Quantification of Excision Repair Cross-Complementing Group 1 and Survival in P16-Negative Squamous Cell Head and Neck Cancers

Published OnlineFirst October 2, 2013; DOI: 10.1158/1078-0432.CCR-13-0152

Clinical Cancer Predictive Biomarkers and Personalized Medicine Research

Quantiﬁcation of Excision Repair Cross-Complementing Group 1 and Survival in p16-Negative Squamous Cell Head and Neck Cancers

Ranee Mehra, Fang Zhu, Dong-Hua Yang, Kathy Q. Cai, JoEllen Weaver, Mahendra K. Singh, Anna S. Nikonova, Erica A. Golemis, Douglas B. Flieder, Harry S. Cooper, Miriam Lango, John A. Ridge, and Barbara Burtness

Abstract Purpose: Multimodality treatment of squamous cell carcinoma of the head and neck (SCCHN) often involves radiotherapy and cisplatin-based therapy. Elevated activity of DNA repair mechanisms, such as the nucleotide excision repair (NER) pathway, of which ERCC1 is a rate-limiting element, are associated with cisplatin and possibly RT resistance. We have determined excision repair cross-complementing group 1 (ERCC1) expression in human papillomavirus (HPV)-negative SCCHN treated with surgery [adjuvant radiotherapy/chemoradiation (CRT)]. Experimental Design: We assessed ERCC1 protein expression in archival tumors using immunofluo- rescence staining and automatic quantitative analysis (AQUA) with three antibodies to ERCC1 (8F1, FL297, and HPA029773). Analysis with Classification and Regression Tree (CART) methods ascertained the cutoff points between high/low ERCC1 expression. Multivariable analysis adjusted for age, T, and N stage. Kaplan– Meier curves determined median survival. ERCC1 expression at initial tumor presentation and in recurrent disease were compared. Performance characteristics of antibodies were assessed. Results: ERCC1 low/high groups were defined on the basis of AQUA analysis with 8F1/2009, FL297, and HPA029773. Among patients treated with surgery plus adjuvant radiotherapy/CRT, longer median survival was observed in ERCC1-low versus ERCC1-high tumors (64 vs. 29 months; P ¼ 0.02; HPA029773). Data obtained with HPA029773 indicated no survival difference among patients treated only with surgery. Recurrent cancers had lower ERCC1 AQUA scores than tumors from initial presentation. Extensive characterization indicated optimal specificity and performance by the HPA029773 antibody. Conclusions: Using AQUA, with the specific ERCC1 antibody HPA029773, we found a statistical difference in survival among high/low-ERCC1 tumors from patients treated with surgery and adjuvant radiotherapy. Clin Cancer Res; 1–11. 2013 AACR.

Introduction role of infection with the human papillomavirus (HPV), Squamous cell carcinoma of the head and neck (SCCHN) especially in patients lacking the usual habitual exposures is diagnosed in more than 500,000 patients worldwide (3). p16 is a reliable surrogate biomarker for HPV-initiated annually, accounting for 5% of all malignancies. In the oropharyngeal cancers, where p16 elevation is often asso- United States, approximately 52,000 new cases occur per ciated with a favorable prognosis (4–7). In contrast, tumors year (1). Risk factors for SCCHN include tobacco and that arise from other head and neck sites such as the larynx alcohol use (2); mounting evidence supports a pathogenic and oral cavity are not associated with HPV infection, and have a poorer prognosis. Platinum chemotherapy using agents such as cisplatin is one important treatment of Authors' Affiliation: Fox Chase Cancer Center, Philadelphia, Pennsylvania SCCHN (8, 9), whereas chemoradiation is often used for patients of SCCHN with high-risk clinical features (10, 11). Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). In view of the significant morbidity of these treatments, it is important to ensure that they are administered only to Current address for J. Weaver: University of Pennsylvania, Philadelphia, Pennsylvania; and current address for M.K. Singh, Biovest International those patients who are likely to benefit. Inc., Minneapolis, Minnesota. Platinum-containing chemotherapies cause formation of Corresponding Author: Ranee Mehra, Fox Chase Cancer Center, 333 platinum-DNA adducts, which interfere with DNA tran- Cottman Ave., Philadelphia, PA 19111. Phone: 215-214-4297; Fax: 215- scription and replication, and are typically controlled by 728-3639; E-mail: [email protected] activation of the nucleotide excision repair (NER) pathway doi: 10.1158/1078-0432.CCR-13-0152 (12, 13). Radiation typically induces double-strand breaks 2013 American Association for Cancer Research. (DSB; ref. 14). The excision repair cross-complementing

www.aacrjournals.org OF1

Mehra et al.

