Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Targeting eIF4A Dependent Translation of KRAS Signaling Molecules
Kamini Singh1, Jianan Lin2, Nicolas Lecomte3, Prathibha Mohan1, Askan Gokce 3,
Viraj R. Sanghvi1, 4, Man Jiang1, Olivera Grbovic-Huezo1, Antonija Burčul5, Stefan
G. Stark5,6, Paul B. Romesser7, Qing Chang8, Jerry P. Melchor3, Rachel K.
Beyer9, Mark Duggan10, Yoshiyuki Fukase10, Guangli Yang11, Ouathek
Ouerfelli11, Agnes Viale12, Elisa de Stanchina8, Andrew W. Stamford10*, Peter T.
Meinke10, Gunnar Rätsch5,6, Steven D. Leach13, Zhengqing Ouyang14, and Hans-
Guido Wendel1**
1Cancer Biology and Genetics Program, Memorial Sloan-Kettering Cancer
Center, New York, NY 10065, USA, 2The Jackson Laboratory for Genomic
Medicine, Farmington, CT 06032 and Department of Biomedical Engineering,
University of Connecticut, Storrs, CT 06269, 3David M. Rubenstein Center for
Pancreatic Cancer Research, Memorial Sloan-Kettering Cancer Center, New
York, NY 10065, USA, 4Department of Molecular and Cellular Pharmacology,
Sylvester Comprehensive Cancer Center, Miller School of Medicine, University of
Miami, Miami, FL 33136, USA, 5Computational Biology Department, Memorial
Sloan-Kettering Cancer Center, New York, NY 10065, 6Biomedical Informatics,
Department of Computer Science, ETH, Zürich, 8092 Zürich,
Switzerland, 7Department of Radiation Oncology, Memorial Sloan-Kettering
Cancer Center, New York, NY 10065, USA, 8Molecular Pharmacology Program,
Memorial Sloan-Kettering Cancer Center, New York, NY 10065, USA, 9Cancer
1
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Research Technology Program, Frederick National Laboratory for Cancer
Research, Frederick, MD, USA, 10Tri-Institutional Drug Development Initiative,
Memorial Sloan-Kettering Cancer Center, New York, NY 10065, USA, 11The
Organic Synthesis Core Facility, Memorial Sloan-Kettering Cancer Center, New
York, NY 10065, USA, 12Integrated Genomics Operation, Center for Molecular
Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY 10065, USA,
13Molecular Systems Biology and Surgery, Geisel School of Medicine,
Dartmouth, Norris Cotton Cancer Center at Dartmouth-Hitchcock, Lebanon, NH
03756, USA, 14Department of Biostatistics and Epidemiology, School of Public
Health and Health Sciences, University of Massachusetts, Amherst, MA 01003.
*Present address, Bridge Medicines, 420 East 70th Street New York, NY 10021
**Correspondence and requests for materials should be addressed to:
Hans-Guido Wendel, Cancer Biology & Genetics Program, Sloan-Kettering
Institute, 1275 York Ave, New York, NY 10065, USA, Phone: 646-888-2526, Fax:
646-422-0197, Email: [email protected]
Conflict of Interest Statement PBR has received honorarium from Corning has served as a consultant for unrelated work for EMD Serono and AstraZeneca. The other authors declare no competing financial interests.
2
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Abstract
Pancreatic adenocarcinoma (PDAC) epitomizes a deadly cancer driven by abnormal KRAS signalling. Here we show that the eIF4A RNA helicase is required for translation of key KRAS signaling molecules and that pharmacological inhibition of eIF4A has single-agent activity against murine and human PDAC models at safe dose levels. EIF4A was uniquely required for the translation of mRNAs with long and highly structured 5'UTRs including those with multiple G-quadruplex (GQ) elements. Computational analyses identified these features in mRNAs encoding KRAS and key downstream molecules.
Transcriptome-scale ribosome footprinting accurately identified eIF4A-dependent mRNAs in PDAC including critical KRAS signaling molecules such as PI3K,
RALA, RAC2, MET, MYC, and YAP1. These findings contrast with a recent study that relied on an older method, polysome fractionation, and implicated redox- related genes as eIF4A clients. Together, our findings highlight the power of ribosome footprinting in conjunction with deep RNA sequencing in accurately decoding translational control mechanisms and define the therapeutic mechanism of eIF4A inhibitors in PDAC.
Significance
Findings document the coordinate, eIF4A-dependent translation of RAS-related oncogenic signaling molecules and demonstrate therapeutic efficacy of eIF4A blockade in pancreatic adenocarcinoma.
3
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Introduction
The translation of mRNAs into protein is tightly controlled at the level of the multi-subunit eIF4F initiation complex (1). The eIF4F complex assembles on the 5’cap structure and scans the 5’UTR for a translation start site. EIF4A
(DDX2) is the RNA helicase component of the eIF4F translation initiation complex and is especially required to initiate translation of mRNAs with long
5’UTRs that contain highly structured RNA sequences such as multiple G-
quadruplex (GQ) elements (2-4). To some extent this insight enables the predictive identification of eIF4A dependent mRNAs. Notably, the NRAS and
KRAS genes have predicted GQ forming sequences in their 5’UTRs, although the therapeutic impact of this prediction is not known (5,6). Importantly, the
natural compound silvestrol binds eIF4A with nanomolar affinity and disables its
RNA unwinding activity (7-10). Synthetic analogues of silvestrol (e.g. CR-1-31B)
have shown promise in models of leukaemia and lymphoma (2,11,12). In
principle, cancers driven by a GQ-controlled oncogene such as KRAS should be
susceptible to eIF4A blockade.
Genomic studies have catalogued the genetic drivers of PDAC and show
nearly ubiquitous activation of KRAS and loss of tumor suppressor genes p53,
p16/INK4A, and SMAD4 (13-17). Activation of mRNA translation is an important
biological consequence of KRAS activation. Accordingly, PDACs show increased
levels of mRNA translation and mediated through activation of MAPK, PI3K-AKT-
mTOR signals, NRF2, and MYC (18-20). mTORC1/S6K1 signaling activates
4
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
translation initiation through phosphorylating eIF4B, co-factor for eIF4A helicase and enhance translation of MYC in pancreatic cancer (21,22). There have been
significant advances in therapeutic development against PDAC (23). These
include, inhibitors of G12C KRAS mutation (24-26), and strategies to co-target
KRAS downstream signalling molecules like (e.g. MAPK, PI3K, mTOR, EGFR, c-
RAF) (27-30). While we have pharmacological inhibitors of the G12C KRAS
mutation, this specific mutation is present in only 3% of PDACs (24,25). A recent study reports effect of eIF4A inhibition on mouse PDAC (31). In this study, we explore exactly how eIF4A inhibition affects human PDACs and we measure effects on global and specific mRNA translation programs.
Materials and methods
Cell Culture and treatments
Pancreatic cancer cell lines were cultures as per specified by American Type
Culture Collection. PANC1 and MiaPaca2 cells were purchased from American
Type Culture Collection. PANC1 cells were cultured in DMEM supplemented with
10% fetal bovine serum and penicillin-streptomycin (100 U/ml; 100 ug/ml) (all Life
Technologies). MiaPaca-2 cells were cultured in DMEM supplemented with 10% fetal bovine serum, 2.5% horse serum penicillin-streptomycin (100 U/ml; 100 ug/ml) (all Life Technologies). All the cell lines used were regularly tested for
Mycoplasma contamination using PCR. The IC50 data on the panel of cancer cell lines was done in collaboration with Tri-Institutional Drug Initiative program at
MSKCC.
5
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Drugs, Inhibitors and Plasmids
Silvestrol was purchased from ChemScene (CS-0543). []CR-1-31B and [-]CR-1-
31B were synthesised in house at organic chemistry core at MSKCC and Tri-
Institutional Drug Development Initiative at MSKCC, respectively. Each was suspended in DMSO for in vitro experiments and 5.2% Tween 80 5.2% PEG 400 for in vivo experiments. Cycloheximide (C7698) was purchased from Sigma. pLEX-HA-birA*-K-Ras(G12D)-IRES-Puro was a gift from Paul Khavari (Addgene plasmid #120562).
Ribosome Footprinting
Human pancreatic cancer PANC1 cells were treated with DMSO or []CR-1-31B
(25 nM; 45 minutes) followed by cycloheximide treatment for 10 minutes. Total
RNA and ribosome-protected fragments were isolated following published protocol (32). Deep sequencing libraries were generated from these fragments and sequenced on the HiSeq 2000 platform. Genome annotation was from the
human genome sequence GRCh37 downloaded from Ensembl public database:
http:// www.ensembl.org.
Sequence Alignment
First, Ribosome footprint (RF) reads were filtered based on the quality score,
which kept reads that have a minimum quality score of 25 for at least 75 percent
of the nucleotides. Second, the linker sequence (5’- CTGTAGGCACCATCAAT-
3’) was trimmed from the 3’ end of the reads. Next, we filtered out the reads
6
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
shorter than 15nt after the linker-trimming step. All these aforementioned steps
were done by using FASTX-Toolkit
(http://hannonlab.cshl.edu/fastx_toolkit/index.html). To remove ribosomal RNA, the footprint reads were then aligned to the ribosome RNA sequences of
GRCh37 downloaded from UCSC Table Browser (https://genome.ucsc.edu/cgi-
bin/hgTables). After removing the reads aligned to the ribosome RNAs, RF reads
were mapped to the human genome sequence GRCh37 downloaded from
Ensembl public database: http:// www.ensembl.org using HISAT2 with default
parameters. We only used the uniquely aligned reads for further analysis.
Total mRNA sequencing reads were aligned to the GRCh37 reference using
HISAT2. Similarly, as RF reads alignment, we performed the splice alignment for
the paired-end mRNA-seq datasets with the default parameters. We only kept
the uniquely aligned reads for the downstream analysis. The alignment
quantification for both RF and mRNA sequencing was done using featureCounts
with the annotations of the protein coding genes of GRCh37 as input. Only reads
aligned to the exonic regions of the protein coding genes were used for the
downstream analysis.
Footprint Profile Analysis using Ribo-diff
We used Ribo-diff to analyse the translation efficiency based on the ribosome
footprinting and mRNA sequencing data. Genes with at least 10 normalized read
counts as the sum of RF and RNA sequencing data were used as input, which
7
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
resulted in 10,861 genes in total. Genes with significantly changed translation efficiency were defined by the q-value cut-off equal to 0.001.
