DNA Barcodes and Phylogenetic of Striped Snakehead and Ocellated Snakehead Fish from South Sumatra, Indonesia
Total Page：16
File Type：pdf, Size：1020Kb
BIODIVERSITAS ISSN: 1412-033X Volume 21, Number 3, March 2020 E-ISSN: 2085-4722 Pages: 1227-1235 DOI: 10.13057/biodiv/d210350 Short Communication: DNA barcodes and phylogenetic of striped snakehead and ocellated snakehead fish from South Sumatra, Indonesia MOCHAMAD SYAIFUDIN, MARINI WIJAYANTI, SEFTI HEZA DWINANTI, MUSLIM, MUHAMMAD MAHENDRA, SHELY MARLIANA Program of Aquaculture, Faculty of Agriculture, Universitas Sriwijaya. Jl. Raya Palembang-Prabumulih Km 32, Indralaya, Ogan Ilir 30662, South Sumatra, Indonesia. Tel.: +62-711-580663, Fax.: +62-711-580276, email: [email protected] Manuscript received: 4 December 2019. Revision accepted: 25 February 2020. Abstract. Syaifudin M, Wijayanti M, Dwinanti SH, Muslim, Mahendra M, Marliana S. 2020. DNA barcodes and phylogenetic of striped snakehead and ocellated snakehead fish from South Sumatra, Indonesia. Biodiversitas 21: 1227-1235. This research aimed to identify the sequences of cytochrome c oxidase subunit I gene mitochondrial DNA (COI mtDNA), to construct a phylogenetic tree of striped snakehead (Channa striata) and ocellated snakehead (Channa pleuropthalma), and to measure water quality of Kelekar River, Indralaya, Ogan Ilir District and Danau Burung Besar River, Penukal Abab Lematang Ilir (PALI) District in South Sumatra, Indonesia. The research procedures consisted of DNA isolation, amplification by PCR (Polymerase Chain Reaction) and sequencing of fragment COI mtDNA. The length of nucleotide was 604 bp for striped snakehead and 587-604 bp for ocellated snakehead. Optimum annealing temperature was 500C for 15 seconds with 30 cycles. The result of BLAST analysis showed that striped snakehead from Kelekar and Danau Burung Besar River had 100% identity to striped snakehead from Java-Bali and furthest (97%) with striped snakehead from India. Ocellated snakehead had 100% similarity with the same species from Musi Banyuasin and Banjarmasin; and furthest (83%) with Channa limbata from Myanmar. Water quality in Kelekar River were temperature 31-31.60C, pH 4.76-4.96, dissolved oxygen 2.7-3.0 mg/L, ammonia <0.009 mg/L, total alkalinity 20 mg/L, and turbidity 62.5-63 cm. Meanwhile in Danau Burung Besar River showed temperature (29.3-30.70C), pH (3.6-6.7), dissolved oxygen (1.31-3.76 mg/L), ammonia (0.17-0.20 mg/L), and turbidity (50-90 cm). Keywords: COI, ocellated snakehead, phylogenetics, striped snakehead INTRODUCTION species are Parachanna (Africa) (Froese and Pauly, 2018). Therefore, robust identification for species is important, Striped snakehead (Channa striata) is economically especially for comparison between wild and cultured important fish in Sumatra, Indonesia. There are some population dan rehabilitation program (Rajiv and Chauhan, popular foods made from this fish, for instance, pempek, 2010). Mitochondrial DNA can be used to investigate model, tekwan and cracker. Recently, domestication and evolutionary process with high resolution (Brown et al. artificial breeding of this fish have already been done, 1979). Sequencing of this region has been widely used to however genetic authentication of this fish is still limited in discriminate species level (Nagl et al. 2001) and population Indonesia. Growing this fish is also not successful until study (Rognon and Guyomard 1997; D’Amato et al. 2007). commercial size. Furthermore, decreasing water quality Cytochrome C Oxidase subunit I is one of mtDNA genes, due to land use change, pollution and overfishing lead to which is conserved, used for distinguishing species and decreasing in fish production in the wild. Therefore, fish population. genetic research, reproduction, and habitat characteristics The COI gene is one of the molecular markers used to in the wild are beneficial for initial attempt in aquaculture. identify a species (Ward et al. 2005) that has conservative Channidae has 2 genera i.e Channa and Parachanna. nucleotide base sequences and has little variation deletion, Channa is originally from Asia, while Parachanna is and insertion (Hebert et al. 2003). This technology (DNA native to Africa. All these fish in this family are known as barcoding) relies on the observation that the ‘barcode’ snakeheads (Courtenay and Williams 2004). There are four sequence divergence within species is typically much lower species of Channa in Kelekar River (Indralaya sub-district, than the divergence exhibited between species (Hebert et Ogan Ilir District) i.e toman (Channa micropeltes), serandang al. 2003). This technique has been widely used for (Channa pleuropthalma), gabus (Channa striata), and barcoding DNA for shark (Peloa et al. 2015), baung bujuk (Channa lucius) (Muslim, 2013). Ocellated Hemibagrus nemurus (Syaifudin et al. 2017), Pangasius