review from a pathologist, which renders ranking of ERCC1 Translational Relevance expression subject to variation among pathologists. This Human papillomavirus (HPV)-negative squamous prompted us to evaluate the ability of quantitative IHC cell carcinoma of the head and neck (SCCHN) is com- analysis using automated quantitative analysis (AQUA, paratively insensitive to cisplatin and radiotherapy. Cis- HistoRx) to measure ERCC1 expression levels in archival platin resistance is associated with increased activity tissue. AQUA provides a highly reproducible platform suit- of the excision repair cross-complementing group 1 able for development as a clinical test (21, 22). Further- (ERCC1) enzyme, a rate-limiting element in the nucle- more, due to the ability to localize signals associated with a otide excision repair (NER) pathway, and also acts in the tumor mask (which eliminates signal from adjacent stro- repair of double-stranded breaks (DSB). Using immu- ma), or to the cytoplasmic or nuclear compartments of nofluorescence staining and automated quantitative tumor cells, it is possible to quantify the marker of interest analysis (AQUA) to probe ERCC1 expression in archival within specific subcellular regions of the most relevant surgical specimens from patients who received adjuvant cell type. This permits more accurate quantification of radiation, as compared with those submitted only to ERCC1 in the nuclear compartment, where it is known to resection, this work suggests that SCCHN patients with localize (23). high ERCC1 levels may not receive a survival benefit A critical concern in IHC studies is the quality of the from adjuvant radiotherapy. Identification of patients antibody used. A growing literature surrounds the use of with this form of intrinsic treatment resistance will help IHC analysis for ERCC1 as a biomarker in other malignan- guide new treatment strategies in the high-risk HPV- cies (19, 24–29). The Lab Vision 8F1 antibody has been negative population, and allow more effective stratifica- most widely used in retrospective series from multiple tion of patients in future trials. tumor types, and has provided data with an ERCC1 cutoff point associated with survival differences in NSCLC and SCCHN, but recent batches of this antibody have been criticized for lack of specificity (and for lot-to-lot variabil- group 1 (ERCC1) enzyme has an essential role in the NER ity), making its continued use as a reagent problematic, and þ pathway, and also functions in the DSB pathway. ERCC1 calling into question the results of studies (including IALT) cell lines are more resistant to cisplatin and radiation than performed during the past decade, as the quality of this ERCC1 cell lines (12, 15). These roles suggest ERCC1 preparation has deteriorated (20, 30, 31). In this study, we expression is a potentially valuable predictor of response have carefully compared early batches of Lab Vision 8F1 to chemotherapy and chemoradiation. antibody (8F1/2009), but also with FL297 (which is rep- Ceppi and colleagues have analyzed ERCC1 gene expres- orted to be more specific for in vitro applications; Santa Cruz sion by reverse transcription polymerase chain reaction Biotechnology; ref. 32) and a new reagent, HPA029773 (RT-PCR) in patients with advanced non–small cell lung can- (Sigma), that has not previously been characterized in cer (NSCLC) treated with cisplatin and gemcitabine (16). SCCHN. In addition, we supported this clinical study with Among cisplatin-treated patients, those with low ERCC1 parallel biochemical analysis of these antibodies in cell line levels had increased survival of 23 versus 12.4 months models, to address the question of specificity for the ERCC1 (P ¼ 0.001). Although these results are intriguing, RT-PCR protein. Our primary goal was to study the correlation of reports mRNA, rather than protein, expression. Given addi- ERCC1 and survival in a retrospective tissue analysis of tional factors including differential translation and stability, patients who were treated with either surgery or surgery plus altered control of localization, and posttranslational modifi- adjuvant radiotherapy. cations that may affect enzymatic activity, results with protein may differ significantly from results with mRNA (17, 18). Given these issues, we have used an immunohistochemistry Materials and Methods (IHC)-based platform to determine tissue ERCC1 levels. Construction of tissue microarrays and annotation of A retrospective standard IHC analysis for ERCC1 protein clinical data expression has also been conducted on tumor specimens SCCHN surgical specimens from the Fox Chase Cancer from the International Adjuvant Lung Trial (IALT), in Center (FCCC) Biosample Repository were used to con- which patients received cisplatin-based therapy (19). In struct tissue microarrays (TMA). Tissue from each tumor the original publication, the survival benefit from adjuvant was placed in two unique spots on each TMA. Cases are a chemotherapy was confined to the 56% of patients whose random representation of tumors resected in our facility tumors were ERCC1 low. However, recent data from the from 1990 to 2007. All samples were obtained from primary same group have not reproduced these results in other tumors and/or nodal metastases at the time of initial resec- adjuvant datasets (20). Moreover, their report has raised tion. A small set of recurrent squamous cell cancers was also questions of antibody quality, and of whether IHC is a randomly sampled. Clinical information was available suitably precise tool for quantifying DNA repair biomar- from the repository database and extracted from clinical kers (20). databases in an anonymized fashion. At the time of tissue In SCCHN, ERCC1 expression levels have been common- acquisition, patients provided Institutional Review Board ly studied with standard IHC using an H-score scale with (IRB)–approved informed consent for storing tissue and