Motif analysis and G-quadruplex prediction
The longest transcript was selected to represent each corresponding gene. The
5’UTR sequences of the transcripts were collected for predicting motifs. Both the significant genes with increased or decreased TE and the corresponding background gene sets were used to predict motifs by DREME (33). The occurrences of the significant motifs (E < 0.05 and P < 110-8 from DREME) were called using FIMO (33) with default parameters for strand specific prediction of all the 5’UTR sequences.
We used RNAfold (version 2.1.6) to predict the G-quadruplex formation in the
RNA secondary structure with the –g option. The number of different types of G- quadruplex (GG4, GGG4, and GGGG4) was then calculated by counting the number of consecutive “G”s using customized python scripts.
KRAS 5’UTR reporter assays
Full-length 5’UTR of KRAS transcript variant b was cloned in MSCV-CMV- dsRed-IRES d1eGFP using Age I and Dra III restriction enzyme sites. This strategy replaced the IRES with the full length 5’UTR of KRAS. For mutant version, we changed the GG pattern in the full length 5’UTR of KRAS that disrupted the RNA G-quadruplex structure. The clones were validated by PCR sequencing using CMV forward primers and the presence of full length 5’UTR of
8
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
KRAS (wildtype and mutant, mentioned below) was confirmed downstream of
CMV promoter. Reporter plasmids were used for transient transfection in 293T cells. Destabilized d1eGFP has a half-life of 1 hr and the translation activity driven by respective 5’UTRs was measured by d1eGFP intensity using flow cytometry. The 5’UTR sequence for full-length wild type and mutant version with restriction enzyme sites is provided below.
AGE I KRAS 5UTR FOR CCGGTGGCCGCACCACCACACCCAGCAGCGCGCGCCGCAGTACCCGCAC CGAGCCTGCCACCGCCGCGCCCCGTGCTCCCGGCCCCCGCCGTTGCACA CTGACAGCGAGCGCACCGCAACCGCTGGAACCACCACCACACCCAGAACC TCAGCACCTCCCAACTGCGGGCGCGCGGCCTGCTGAGAATGCACGTT
DRAIII KRAS 5UTR REV
GTGCATTCTCAGCAGGCCGCGCGCCCGCAGTTGGGAGGTGCTGAGGTTCT GGGTGTGGTGGTGGTTCCAGCGGTTGCGGTGCGCTCGCTGTCAGTGTGCA ACGGCGGGGGCCGGGAGCACGGGGCGCGGCGGTGGCAGGCTCGGTGCG GGTACTGCGGCGCGCGCTGCTGGGTGTGGTGGTGCGGCCA
AGE I KRAS 5UTR Mutant FOR CCGGTGGCCGCGGCGGCGGAGGCAGCAGCGGCGGCGGCAGTGGCGGCG GCGAAGGTGGCGGCGGCTCGGCCAGTACTCCCGGCCCCCGCCATTTCGGA CTGGGAGCGAGCGCGGCGCAGGCACTGAAGGCGGCGGCGGGGCCAGAG GCTCAGCGGCTCCCAGGTGCGGGAGAGAGGCCTGCTGAAACACGTT
DRAIII KRAS 5UTR Mutant REV
GTGTTTCAGCAGGCCTCTCTCCCGCACCTGGGAGCCGCTGAGCCTCTGGC CCCGCCGCCGCCTTCAGTGCCTGCGCCGCGCTCGCTCCCAGTCCGAAATG GCGGGGGCCGGGAGTACTGGCCGAGCCGCCGCCACCTTCGCCGCCGCCA CTGCCGCCGCCGCTGCTGCCTCCGCCGCCGCGGCCA
Restriction enzyme sites are shown as underlined.
CMV Forward Primer- CGCAAATGGGCGGTAGGCGTG
CRISPR-cas9 mediated deletion of KRAS 5’UTR
9
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
To delete the RNA G-quadruplexes from KRAS 5’UTR we designed sgRNAs targeting the genomic regions on KRAS. Each sgRNA was cloned into the lenti-
CRISPRv2 (addgene cat no. 52961) using BsmB I restriction enzyme site.
PANC1 cells were co-transfected with sgRNA containing plasmids and then selected with Puromycin (2 ug/ml) for 24 hrs. Selected colonies were expanded for two weeks. The deletion was confirmed using PCR primers spanning the
KRAS 5’UTR region in genomic DNA. The sequence of sgRNA and PCR primers is provided below. sg-1
KRAS-5’UTR-5’sg1-F: CACCGCTAGGCGGCGGCCGCGGCGG KRAS-5’UTR-5sg1’-R: AAACCCGCCGCGGCCGCCGCCTAGC sg-2
KRAS-5’UTR-3’sg1-F: CACCGCCAGAGGCTCAGCGGCTCCC KRAS-5’UTR-3’sg1-R: AAACGGGAGCCGCTGAGCCTCTGGC
sg-3
KRAS-5’UTR-3’sg2-F: CACCGCTCAGCGGCTCCCAGGTGC KRAS-5’UTR-3’sg2-R: AAACGCACCTGGGAGCCGCTGAGC
PCR primers
KRAS 5’UTR F2: GACCGCCTCCAGCCTCA KRAS 5’UTR R2: AAGAAGAATCGAGCGCGGAA
Immunoblots
Lysates were made using TNN lysis buffer (50 mM Tris-Cl, 250 mM NaCl, 5 mM
EDTA, 0.5% NP-40 supplemented with protease inhibitor). 60ug of protein was
loaded onto SDS-PAGE gels then transferred onto Immobilon-FL Transfer
10
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Membranes (Millipore IPFL00010). The antibodies used were KRAS2B
(Proteintech), MYC (Cell signalling Technology), HRAS (Abcam), ERK (BD
Pharmingen), p-ERK (p42/44), MET, YAP1, XPO1, DDX6, PARP1, RALBP1,
PI3KCA, RAC1/2, β-tubulin, GAPDH (Cell signalling Technology) and β-actin
(Sigma A5316). Quantification of western blot images were done by using Image
J software.
Annexin V staining assay
Human pancreatic cancer cell lines PANC1, were used for annexin V staining
using kit (Invitrogen) and following manufacturer’s instruction. Annexin V staining
were detected by FACS analysis.
Polysome profiling
We performed polysome profiling to evaluate the effect of []CR-1-31B on global
translation and translation of KRAS4B transcript. Briefly, we used polysome
lysate from PANC1 cells treated with DMSO or []CR-1-31B (50 nM) for 1 and 4
hours in duplicates and performed polysome fractionation using a published
protocol from Panda et. al. (34). The relative distribution of the % mRNA of KRAS
and B2M over the sucrose gradient was studied by RT-qPCR analysis of the
RNA in each of the 12 gradient fractions.
In vitro eIF4A duplex unwinding assay
11
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
To evaluate the eIF4A activity we have used a fluorescent duplex unwinding assay as reported in (35,36). Briefly, we designed oligo containing 12-mer CGG4
(GQ) motif and AG)7 repeats labelled with Cy3 on the positive strand and with
BHQ (Black Hole Quencher) on the negative strand. We purified human eIF4A1, eIF4H isoform 2, and eIF4GΔ using previously reported study (37). Purified proteins eIF4A and eIF4GΔ proteins are stored at −80 °C in storage buffer (20 mM Hepes, pH 7.5, 200 mM KCl, 1 mM DTT) supplemented with 10% glycerol.
To maintain stability, purified eIF4H is stored at −80 °C in storage buffer supplemented with 20% glycerol as reported in (35,36). We performed the duplex unwinding exactly as reported in Ozes et al using eIF4A1 (10 uM), eIF4H isoform
2 (10 uM), eIF4GΔ (5 uM) with 12 mer (CGG) and (AG)7 repeat oligos (50 nM) in
the presence of eIF4A inhibitor []CR-1-31B at (50 uM and 100 uM).
Oligo sequences are provided below.
1. 12 mer (CGG)-Cy3 REV- 5’-Cy3-CGGCGGCGGCGG-3’
2. 12 mer (CGG)-BHQ FOR-5’-GCCGCCGCCGCC-BHQ-3’
3. 12 mer (CGG)-Competitor DNA-5’-GCCGCCGCCGCC-3’
4. (AG)7 repeat-Cy3 REV-5’-Cy3-AGAGAGAGAGAG-3’
5. (AG)7 repeat-BHQ FOR-5’-CUCUCUCUCUCU-BHQ-3’
6. (AG)7 repeat-Competitor DNA-5’-CTCTCTCTCTCT-3’
Human Pancreatic cancer cell line xenografts and PDXs
12
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Human pancreatic cancer MiaPaca-2 cells expressing stable GFP-Luciferase reporter were injected in subcutaneous flank in J:Nu mice (5 million cells per flank). IVIS imaging was performed weekly to monitor the tumor growth. When tumours were between 80-100 mm3, Silvestrol (0.5 m/kg) or []CR-1-31B (0.5 mg/kg) or [-]CR-1-31B (0.5 mg/kg) was injected in mice intra peritoneally twice a week until the control mice developed fully-grown tumors. P-values were calculated using 2-way repeated measures ANOVA. PDX tumors were established by the Antitumor Facility at MSK under an approved IRB protocol and were transplanted subcutaneously in nude mice. Once tumors reached 80-100 mm3, the mice were randomized into treatment groups as above. J:nu mice were purchased from Jackson Laboratories. All animal experiments were performed in accordance with regulations from Memorial Sloan-Kettering Cancer Center’s
Institutional Animal Care and Use Committee.
Orthotopic implantation studies
PDA cell line KPC4662 used for orthotopic implantation was obtained from RH
Vonderhide group and previously described (38) and stably transfected with
GFP-Luciferase reporter. C57BL/6 mice were obtained from The Charles River
Laboratories. For orthotopic implantation of PDEC, we followed previously described procedure with some modifications (39). In brief, mice were anesthetized using isoflurane and then the pancreas was exposed through an abdominal incision (laparotomy). PDAC (2 ×105 cells/mouse) were suspended in
Matrigel (Corning) diluted 1:1 with cold PBS (total volume of 25μl) and injected
13
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
into the tail region of the pancreas using a Hamilton Microliter Syringe. A successful injection was verified by the appearance of a fluid bubble without intraperitoneal leakage. The abdominal wall was closed with absorbable
Vicryl RAPIDE sutures (Ethicon) and the skin was closed with wound clips
(Roboz). Mice with luciferase imaging diagnosed tumors of volume 50 to 150 mm3 were enrolled and block randomized into treatment groups. Tumors were visualized and reconstructed for quantifying tumor volume using the integrated
Vevo 2100 Workstation software package. The Institutional Animal Care and Use
Committee at MSKCC approved all animal care and procedures.
