekmannF,MuerbUT,etal. Adverse health outcomes in women exposed in utero to diethylstilbestrol. SIX1 mutations cause branchio-oto-renal syndrome by disruption of N Engl J Med 2011;365:1304–14. EYA1-SIX1-DNA complexes. Proc Natl Acad Sci U S A 2004;101: 6. Newbold RR, Bullock BC, McLachlan JA. Uterine adenocarcinoma in mice 8090–5. following developmental treatment with estrogens: a model for hormonal 25. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell carcinogenesis. Cancer Res 1990;50:7677–81. 2011;144:646–74. 7. Newbold RR, Padilla-Banks E, Jefferson WN. Adverse effects of the model 26. Blevins MA, Towers CG, Patrick AN, Zhao R, Ford HL. The SIX1-EYA environmental estrogen diethylstilbestrol are transmitted to subsequent transcriptional complex as a therapeutic target in cancer. Expert Opin Ther generations. Endocrinology 2006;147:S11–7. Targets 2015;19:213–25. 8. Newbold RR. Effects of developmental exposure to diethylstilbestrol 27. Xin X, Li Y, Yang X. SIX1 is overexpressed in endometrial carcinoma and (DES) in rodents: clues for other environmental estrogens. APMIS 2001; promotes the malignant behavior of cancer cells through ERK and AKT 109:S261–71. signaling. Oncol Lett 2016;12:3435–40. 9. Jefferson WN, Padilla-Banks E, Phelps JY, Gerrish KE, Williams CJ. Per- 28. Soyal SM, Mukherjee A, Lee KY, Li J, Li H, DeMayo FJ, et al. Cre-mediated manent oviduct posteriorization after neonatal exposure to the phytoes- recombination in cell lineages that express the progesterone receptor. trogen genistein. Environ Health Perspect 2011;119:1575–82. Genesis 2005;41:58–66. 10. Jefferson WN, Padilla-Banks E, Phelps JY, Cantor AM, Williams CJ. Neo- 29. Dunlap KA, Filant J, Hayashi K, Rucker EB 3rd, Song G, Deng JM, et al. natal phytoestrogen exposure alters oviduct mucosal immune response to Postnatal deletion of Wnt7a inhibits uterine gland morphogenesis and pregnancy and affects preimplantation embryo development in the compromises adult fertility in mice. Biol Reprod 2011;85:386–96. mouse. Biol Reprod 2012;87:10, 1-. 30. Newbold RR, Banks EP, Bullock B, Jefferson WN. Uterine adenocarci- 11. Jefferson WN, Chevalier DM, Phelps JY, Cantor AM, Padilla-Banks E, noma in mice treated neonatally with genistein. Cancer Res 2001;61: Newbold RR, et al. Persistently altered epigenetic marks in the mouse 4325–8. uterus after neonatal estrogen exposure. Mol Endocrinol 2013;27: 31. Couse JF, Davis VL, Hanson RB, Jefferson WN, McLachlan JA, Bullock BC, 1666–77. et al. Accelerated onset of uterine tumors in transgenic mice with aberrant 12. Suen AA, Jefferson WN, Williams CJ, Wood CE. Differentiation patterns of expression of the estrogen receptor after neonatal exposure to diethylstil- uterine carcinomas and precursor lesions induced by neonatal estrogen bestrol. Mol Carcinog 1997;19:236–42. exposure in mice. Toxicol Pathol 2018;46:574–96. 32. Davis VL, Newbold RR, Couse JF, Rea SL, Gallagher KM, Hamilton KJ, et al. 13. Suen AA, Jefferson WN, Wood CE, Padilla-Banks E, Bae-Jump VL, Williams Expression of a dominant negative estrogen receptor alpha variant in CJ. SIX1 oncoprotein as a biomarker in a model of hormonal carcinogen- transgenic mice accelerates uterine cancer induced by the potent estrogen esis and in human endometrial cancer. Mol Cancer Res 2016;14:849–58. diethylstilbestrol. Reprod Toxicol 2012;34:512–21. 14. Li X, Oghi KA, Zhang J, Krones A, Bush KT, Glass CK, et al. Eya protein 33. Creasman WT. Endometrial Cancer Staging. 2015. Available from: http:// phosphatase activity regulates Six1-Dach-Eya transcriptional effects in emedicine.medscape.com/article/2006791-overview. mammalian organogenesis. Nature 2003;426:247–54. 34. Painter JT, Clayton NP, Herbert RA. Useful immunohistochemical markers 15. Christensen KL, Patrick AN, McCoy EL, Ford HL. The six family of of tumor differentiation. Toxicol Pathol 2010;38:131–41. homeobox genes in development and cancer. Adv Cancer Res 2008; 35. Dixon D, Alison R, Bach U, Colman K, Foley GL, Harleman JH, et al. 101:93–126. Nonproliferative and proliferative lesions of the rat and mouse female 16. Wu W, Ren Z, Li P, Yu D, Chen J, Huang R, et al. Six1: a critical transcription reproductive system. J Toxicol Pathol 2014;27:1s–107s. factor in tumorigenesis. Int J Cancer 2015;136:1245–53. 36. Pfaffl MW. A new mathematical model for relative quantification in 17. Liu Y, Han N, Zhou S, Zhou R, Yuan X, Xu H, et al. The DACH/EYA/SIX gene real-time RT-PCR. Nucleic Acids Res 2001;29:e45. network and its role in tumor initiation and progression. Int J Cancer 2016; 37. NextBio. Available from: http://www.nextbio.com/b/nextbio.nb. 138:1067–75. 38. Chou JW, Zhou T, Kaufmann WK, Paules RS, Bushel PR. Extracting gene 18. Kumar JP. The sine oculis homeobox (SIX) family of transcription expression patterns and identifying co-expressed genes from microarray factors as regulators of development and disease. Cell Mol Life Sci data reveals biologically responsive processes. BMC Bioinformatics 2007; 2009;66:565–83. 8:427.

www.aacrjournals.org Mol Cancer Res; 2019 OF13

Suen et al.

