Supporting Information Von Gise Et Al

Supporting Information von Gise et al. 10.1073/pnas.1116136109

SI Materials and Methods 48 h in the presence of 20 μM cytosine B-D-arabinofuranoside(araC; Mice. All animal procedures were approved by the Institutional Sigma) and 5% (vol/vol) horse serum to prevent proliferation of fl Animal Care and Use Committee. Col-TetO-YAP1 (1), Yap1 ox nonmyocytes. Then cardiomyocytes were transduced with virus (2), Yap1S79A (2), Rosa26mTmG (3), Rosa26fs-rtTA (4), and (multiplicity of infection, 25) in serum-free medium and cultured Tnnt2–Cre (5) alleles were described. Dox was administered to for an additional 48 h. For BrdU labeling, we treated cells for 24 h pregnant dams at 1 mg/mL in drinking water. For delivery to with 10 μM BrdU. Cells were fixed with 4% (wt/vol) PFA and lactating pups, Dox in maternal drinking water was supple- immunostained. For quantitation of cardiomyocyte number, cells mented with IP injection of 100 μg per g of body weight daily. were cultured on labeled, gridded dishes (MatTeK) and sequen- Gestational age was determined by checking for vaginal plugs, tially imaged. Adult cardiomyocytes were isolated by antegrade with noon of the day of the plug defined as E0.5. Ascending collagenase perfusion and purified by differential centrifugation. aortic constriction was performed as described (6). Histology. H&E staining was performed on paraffin-embedded Adenoviruses. Tnnt2-Cre adenovirus was constructed using the rat sections. Immunostaining was performed on cryosections and Tnnt2 promoter (7) and the AdEasy system (Stratagene). 3xFlag– detected with Alexa-labeled secondary antibodies (Invitrogen). YAP1 adenovirus was generated by cloning S127A-mutated hu- Antibody sources are listed in Table S1. EdU was administered man YAP1 cDNA with an N-terminal triple FLAG epitope tag intraperitoneally at 200 μg (pregnant dams) or 5 μg per g of body into pENTR3C (Invitrogen). The GFP–YTIP construct was weight (pups), 2 or 24 h before tissue collection, respectively. generated by cloning eGFP, a 15-amino acid C-terminal linker, EdU was detected with Click-iT chemistry (Invitrogen). Imaging and residues 47–155 of human YAP1 into pENTR3C. These was performed on a Nikon TE2000 epifluorescent microscope expression cassettes were then transferred to pAd/CMV/V5- with deconvolution (Volocity; Perkin-Elmer) or on an Olympus DEST by using LR clonase (Invitrogen). Viruses were purified on FV1000 confocal. cesium chloride gradients and titered by using the AdEasy adenoviral titer kit (Stratagene). Retro-orbital adenoviral injection Gene Expression. Western blotting was performed by using specific to neonatal pups was performed as described (8). antibodies (Table S1). Total RNA was isolated by using the RNeasy kit (Qiagen) and hybridized to Affymetrix microarrays (Rat Gene Cardiomyocyte Isolation and Culture. Fetal and neonatal rat car- 1.0 ST). Array data were deposited at the Gene Expression Om- diomyocyte culture was performed by using the Neomyts car- nibus (GEO) database (accession no. GSE33019). For qRT-PCR, diomyocyte dissociation kit (Cellutron). Cardiomyocytes were RNA was reverse transcribed (Superscript III) and specific tran- enriched by preplating on tissue culture plastic to remove non- scripts were measured by using Sybr Green chemistry and nor- myocytes. P4 neonatal cardiomyocytes were initially cultured for malized to GAPDH. Primer sequences are provided in Table S2.