OF2 Clin Cancer Res; 2013 Clinical Cancer Research

ERCC1 and Survival in Squamous Cell Head and Neck Cancer

reviewing clinical data. Controls included SCCHN speci- for 15 minutes and washed once with distilled water and 3 mens with varying levels of ERCC1 expression. times with PBS. After limiting nonspecific binding with blocking reagent (Protein Block Serum-Free, 162 DAKO) Cell culture, siRNA, and quantitative RT-PCR for 30 minutes, the sections were incubated overnight HeLa cervical adenocarcinoma cells and FaDu SCCHN with ERCC1 antibody (1:100, 8F1/2009, Lab Vision; cells from the American Type Culture collection (ATCC) and 1:400 FL297/2010, Santa Cruz Biotechnology; or 1:5,000 SV40-transformed XP2YO skin fibroblasts (Coriell Institute HPA0297731/2011, Sigma) and pan-cytokeratin (tumor for Medical Research, Camden, NJ) were cultured as recom- mask) in antibody diluent Da Vinci Green (PD900, Biocare mended by the suppliers. Transfection with siRNAs used Medical) at 4C overnight. The pan-cytokeratin was probed RNAiMAX (Invitrogen). ERCC1 was depleted using Human with an Alexa Fluor 555 dye–labeled secondary antibody ERCC1-ON-TARGET-plus SMARTpool (NM_001983) from (Invitrogen). The primary antibody was targeted with Envi- Dharmacon. The four siRNAs in this pool bind areas in sion reagents (DAKO), which provides multiple HRP moi- common between all reported ERCC1 isoforms and, there- eties, intensifying signal. Target amplification and visuali- fore, are predicted to deplete all ERCC1 species. Negative zation was accomplished using a Cy-5-tyramide signal scrambled control was purchased from Dharmacon. For amplification system (TSA; Cat. AT705A, PerkinElmer): the evaluation of ERCC1 knockdown, total RNA was extracted Cy-5 (far-red) emission peak is well outside the green- using the RNeasy Mini Kit (Qiagen) 48 hours after transfec- orange spectrum of tissue autofluorescence. Prolong Gold tion, reverse-transcribed using standard approaches, and mounting medium (P36931; Molecular Probes) containing analyzed by Taqman chemistry using Assay-on-Demand 4,6-diamidino-2-phenylindole (DAPI) was used to stain Hs01012158_m1 for ERCC1. Expression was normalized tissue nuclei. Positive and negative controls, discussed in to the housekeeping gene POLR2F, for which the primers the Results section, were stained simultaneously. and probe sequences were TGCCATGAAGGAACTCAAGG, TCATAGCTCCCATCTGGCAG, and 6fam-CCCCATCATCA- Image acquisition and AQUA analysis TTCGCCGTTACC-bhq1. The assays were validated with a Automated image capturewasperformedbythe 4-fold 4-point dilution curve of cDNA. HistoRx PM-2000 (HistoRx), using the AQUAsition soft- ware. High-resolution monochromatic digital images of Western blot and immunoprecipitation analyses the cytokeratin staining visualized with AF555, DAPI, and Cells were lysed in the CelLytic M lysis buffer from Sigma- target staining with Cy5 were captured and saved for each Aldrich supplemented with Halt protease and phosphatase tumor histospot. Tumor mask was created from the inhibitor cocktail (Thermo Scientific). Tumor tissues were cytokeratin image of each histospot, representing areas homogenized in T-PER Tissue protein extraction reagent of the epithelial tumor. Histospots were excluded if the from (Thermo Scientific) supplemented with Halt protease tumor mask represented less than 5% of the total histo- and phosphatase inhibitor cocktail on ice, then cleared by spot area. DAPI immunoreactivity defined the nuclear centrifugation. Immunoprecipitation samples were incu- compartment. The cytoplasmic compartment was defined bated overnight with antibody at 4C, then incubated for 2 by the tumor mask. Images were visually inspected and hours with protein A/G-Sepharose (Thermo Scientific), cropped for unfavorable factors such as "out of focus," washed, and resolved by SDS-PAGE. Western blotting used debris, or damaged specimen before automatic analysis standard procedures, and was developed by chemolumi- (33). An AQUA score was generated by dividing the sum nescence using Luminata Western HRP substrates (Classico, of target signals within the tumor mask. AQUA scores Crescendo, and Forte) from EMD Millipore. Primary anti- were normalized to the exposure times and bit depth at bodies included anti-ERCC1 (FL-297) from Santa Cruz which the images were captured, allowing scores collected Biotechnology, anti-ERCC1 (8F1) from Neomarker, anti- at different exposure times to be compared directly. The ERCC1 (HPA029773) from Sigma-Aldrich, and mouse nuclear scores from two nonoverlapping images were anti-b-actin conjugated to horseradish peroxidase (HRP; averaged for each case. #ab49900) from Abcam. Secondary anti-mouse and anti- rabbit HRP-conjugated antibodies from GE Healthcare were Standard IHC for ERCC1 and p16 used at a dilution of 1:10,000. Image analysis was done Immunohistochemical staining was performed on 5-mm using ImageJ (NIH, Bethesda, MD), with signal intensity slides. Deparaffinization, rehydration, epitope retrieval, normalized to b-actin. blocking of peroxidase activity, and nonspecific protein binding, and primary antibody incubation were as for Fluorescent immunohistochemistry fluorescent IHC (F-IHC). Primary antibodies included Tissue sections were deparaffinized in xylene and rehy- ERCC1 (1:100; 8F1/2009, Lab Vision) and p16 (1:3,000; drated in a graded series of ethanol. The sections were E6H4, MTM Laboratories), with mouse immunogobulin G subjected to antigen retrieval by boiling in 0.01 mol/L (IgG) as negative control. Immunodetection was performed þ sodium citrate buffer (pH 6.0) in a steamer for 20 minutes, with the Dako Envision system. The antigen–antibody and then allowed to cool in the buffer for 20 minutes. immunoreaction was visualized using 3–30-diaminobenzi- Endogenous peroxidase activity was blocked by incubating dine as the chromogen. The slides were washed, counter- the slides in 3% hydrogen peroxide in absolute methanol stained with hematoxylin, dehydrated with alcohol, cleared

www.aacrjournals.org Clin Cancer Res; 2013 OF3

Mehra et al.

in xylene, and mounted. Patient samples that were shown Results previously to express high levels were used as positive TMA patient characteristics controls. TMAs were initially constructed from tissue obtained from 105 patients at the time of surgery at the FCCC for Standard IHC evaluation (H-score) newly diagnosed SCCHN. Primary sites included tongue, The slides were viewed and scored by a single pathologist. tonsil, glottis, pyriform sinus, and non-tongue oral cavity Immunoreactivity was semiquantitatively scored using a (Table 1). The patient population is representative of well-established immunoreactivity score system (H-Score) SCCHN disease, as illustrated by the overall survival curves by multiplying both the percentage of positive tumor cells of the patients analyzed across all stages. (Fig. 1) The limited (0%–100%) and the intensity of staining (0–3). H-score number of oropharyngeal tumors reflects institutional prac- range is 0 to 300. tice in which such patients were predominantly treated with definitive chemoradiation. Thirty-three patients were trea- Statistical analysis ted with surgery alone and 72 received adjuvant radiother- Only HPV-negative primary tumors were included in the apy; a minority (n ¼ 7) were treated with platinum-based final statistical analysis (all oropharyngeal primary tumors chemoradiation (CRT). Standard indications for adjuvant in which p16 was positive or unknown were excluded). therapy included multiple involved lymph nodes, close or Nuclear ERCC1 AQUA scores were analyzed for all anti- positive margins, or extracapsular spread of disease. bodies used. Survival time was measured as the number of months between diagnosis and death from any cause. Quantitative IHC analysis Individualswhowerealiveattimeoflastfollow-upwere To optimize the AQUA-based assay with increased reli- considered censored. Overall survival time distributions ability, we analyzed these TMAs with three different ERCC1 were plotted by stage and level of nuclear ERCC1 expression using Kaplan–Meier curves and median survival times were estimated. Classification and Regression Tree (CART) Table 1. Patient characteristics of initial and methods for failure time data (34) were used to identify expanded TMAs optimal cutoff points for nuclear ERCC1 expression levels with respect to the association with survival time within the population treated with adjuvant radiotherapy, sepa- Initial TMA Expanded TMA rately for each antibody. Next, Cox proportional hazards Primary site models were used to compare survival times between Oral cavity 46 51 nuclear ERCC1 expression-level groups (above or below Tongue 33 42 the optimal cutoff point) while adjusting for patient age, Tonsil 2 2 gender, and T/N stage. These analyses were performed Glottic 15 13 separately for surgery-only and adjuvant radiotherapy Pyriform sinus 3 4 groups using the same ERCC1 expression cutoff point. To Other 6 6 assess the validity of our method, we randomly sampled Gender 75% of the entire dataset as a training set and used the Male 66 76 remaining 25% as a test set. The Harrell C index was Female 39 42 computed on the basis of the multivariable Cox model Race on the test set (35). The Harrell C index measures the Caucasian 95 107 agreement of predictions with observed failure order. It is Non-Caucasian 10 11 defined as the proportion of all usable subject pairs in T stage which the predictions and outcomes are concordant. The 11415 C-index ranges between 0 and 1 with a value of 0.5 22333 indicating no predictive ability. We repeated this proce- 31414 dure 50 times, and the C-index ranged between 0.70 and 43238 0.89 with a mean of 0.78, indicating good predictive Unknown 22 18 ability of the CART method. These permutations were N stage performed using HPA029773 (Sigma) expression data 04041 derived from patients treated with adjuvant radiotherapy. 11215 The Spearman correlation coefficient was computed to 23141 assess the association between nuclear AQUA and H- Unknown 22 18 scores measured on the same tissue sample. Wilcoxon Treatment ranked sum tests were used to compare ERCC1 expression Surgery alone 33 38 values between primary and recurrent tissue samples. All Radiotherapy 65 63 test were two-sided with a 5% type-I error. Statistical Chemoradiation 7 17 analyses were conducted using Stata version 12 (Stata Total 105 118 Corporation, College Station, Texas).