In vivo therapy dosing
For the in vivo application in KPC mouse model of PDAC (PdxCre; KrasG12D,
TP53fl/fl), []CR-1-31B was diluted in 5.2% PEG400 (Sigma Aldrich), 5.2%
Tween 80 (Sigma Aldrich), 2% DMSO (Sigma Aldrich) and administered intraperitoneally at 0.5 mg/kg, twice a week, from d28-d83. For the in vivo application in PDA cell line KPC4662 derived orthotopic tumors in pancreas of
C57/Bl mice, []CR31B was diluted in 5.2% PEG400 (Sigma Aldrich), 5.2%
Tween 80 (Sigma Aldrich), 2% DMSO (Sigma Aldrich). Vehicle or []CR-1-31B was administered at 0.5mg/Kg dose via intra peritoneal (i.p.) injection on Mon-
Wed-Fri (three days a week). For the in vivo application in MiaPaca-2 cell line
derived xenografts nude mice, silvestrol was diluted in 5.2% PEG400 (Sigma
Aldrich), 5.2% Tween 80 (Sigma Aldrich), 2% DMSO (Sigma Aldrich). Vehicle or silvestrol was administered at 0.5 mg/kg dose via intra peritoneal (i.p.) injection
14
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
on Mon-Wed-Fri (three days a week). For the in vivo application in human PDAC derived tumors in nude mice, [-]CR-1-31B was diluted in 10% Captisol (Sigma
Aldrich) in sterile water. Vehicle or [-]CR31B was administered at 0.5 mg/kg dose via intra venous (i.v.) injection on Mon-Thur (e.g. twice a week). Toxicity in all the in vivo treatment experiments was monitored by weight loss and daily clinical observation until the end of the experiment. 24 hours after the last test article administration, 4-5 mice in each group were sacrificed and clinical chemistry, haematology and tissue specific histopathology were done at autopsy.
Patient-derived ex vivo PDAC organoid culture, treatment and read out
The study was conducted under Memorial Sloan-Kettering Cancer Center
Institutional Review Board approval (MSKCC IRB 15-149 or 06-107) and all
patients provided written informed consent prior to tissue acquisition. Tissue
resections and biopsies from pancreatic cancer patients were processed
according to protocols previously described by Pr Hans Clevers (40,41) slightly
modified to ensure maximum viable cell recovery and organoid formation
efficiency. Briefly, resected tissue or biopsy were minced in less than 1mm3
pieces and digested in organoid medium containing collagenase II (2.5mg/mL)
and Rho kinase inhibitor Y-27632 10.5μM (Selleck Chemicals). Tissue digestion
was performed up to 4 hours at 37°C. Red blood cells were removed by specific
lysis with ACK buffer (Gibco). After 3 successive wash in PBS and organoid
medium, dissociated cells were seeded in growth factor reduced Matrigel (BD
biosciences) and cultured in WNT-driven expansion medium containing: DMEM-
15
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
F12 Advanced (Gibco), Hepes 10mM (Gibco), antibiotics 500μg/mL (Gibco),
Glutamax 2mM (Gibco), A83-01 0.5μM (Tocris), human EGF 50ng/mL
(Peprotech), human FGF10 100 ng/mL (Peprotech), human Noggin 100ng/mL
(Peprotech), human Gastrin I 10 nM (Sigma), N-acetylcysteine 1.25 mM (Sigma),
Nicotinamide 10 nM (Sigma), B-27 supplement 1X (Gibco), Wnt3A conditioned media 50% (v/v, from Hans Clevers), R-spondin1 conditioned media 10 % (v/v, from Calvin Kuo). Organoid lines were considered established when sustained epithelial proliferation was maintained over 5 passages (about 3 to 5-week culture).
Evaluation of PDAC organoids sensitivity to CR31B was performed in 384-well plate format. Briefly 2,000 single organoid cells were plated into matrigel-coated well and precultured for 4 days. Organoids were then exposed to the drug over a
7-concentration range (from μM to sub-nM) or vehicle control for 6 days. Cell viability was assessed at day 10 using the Cell Titer-Glo 3D assay (Promega).
Clonogenic survival assay
Cells were seeded in 6-well plates (20 x 103 cells per well) and allowed to adhere overnight in regular growth media. DMSO or []CR-1-31B (10 nM) was added
and refreshed every 3 days until the end of the experiment (14 days). For each
independent experiment, the DMSO or []CR-1-31B treated cells were fixed in
4% formaldehyde for 15 minutes at RT and subsequently stained with 0.1%
crystal violet and digitalized on an image scanner. All experiments were
performed at least three times in triplicates and representative results are shown.
16
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Histology and Immuno-histochemistry analysis
Tissue specimens were fixed in 4% buffered paraformaldehyde, dehydrated and embedded in paraffin wax. Formalin-fixed paraffin embedded sections of 3 um was stained with H&E, TUNNEL and Ki-67. Immuno-histochemical analysis was done on five samples in each vehicle and drug treated group by counting number of positive tumor cells at ten high power field (X400) and for ki67 staining one hot spot area at X400 was selected for each case.
Real Time PCR assay
Total RNA was extracted using AllPrep DNA/RNA/Protein Mini Kit (Qiagen
80004). cDNA was made using SuperScript III First-Strand (Invitrogen 18080-
400). Analysis was performed by ΔΔCt. Applied Biosystems Taqman
GeneExpression Assays: human KRAS Hs00364284_g1, Myc Hs00153408_m1,
MET Hs01565584_m1, YAP1 Hs00902712_g1, XPO1 Hs00185645_m1, DDX6
Hs00898915_m1 and B2M Hs00187842_m1.
Statistical analysis
All the results were analysed with two-tailed t-tests unless specified. The significance of motif enrichments was from DREME program based on the
Fisher’s Exact Test. Hypergeometric test was performed to test for the significance in the enrichment of the gene overlap in KEGG pathway.
17
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Online Content Additional Methods, Supplementary display items and Source
Data are available in the online version of the paper; references unique to these sections appear only in the online paper.
The ribosome footprinting and total mRNA sequencing raw and processed data were deposited in the NCBI Gene Expression Omnibus database GSE120159 accession number available at following link. (To review GEO accession
GSE120159: Go to https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE120159 Enter token
yhkpamwsnpinfkt into the box).
Results
The KRAS protein is encoded by two variant transcripts (a, b) and two pseudogenes that do not encode a protein (Supplementary Fig. S1A). 5’UTR sequence of human and mouse KRAS transcripts is identical as shown by
ClustalX alignment (Supplementary Fig. S1A and S1B). The KRAS4B 5’UTR is
192 bp long and computational prediction using M-Fold indicates the presence of
three highly structured and potentially G-quadruplex (GQ) forming regions in the
5’UTR of both KRAS transcripts that are reminiscent of eIF4A dependent mRNAs
(Fig. 1 A and B) (2,3,5,6). The TSS can vary within different cell types and tissue
(32). We have compared the TSS in various PDAC cell lines (RNA seq data
reported in GSE dataset GSE160434) and observed that KRAS variant b
(KRAS4B) is the most expressed transcript across the nine PDAC cell lines
suggesting that the TSS for KRAS is very much stable in these PDAC cell lines.
18
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
We built a KRAS4B 5’UTR translation reporter assay to test the eIF4A requirement using the eIF4A inhibitor []CR-1-31B (11). Briefly, destabilized eGFP (d1eGFP, T1/2 = 1h) is expressed from a CMV promoter and its translation controlled by the KRAS4B 5’UTR or a mutant 5’UTR where predicted GQ
structures are disrupted without changing 5’UTR length or GC content (Fig. 1C).
[]CR-1-31B is a synthetic analogue of silvestrol synthesized by J. Porco’s group
at U. Boston and shows nanomolar eIF4A inhibition (2,11,12,31,42-44). We measured the basal expression of d1eGFP driven by KRAS4B 5’UTR or a mutant 5’UTR in 293T cells (Supplementary Fig. S1C). Next, we confirmed the
half-life of d1eGFP by adding a pan translation inhibitor cycloheximide. Both
KRAS4B 5’UTR or a mutant 5’UTR driven d1eGFP expression was reduced to
50% following 1h treatment with cycloheximide (Supplementary Fig. S1D and
S1E). In 293T cells transiently expressing the KRAS4B 5’UTR reporter constructs treatment with []CR-1-31B (50 nM) reduces translation of the d1eGFP reporter controlled by the wild type KRAS 5’UTR by 70% and has little
effect on the mutant 5’UTR (p<0.001) (Fig. 1D and Supplementary Fig. S1F).
Consistently, treatment of KRAS mutant PDAC cell lines (PANC1, in MiaPaca-2)
with different doses of []CR-1-31B (1-50nM, 72h) reduces the KRAS protein
levels consistent with reported KRAS protein half-life (45) (Fig. 1E-H). EIF4A inhibition resulted in slight reduction of phospho-ERK levels at 72h of []CR-1-
31B (1-50nM) treatment (Fig. 1E and 1F). KRAS mRNA expression was not
affected by []CR-1-31B (Supplementary Fig. S1G). Importantly, eIF4A
dependence of KRAS translation depends on an intact, endogenous KRAS
19
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
5’UTR. For example, using two pairs of CRISPR guideRNAs (sgRNAs) we
induce KRAS 5’UTR deletions sg1-sg2 and sg1-sg3, respectively, that abrogate
[]CR-1-31B sensitivity and eIF4A dependent KRAS translation in PANC1 cells
(Fig. 1I, J, Supplementary Fig. S1H and S1I). Deletion of KRAS 5’UTR did not
affect the protein expression of KRAS, phospho-ERK levels and mRNA of KRAS
in the PANC1 cells (Supplementary Fig. S1J and S1K). Hence, GQ elements in
the KRAS 5’UTR confer dependence on eIF4A in translation reporter assays and
in human PDAC cells.