1. Camargo FD, et al. (2007) YAP1 increases organ size and expands undifferentiated 5. Jiao K, et al. (2003) An essential role of Bmp4 in the atrioventricular septation of the progenitor cells. Curr Biol 17:2054–2060. mouse heart. Genes Dev 17:2362–2367. 2. Schlegelmilch K, et al. (2011) Yap1 acts downstream of α-catenin to control epidermal 6. Bisping E, et al. (2006) Gata4 is required for maintenance of postnatal cardiac function proliferation. Cell 144:782–795. and protection from pressure overload-induced heart failure. Proc Natl Acad Sci USA 3. Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L (2007) A global double-ﬂuorescent Cre 103:14471–14476. reporter mouse. Genesis 45:593–605. 7. Wang G, Yeh HI, Lin JJ (1994) Characterization of cis-regulating elements and trans- 4. Belteki G, et al. (2005) Conditional and inducible transgene expression in mice through activating factors of the rat cardiac troponin T gene. J Biol Chem 269:30595–30603. the combinatorial use of Cre-mediated recombination and tetracycline induction. 8. Jerome LA, Papaioannou VE (2001) DiGeorge syndrome phenotype in mice mutant for Nucleic Acids Res 33:e51. the T-box gene, Tbx1. Nat Genet 27:286–291.

von Gise et al. www.pnas.org/cgi/content/short/1116136109 1of8 proliferative hypertrophic growth growth

birth

150

100 8

50 4 Heart Weight (mg) 0 10 20 0

1.5 1.5

1.0

1.0 0.5

0 10 20 0.5

0 0 20 40 60 80 100 120 140 Postconception Age (d)

Fig. S1. Growth of the mammalian heart. Fetal growth occurs through cardiomyocyte proliferation, and postnatal growth occurs through cardiomyocyte hypertrophy. The fold increase in heart weight between E10.5 and birth and birth to adulthood is comparable. The rate of change of heart weight normalized to the size of the heart, a measure of the growth velocity at the cellular level, decreases rapidly with increasing age.

A 3d7d3w 4w 8w 12w 20w 28w YAP1

GAPDH

B E17 3d 1.5m CM NM CM NM CM NM

YAP1

GAPDH

Fig. S2. Cardiac YAP1 expression. (A) Postnatal YAP1 expression in myocardium. Postnatal age is indicated. d, days; w, weeks. (B) YAP1 expression in cardiomyocytes (CM) and nonmyocytes (NM) at indicated developmental stages. Myocardium was dissociated by collagenase digestion, and the cardiomyocyte fraction was isolated by differential plating (fetal and neonatal) or differential centrifugation (adult). E, embryonic.

von Gise et al. www.pnas.org/cgi/content/short/1116136109 2of8 n akr Y2adML a nhne nYap1-de in unchanged Yap1 was MYL7 and MYL2 markers ciae xrsino GPfo h Rosa26 the from mGFP of expression activated hp a omldsiecrichppai.( hypoplasia. cardiac despite normal was ( shape effusion. pericardial to due heads) S3. Fig. o iee al. et Gise von =9 Tnnt2 – 1 ( 11. itlgcladFC nlsso Yap1-de of analysis FACS and Histological er.Arwed niaeaottcnce nsi.(cl a:10 bar: (Scale skin. in nuclei apoptotic indicate Arrowheads heart. H elsz,a siae yfradsatr a nhne ewe oto n YAP1-de and control between unchanged was scatter, forward by estimated as size, Cell ) B A E www.pnas.org/cgi/content/short/1116136109 Yap1Tnnt2 Control Yap1 TUNEL Tnnt2 TNNI3 B xml famtn er ihsvr lblmoada yolsa vrl ada atrigwspeevd Lungs preserved. was patterning cardiac Overall hypoplasia. myocardial global severe with heart mutant a of Example ) DAPI C Control Yap1 mTmG E16.5 E16.5 C ebaosVDi aeYap1 rare a in VSD Membranous ) F ﬁ ﬁ lee ( allele. RA RA in ea ers ( hearts. fetal cient Tnnt2 in ers Saebr:100 bars: (Scale hearts. cient Tnnt2-Cre::Rosa26 10 10 10 RFP dissociate 10 0 1 2 FACS G RV RFP 0 oa adoyct ubrwsrdcdi Yap1 in reduced was number cardiomyocyte Total ) RV LA 10 1 LA LV LV A mTmG/+ GFP hl-on iwo aki mrosoigtasuetmtn hs (arrow- chest mutant translucent showing embryo backlit of view Whole-mount ) 10 μ 2 . ( m.) μ F D 10 . ( m.) ASaayi fftlcrimoye,ioae ysrigfrTnnt2-Cre for sorting by isolated cardiomyocytes, fetal of analysis FACS ) GFP

