Nonsteroid Anti-Inflammatory Drugs Inhibit Both the Activity and the Inflammation-Induced Expression of Acid-Sensing Ion Channel

The Journal of Neuroscience, October 15, 2001, 21(20):8026–8033 Nonsteroid Anti-Inflammatory Drugs Inhibit Both the Activity and the Inflammation-Induced Expression of Acid-Sensing Ion Channels in Nociceptors Nicolas Voilley, Jan de Weille, Julien Mamet, and Michel Lazdunski Institut de Pharmacologie Mole´ culaire et Cellulaire, Centre National de la Recherche Scientifique Unite´ , Mixte de Recherche 6097, Sophia Antipolis, 06560 Valbonne, France Nonsteroid anti-inflammatory drugs (NSAIDs) are major drugs neurons along with substance P and isolectin B4 and that, in against inflammation and pain. They are well known inhibitors case of inflammation, ASIC1a appears in some larger A␤ fibers, of cyclooxygenases (COXs). However, many studies indicate (2) that NSAIDs prevent the large increase of ASIC expression in that they may also act on other targets. Acidosis is observed in sensory neurons induced by inflammation, and (3) that NSAIDs inflammatory conditions such as chronic joint inflammation, in such as aspirin, diclofenac, and flurbiprofen directly inhibit tumors and after ischemia, and greatly contributes to pain and ASIC currents on sensory neurons and when cloned ASICs are hyperalgesia. Administration of NSAIDs reduces low-pH- heterologously expressed. These results suggest that the com- induced pain. The acid sensitivity of nociceptors is associated bined capacity to block COXs and inhibit both inflammation- with activation of H ϩ-gated ion channels. Several of these, induced expression and activity of ASICs present in nocicep- cloned recently, correspond to the acid-sensing ion channels tors is an important factor in the action of NSAIDs against pain. (ASICs) and others to the vanilloid receptor family. This paper Key words: acid-sensing ion channel; inflammation; dorsal shows (1) that ASIC mRNAs are present in many small sensory root ganglion; nociception; aspirin; NSAID Nonsteroid anti-inflammatory drugs (NSAIDs) have been gener- been identified and characterized: ASIC1a (Waldmann et al., ally considered as inhibitors of cyclooxygenases (COXs) (Walker, 1997a) and its splice variant ASIC1b (Chen et al., 1998), both 1995; Vane and Botting, 1998). Their anti-inflammatory and present in dorsal root ganglion (DRG) neurons; ASIC2a (Wald- analgesic action is thought to be mainly mediated via this inhibi- mann et al., 1996) and ASIC2b (Lingueglia et al., 1997), the latter tion. However, data have been accumulating through the years being the more abundant in DRGs and the former being only suggesting that NSAIDs also probably act on other targets to present in large DRG neurons (Garcia-Anõveros et al., 2001); counteract pain. One recent result in this regard is that COX-1- and ASIC3 (Waldmann et al., 1997b), abundant in peripheral and COX-2-deficient mice still show sensitivity to the analgesic sensory neurons and thought to mediate cardiac ischemic pain action of NSAIDs (Ballou et al., 2000). On the other hand, (Sutherland et al., 2001). This paper examines the relationships administration of NSAIDs reduces both cutaneous (Steen et al., between ASICs, nociceptors, and inflammatory pain and shows 1996) and corneal (Chen et al., 1997) pain induced by exposure to that NSAIDs inhibit the activity of this class of channels in a acidic pH in the absence of inflammation. COX-independent way, as well as their inflammation-induced Tissue acidosis is a dominant factor in inflammation and in expression. tumors and after ischemia (Reeh and Steen, 1996; Helmlinger et al., 1997) and has an important contribution in pain and hyper- MATERIALS AND METHODS algesia (Steen and Reeh, 1993; Steen et al., 1995). This is attrib- In situ hybridization. Sections (12 ␮m thick) of L4–L5 DRGs from normal utable to direct excitation of nociceptive sensory neurons by or inflamed adult rats were fixed and hybridized (15 hr at 52°C) in 12.5% ϩ formamide, 4ϫ SSC, 2.5ϫ Denhardt’s solution, 250 ␮g/ml herring sperm H -gated currents (Krishtal and Pidoplichko, 1981a; Bevan and DNA, 125 ␮g/ml yeast tRNA, and 5 ng/␮l oligonucleotides labeled with Yeats, 1991). Several channels corresponding to these currents biotin-21-dUTP by terminal transferase. For fluorescent labeling, detec- have been cloned recently and belong to the acid-sensing ion tion was performed with the ELF-97 mRNA In situ Hybridization kit channel (ASIC) family (Waldmann et al., 1996, 1997a,b; Lingue- (Molecular Probes, Eugene, OR) based on streptavidin–alkaline phos- phatase–biotinylated probe interaction and the substrate ELF-97, which glia et al., 1997; Chen et al., 1998) and to the vanilloid receptor yields green fluorescent precipitates. For diaminobenzidine labeling, family (Caterina et al., 1997; Tominaga et al., 1998) (for review, detection