Nanomolar concentrations (2-10nM) of []CR-1-31B inhibit cell growth in
KRAS mutant PDAC and other cancer cell lines indicated by IC50 analysis,
PARP1 cleavage, and block colony formation in human PDAC cell lines (PANC1,
MiaPaca-2) (Fig. 2A, B, Supplementary Fig. S2A, and B). Primary fibroblast
lines showed at least ~1000 fold higher IC50 for []CR-1-31B (Supplementary
Fig. S2A). Importantly, CRISPR-cas9 engineered KRAS 5’UTR deletions (sg1-
sg2 and sg1-sg3) are largely (> 80% colonies at 4 and 6 nM []CR-1-31B) able to
rescue colony formation by PANC1 cells under continued []CR-1-31B exposure
indicating that KRAS is a significant target of the drug’s action (Fig. 2C). Deletion
of KRAS 5’UTR in PANC1 cells increased the IC50 for []CR-1-31B to ~10 nM
compared with ~6 nM in Cas9 expressing PANC1 control cells (Supplementary
Fig. 2C and 2D). Next, overexpression of HA-BirA*-K-RAS4B (G12D) in PANC1
cells rescued the cell death induced by []CR-1-31B. We observed only 30%
inhibition in cell proliferation at the highest dose of []CR-1-31B (10 uM) in
20
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
PANC1 cells with ectopic expression of KRAS4B (G12D) (Supplementary Fig.
2E). While the []CR-1-31B treatment inhibited the endogenous KRAS4B protein it did not affect the ectopic expression of HA-BirA*-KRAS4B(G12D) as determined by the western blot analysis (Supplementary Fig. 2F). []CR-1-31B
treatment also equally inhibited the MYC protein levels similar to the wild type
PANC1 cells (Supplementary Fig. 2F). We observed higher levels of total ERK in PANC1 cells with ectopic expression of KRAS4B (G12D) compared to wild type PANC1 cells but the p-ERK levels were equally affected by the []CR-1-31B
treatment (Supplementary Fig. 2F).
Organoid culture more closely models the 3-dimensional tissue
organization of tumors that may also affect drug action (40). Here, []CR-1-31B
effectively blocked organoid formation from murine KRAS/p53 PDACs (Fig. 2D)
and similarly inhibited the growth of primary human PDAC organoids ([]CR-1-
31B IC50s: 0.4nM - 22nM; 72 hr) (Fig. 2E and F). Hence, the silvestrol analogue
[]CR-1-31B kills PDAC cells and the effects is reduced upon disruption of the
KRAS 5’UTR.
We performed ribosome footprinting (ribosome profiling) and deep
sequencing (32) in the presence and absence of the eIF4A inhibitor []CR-1-31B
to identify eIF4A dependent translation. Briefly, we normalized ribosome-
protected RNA fragments (RF reads) to the total RNA abundance to isolate
changes in translation efficiency (TE). We performed ribosome footprinting on
21
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
three control (DMSO) and three []CR-1-31B (25 nM) treated PANC1 samples
(Fig. 3A). We chose an early time point (45 min) to minimize secondary and
knock-on effects. Read mapping to ribosomal RNAs, non-coding RNAs, library
linkers, and incomplete alignments were removed from the analysis
(Supplementary Fig. S3A-F). Most of the remaining reads range from 25 to 35
nucleotides in length and map to protein coding genes (Supplementary Fig.
S3A-F). The total number of RF reads mapped to exons was 4.1 million in control
and 3.5 million in []CR-1-31B treated samples. This corresponds to 19,821 protein coding genes. Quality control analysis of replicates showed significant correlations among the replicates with a Pearson coefficient >0.97
(Supplementary Fig. S3G-H). We used the RiboDiff statistical framework to
isolate the effect on mRNA translation (46). With a very stringent statistical cut-off
at q < 0.001 (FDR <1%) we identified 614 mRNAs whose translation was
significantly repressed (TE down: n = 614; q < 0.001), and we also detect a set of
mRNAs showing a relative increase in ribosome occupancy (TE up: n = 456; q <
0.001) (Fig. 3B, Supplementary Table 1A, 1B; Complete dataset at GEO#
GSE120159). A full list of genes differentially affected on TE by eIF4A inhibitor
[]CR-1-31B in PANC1 cells is provided in Supplementary Table 2. Importantly,
we notice that eIF4A dependent (TE down) mRNAs included key oncogenic
drivers of PDAC, such as MYC, MET, YAP, TGF1/2, PI3K, and other proteins
involved in RAS signalling (Fig. 3B). KRAS translation efficiency was reduced by
35%, at q = 0.5 while MYC translation efficiency decreased by 40% at q < 0.001
(Supplementary Table 2).
22
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
These findings differ from results reported in a recent polysome fractionation study on PDAC cells treated with the same inhibitor (31). For example, we do not see the reported changes in the translation of redox and central carbon metabolism genes (31). A review of the published dataset (Suppl.
Table 2 in (31) shows that the polysome fractionation experiment identified exactly two genes (Lag3 and Tmcc2!) whose translation was significantly (q <
0.05) reduced upon eIF4A inhibition. Other genes implicated in the study as eIF4A targets are shown with significance values as high as q = 0.25 and in some instances q = 0.45 are chosen based on the manual analysis. Most likely this reflects poor inter-sample reproducibility of manual or instrumental separation of heavy and light polysome fractions using this older methodology.
We confirmed the effects on protein levels for KRAS and several targets across identified with as highly significant cell lines (PANC1, MiaPaca-2),
organoids, in PDACs arising in vivo (PdxCre; KrasG12D, TP53fl/fl) (47) (Fig. 3C-
F). []CR-1-31B did not affected the mRNA levels of these targets in PANC1
cells (Supplementary Fig. S3I). We also validated the effect of []CR-1-31B on
global and KRAS translation by polysome profiling. We observed a significant
increase of total mRNA in the light molecular weight (LMW) (p<0.05) and
corresponding reduction in the heavy molecular weight (HMW) polysome fraction
following []CR-1-31B treatment (50 nM for 1 and 4 hours) in PANC1 cells
(Supplementary Fig. S3J). KRAS mRNA was highly and significantly reduced in
23
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
the heavy molecular weight (HMW) polysome fraction (p<0.05) while B2M mRNA showed slight reduction in the HMW polysome fraction following []CR-1-31B treatment indicating that []CR-1-31B selectively target KRAS translation
(Supplementary Fig. S3K and S3L). Next, we evaluated the effect of []CR-1-
31B on the kinetics of KRAS protein degradation. Using cycloheximide treatment
(1 ng/ml) we observed ~40% degradation of KRAS protein between 4-24 hours in
PANC1 cells while []CR-1-31B treatment (50 nM) reduced KRAS protein
expression to similar extent (40-50%) in 4-24 hours as observed and quantified
by western blotting analysis (Supplementary Fig. S3M and S3N). Both
cycloheximide (1 ng/ ml) and []CR-1-31B (50 nM)) combined showed no
significant difference on KRAS protein degradation suggesting that []CR-1-31B
do not affect the half-life of KRAS protein in PANC1 cells (Supplementary Fig.
S3M and S3N). An unbiased gene ontology analysis of eIF4A dependent genes
(TE down) further supported the enrichment (p <1.18E-09) of RAS/MAPK
pathway genes including KRAS, RALA, RALBP1, MEK1/2, RAC2, and MYC (Fig.
3G and H). Together, these findings reveal coordinate translational downmodulation of key KRAS-MAPK-MYC signalling proteins following eIF4A inhibition.
Next, we explored these significant and confirmed eIF4A targets for common molecular features. We compared the []CR-1-31B sensitive (TE down)
group of mRNAs with annotated 5’UTRs (n=591), the []CR-1-31B independent
(TE up; n = 431) to each other and a background list of 623 equally expressed
24
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
and annotated mRNAs that showed no significant change in their translation
(Supplementary Table 3A-C). We noticed that []CR-1-31B sensitive mRNAs had significantly longer 5’UTRs (TE down vs Bkg p=4.0e-13; TE down vs TE up p=3.2e-24) (Fig. S4A). Next, we applied the MEME (Motif-Based sequence
analysis tool) (48) search tool to investigate sequence elements that were either
over- or underrepresented in any of the three groups. Comparing the TE down
group to TE up and background lists, we identify one significantly
overrepresented 12-mer sequence (CGGCGGCGGCGG) and two 9-mer motifs
(CGGCGGCGG and CCGCCGCCG) (p=3.8e-10; p=1.6e-14; and p=1.1e-8,
respectively) (Fig. 4A, Supplementary Table 4). We observed no significant
enrichment or depletion of sequences/motifs in the coding or 3’UTR sequences.
We also performed a separate search for differentially represented structural elements using RNAfold program. This search identified an enrichment of predicted RNA G-quadruplex (GQ) structures (sequence: GGX4) in the 5’UTRs of eIF4A dependent (TE down) genes compared to the background genes (p =
8.4e-7) and TE up genes (p = 3.8e-9); other potentially GQ forming sequences
(GGGX4 and GGGGX4), TOP motif, IRES, uORFs, Pyrimidine Rich Translation
Element (PRTE), and putative eIF4A binding sites (GAAG, (AG)3 repeats) were too infrequent to detect changes in their representation between groups
(Supplementary Fig. S4B and S4C). Next, the 12-mer sequence
(CGGCGGCGGCGG) and the 9-mer motif (CGGCGGCGG) significantly overlapped with GQ forming sequences while the 9-mer motif (CCGCCGCCG) did not coincide with the GQ sequences (Fig. 4B). 36% of the TE down
25
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
transcripts contain GQ sequences their 5’UTR in while only 19% and 23% of the
TE Up and background genes harbor GQ sequences, respectively (Fig. 4C).
Consistently, we found that 5’UTR GQ sequence elements were highly significantly (p<0.0001) associated with changes in translation efficiency across
the transcriptome upon eIF4A inhibition (Fig. 4D). A swimmer plot illustrates how
the number of GQ elements per 5’UTR corresponds to the degree of translational
repression []CR-1-31B treatment indicating a dosage effect (Fig. 4E). We also
mapped the relative position and number of GQ sequence elements in the 5’UTR
of key oncogenes using QGRS mapper and a stringent cut-off (QGRS score >
20), for example, the algorithm identifies three GQ sequence elements in the
KRAS 5’UTR, four in MYC, five in RALBP1, four in PI3K, four in HRAS, and
seven in YAP1 (Fig. 4F). Again, our findings are in stark contrast to Chan et al
(31) which report effects on short and unstructured 5’UTRs, instead we find that long and highly structured 5’UTRs are highly enriched among eIF4A dependent mRNAs.