Tnnt2 Tnnt2 3 Yap1 Control E UE tiigidctdn signi no indicated staining TUNEL ) uatta uvvdt 1..( E16.5. to survived that mutant 10 RA MYL7 RA 4 RV RV G DAPI

4 LV ﬁ CM number (x 10 ) 0 1 2 3 4 in cardiomyocytes. cient LA LA LV Tnnt2 P=0.02 uathatcmae ihcontrol. with compared heart mutant H

Yap1 Control RA D MYL2 RV RA

ﬁ Forward Scatter xrsino chamber-speci of Expression ) atcag naotssrt in rate apoptosis in change cant n

Tnnt2 (Arbitrary Units) 100 150 50 RV =9 0 DAPI – LV 11. LA NS LA LV 3of8 ﬁ c RFP GFP DAPI

RFP+ GFP+

*** *** 300 NS ) 2 baseline 250

200 NS

150

100

50 Cross-sectional Area (µm AAC 0 baseline TAC

Fig. S4. YAP1 is not required for pathological cardiac hypertrophy. Mice with mosaic cardiac YAP1 inactivation were treated with ascending aortic constriction (AAC) or no operation at 6 wk. One week later, cardiomyocyte cross-sectional areas were measured. GFP+ (YAP1-depleted) and RFP+ (control) cardiomyocyte cross-sectional areas were not statistically different (NS). More than 280 cardiomyocytes were measured per group. ***P < 0.001. (Scale bars: 10 μm.)

von Gise et al. www.pnas.org/cgi/content/short/1116136109 4of8 ppoi fclue adoycts ( cardiomyocytes. cultured of apoptosis h utr eid adoyct ubrdcie es nteaA1gop * group. aYAP1 the in least indica declined arrows number White Cardiomyocyte period. treatment. culture virus the after hours on performed indicate was Times staining cytokinesis. TNNI3 cytokinesis. for 50 after sequentially con just to cardiomyocytes observed period indicate and culture arrowheads Yellow dishes cytokinesis. culture undergoing tissue diomyocytes gridded on plated entlrtcrimoye.YP a eetdwt speci with detected ( was YAP1 cardiomyocytes. rat neonatal S5. Fig. o iee al. et Gise von C ifrn hsso ioi nue yepeso faA1 e,TN3 Saebr 50 bar: (Scale TNNI3. Red, aYAP1. of expression by induced mitosis of phases Different ) G E C AB μ . ( m.) E ciae A1siuae rlfrto fclue ea n otaa adoycts ( cardiomyocytes. postnatal and fetal cultured of proliferation stimulated YAP1 Activated AurB TNNI3 pH3 TNNI3 usto 4NVsudretaotssdrn h utr eid sidctdb UE tiig Saebr 20 bar: (Scale staining. TUNEL by indicated as period, culture the during apoptosis underwent NRVMs P4 of subset A ) Anaphase aYAP1 LacZ Ctrl Ad:LacZ www.pnas.org/cgi/content/short/1116136109 npaeCytokinesis Anaphase Relative cell number (%) Metaphase Prophase 100 120 20 40 60 80 0 TUNEL ﬁ mlnaeiett.Crimoyectknsswsntosre nutetd(oto)o aZaeoiu-rae rus Saebars: (Scale groups. adenovirus-treated LacZ or (control) untreated in observed not was cytokinesis Cardiomyocyte identity. lineage rm 244060hours0 Ad:FLAG-aYAP1 Control DAPI G Lacz uniaino bouecl ubrb euniliaigidctdta adoyct ubrdcie during declined number cardiomyocyte that indicated imaging sequential by number cell absolute of Quantitation ) GAPDH aYap1 FLAG-aYAP1 YAP1 Anaphase Telophase * AP 505 TNNI3 P 0 ﬁ nioy ( antibody. c D B YP tmltdpoieaino 1. ea a cardiomyocytes. rat fetal E16.5 of proliferation stimulated aYAP1 ) aYAP1 LacZ Ctrl Merge P 0 hr < .5v.LacZ. vs. 0.05 BrdU μ 10 20 30 40 50 0 . ( m.) + D CM(%) eilosraino adoyct iiin 4NVswere NRVMs P4 division. cardiomyocyte of observation Serial ) 24 hr * A dnvrlepeso fatvtdYP aA1 in (aYAP1) YAP1 activated of expression Adenoviral ) pH3 0 1 2 3 4 F +