39. National Cancer Institute. NCI Dictionary of Cancer Terms, 1803D. 2018. 49. Hirayama M, Ko SBH, Kawakita T, Akiyama T, Goparaju SK, Soma A, et al. Available from: https://www.cancer.gov/publications/dictionaries/cancer- Identification of transcription factors that promote the differentiation of terms. human pluripotent stem cells into lacrimal gland epithelium-like cells. 40. Franco HL, Lee KY, Broaddus RR, White LD, Lanske B, Lydon JP, et al. NPJ Aging Mech Dis 2017;3:1. Ablation of Indian hedgehog in the murine uterus results in decreased cell 50. Ostrander PL, Mills KT, Bern HA. Long-term responses of the mouse uterus cycle progression, aberrant epidermal growth factor signaling, and to neonatal diethylstilbestrol treatment and to later sex hormone exposure. increased estrogen signaling. Biol Reprod 2010;82:783–90. J Natl Cancer Inst 1985;74:121–35. 41. Wang X, Li X, Wang T, Wu SP, Jeong JW, Kim TH, et al. SOX17 regulates 51. Visvader JE. Cells of origin in cancer. Nature 2011;469:314–22. uterine epithelial-stromal cross-talk acting via a distal enhancer upstream 52. Rycaj K, Tang DG.Cell-of-origin of cancer versus cancer stem cells: assays of Ihh. Nat Commun 2018;9:4421. and interpretations. Cancer Res 2015;75:4003–11. 42. Cooke PS, Spencer TE, Bartol FF, Hayashi K. Uterine glands: development, 53. Schwitalla S, Fingerle AA, Cammareri P, Nebelsiek T, Goktuna SI, Ziegler function and experimental model systems. Mol Hum Reprod 2013;19: PK, et al. Intestinal tumorigenesis initiated by dedifferentiation and 547–58. acquisition of stem-cell-like properties. Cell 2013;152:25–38. 43. Wang ZA, Mitrofanova A, Bergren SK, Abate-Shen C, Cardiff RD, Califano 54. White AC, Lowry WE.Refining the role for adult stem cells as cancer cells of A, et al. Lineage analysis of basal epithelial cells reveals their unexpected origin. Trends Cell Biol 2015;25:11–20. plasticity and supports a cell-of-origin model for prostate cancer hetero- 55. Creasman WT, Odicino F, Maisonneuve P, Quinn MA, Beller U, Benedet JL, geneity. Nat Cell Biol 2013;15:274–83. et al. Carcinoma of the corpus uteri. FIGO 26th annual report on the results 44. Cairns P, Okami K, Halachmi S, Halachmi N, Esteller M, Herman JG, et al. of treatment in gynecological cancer. Int J Gynaecol Obstet 2006;95: Frequent inactivation of PTEN/MMAC1 in primary prostate cancer. S105–43. Cancer Res 1997;57:4997–5000. 56. Arend RC, Jones BA, Martinez A, Goodfellow P. Endometrial cancer: 45. Kong D, Suzuki A, Zou TT, Sakurada A, Kemp LW, Wakatsuki S, et al. PTEN1 molecular markers and management of advanced stage disease. is frequently mutated in primary endometrial carcinomas. Nat Genet 1997; Gynecol Oncol 2018;150:569–80. 17:143–4. 57. Bokhman JV. Two pathogenetic types of endometrial carcinoma. 46. Daikoku T, Hirota Y, Tranguch S, Joshi AR, DeMayo FJ, Lydon JP, et al. Gynecol Oncol 1983;15:10–7. Conditional loss of uterine Pten unfailingly and rapidly induces endome- 58. Felix AS, Weissfeld JL, Stone RA, Bowser R, Chivukula M, Edwards RP, trial cancer in mice. Cancer Res 2008;68:5619–27. et al. Factors associated with Type I and Type II endometrial cancer. 47. Yajima H, Motohashi N, Ono Y, Sato S, Ikeda K, Masuda S, et al. Six family Cancer Causes Control 2010;21:1851–6. genes control the proliferation and differentiation of muscle satellite cells. 59. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin Exp Cell Res 2010;316:2932–44. 2013;63:11–30. 48. Brunmeir R, Wu J, Peng X, Kim SY, Julien SG, Zhang Q, et al. Comparative 60. Alvarez T, Miller E, Duska L, Oliva E. Molecular profile of grade 3 transcriptomic and epigenomic analyses reveal new regulators of murine endometrioid endometrial carcinoma: is it a type I or type II endometrial brown adipogenesis. PLoS Genet 2016;12:e1006474. carcinoma? Am J Surg Pathol 2012;36:753–61.

OF14 Mol Cancer Res; 2019 Molecular Cancer Research

SIX1 Regulates Aberrant Endometrial Epithelial Cell Differentiation and Cancer Latency Following Developmental Estrogenic Chemical Exposure

Alisa A. Suen, Wendy N. Jefferson, Charles E. Wood, et al.

Mol Cancer Res Published OnlineFirst October 9, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-19-0475

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2019/10/09/1541-7786.MCR-19-0475.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2019/10/30/1541-7786.MCR-19-0475. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.