We directly tested unwinding by the eIF4A helicase in the presence and absence of the inhibitor ([]CR-1-31B) in a sequence specific manner. Briefly, we used an in vitro duplex unwinding assay using the purified initiation factors
(eIF4A, eIF4H, eIF4G and ATP) to measure resolution of the 12-mer CGG4 (GQ)
motif and we used a ubiquitous (AG)7, that has been proposed as preferred
eIF4A binding sequence (35), as a control. The assay uses duplex probes
labelled with Cy3 on the positive strand and with BHQ (Black Hole Quencher) on
26
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
the negative strand such that unwinding results in an increased Cy3 signal (Fig.
4G). ATP addition results in activation of 12-mer CGG4 (GQ) motif unwinding that is blocked by the eIF4A inhibitor []CR-1-31B (pvehicle vs []CR-1-31B = 0.0001)
(Fig. 4H). On the other hand, []CR-1-31B led to increased unwinding of the
(AG)7 sequence (pvehicle vs []CR-1-31B < 0.001), potentially consistent with reports of
rocaglamide increasing eIF4A’s affinity ubiquitous and AG-rich sequences (7,49)
(Fig. 4I). Hence, []CR-1-31B inhibits the eIF4A helicase activity in a sequence specific manner on 12-mer CGG4 (GQ) sequence motif that are also highlighted in our ribosome profiling data.
Chan et al report activity of an eIF4A inhibitor against mouse PDAC (31) and we are pleased to confirm and expand the therapeutic benefit in the same
KPC model and also in human PDAC tumors. Briefly, in murine KPC tumors we observe an increase in median overall survival from 49 days (control) to 69 days upon treatment with []CR-1-31B (0.5 mg/kg, i.p., twice a week, d28-d83n = 7/5, p < 0.02 Log-rank Mantel-Cox test) (Fig. 5A). In orthotopically engrafted KPC
tumors engineered to express luciferase, responses were more varied and
[]CR-1-31B (0.5 mg/kg, i.p., twice a week, d10-d42) induced responses in 3 out
of 5 animals, while control animals uniformly succumbed to PDAC (n = 5, pvehicle
vs CR-1-31B < 0.01) (Fig. 5B, Supplementary Fig. S5A and S5B). Histology showed a cytostatic effect with loss of proliferation (Ki67 positive) (Fig. 5C, and
Supplementary Fig. S5C), animal weights, blood, and platelet counts were unchanged indicating tolerability in mice (Fig. 5D and Supplementary Fig. S5D-
27
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
F). Expression of KRAS, MYC, PI3K and YAP1 were significantly reduced in orthotopically engrafted KPC tumors treated with []CR-1-31B (0.5 mg/kg, i.p., twice a week, d10-d42) compared to vehicle treated tumors as observed by western blotting and quantification (p<0.05) (Fig. 5E and 5F).
We further find that the eIF4A inhibitor has single agent activity against human PDACs. Specifically, we purified the active [-] enantiomer of CR-1-31B.
We treated a primary, patient-derived PDX model of PDAC transplanted into the flanks of five nude mice once tumors had reached a volume of ~80mm3 (dosing
schedule: [-]CR-1-31B, 0.5mg/kg, i.v., twice a week from d22-d54). We observed
a significant delay in human PDX growth during the treatment period, although
tumors resumed growth when treatment was stopped, potentially indicating the
need for combination therapies (pvehicle vs [-]CR-1-31B <0.03, n=5) (Fig. 5G). When
tumors in either group reached a size of ~2000mm3 animals were euthanized
and we considered this as an endpoint for a survival analysis. Notably, [-]CR-1-
31B treatment of tumor-bearing animals significantly increased the median
overall survival from 49 days to 62 days (0.5 mg/kg i.v., twice a week, n=10 in
vehicle group, n=13 in treated group, Kaplan-Meier analysis: p < 0.0001 Log-rank
Mantel-Cox test) (Fig. 5H). Histology showed a striking reduction of proliferating
(Ki67 positive) adenocarcinoma cells (indicated by arrows) surrounded by tumor
stroma (Fig. 5I). We confirmed significant loss of KRAS, MYC, and phospho-
ERK (p<0.05) while total ERK remained unchanged as shown by immunoblots on
lysates of in vivo treated tumors collected from controls or 24h after the last [-
28
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
]CR-1-31B dosing (Fig. 5J). Image J quantification is shown where the KRAS,
MYC protein expression is normalized to -actin (Fig. 5K). p-ERK is normalized
to total ERK (Fig. 5K). As with the racemic mixture, we found [-]CR-1-31B was well tolerated without evidence of drug-related mortality or weight loss (Fig. 5L).
To enhance reproducibility of these important results, we also tested the
natural compound silvestrol and the analogue [-]CR-1-31B in more widely
available PDAC xenograft models. For example, silvestrol (0.5 mg/kg, i.p., twice
a week, from d10-d63) caused tumor growth arrest in MiaPaca-2 xenografts in
nude mice by luciferase imaging, and ex vivo tumor weights and volumes (n = 5,
p< 0.05) (Supplementary Fig. S5G-I). TUNEL stains (24h after last dosing)
indicated tumor cell apoptosis in silvestrol treated tumors (Supplementary Fig.
S5J and K). Silvestrol was well tolerated without weight loss or significant changes in blood counts (24h after last dosing) (Supplementary Fig. S5L-O). [-
]CR-1-31B showed similar tumor growth delay in this model (Supplementary
Fig. S5P), and endpoint analysis (tumor > 2000mm3) indicate a significant survival advantage in [-]CR-1-31B treated MiaPaca-2 bearing animals (0.5
mg/kg, i.p., twice a week, n=5/8, p<0.0012) (Supplementary Fig. S5Q).
Discussion
Our findings provide new insight into the therapeutic utility and the
mechanism of eIF4A inhibitor treatment. Using ribosome footprinting on human
PDAC cells, we find that genes with long- and highly structured 5’UTRs depend
29
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
on eIF4A for their translation. These include important KRAS signalling molecules such as RALA, RALGDS, RAF, RAC, PI3K, RALBP1, and MYC, whereas KRAS itself falls just outside our stringent statistical criteria and is still affected in protein studies. Consistent with our previous findings in T-cell leukemia we notice that many eIF4A dependent mRNAs harbor sequence
elements that are predicted to fold into secondary, non-covalent G-quadruplex
structures (2). Inserting GQ sequences confers eIF4A dependence in translation
reporter and helicase assays. Conversely, removing them from the endogenous
KRAS gene reduces the eIF4A requirement. However, it is not clear to what
extent these sequences exist in a stably folded state in cells. For example, one
RNA sequencing-based method suggested GQ elements are largely
unstructured in cells (50), another method (rG4-seq) indicates that they are
structured, and a third, antibody based method, also detects abundant GQ
structures in cells (51,52). Our study does not directly address this question,
although consistent and unbiased identification of GQ sequences in eIF4A
dependent RNAs and functional evidence consistently support a role for GQ
elements in eIF4A dependence. By contrast, ubiquitous AG-rich sequences that
act as accessible sites for eIF4A binding (49) do not confer eIF4A dependence
and may act to sequester eIF4A.
Ribosome profiling has emerged as the experimental standard to precisely
map and measure ribosome occupancy across the transcriptome and provides a
surrogate measure for mRNA translation into protein (53). The previous
30
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
polysome fractionation method relied on manual separation of heavy and light polysome fractions from sucrose gradients and suffered low reproducibility.
Highlighting these differences, our findings differ strongly from a recent polysome
study on PDAC cells treated with the same eIF4A inhibitor treated PDAC cells
(31). The other study ruled out MYC, KRAS, and instead implicated a number of redox enzymes and central carbon metabolism genes as a although using conventional statistical cut-offs (q < 0.05) none of named genes showed a
significant difference (31). Relying on this data the study reports preferential
eIF4A effects on genes with short and unstructured 5’UTRs which contradicts
much prior work on this helicase (54,55). On the other hand, we happily agree
that eIF4A inhibition has promising single agent activity against PDAC in vitro and in vivo (31). A prior study on a different rocaglamide (Infinity’s Compound 76) showed toxicity and low efficacy and these effects may be specific to that inhibitor (56). Our findings show in vivo efficacy at tolerable dose levels for the
CR-1-31B compound in mouse and human models of PDAC and indicate a
therapeutic window in treating this deadly cancer with this new and exciting class
of drugs.
Acknowledgements:
HGW is supported by NIH/NCI grants R01CA183876-03, R01 CA207217-04,
R01CA190384-05, P50 CA217694-02, P50 CA192937-04. HGW is supported by
Lymphoma Research Foundation; Mr. William H. Goodwin and Mrs. Alice
Goodwin and the Commonwealth Foundation for Cancer Research; the Center
31
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
for Experimental Therapeutics at MSKCC; the Starr Cancer Consortium;
the Geoffrey Beene Cancer Research Center; David Rubenstein Center for
Pancreatic Cancer; Druckenmiller Center for Lung Cancer Research; a Leukemia
and Lymphoma Society (LLS) SPORE grant; and the MSKCC Core Grant (P30
CA008748). H.G.W. is a scholar of the Leukemia Lymphoma Society. KS is
supported by the Pancreatic Cancer Action Network. GR, YZ were supported by
MSK Core funding. SDL is supported by NIH grant R01CA204228. EdS is
supported by NIH U54 OD020355-01. PBR is supported by a K12 CA184746,
GR is supported by the core funding of ETH Zürich. ZO is supported by NIH R35
GM124998. We acknowledge the use of the Integrated Genomics Operation
Core (funded by CCSG, P30 CA08748, Cycle for Survival, Marie-Josée and
Henry R. Kravis Center for Molecular Oncology, the mouse pharmacology and
Organic synthesis cores funded by the NCI CCSG, P30 CA08748. We thank G.
Sukenick, J. McCauley S. Kargman (Tri-I-TDI), T. Tammela (MSK) for assistance
with various part of the study. We thank Dr. Christopher S. Fraser for sharing the
human eIF4AI (406 amino acids), eIF4H isoform 2 (228 amino acids) and
eIF4GΔ (amino acids 682–1166 from eIF4GI) expression plasmids.