OF4 Clin Cancer Res; 2013 Clinical Cancer Research

ERCC1 and Survival in Squamous Cell Head and Neck Cancer

an additional control, specimens stained with 8F1 antibody were also assigned H-scores using standard IHC; these results indicated a strong correlation between AQUA and H-scores (r ¼ 0.69), indicating robust performance of the AQUA technology (Supplementary Fig. S1B). In comparison, FL297 did not provide a cutoff point for high/low ERCC1 expression that was associated with a significant survival difference (Fig. 2C and D). With this antibody, a trend toward improved survival among the patients who had surgery plus radiation was observed at the 28th percentile cutoff point (2,492 in the nuclear 0.00 0.25 0.50 0.75 1.00 0 50 100 150 200 250 compartment). However, this was not statistically signifi- Months from diagnosis cant (P ¼ 0.19) after adjusting for patient age, gender, and Stage I Stage II Stage III T/N stage. Stage IV Unknown We then used HPA029773 to stain 97 of the original specimens, augmented with 21 additional clinical samples obtained from the FCCC Biosample Repository, for a total Figure 1. Overall survival by stage for total patient population. Median survival time: stage I, 128 months; stage 2, 163 months; stage 3, 53 of 118 cases (see Table 1). Thirty-eight patients were treated months; stage 4, 61 months; and unknown, 56 months. with surgery alone; 80 received adjuvant treatment, either with radiation or chemoradiation. At a cutoff point of antibodies: 8F1/2009, FL297, and HPA029773 (Supple- 2,136, which was the 28th percentile, there were 24 mentary Fig. S1A). A 2009 lot of the antibody 8F1 (Lab ERCC1-low cases and 94 ERCC1-high cases (Fig. 2E and Vision), produced before the time of reported deterioration F). For this new reagent, in an additional assessment, we in performance (20), represents a standard that is much found that the ERCC1-low specimens showed the same reported in the literature. However, given increasing con- level of cytokeratin and DAPI staining as the ERCC1-high cerns about reproducibility and specificity with the 8F1 specimens, indicating that the difference of ERCC1 expres- antibody (30), we evaluated the expression of nuclear sion is intrinsic and not due to differences in tissue preser- ERCC1 on these TMAs with additional antibodies. FL297 vation (Supplementary Fig. S2). Using the HPA029773 (32) is a rabbit polyclonal IgG developed against full-length antibody on the AQUA platform, there was a statistically ERCC1. This reagent has been reported to be highly specific significant difference in survival (P ¼ 0.02, HR ¼ 2.72) after for ERCC1 by Western blot and immunoprecipitation anal- adjusting for patient age, gender, and T/N stage, with an yses (32), although it has not been certified by its manu- overall median survival of 64 months in the low ERCC1 facturer for IHC. Finally, HPA029773 is a more recently group and 29 months in the high ERCC1 group among developed polyclonal affinity-isolated antibody that targets patients receiving adjuvant radiotherapy/chemoradiation ERCC1 with reported high specificity (36). These three therapy. Among patients treated with surgery alone, there antibodies indicate a wide expression range of ERCC1 was no difference in overall survival between the two between different tumor specimens, indicating a potentially ERCC1 groups (P ¼ 0.23). useful dynamic range. In most specimens, 8F1/2009 and On the basis of AQUA nuclear scores, there was a weak to HPA029773 staining was largely restricted to the nuclear moderate relationship of ERCC1 high/low assignment compartment. In contrast, FL297 showed nuclear staining using the CART-based cutoff points between all three anti- in some cases, but in other specimens, the staining was bodies, with 82% concordance between 8F1 and FL297, ambiguous with considerable cytoplasmic staining, raising 75% agreement between 8F1 and HPA029773, and 73% some concerns (Supplementary Fig. S1A). between FL297 and HPA209773.

AQUA analysis Recurrent disease The cutoff point for nuclear ERCC1 expression (8F1/ Tissues were available from a cohort of patients with 2009) based on CART was established at the 23rd percentile SCCHN with recurrent cancer. In further analysis with of AQUA scores from this cohort of tissue (172 in the HPA029773, we sought to determine if there was a differ- nuclear compartment; Fig. 2A and B). With this value, in ence in nuclear ERCC1 levels among previously untreated a multivariable analysis adjusted for age, gender, and T and cancers and tumor samples from sites of recurrent disease N stage, a higher median survival (133 months) was (Fig. 3). Specimens from recurrences were available from observed in ERCC1-low tumors compared with ERCC1- oral cavity, oropharyngeal, and laryngeal tumors. Initial high (26 months; P ¼ 0.036, HR ¼ 2.35) in SCCHN treated treatment was heterogeneous and included radiotherapy, with adjuvant radiotherapy. At this cutoff point, there was a chemoradiation, surgery, and surgery plus radiotherapy signiﬁcantly increased survival among the patients who (Supplementary Table S1). This series includes 15 nonre- were treated with surgery alone as well (P ¼ 0.014). How- current nodal metastases, which were removed at the time ever, we note that in this cohort there were only seven of the original presentation of malignancy, 11 recurrent patients in the ERCC1-low group, and merely two events. As nodal metastases, 20 recurrences at the primary site, and 43

www.aacrjournals.org Clin Cancer Res; 2013 OF5

Mehra et al.