was performed with Dako (High Wycombe, UK) GenPoint see Kress and Zeilhofer, 1999). Different ASIC isoforms have with two cycles of amplification. Counterstain used hematoxylin. Probes were as follows: ASIC1a, CATTCTTGGAGACTTGGCTAAAGCG- GAAC; ASIC1b, GGGTCATCACTCTCATCCAGTCCTAGCAT; Received June 11, 2001; revised July 20, 2001; accepted July 26, 2001. ASIC2b, CCCAAACGGTCCATGAAGGCAGC; and ASIC3, CTGT- This work was supported by the Centre National de la Recherche Scientifique, the TCCAGAAATACCCCAGGAC. Results were confirmed with a second Association Française contre les Myopathies, and the Association pour la Recherche set of probes. Control experiments were performed with ASIC1a sense sur le Cancer. We thank Dr. F. Kuper and Dr. A. Baron for fruitful discussion and M. Jodar and C. Widmann for expert technical assistance. oligonucleotide (CACAGATGGCTGATGAAAAGCAG), and back- Correspondence should be addressed to Prof. Michel Lazdunski, Institut de ground was assessed without probe. Each experiment was done on at Pharmacologie Molećulaire et Cellulaire, Centre National de la Recherche Scien- least three animals. tifique Unite´ Mixte de Recherche 6097, 660 route des Lucioles, Sophia Antipolis, Substance P immunochemistry and isolectin B4 binding. After in situ 06560 Valbonne, France. E-mail: [email protected]. hybridization, slides were treated with anti-substance P (SP) antibody Copyright © 2001 Society for Neuroscience 0270-6474/01/218026-08$15.00/0 (dilution of 1:100; Sigma, St. Louis, MO) and revealed with anti-IgG Voilley et al. • NSAIDs Block the Activity and Expression of ASICs J. Neurosci., October 15, 2001, 21(20):8026–8033 8027 Texas Red-coupled antibodies (Jackson ImmunoResearch, West Grove, IB4-positive cells. Some SP-positive (40 Ϯ 8%) and IB4-positive PA). For isolectin B4 (IB4) binding, FITC-labeled IB4 was applied at (48 Ϯ 13%) cells do not express ASIC1a. ASIC3 is expressed in 12.5 ␮g/ml. IB4-positive cells appeared green, which was changed to red 50 Ϯ 7% of SP-positive and 43 Ϯ 9% of IB4-positive cells. Some with Adobe PhotoShop 5.0 (Adobe Systems, San Jose, CA) before Ϯ Ϯ superposition with ASIC-labeled pictures. Cell proportions and profiles SP-positive (48 13%) and IB4-positive (39 15%) cells do not were calculated by measuring individually and counting cells. express ASIC3. Similar labeling patterns were observed for Inflammation experiments. Right hindpaws of anesthetized male ASIC1b and for ASIC2b (data not shown), which are expressed in ␮ Wistar rats (7–9 weeks) were inflamed by a 50 l injection of complete SP- and IB4-positive and -negative neurons in the same propor- Freund’s adjuvant (Stein et al., 1988). L4–L5 DRGs were removed at day 2 on both sides, the left ganglia serving as negative controls. The tions as the other ASICs (i.e., 40–50%). anti-inflammatory drug was infused intraperitoneally when the injection In normal conditions, ASIC1a mRNA is mainly expressed in of adjuvant was given and was repeated the next day. The drugs used cells with cross-sectional areas between 200 and 600 ␮m 2 (mean were (in mg/kg): 8 diclofenac, 4 ibuprofen, 40 salicylate, 40 aspirin, 20 area, 522 Ϯ 36 ␮m 2) that correspond to cell diameters between 15 nimesulide, 8 nordihydroguaiaretic acid (NDGA), 0.1 dexamethasone ␮ (all from Sigma), 20 Zileuton (kindly provided by Abbott Labs, Irving, and 30 m (Fig. 1B). In inflammatory conditions, this area Ϯ ␮ 2 Ͻ TX), or 20 MK-886 (kindly provided by Merck-Frosst, Dorval, Quebec, increases significantly to 722 39 m ( p 0.001). This increase Canada). can be explained by the appearance of a population of ASIC1a- Reverse transcription-PCR experiments. Total RNA (2 ␮g) was reverse positive cells with areas of 600–1200 ␮m 2 (i.e., 30–40 ␮min transcripted (First-strand cDNA synthesis kit; Amersham Pharmacia diameter). The area of cells coexpressing the ASIC1a transcript Biotech, Arlington Heights, IL). One-twentieth was used per PCR con- Ϯ ␮ 2 dition. Primers used were (5Ј–3Ј, sense/antisense): ASIC1a (Waldmann and SP is increased from 514 47 m in normal conditions to 2 et al., 1997a), CACAGATGGCTGATGAAAAGCAG/CATGGTAA- 664 Ϯ 30 ␮m in inflamed conditions ( p Ͻ 0.006) and the number CAGCATTGCAGGTGC; ASIC1b (Chen et al., 1998), ATGCCGT- of coexpressing cells from 40 Ϯ 4to62Ϯ 7% ( p Ͻ 0.03). No GCGGTTGTCCC/same as ASIC1a; ASIC2a (Waldmann et al., 1996), difference in ASIC3 distribution has been observed between TCAACCTACAGATTCCCGACCCG/CGAGTCCCATCTCTGAGGAC- Ϯ ␮ 2 Ϯ ␮ 2 CGG; ASIC2b (Lingueglia et al., 1997), CTGCCTTCATGGAC- normal (705 43 m ) and inflammatory (653 33 m ) CGTTTG/same as ASIC2a; ASIC3 (Waldmann et al., 1997b), CCCA- conditions (Fig. 1B). There is no significant difference for GACCCAGACCCAGCCCTCC/CTGTTCCAGAAATACCCCAGGAC; ASIC1b (560 Ϯ 28 vs 556 Ϯ 33 ␮m 2) and ASIC2b (677 Ϯ 35 vs and ␤-actin (Nudel et al., 1983), GTGCCCATCTATGAGGGT- 729

Load more