Author contributions KS designed, performed, analysed experiments, and co-
wrote the paper. JL, SS and AB performed the computational analysis. NL and
GHO performed the pancreatic cancer organoid treatment studies. PM, MJ, and
JPM provided technical assistance. AG analysed the pathology of human and
mouse PDAC tumor samples. VRS assisted with designing CRISPR donor DNA
32
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
oligos. QC performed the orthotopic implantations and PDX treatment studies.
EdS and PBR supervised generation of the PDX models and in vivo studies.
RKB provided various human pancreatic cancer cell lines. MD, AWS, and PTM provided [-]CR-1-31B and performed the PK and toxicity studies using this material. OO synthesised []CR-1-31B compound. LS and AV performed the
HiSeq-2000. SDL supervised the pancreatic cancer organoid and mouse model treatment studies. ZO and GR supervised the computational analyses. HGW designed the study and co-wrote the paper.
References
1. Parsyan A, Svitkin Y, Shahbazian D, Gkogkas C, Lasko P, Merrick WC, et al. mRNA helicases: the tacticians of translational control. Nat Rev Mol Cell Biol 2011;12(4):235-45 doi 10.1038/nrm3083. 2. Wolfe AL, Singh K, Zhong Y, Drewe P, Rajasekhar VK, Sanghvi VR, et al. RNA G-quadruplexes cause eIF4A-dependent oncogene translation in cancer. Nature 2014;513(7516):65-70 doi 10.1038/nature13485. 3. Rubio CA, Weisburd B, Holderfield M, Arias C, Fang E, DeRisi JL, et al. Transcriptome-wide characterization of the eIF4A signature highlights plasticity in translation regulation. Genome Biol 2014;15(10):476 doi 10.1186/s13059-014- 0476-1. 4. Linder P, Jankowsky E. From unwinding to clamping - the DEAD box RNA helicase family. Nat Rev Mol Cell Biol 2011;12(8):505-16 doi 10.1038/nrm3154. 5. Kumari S, Bugaut A, Huppert JL, Balasubramanian S. An RNA G-quadruplex in the 5' UTR of the NRAS proto-oncogene modulates translation. Nat Chem Biol 2007;3(4):218-21 doi 10.1038/nchembio864. 6. Miglietta G, Cogoi S, Marinello J, Capranico G, Tikhomirov AS, Shchekotikhin A, et al. RNA G-Quadruplexes in Kirsten Ras (KRAS) Oncogene as Targets for Small Molecules Inhibiting Translation. J Med Chem 2017;60(23):9448-61 doi 10.1021/acs.jmedchem.7b00622. 7. Bordeleau ME, Robert F, Gerard B, Lindqvist L, Chen SM, Wendel HG, et al. Therapeutic suppression of translation initiation modulates chemosensitivity in a mouse lymphoma model. J Clin Invest 2008;118(7):2651-60 doi 10.1172/JCI34753. 8. Chu J, Galicia-Vazquez G, Cencic R, Mills JR, Katigbak A, Porco JA, Jr., et al. CRISPR-Mediated Drug-Target Validation Reveals Selective Pharmacological
33
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Inhibition of the RNA Helicase, eIF4A. Cell Rep 2016;15(11):2340-7 doi 10.1016/j.celrep.2016.05.005. 9. Sadlish H, Galicia-Vazquez G, Paris CG, Aust T, Bhullar B, Chang L, et al. Evidence for a functionally relevant rocaglamide binding site on the eIF4A-RNA complex. ACS Chem Biol 2013;8(7):1519-27 doi 10.1021/cb400158t. 10. Iwasaki S, Iwasaki W, Takahashi M, Sakamoto A, Watanabe C, Shichino Y, et al. The Translation Inhibitor Rocaglamide Targets a Bimolecular Cavity between eIF4A and Polypurine RNA. Mol Cell 2019;73(4):738-48 e9 doi 10.1016/j.molcel.2018.11.026. 11. Rodrigo CM, Cencic R, Roche SP, Pelletier J, Porco JA. Synthesis of rocaglamide hydroxamates and related compounds as eukaryotic translation inhibitors: synthetic and biological studies. J Med Chem 2012;55(1):558-62 doi 10.1021/jm201263k. 12. Cencic R, Carrier M, Galicia-Vazquez G, Bordeleau ME, Sukarieh R, Bourdeau A, et al. Antitumor activity and mechanism of action of the cyclopenta[b]benzofuran, silvestrol. PLoS One 2009;4(4):e5223 doi 10.1371/journal.pone.0005223. 13. Cancer Genome Atlas Research Network. Electronic address aadhe, Cancer Genome Atlas Research N. Integrated Genomic Characterization of Pancreatic Ductal Adenocarcinoma. Cancer cell 2017;32(2):185-203 e13 doi 10.1016/j.ccell.2017.07.007. 14. Biankin AV, Waddell N, Kassahn KS, Gingras MC, Muthuswamy LB, Johns AL, et al. Pancreatic cancer genomes reveal aberrations in axon guidance pathway genes. Nature 2012;491(7424):399-405 doi 10.1038/nature11547. 15. Waddell N, Pajic M, Patch AM, Chang DK, Kassahn KS, Bailey P, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature 2015;518(7540):495-501 doi 10.1038/nature14169. 16. Bardeesy N, Morgan J, Sinha M, Signoretti S, Srivastava S, Loda M, et al. Obligate roles for p16(Ink4a) and p19(Arf)-p53 in the suppression of murine pancreatic neoplasia. Mol Cell Biol 2002;22(2):635-43. 17. Ying H, Dey P, Yao W, Kimmelman AC, Draetta GF, Maitra A, et al. Genetics and biology of pancreatic ductal adenocarcinoma. Genes Dev 2016;30(4):355-85 doi 10.1101/gad.275776.115. 18. Castellano E, Downward J. RAS Interaction with PI3K: More Than Just Another Effector Pathway. Genes Cancer 2011;2(3):261-74 doi 10.1177/1947601911408079. 19. Chio IIC, Jafarnejad SM, Ponz-Sarvise M, Park Y, Rivera K, Palm W, et al. NRF2 Promotes Tumor Maintenance by Modulating mRNA Translation in Pancreatic Cancer. Cell 2016;166(4):963-76 doi 10.1016/j.cell.2016.06.056. 20. Fujita-Sato S, Galeas J, Truitt M, Pitt C, Urisman A, Bandyopadhyay S, et al. Enhanced MET Translation and Signaling Sustains K-Ras-Driven Proliferation under Anchorage-Independent Growth Conditions. Cancer Res 2015;75(14):2851-62 doi 10.1158/0008-5472.CAN-14-1623. 21. Csibi A, Lee G, Yoon SO, Tong H, Ilter D, Elia I, et al. The mTORC1/S6K1 pathway regulates glutamine metabolism through the eIF4B-dependent control of c-Myc translation. Curr Biol 2014;24(19):2274-80 doi 10.1016/j.cub.2014.08.007.
34
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
22. Holz MK, Ballif BA, Gygi SP, Blenis J. mTOR and S6K1 mediate assembly of the translation preinitiation complex through dynamic protein interchange and ordered phosphorylation events. Cell 2005;123(4):569-80 doi 10.1016/j.cell.2005.10.024. 23. Makohon-Moore A, Iacobuzio-Donahue CA. Pancreatic cancer biology and genetics from an evolutionary perspective. Nat Rev Cancer 2016;16(9):553-65 doi 10.1038/nrc.2016.66. 24. Ostrem JM, Peters U, Sos ML, Wells JA, Shokat KM. K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions. Nature 2013;503(7477):548-51 doi 10.1038/nature12796. 25. Waters AM, Der CJ. KRAS: The Critical Driver and Therapeutic Target for Pancreatic Cancer. Cold Spring Harb Perspect Med 2018;8(9) doi 10.1101/cshperspect.a031435. 26. Janes MR, Zhang J, Li LS, Hansen R, Peters U, Guo X, et al. Targeting KRAS Mutant Cancers with a Covalent G12C-Specific Inhibitor. Cell 2018;172(3):578- 89 e17 doi 10.1016/j.cell.2018.01.006. 27. Samatar AA, Poulikakos PI. Targeting RAS-ERK signalling in cancer: promises and challenges. Nat Rev Drug Discov 2014;13(12):928-42 doi 10.1038/nrd4281. 28. Blasco MT, Navas C, Martin-Serrano G, Grana-Castro O, Lechuga CG, Martin- Diaz L, et al. Complete Regression of Advanced Pancreatic Ductal Adenocarcinomas upon Combined Inhibition of EGFR and C-RAF. Cancer cell 2019 doi 10.1016/j.ccell.2019.03.002. 29. Kinsey CG, Camolotto SA, Boespflug AM, Guillen KP, Foth M, Truong A, et al. Protective autophagy elicited by RAF-->MEK-->ERK inhibition suggests a treatment strategy for RAS-driven cancers. Nat Med 2019;25(4):620-7 doi 10.1038/s41591-019-0367-9. 30. Bryant KL, Stalnecker CA, Zeitouni D, Klomp JE, Peng S, Tikunov AP, et al. Combination of ERK and autophagy inhibition as a treatment approach for pancreatic cancer. Nat Med 2019;25(4):628-40 doi 10.1038/s41591-019-0368-8. 31. Chan K, Robert F, Oertlin C, Kapeller-Libermann D, Avizonis D, Gutierrez J, et al. eIF4A supports an oncogenic translation program in pancreatic ductal adenocarcinoma. Nat Commun 2019;10(1):5151 doi 10.1038/s41467-019-13086- 5. 32. Ingolia NT, Brar GA, Rouskin S, McGeachy AM, Weissman JS. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments. Nat Protoc 2012;7(8):1534-50 doi 10.1038/nprot.2012.086. 33. Grant CE, Bailey TL, Noble WS. FIMO: scanning for occurrences of a given motif. Bioinformatics 2011;27(7):1017-8 doi 10.1093/bioinformatics/btr064. 34. Panda AC, Martindale JL, Gorospe M. Polysome Fractionation to Analyze mRNA Distribution Profiles. Bio Protoc 2017;7(3) doi 10.21769/BioProtoc.2126. 35. Ozes AR, Feoktistova K, Avanzino BC, Baldwin EP, Fraser CS. Real-time fluorescence assays to monitor duplex unwinding and ATPase activities of helicases. Nat Protoc 2014;9(7):1645-61 doi 10.1038/nprot.2014.112.