AB8F1/Surgery 8F1/Surgery+RT P = 0.014 P = 0.036 Probability of survival Probability of survival Figure 2. Kaplan–Meier curves 0.00 0.25 0.50 0.75 1.00 050100150 200 0.000 0.25 0.5050 0.75 1.00 100 150 200 250 showing overall survival based on Months from diagnosis Months from diagnosis ERCC1– ERCC1+ ERCC1– ERCC1+ nuclear ERCC1 level in patients CD treated with (A, C, and E) surgery FL297/Surgery FL297/Surgery+RT alone or (B, D, and F) surgery plus P = 0.11 P = 0.19 adjuvant radiotherapy (RT). A and B, specimens were stained with 8F1: The cutoff point used was the 23rd percentile (172) of nuclear staining. C and D, specimens were stained with FL297: the cutoff point used was the 38th percentile Probability of survival

Probability of survival (2492). E and F, Specimens were stained with HPA029773: the 0.00 0.25 0.50 0.75 1.00

0 50 100 150 200 0.00 0.25 0.50 0.75 1.00 Months from diagnosis 0 50 100 150 200 250 cutoff point used was the 28th Months from diagnosis ERCC1– ERCC1+ percentile (2136). n ¼ 33 for surgery ERCC1– ERCC1+ and n ¼ 72 for surgery þ RT for 8F1 EF n ¼ HPA029773/Surgery HPA029773/Surgery+RT and FL297; 38 for surgery and n ¼ 80 for surgery þ RT for P = 0.23 P = 0.02 HPA029773. Probability of survival Probability of survival 0.00 0.25 0.50 0.75 1.00 0 50 100 150 200 0.000 0.25 0.5050 0.75 1.00 100 150 200 250 Months from diagnosis Months from diagnosis ERCC1– ERCC1+ ERCC1– ERCC1+

untreated primary cancers (which were randomly selected ern blot and immunoprecipitation analyses (Fig. 4). As a from the original TMA). There was an insufficient number of test set for evaluation of antibody specificity, we used the matched previously untreated and recurrent specimens HeLa, FaDu, and XP2YO cell lines (in this last cell line, a from the same patient for direct intrapatient comparison. mutation eliminating the ERCC1 partner XPF destabilizes Overall, the ERCC1 AQUA values were lower in recurrent the ERCC1 protein; ref. 37), transfected with an siRNA to tumors (P < 0.01) with a mean score of 1,243 compared deplete ERCC1 or a negative-control–scrambled siRNA. with 2,879 for previously untreated tumors. Nonrecurrent Control assessment using quantitative RT-PCR confirmed nodes, recurrent nodes, and primary tumors all had similar very effective depletion of ERCC1 mRNA using the ERCC1 values. siRNA (Fig. 4A). Western blot analysis indicated that 8F1/ 2009 and FL297 both identified a single species with a Comparison of antibodies by Western blot and molecular weight corresponding to the reported gel mobil- immunoprecipitation analyses ity of ERCC1 (35–38 kD) whether analyzed by Western Our data demonstrated nonequivalent behavior of three blot (Fig. 4B) or immunoprecipitation analyses (Figures 4C, different commercial reagents for detection of ERCC1 in D). HPA029773 not only identified unambiguously a single predicting clinical outcome. Several recent studies have specific ERCC1 species, but also identified a prominent emphasized changes in behavior in the erstwhile gold cross-reacting species (Fig. 4B and C). In contrast, the recent standard 8F1 affecting antibody lots produced in recent batch lot of 8F1 did not detect a specific species either by years (20, 31), whereas FL297 and HPA029773 have not Western blot or by immunoprecipitation analysis (Fig. 4B– been as extensively characterized. To address this issue, we D), concurring with other recent studies indicating a loss of compared (i) the early batch of 8F1/2009 used here for performance (20, 31). AQUA and IHC on tumors, (ii) a more recent batch of 8F1 In AQUA analysis, low ERCC1 expression as measured (from 2010), (iii) FL297, and (iv) HPA029773, using West- with FL297 did not predict an increased survival benefit, in

OF6 Clin Cancer Res; 2013 Clinical Cancer Research

ERCC1 and Survival in Squamous Cell Head and Neck Cancer

among patients with HPV-negative SCCHN who received adjuvant radiotherapy after surgery. Because HPV-negative tumors are known to be less sensitive to chemoradiation, this association provides a potential mechanistic explanation for this well-established clinical ﬁnding. Importantly, this work includes a cohort of patients treated with surgery alone; ERCC1 biomarker data have not been studied previously in such patients, because patients in all earlier 4,000 6,000 8,000 reports received chemoradiation. With HPA029773, there was no appreciable difference in survival associated with