TUNEL CM (%) + CM(%) 4 1 2 3 0 0h 60hr 40 hr oto azaYap1 Lacz Control * 100 150 Rel CMNum(%) 50 0 * μ . ( m.) * ﬁ TNNI3 aYAP1 LACZ Ctrl F e el fe the after cells xed YP reduced aYAP1 ) n =3.*

DAPI P < ecar- te 5of8 0.05. A fsrtTA B TnTCre::tetOYap hYAP1 Induction Cre Tnnt2-Cre Tnnt2 1.8 1.6 fs-rtTA Rosa26 stop rtTA 1.4 Rosa26 Col Dox 1.2 rtTA 1.0 0.8 0.6 TRE

(hYAP1/Gapdh) 0.4 ColTRE-YAP1 YAP1 Collagen locus 0.2 0 Control TetO-aYap1Tnnt2 Dox-regulated, Cardiomyocyte-specific Dox P5 P15 YAP1 Expression

C E12.5 D Control TetO-aYap1Tnnt2 Control

E12.5 Tnnt2

Nppa Nppa TetO-aYap1

Fig. S6. Fetal YAP1 gain of function stimulated cardiomyocyte proliferation in vivo. (A) Genetic strategy for cardiomyocyte-restricted YAP1 gain of function. – Tnnt2–Cre recombination of Rosa26fs rtTA resulted in cardiomyocyte-restricted expression of the rtTA, which stimulated activated human YAP1 expression from a Dox-regulated promoter positioned distal to the collagen locus. (B) Induction of the human YAP1 transgene by Dox. qRTPCR was performed with primers speciﬁc for human YAP1. (C) Peripheral hemorrhage and growth retardation of mutant embryo at E12.5. Hearts of mutant embryos were enlarged and exhibited pockets of pooled blood. (Left bars: 1 mm; right bars: 250 μm.) (D) Nppa in situ hybridization of E12.5 left ventricle. Trabecular myocardium (red arrowheads) expressed markedly lower Nppa transcript levels in TetO-aYap1Tnnt2 compared with control. (Scale bars: 100 μm.)

von Gise et al. www.pnas.org/cgi/content/short/1116136109 6of8 AB

FDR 1234 Rank Name Size (q-val) 1 Reactome Mitotic Prometaphase 77 0.000 2 Reactiome Cell Cycle Mitotic 262 0.000 3 Reactome Mitotic M M G1 132 0.000 Phases 4 Reactome G2 M Transition 72 0.000 5 Reactome Cetrosome Matruation 60 0.000 6 Reactome Loss of NLP from 53 0.000 5 6 7 8 Mitotic Centrosomes 7 Kegg Cell Cycle 106 0.002 8 Reactome Cholesterol 20 0.009 Biosynthesis 9 Reactome G2 M Checkpoints 34 0.010 10 Reactome Inactivation of APC 15 0.029 Via Direct Inhibition of the AP Complex 11 Kegg Steroid Biosynthesis 16 0.027 91011 12 12 Biocarta ATBRCA Pathway 18 0.030 13 Kegg Homologous 24 0.033 Recombination 14 Reactome Activation of the PRE 21 0.032 Replicative Complex 15 Reactome Double Strand Break 20 0.035 Repair 16 Biocarta Cell Cycle Pathway 19 0.033 13 16 17 Reactome E2F-Mediated Regula- 22 0.042 14 15 tion of DNA Replication 18 Reactome Mitochondrial tRNA 17 0.048 Aminoacylation