35
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
36. Ozes AR, Feoktistova K, Avanzino BC, Fraser CS. Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B. J Mol Biol 2011;412(4):674-87 doi 10.1016/j.jmb.2011.08.004. 37. Fraser CS, Berry KE, Hershey JW, Doudna JA. eIF3j is located in the decoding center of the human 40S ribosomal subunit. Mol Cell 2007;26(6):811-9 doi 10.1016/j.molcel.2007.05.019. 38. Winograd R, Byrne KT, Evans RA, Odorizzi PM, Meyer AR, Bajor DL, et al. Induction of T-cell Immunity Overcomes Complete Resistance to PD-1 and CTLA-4 Blockade and Improves Survival in Pancreatic Carcinoma. Cancer Immunol Res 2015;3(4):399-411 doi 10.1158/2326-6066.CIR-14-0215. 39. Pylayeva-Gupta Y, Lee KE, Hajdu CH, Miller G, Bar-Sagi D. Oncogenic Kras- induced GM-CSF production promotes the development of pancreatic neoplasia. Cancer cell 2012;21(6):836-47 doi 10.1016/j.ccr.2012.04.024. 40. Boj SF, Hwang CI, Baker LA, Chio, II, Engle DD, Corbo V, et al. Organoid models of human and mouse ductal pancreatic cancer. Cell 2015;160(1-2):324-38 doi 10.1016/j.cell.2014.12.021. 41. Gao D, Vela I, Sboner A, Iaquinta PJ, Karthaus WR, Gopalan A, et al. Organoid cultures derived from patients with advanced prostate cancer. Cell 2014;159(1):176-87 doi 10.1016/j.cell.2014.08.016. 42. Gerard B, Jones Ii G, Porco JA, Jr. A biomimetic approach to the rocaglamides employing photogeneration of oxidopyryliums derived from 3-hydroxyflavones. J Am Chem Soc 2004;126(42):13620-1 doi 10.1021/ja044798o. 43. Gerard B, Sangji S, O'Leary DJ, Porco JA, Jr. Enantioselective photocycloaddition mediated by chiral Bronsted acids: asymmetric synthesis of the rocaglamides. J Am Chem Soc 2006;128(24):7754-5 doi 10.1021/ja062621j. 44. Gerard B, Cencic R, Pelletier J, Porco JA, Jr. Enantioselective synthesis of the complex rocaglate (-)-silvestrol. Angew Chem Int Ed Engl 2007;46(41):7831-4 doi 10.1002/anie.200702707. 45. Shukla S, Allam US, Ahsan A, Chen G, Krishnamurthy PM, Marsh K, et al. KRAS protein stability is regulated through SMURF2: UBCH5 complex- mediated beta-TrCP1 degradation. Neoplasia 2014;16(2):115-28 doi 10.1593/neo.14184. 46. Zhong Y, Karaletsos T, Drewe P, Sreedharan VT, Kuo D, Singh K, et al. RiboDiff: detecting changes of mRNA translation efficiency from ribosome footprints. Bioinformatics 2017;33(1):139-41 doi 10.1093/bioinformatics/btw585. 47. Bardeesy N, Aguirre AJ, Chu GC, Cheng KH, Lopez LV, Hezel AF, et al. Both p16(Ink4a) and the p19(Arf)-p53 pathway constrain progression of pancreatic adenocarcinoma in the mouse. Proc Natl Acad Sci U S A 2006;103(15):5947-52 doi 10.1073/pnas.0601273103. 48. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, et al. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res 2009;37(Web Server issue):W202-8 doi 10.1093/nar/gkp335. 49. Iwasaki S, Floor SN, Ingolia NT. Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor. Nature 2016;534(7608):558-61 doi 10.1038/nature17978.
36
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
50. Guo JU, Bartel DP. RNA G-quadruplexes are globally unfolded in eukaryotic cells and depleted in bacteria. Science 2016;353(6306) doi 10.1126/science.aaf5371. 51. Kwok CK, Marsico G, Sahakyan AB, Chambers VS, Balasubramanian S. rG4-seq reveals widespread formation of G-quadruplex structures in the human transcriptome. Nat Methods 2016;13(10):841-4 doi 10.1038/nmeth.3965. 52. Kwok CK, Marsico G, Balasubramanian S. Detecting RNA G-Quadruplexes (rG4s) in the Transcriptome. Cold Spring Harb Perspect Biol 2018;10(7) doi 10.1101/cshperspect.a032284. 53. Ingolia NT, Ghaemmaghami S, Newman JR, Weissman JS. Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 2009;324(5924):218-23 doi 10.1126/science.1168978. 54. Pelletier J, Graff J, Ruggero D, Sonenberg N. Targeting the eIF4F translation initiation complex: a critical nexus for cancer development. Cancer Res 2015;75(2):250-63 doi 10.1158/0008-5472.CAN-14-2789. 55. Sen ND, Zhou F, Harris MS, Ingolia NT, Hinnebusch AG. eIF4B stimulates translation of long mRNAs with structured 5' UTRs and low closed-loop potential but weak dependence on eIF4G. Proc Natl Acad Sci U S A 2016;113(38):10464- 72 doi 10.1073/pnas.1612398113. 56. Liu T, Nair SJ, Lescarbeau A, Belani J, Peluso S, Conley J, et al. Synthetic silvestrol analogues as potent and selective protein synthesis inhibitors. J Med Chem 2012;55(20):8859-78 doi 10.1021/jm3011542.
Figure legends
Figure 1: The translation of KRAS mRNA depends on the eIF4A helicase.
A and B, the 5’UTRs of KRAS transcript variants “a” and “b” harbor three highly structured regions (red boxes; subsequent panels refer to variant “b” and
KRAS2B). C, Diagram of the KRAS 5’UTR translation reporter assay where wild type (structured) or mutant (unstructured, same length and GC content, sequence in methods) control d1eGFP expression in 293T cells. D,
Quantification of d1eGFP translation from wild type or mutant KRAS 5’UTR in
response to []CR-1-31B (50 nM; 24 hrs) or solvent (DMSO). E-H, KRAS, p-
ERK, ERK protein levels and β-actin in PANC1 and MiaPaca-2 cells following
[]CR-1-31B treatment at indicated doses and time points. I, Schematic diagram
37
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
showing CRISPR-Cas9 sgRNA pairs used to generate the two deletion mutants of the endogenous KRAS 5’UTR in PANC1 cells. J, In parental PANC1 cells the
KRAS protein decreases upon []CR-1-31B treatment (50 nM) (top panel), in cells with 5’UTR deletions corresponding to sgRNA pairs sg1-sg2 and sg1-sg3 the KRAS is not affected by []CR-1-31B. MYC protein is equally affected in the parental and KRAS 5’UTR deleted PANC1 cells. β-actin is used as loading control.
Figure 2: Activity of the eIF4A inhibitor CR-1-31B against PDAC cells and organoids.
A, IC50 analysis for []CR-1-31B in a panel of human PDAC cell lines. B and C,
Long term (14d) colony formation assay from MiaPaca-2 and PANC1 cells with different deletions of KRAS 5’UTR in []CR-1-31B (0-10 nM) or DMSO. D,
Primary murine PDAC (mKPC1/2) and normal pancreatic duct cell (mNormal1/2) organoids derived from the KPC (Pdx1-Cre; Kras+/LSL-G12D; Trp53+/LSL-
R172H) mouse model exposed to []CR-1-31B at indicated doses; p value for comparison of PDAC and normal pancreatic organoids. E, Six primary human
PDAC organoids exposed to indicated concentrations of []CR-1-31B and
assessed for viability. F, Representative images corresponding to human PDAC
organoids in (E) treated as indicated.
Figure 3: Ribosome profiling identifies the eIF4A dependent mRNAs in
PDAC cells.
38
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
A, Schematic of the ribosome profiling on PANC1 cells treated with DMSO or
[]CR-1-31B (25 nM; 45 minutes). Comparison of ribosome protected sequences and total mRNA isolates the translational efficiency for each mRNA (TE). B,
Frequency distribution of the change translation efficiency (TE) in untreated and
[]CR-1-31B treated PANC1 cells. Using the indicated statistical cut-offs we identify mRNAs with decreased (TE down, red) and increased (TE up, blue) and unchanged translation (background, grey); three biological replicates; the most significantly affected genes are indicated on each side. C-F, Immunoblot on lysates for PANC1 (C), MiaPaca-2 (D), KPC-4622 (E), and human PDAC organoid (F) treated with CR-1-31B and probed for the indicated proteins; β-
tubulin and GAPDH used as loading control; mRNA levels PANC1 in Fig. S3I. G,
GSEA KEGG pathway analysis of eIF4A dependent (TE down) genes. H, Key
proteins in the KRAS and MAPK, pathway are sensitive to eIF4A inhibition in
PDAC cells (marked with black star).
Figure 4: CR-1-31B impairs the translation of RNA G-quadruplex containing
mRNAs in PDAC.
A, An unbiased search for significantly enriched sequences (TE down versus
background and TE up; search across the entire coding sequence) identifies a
12-mer (CGG)4 and two 9-mer (CGG)3 and (CCG)3 sequences as significantly
enriched motifs that correspond to G quadruplex (GQ) forming sequences
(significance for GQ motifs: p12mer=3.8e-10, p9mer=1.6e-14, and p9mer=1.1e-8). B,
Analysis showing overlap between 12-mer (CGG)4 and two 9-mer (CGG)3 and
39
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
(CCG)3 sequences with predicted GQ structure forming sequences in TE down group of transcripts. C, Percentage of transcripts containing predicted GQ structure forming motifs in TE down, TE up and background. D, Frequency
distribution analysis across the TE range shows that transcripts with 5’UTR GQ
motifs are more sensitive to []CR-1-31B mediated inhibition compared to the transcripts without 5’UTR GQ sequences. E, Swimmer plot shows a reduction
(fold change) in TE upon []CR-1-31B treatment corresponds to the number of
5’UTR GQ sequences suggesting a dosage effect. F, Diagram of the 5’UTRs of key eIF4A dependent mRNAs indicating the presence of GQ sequences (red stars). G, Schematic of an eIF4A duplex unwinding assay that accounts for the sequence specific unwinding activity of eIF4A using a Cy3/BHQ labelled RNA duplex probe. H, eIF4A duplex unwinding assay using 12-mer (CGG)4 oligomers in RNA GQ folding conditions with DMSO or []CR-1-31B at the indicated doses and time points. I, eIF4A duplex unwinding assay with oligomers encoding the putative eIF4A binding site (AG)7 with DMSO or []CR-1-31B at the indicated
doses and time points.