ERCC1(SIGMA) in nucleus ERCC1 expression among these patients with a more favorable prognosis who needed no adjuvant therapy and were treated with resection alone. Our finding that 0 2,000 low ERCC1 expression correlates with improved treatment Non-recurr LN Recurr LN Recurrent tumor Tumor outcomes is consistent with previous reports (24, 25, 35). n = 15 n = 11 n = 20 n = 43 The finding that recurrent disease shows lower ERCC1 expression levels was unexpected and potentially reflects Figure 3. Comparison of ERCC1 values with HPA029773 between altered DNA repair capacity in response to prior therapy; primary and recurrent tumor. Overall, values for the recurrent tumor are this warrants study in a larger series. Our retrospective, smaller (P < 0.01). Nonrecurrent lymph nodes, recurrent lymph nodes, and primary tumors have similar values. nonrandomized series suggests, but does not prove, the hypothesis that ERCC1 is a predictive marker for radiation sensitivity in SCCHN. Similarly, it suggests, but does not contrast to data generated with 8F1/2009 or with prove the hypothesis that ERCC1 expression has no influ- HPA029773. One potential explanation suggests that FL297 ence on the prognosis of SCCHN, a factor independent of does not recognize ERCC1 following preparation of fresh- treatment. frozen paraffin embedded (FFPE) tissue and, therefore, Other retrospective studies of ERCC1 levels and cor- AQUA data with this antibody reflect nonspecific cross- relation to chemotherapy response and survival in reactivity, whereas early-batch 8F1 and HPA029773—des- SCCHN have been reported (24, 25, 38). In one of the pite having partial cross-reactivity with non-ERCC1 proteins larger series, Handra-Luca and colleagues studied speci- detectable by Western blot—predominantly react with mens from 107 patients with SCCHN who had received ERCC1 in IHC and AQUA analyses. If this hypothesis is cisplatin-based induction therapy. In this report, which correct, ERCC1 is predictive of overall survival. An alternative was published in 2007, ERCC1 expression was also possibility is that FL297 accurately and specifically identifies analyzed with an older batch of 8F1 and assigned an ERCC1 in IHC and AQUA analyses, whereas early-batch 8F1 H-score with standard IHC; 71% of tumors had high- and HPA029773 do not. In that scenario, ERCC1 expression level expression, whereas 29% had low-level expression. does not predict overall survival. To discriminate between This later group derived a 4-fold greater response and these models, we used AQUA and IHC to analyze FFPE cell benefit to cisplatin-based induction therapy, as well as an pellets prepared from some of the cell lines used for Western increase in median survival (24). However, additional blot and immunoprecipitation analyses (Fig. 4E). In this series yielded conflicting results, thus engendering con- setting, the reduced expression of ERCC1 associated with troversy whether ERCC1 is truly a marker for platinum siRNA depletion or with the XP2YO genotype was reflected resistance and if IHC is the best method to interrogate by reduced HPA029773 signal levels, consistent with a this marker (38, 39). specific signal. In reciprocal analysis, in Western blotting Many previous reports used the 8F1 ERCC1 antibody, and immunoprecipitation of tumor lysates from tumors with specific batch undefined; most reports in the past 2 characterized by AQUA using the HPA029773 antibody as years probably involve 8F1 batches that have lost specificity high or low for ERCC1, signal variance detected by the FL297 for ERCC1 (24, 25, 35). In a 2012 American Society of and HPA029773 reflected ERCC1, rather than the nonspe- Clinical Oncology (ASCO) report, Austin and colleagues cific cross-reacting band, again supporting the idea of a analyzed tissue from 84 platinum-treated patients who were specific signal for HPA029773 in AQUA analysis (Fig. 4F). enrolled in a clinical trial for locally advanced SCCHN. In Taken in sum, these data are most simply interpreted as standard IHC reported as an H-score, and cutoff point indicating the presence of a common, prognostic protein established at the median, 8F1-based determination of high that is part of a larger pool of cross-reacting species detected ERCC1 expression (46%) was not associated with an infe- by 8F1 and HPA029773. rior response rate or progression-free survival (PFS) whereas, in FL297-based determination, high ERCC1 levels were Discussion associated with a significantly inferior PFS (40). Similarly, In summary, our AQUA data indicate that low nuclear in 2012 Hao and colleagues reported a retrospective AQUA ERCC1 expression detected by either 8F1/2009 or current IHC using 8F1 and FL297 to analyze 55 SCCHN tumors HPA029773 antibodies is associated with a survival benefit from patients who underwent chemoradiation (38) Results

www.aacrjournals.org Clin Cancer Res; 2013 OF7

Mehra et al.

OF8 Clin Cancer Res; 2013 Clinical Cancer Research

ERCC1 and Survival in Squamous Cell Head and Neck Cancer

with 8F1 indicated no difference in survival, whereas, with cated in increased hypoxic radiosensitivity, which is of FL297, there was a significant relationship between low particular interest in SCCHN (44, 45). Thus, improved ERCC1 expression and increased overall survival (P ¼ survival among ERCC1-low patients treated with radio- 0.004). This relationship remained significant among the therapy has a sound biologic rationale. Furthermore, a HPV-negative tumors, but not the HPV-positive group, retrospective series reported by Vaezi and colleagues (46) which comprised half of their study population. This work, used a quantitative IHC platform to measure XPF expres- in general, supports the results of our study, conducted sion in 80 SCCHN tumors. Their finding that low XPF entirely in an HPV-negative group. However, although our expression is statistically associated with a prolonged PFS, studies with FL297 suggest a survival difference predicted by thus, corroborates our findings (46). In that study, the this reagent, statistical significance was not reached. Why primary site of disease was heterogeneous, and treatments FL297 would be prognostic in the article by Hao and consisting of chemoradiation, radiotherapy alone, or colleagues but not our series is unclear. In prior analyses, surgery plus adjuvant radiotherapy, were not considered and consistent with our experience with automated plat- separately. Despite this, the authors showed a statistically forms, FL297 nuclear staining was weak and cytoplasmic significant increase in PFS among tumors with low XPF staining strong, suggesting cross-reactivity in tissues fixed expression. Nonetheless, the DNA repair mechanisms for IHC which might account for the varying results associated with radioresistance are complex, and will observed with FL297 (41, 42). warrant evaluation of interactions between ERCC1, XPF, Accurate and reproducible methods are essential when and other DNA repair pathways. assaying clinical biomarkers. The recent report by Fibrou- In view of the magnitude of the survival disadvantage let and colleagues (20) in lung cancer emphasizes the associated with high ERCC1 expression in resected patients importance of integrating careful controls into the per- requiring radiotherapy or chemoradiation, future studies of formance of IHC-based biomarker studies, particularly adjuvant therapy, especially among HPV-negative patients, when interrogating ERCC1. Their report is consistent may benefit from incorporation of ERCC1 status as a with our conclusion that currently available lots of 8F1 stratification variable to ensure balance across treatment should not be used in future biomarker studies. Although arms. Currently, there are limited nonplatinum chemother- Fibroulet and colleagues conclusively showed this, they apy options for patients with SCCHN. Future work should did not reevaluate the lung tumors in their cohort with focus on developing optimal therapies for HPV-negative, additional antibodies against ERCC1. On the basis of ERCC1-high patients, and might also explore methods to Western blot analysis, our data indicate that HPA029773 target and inhibit ERCC1-XPF to restore sensitivity to cis- is a reasonable replacement for the early, "specific" platin and radiation. batches of 8F1 in IHC/AQUA applications for research In conclusion, although limited, the results of our retro- applications. In addition, Fibroulet and colleagues noted spective review are intriguing. Although the lack of ran- that all commercially available antibodies to ERCC1 react domized data hinders our ability to make definite conclu- with multiple isoforms, some of which are catalytically sions as to whether ERCC1 represents a predictive biomark- inactive, which may obscure interpretations. However, er for treatment selection, the data presented here are there are limited data regarding the role of ERCC1 iso- strongly suggestive. A prospective, randomized trial design forms in DNA repair (24), and our own Western blot will be necessary to define this with complete confidence. analyses (Fig. 4) typically detected only a single species of The current work additionally supports the significance of correct molecular weight in analyzed specimens, reducing such a study and illustrates the importance of selecting the this concern. appropriate antibody and assay conditions for all such ERCC1 association with XPF (ERCC4) is essential for endeavors. Much of the debate surrounding the utility of both NER and DSB repair, and the expression levels of ERCC1 IHC would be addressed by the availability of a these enzymes are closely linked (15, 32, 43). Fibroblasts clinical-grade reagent. We are now working under the deficient in the ERCC1–XPF (ERCC4) complex are sen- auspices of the NCI Clinical Assay Development Program sitive to radiation, with coincident defects in DSB repair to develop a standard clinical assay that uses an antibody (15). Decreased ERCC1–XPF activity has also been impli- adequate for this purpose.