17 18

C +3 0 -3 x Cdkn3 Cdc20 Ccnh Mcm5 Cdk2 Hus1 Ba Cdk4 Tfdp2 Bccip Mad2l2 Sertad1 Mcm4 Ccnt1 Rbbp8 Chek1 Cul1 Ccnt2 Brca2 Ccne1 Rpa3 Pcna Cdc2 Ccnb1 Ccnf Ccnb2 Cks1b Cks1b Cdk6 Brca1 Cul2 Rad17 Cul3 Tp53 Cdkn1a Bax Cdk5rap1 Cdkn2a Kpna2 Ccnb2 Ccnd1 Rad51 Skp2 Cdk7 Rad1 Dnm2 Gtse1 Ccnd2 Kntc1 Mki67 Atm Gadd45a Sumo1 Brca2 Cdc34 Gtf2h1 Mcm3 Abl1 Ccnc Rbl2 Nbn Cdkn1b Cdk5r1 Mnat1 Mcm2 Cks2 Ccng2 Rpa3 Anapc2 Kpna2 Chek2 Cdkn2b Bcl2 Ddx11 Rbl1 Mre11a Cdc16 Ccng1 Rb1 Anapc4 yap4 yap3 yap1 yap2 lacz4 lacz3 lacz1 lacz2

Fig. S7. YAP1 promotes expression of cell-cycle genes. (A and B) Gene Set Enrichment Analysis was performed by using gene expression proﬁles of P4 NRVMs expressing activated YAP1 or control (LacZ) on curated canonical pathway gene sets. (A) Gene sets signiﬁcantly enriched (FDR < 0.05) in activated YAP1 expressing NRVMs. (B) Enrichment graphs showing overrepresentation of indicated gene set members among genes more highly expressed in activated YAP1 compared with control. Red numbers correspond to ranks indicated in A.(C) Heat map displaying two-way hierarchical clustering of cell cycle genes in P4 NRVMs expressing either aYAP1 or LacZ (control). Expression of cell-cycle genes clustered samples into treatment groups. This is the same heat map as in Fig. 6A but in expanded form with gene symbols.

von Gise et al. www.pnas.org/cgi/content/short/1116136109 7of8 Table S1. Antibodies and other staining reagents used in this study Antibody/staining reagent Supplier Catalog no.

Aurora B Abcam ab2254 BrdU Abcam Ab6326 EdU Invitrogen C10338 GAPDH Sigma G8795 MYL2 Sigma AT10493 MYL7 Santa Cruz sc66967 pH3 Millipore 06-570 TEAD1 BD 610923 TNNI3 (cardiac Troponin I) Abcam ab56357 TUNEL Roche 12 156 792 910 WGA, AlexaFluor Invitrogen W32466 647 conjugate YAP1 Sigma Y4770 Digoxigenin-AP Roche 11 093 274 910

Table S2. qRT-PCR primers used in this study Gene Forward primer Reverse primer

Aurka GGGTGGTCTGTGCATGCTCCG GCCTCAAAAGGAGGCATCCCCACTA Aurkb ATGAGCAGCGGACTGCCACG GTCCAGGGTGCCGCACATGG Ccna2 CCCGGAGCCAGAAAACCACTGGT GTCCACAAGGATGGCCCGCAT Ccnb1 TGCGAACCAGAGGTGGAACTGGA TTCCATTGGGCTTGGAGAGGGAGT Cdc20 GGCTGGGTTCCCCTGCAGACAT TGGGCAAAGCCATGGCCTGAGA Cdc25b TGGTGGCCCTGTTGACAGGC GCGGCACATCCGTGGTCCAC Cdc2 TTTCGGCCTTGCCAGAGCGTT GTGGAGTAGCGAGCCGAGCC Cdkn1a ATGTACCAGCCACAGGCACCATG GGGACCGAACAGACGACGGC Cdkn1b GGCCTTCGACGCCAGACGTAA GCGCAATGCTACATCCAATGCTT YAP1 ABI assay Mm00494240_m1 GAPDH ABE assay 4352339E Yap S127A AGCTGCTGGGCCAGAGACTACT TCGAGCTCATGCCTCTCCAGC

Other Supporting Information Files

Dataset S1 (XLS)

von Gise et al. www.pnas.org/cgi/content/short/1116136109 8of8