Figure 5: In vivo safety and efficacy of eIF4A inhibitors in PDAC models.
A, Genetically engineered mouse model of PDAC. Kaplan-Meier survival
analysis comparing overall survival of KPC (PdxCre;KrasG12D,TP53fl/fl) mouse
treated with []CR-1-31B (0.5 mg/kg twice a week i.p.) (n=5) or vehicle (n=7)
starting at 4-5 weeks of age and followed for disease progression and death. B –
D, Orthotopically engrafted KPC mouse PDAC cells (KPC-4662) in the pancreas
40
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
of immune competent C57/B6 animals and treated with []CR-1-31B (0.5mg/kg,
i.p, twice a week, d1-d42) or vehicle. B, Luciferase imaging. C, Representative
H&E and Ki-67 stains on KPC tumors following []CR-1-31B treatment (d42). D,
Animal weights following []CR-1-31B (0.5mg/kg, i.p, twice a week, d1-d42) or vehicle treatment. E, KRAS, p-ERK, ERK protein levels and β-actin in
orthotopically engrafted KPC tumors treated with []CR-1-31B (0.5mg/kg, i.p,
twice a week, d1-d42) or vehicle at day42. F, Image J quantification of KRAS,
MYC, PI3K, and YAP1 protein levels normalized to β-actin (as in Fig. 5E). G-L
Human PDAC patient xenograft (PDX) implanted subcutaneously in NSG mice and treated with [-]CR-1-31B (0.5 mg/kg twice a week i.v.) or vehicle after tumors formed (~80mm3) from d22 until d54; G, Tumor volume curve, p value compares
[-]CR-1-31B and vehicle treated cohorts (n=5 per group). H, Kaplan-Meier survival analysis comparing overall survival of mice harbouring tumor volume
>2000 mm3 in vehicle treated (n=10) and [-]CR-1-31B treated animals (n=13). I,
Tumor histology (H&E and Ki-67 stains) on PDX tumors harvested after last treatment. J, Immunoblot on PDX lysates probed for KRAS, MYC, p-ERK, and
ERK 24h after last treatment (vehicle or [-]CR-1-31B). K and L, Image J quantification of KRAS and MYC protein levels normalized to β-actin, p-ERK is normalized to total ERK (as in Fig. 5J). M, Animal weights indicate tolerability of
[-]CR-1-31B treatment (as in G).
41
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Figure 1
A 5’UTR-KRAS transcript variant b B 5’UTR-KRAS transcript variant a ENST00000311936 ENST00000256078
C D 150 KRAS WT KRAS 5’UTR Reporter *p<0.00003 KRAS Mutant Wild Type n.s. 100 d1eGFP or Mutant 50
d1eGFP % d1eGFP positive cells positive d1eGFP %
0 KRAS 5’UTR activity 0 25 (eGFP positive cells) [±]CR31B (nM) E F PANC1 MiaPaca-2 0 1 5 10 25 50 nM [±]CR31B (72hr) 0 1 5 10 25 50 nM [±]CR31B (72hr) KRAS4B KRAS4B
p-ERK (p42/44) p-ERK (p42/44)
ERK ERK
` -Actin ` -Actin G H PANC1 MiaPaca-2 0 24 48 72 hr [±]CR31B (50 nM) 0 24 48 72 hr [±]CR31B (50 nM) KRAS4B KRAS4B
`-Actin `-Actin
I J PANC1 0 24 48 72 hr [±]CR31B (50 nM) CRISPR-Cas9 targeting KRAS 5’UTR KRAS4B Full length MYC 5’UTR CDS 5’UTR [ `-Actin sg1 sg2 KRAS2B sg1-sg2 sg3 MYC Full length transcript 5’UTR del [ `-Actin
sg1-sg3 KRAS2B 5’UTR deleted transcript CDS 5’UTR del [ MYC `-Actin
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Figure 2 A B C MiaPaca-2 PANC1 Full length sg1-sg2 sg1-sg3 5’UTR 5’UTR del 5’UTR del 8 DMSO DMSO
6 [±]CR31B [±]CR31B 2 nM 2 nM 4 [±]CR31B [±]CR31B 4 nM 4 nM 2 [±]CR31B [±]CR31B
[±]CR31B IC50 (nM) IC50 [±]CR31B 0 6 nM 6 nM [±]CR31B [±]CR31B PK-1 KP-4 KP-3 PL45 8 nM 8 nM PSN1 KLM-1 SUIT-2 PANC1 BxPC-3 HPAF-II SW1990
SNU-324 [±]CR31B SU.86.86
CAPAN-2 [±]CR31B MiaPaca2 10 nM 10 nM
D Mouse PDAC organoid E Human PDAC organoid mNormal 1 150 150 MSK-6 mNormal 2 MSK-8 mKPC 1 MSK-17 mKPC 2 MSK-3A 100 100 MSK-3B MSK-18 % viability %
% viability viability % 50 50 ] *p<0.0001 0 0 -2 -1 0 1 2 -1 0 1 2 3 4 [±]CR31B log (nM) [±]CR31B log10(nM) 10
F Control [±]CR31B (1 nM) [±]CR31B (10 nM) [±]CR31B (100 nM)
MSK-3B
600 +m 600 +m 600 +m 600 +m
MSK-17
600 +m 600 +m 600 +m 600 +m
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Figure 3 A B 1000 Total RNA MYC Background [±]CR31B KRAS TE Down q<0.001 or DMSO MAP2K1 RALBP1 TE Up q<0.001 treatment RNA Seq eIF4A targets 800 Ribo Seq RALA n=10861 RAC2 += -0.07 RASA1 m=0.97 Ribosome- 600 MET PANC1 AKT1/2 protected RNA TGFB1/2 TK2 PI3K UCK1 FZD1/2/6 IMPDH2
Frequency 400 PLCG2 GMPS C PANC1 D MiaPaca-2 PAK1 CES1 RAC2 CES2 0 24 48 72 hr [±]CR31B (50 nM) 0 24 48 72 hr [±]CR31B (50 nM) 200 NFKB1 SEC61G SEC11A MYC MYC
RALBP1 RALBP1 0 -4 -2 0 2 4 PI3K PI3K TE log2 Fold change [±]CR31B +/- H-RAS H-RAS E KPC- 4622 mouse PDAC cell line RAC2 RAC2 (50 nM) 0 24 48 72 hr [±]CR31B (50 nM) MYC MET MET KRAS4B YAP1 YAP1 p-ERK ERK XPO1 XPO1 MET DDX6 DDX6 YAP1 `-Tubulin `-Tubulin XPO1 DDX6 GAPDH GAPDH `-Actin F G H RAS signaling Human PDAC Organoid Pancreatic cancer Cell Membrane Chronic myeloid leukemia 0 24 48 72 hr [±]CR31B (50 nM) KRAS PI3K AKT TGF-beta signaling pathway KRAS4B Wnt signaling pathway MET Cell cycle Neurotrophin signaling pathway RALGDS RAF TIAM1 YAP1 Ubiquitin mediated proteolysis MAPK signaling pathway RAL MEK1/2 RAC DDX6 Focal adhesion Pathways in cancer RALBP1 ERK1/2 PAK1 `-actin MAPK 0 10 20 30 40 TE down genes (% Enrichment KEGG pathways) Nucleus MYC
Indicate EIF4A target
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Figure 4 A (CGG)4 12-mer motif (CGG)3 9-mer motif (CCG)3 9-mer motif
p=3.8e-10 p=1.6e-14 p=1.1e-8
B C 40 TE Down F Motif and GQ RNA G-quadruplex motif in 5’UTR Only Motif TE Up 750 CDS 30 KRAS BKG (197 bp) 500 MYC 20 (1202 bp) Motif overlap 250 RALBP1 with GQ structure
% GQ motif GQ % (234 bp) 0 10 PI3K (323 bp) H-RAS 0 SVGCGGCGGCCGCCGCYG (188 bp) CGGCGGCGGCKG RAC2 (256 bp) MET D E (201 bp) 1.0 GQ genes 0 GQ YAP1 (388 bp) 0.8 [N=1015] 1-3 GQ XPO1 BKG genes (728 bp) 0.6 [N=4000] DDX6 4-7 GQ (361 bp) 0.4 TUBB > 7GQ (60 bp) 0.2 GAPDH Number of RNA GQ RNA of Number (79 bp) Cumulative Frequency 0.0 -1.5-2 0.50-1-0.5 1.0 1.5 -1.5 -1.0 -0.5 0.50 1.0
TE log Fold change [±]CR31B +/- TE log2 Fold change [±]CR31B +/- 2
G H I eIF4A duplex unwinding assay RNA Probe: (CGG)4 12 mer RNA Probe: (AG)7 repeat No drug No drug [±]CR31B (50 uM) [±]CR31B (50 uM) [±]CR31B (100 uM) RNA probe DNA competitor (10X) 160 [±]CR31B (100 uM) 150 5’ Cy3 5’ No Helicase 5’ BHQ + No Helicase 140 *p<0.001 Low Cy3 Signal *p=0.0001 100
eIF4A 120 +ATP RFU +eIF4H+eIF4G RFU 50 100 Cy3 5’ 5’ BHQ 5’ + 0 High Cy3 Signal 80 0 0 60 60 120 180 240 300 360 420 480 540 600 660 720 780 120 180 240 300 360 420 480 540 600660 720 780
Time (seconds) Time (seconds)
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
*
*
*
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Targeting eIF4A Dependent Translation of KRAS Signaling Molecules
Kamini Singh, Jianan Lin, Nicolas Lecomte, et al.
Cancer Res Published OnlineFirst February 25, 2021.
Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-20-2929
Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2021/02/24/0008-5472.CAN-20-2929.DC1
Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.
E-mail alerts Sign up to receive free email-alerts related to this article or journal.
Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].
Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2021/02/24/0008-5472.CAN-20-2929. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.
Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2021 American Association for Cancer Research.