Figure 4. qRT-PCR, Western blot, and immunoprecipitation analysis of ERCC1 in cell lines and tumor lysates. A, expression of ERCC1 following transfection with siRNA to ERCC1 (siERCC1) or scrambled (Scr) nonspeciﬁc siRNA in HeLa, FaDu, and XP2YO cell lines. Data are normalized to the HeLa-Scr combination; numbers below bars represent quantiﬁcation. Note, basal mRNA levels are elevated in the XP2YO cell line, likely in compensation for the destabilization of the protein associated with absence of XPF/ERCC4. For each sample, the values are average and SD of data from two PCR reactions performed with the cDNAs from two radiotherapy reactions. B, Western blotting detection of ERCC1 protein in HeLa, FaDu, and XP2YO cells transfected with siERCC1 or Scr, using old and new batches of 8F1, FL297, and HPA029773 antibodies as indicated. C, ERCC1 immunoprecipitated and visualized with old and new batches of 8F1, FL297, or HPA029773 antibodies from indicated cell lines transfected with siERCC1 or Scr. D, ERCC1 immunoprecipitated with old and new batches of 8F1 and HPA029773 antibodies indicated cell lines, detected by FL297 antibody. E, AQUA and IHC scores generated following analysis of FFPE cell pellets from HeLa, FaDu, and XP2YO cells transfected with the indicated siRNAs. F, graph indicates expression levels of ERCC1 in four tumor samples characterized by AQUA. Bottom, Western blot analyses indicate ERCC1 levels detected in these tumor lysates with low (lanes 1 and 2) and high (lanes 3 and 4) expression levels of ERCC1 as characterized by AQUA.

www.aacrjournals.org Clin Cancer Res; 2013 OF9

Mehra et al.

Disclosure of Potential Conflicts of Interest Acknowledgments No potential conflicts of interest were disclosed. The authors thank Eric Ross (Director, Biostatistics and Bioinformatics Facility), Emmanuelle Nicolas (Genomics Facility), and Mary Donovan Authors' Contributions (Data Manager, Biosample Repository) for their assistance with this work. Conception and design: R. Mehra, M.N. Lango, B. Burtness Development of methodology: R. Mehra, D-H. Yang, K.Q. Cai, M.K. Singh, H. Cooper, B. Burtness Grant Support Acquisition of data (provided animals, acquired and managed patients, This work was financially supported by the CA06927 NIH core grant and provided facilities, etc.): D-H. Yang, K.Q. Cai, J. Weaver, M.K. Singh, the Pew Charitable Trust (to the Fox Chase Cancer Center) and CA63366 (to A. Nikonova, D.B. Flieder, J.A. Ridge E.A. Golemis), and support from the Fox Chase Cancer Center Head and Analysis and interpretation of data (e.g., statistical analysis, biosta- Neck Keystone. tistics, computational analysis): R. Mehra, F. Zhu, D-H. Yang, K.Q. Cai, The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked E.A. Golemis, H. Cooper, B. Burtness advertisement Writing, review, and/or revision of the manuscript: R. Mehra, D-H. Yang, in accordance with 18 U.S.C. Section 1734 solely to indicate K.Q. Cai, E.A. Golemis, M.N. Lango, J.A. Ridge, B. Burtness this fact. Administrative, technical, or material support (i.e., reporting or orga- nizing data, constructing databases): R. Mehra Received January 28, 2013; revised September 25, 2013; accepted Sep- Study supervision: R. Mehra tember 26, 2013; published OnlineFirst October 2, 2013.