snakehead, a native species in Musi River, Batanghari and Pangasius hypophthalmus (Pratama et al. 2017), wild stock Barito, has economic value for consumption in Sumatra and the first generation (F1) of Channa spp. (Irmawati et and Kalimantan (Kotellat et al. 1993). al. 2017), tilapia (Syaifudin et al. 2019), snakeskin gourami There are 37 species in family Channidae globally, and blue gourami (Syaifudin et al. 2019). This research which consisted of 34 species are Channa (Asia) and three aimed to obtain nucleotide sequences of COI gene of C. 1228 BIODIVERSITAS 21 (3): 1227-1235, March 2020 striata and C. plurophthalma, construct a phylogenetic tree samples that showed no observable RNA and comprising and characterize water quality of fish habitat in the Kelekar predominantly high molecular weight DNA were selected and Danau Burung Besar River in South Sumatra. for PCR (Polymerase Chain Reaction). DNA amplification MATERIALS AND METHODS In order to amplify 650 bp fragment, the DNA of stripped snakehead and ocellated snakehead were used in Biological materials PCR with primer pairs of FishF2-5’ Four individuals each species of striped snakehead and TCGACTAATCATAAAGATATCGGCAC 3’ and ocellated snakehead were collected from Kelekar River in FishR2-5’ ACTTCAGGGTGACCGAAGAATCAGAA 3’ Indralaya, Ogan Ilir District and Danau Burung Besar (Ward et al. 2005). PCR was performed in 40 µl final River, Penukal Abab Lematang Ilir (PALI) District at volumes using KAPA HiFi HotStart ReadyMixPCR kit South Sumatra Provinces, Indonesia (Fig. 1). Fish were (Kapa Biosystems, Massachusetts, United States). Each captured in the wild with the help of local fishermen in the reaction contained 1.6 µl of 10 µM each primer, 14.8 µl of research area. Approximately 3 cm of a segment of the nuclease-free water, 20 µl of 2x KAPA HiFi HotStart caudal fin was snipped and preserved in 99% ethanol (1:10 ReadyMix and 2 µl of DNA template. The thermal cycling w:v), then stored in individual Eppendorf tubes at-20°C protocol was as follows: initial denaturation at 95°C for 3 until required. min followed by 30 cycles of 98°C for 20 sec, annealing at 50C for 15 sec, extension at 72°C for 30 sec and a final DNA extraction extension at 72°C for 1 min. Optimation of PCR resulted in A total of 8 fin clips from two species have been used an annealing temperature of 50C (temperature melting/Tm in genomic DNA extraction. Total genomic DNA was of primer is 54.5C). The temperature of annealing can be extracted based on Geneaid DNA Extraction kit (GT 100 used in the range of (Tm-5C) to (Tm+5C). Amplified Geneaid Biotech Ltd. Taiwan) as outlined in the fragments were run in electrophoresis 1% agarose gel at 75 manufacturer's protocol. An RNAse incubation step was V for 40 min with 1 Kb marker and visualized using included to minimize RNA contamination. DNA samples GelDoc. PCR products were described in Figure 2. were further stored in freezer (-20ºC) until required. Those Figure 1. Sampling site of striped snakehead and ocellated snakehead collected from Kelekar River in Indralaya, Ogan Ilir District and Danau Burung Besar River, Penukal Abab Lematang Ilir (PALI) District at South Sumatra Provinces, Indonesia SYAIFUDIN et al. – DNA barcodes and phylogenetic of striped snakehead and ocellated snakehead 1229 COI gene sequencing Eight DNA samples derived from two species that were successfully amplified using PCR were then bi-direction sequenced at the target area of the COI gene in Singapore through the services of the Genetica Science Institute in Jakarta. Water quality The physical and chemical water qualities were characterized during sample collection in Kelekar and Danau Burung Besar River. The physical characteristics i.e turbidity (cm) was measured using Secchi disc, while temperature (°C) using a thermometer. The chemical water qualities i.e pH was measured using pH meter, dissolved oxygen (mg.L-1) using DO meter, ammonia (mg.L-1) using -1 spectrophotometer and total alkalinity (mg.L CaCO3) Figure 2. Visualization of PCR products of COI gene on stripped using titrimetric method. snakehead and ocellated snakehead. 1 kb = DNA ladder (bp) : 250, 500, 750, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 8000, 10000. CS1-CS4 = stripped snakehead; CP1-CP4 = ocellated Data analysis snakehead Four COI sequences of each species in Fasta format were aligned using MEGA 7.0 software (Kumar et al. 2016) for timing process. It was then blasted using BLASTn (Basic Local Alignment Search Tool-nucleotide) The BLASTn analysis showed that COI sequences in in GenBank NCBI (National Center for Biotechnology this study conceded with those in the GenBank database. C. Information) on the sequence database striata from Kelekar and Danau Burung Besar River, South http://www.ncbi.nlm.nih.gov to compare the similarity of the Sumatra had the highest percentage