References 1. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J sion predicts locoregional failure and death following radiotherapy. Clin 2010;60:277–300. Clin Cancer Res 2011;17:2035–43. 2. Goldenberg D, Lee J, Koch WM, Kim MM, Trink B, Sidransky D, et al. 15. Ahmad A, Robinson AR, Duensing A, van Drunen E, Beverloo HB, Habitual risk factors for head and neck cancer. Otolaryngal Head Neck Weisberg DB, et al. ERCC1-XPF endonuclease facilitates DNA double- Surg 2004;131:986–93. strand break repair. Mol Cell Biol 2008;28:5082–92. 3. Herrero R, Castellsague X, Pawlita M. Human papillomavirus and oral 16. Ceppi P, Volante M, Novello S, Rapa I, Danenberg KD, Danenberg cancer: the International Agency for Research on Cancer multicenter PV, et al. ERCC1 and RRM1 gene expressions but not EGFR are study. J Natl Cancer Inst 2003;95:1772–83. predictive of shorter survival in advanced non–small-cell lung can- 4. Spector NL, Xia W, Burris H 3rd, Hurwitz H, Dees EC, Dowlati A, cer treated with cisplatin and gemcitabine. Ann Oncol 2006;17: et al. Study of the biologic effects of lapatinib, a reversible inhibitor 1818–25. ofErbB1andErbB2tyrosinekinases,ontumorgrowthandsurvival 17. Bessho T, Sancar A, Thompson LH, Thelen MP. Reconstitution of pathways in patients with advanced malignancies. J Clin Oncol human excision nuclease with recombinant XPF-ERCC1 complex. 2005;23:2502–12. J Biol Chem 1997;272:3833–7. 5. Rischin D, Young R, Fisher R, Fox S, Le Q-T, Peters L, et al. Prognostic 18. Orelli B, McClendon TB, Tsodikov OV, Ellenberger T, Niedernhofer LJ, significance of HPV and p16 status in patients with oropharyngeal Scharer OD. The XPA-binding domain of ERCC1 is required for cancer treated on a large international phase III trial. J Clin Oncol nucleotide excision repair but not other DNA repair pathways. J Biol 27:15s, 2009 (suppl; abstr 6004). Chem 2009;285:3705–12. 6. Weinberger PM, Yu Z, Haffty BG, Kowalski D, Harigopal M, Sasaki C, 19. Olaussen KA, Dunant A, Fouret P, Brambilla E, Andre F, Haddad V, et al. Prognostic significance of p16 protein levels in oropharyngeal et al. DNA repair by ERCC1 in non–small-cell lung cancer and cisplatin- squamous cell cancer. Clin Cancer Res 2004;10:5684–91. based adjuvant chemotherapy. N Engl J Med 2006;355:983–91. 7. Lingen MW, Xiao W, Schmitt A, Jiang B, Pickard R, Kreinbrink P, et al. 20. Friboulet L, Olaussen KA, Pignon JP, Shepherd FA, Tsao MS, Graziano Low etiologic fraction for high-risk human papillomavirus in oral cavity S, et al. ERCC1 isoform expression and DNA repair in non–small-cell squamous cell carcinomas. Oral Oncol 2013;49:1–8. lung cancer. N Engl J Med 2013;368:1101–10. 8. Forastiere AA, Metch B, Schuller DE, Ensley JF, Hutchins LF, Triozzi P, 21. Gustavson MD, Bourke-Martin B, Reilly DM, Cregger M, Williams C, et al. Randomized comparison of cisplatin plus fluorouracil and car- Tedeschi G, et al. Development of an unsupervised pixel-based boplatin plus fluorouracil versus methotrexate in advanced squamous- clustering algorithm for compartmentalization of immunohistochem- cell carcinoma of the head and neck: a Southwest Oncology Group ical expression using automated QUantitative analysis. Appl Immu- study. J Clin Oncol 1992;10:1245–51. nohistochem Mol Morphol 2009;17:329–37. 9. Vermorken JB, Mesia R, Rivera F, Remenar E, Kawecki A, Rottey S, 22. Moeder CB, Giltnane JM, Moulis SP, Rimm DL. Quantitative, fluores- et al. Platinum-based chemotherapy plus cetuximab in head and neck cence-based in-situ assessment of protein expression. Methods Mol cancer. N Engl J Med 2008;359:1116–27. Biol 2009;520:163–75. 10. Bernier J, Domenge C, Ozsahin M, Matuszewska K, Lefebvre JL, 23. Houtsmuller AB, Rademakers S, Nigg AL, Hoogstraten D, Hoeijmakers Greiner RH, et al. Postoperative irradiation with or without concomitant JH, Vermeulen W. Action of DNA repair endonuclease ERCC1/XPF in chemotherapy for locally advanced head and neck cancer. N Engl living cells. Science 1999;284:958–61. J Med 2004;350:1945–52. 24. Handra-Luca A, Hernandez J, Mountzios G, Taranchon E, Lacau- 11. Pignon JP, Bourhis J, Domenge C, Designe L. Chemotherapy added to St-Guily J, Soria JC, et al. Excision repair cross complementation locoregional treatment for head and neck squamous-cell carcinoma: group 1 immunohistochemical expression predicts objective three meta-analyses of updated individual data. MACH-NC Collabo- response and cancer-specific survival in patients treated by Cis- rative Group. Meta-Analysis of Chemotherapy on Head and Neck platin-based induction chemotherapy for locally advanced head Cancer. Lancet 2000;355:949–55. and neck squamous cell carcinoma. Clin Cancer Res 2007;13: 12. Lee KB, Parker RJ, Bohr V, Cornelison T, Reed E. Cisplatin sensitivity/ 3855–9. resistance in UV repair-deficient Chinese hamster ovary cells of com- 25. Jun HJ, Ahn MJ, Kim HS, Yi SY, Han J, Lee SK, et al. ERCC1 expression plementation groups 1 and 3. Carcinogenesis 1993;14:2177–80. as a predictive marker of squamous cell carcinoma of the head and 13. Dabholkar M, Vionnet J, Bostick-Bruton F, Yu JJ, Reed E. Messenger neck treated with cisplatin-based concurrent chemoradiation. Br J RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate with Cancer 2008;99:167–72. response to platinum-based chemotherapy. J Clin Invest 1994;94: 26. Kim MK, Cho KJ, Kwon GY, Park SI, Kim YH, Kim JH, et al. Patients 703–8. with ERCC1-negative locally advanced esophageal cancers may 14. Moeller BJ, Yordy JS, Williams MD, Giri U, Raju U, Molkentine DP, et al. benefit from preoperative chemoradiotherapy. Clin Cancer Res 2008; DNA repair biomarker profiling of head and neck cancer: Ku80 expres- 14:4225–31.

OF10 Clin Cancer Res; 2013 Clinical Cancer Research

ERCC1 and Survival in Squamous Cell Head and Neck Cancer

27. Kim MK, Cho KJ, Kwon GY, Park SI, Kim YH, Kim JH, et al. ERCC1 in squamous cell carcinomas of the head and neck treated with predicting chemoradiation resistance and poor outcome in oesopha- concurrent chemoradiation stratified by HPV status. Head Neck geal cancer. Eur J Cancer 2008;44:54–60. 2011;34:785–91. 28. Zheng Z, Chen T, Li X, Haura E, Sharma A, Bepler G. DNA synthesis and 39. Seiwert TY, Cohen EE, Wang X, Kocherginsky M, Bhayani M, Stenson repair genes RRM1 and ERCC1 in lung cancer. N Engl J Med 2007; K, et al. editors. Use of systematic analysis of DNA repair pathways in 356:800–8. head and neck cancer (HNC) to identify XPF as a novel predictor of 29. Akita H, Zheng Z, Takeda Y, Kim C, Kittaka N, Kobayashi S, et al. induction response, and pMK2 relationship to chemoradiotherapy. J Significance of RRM1 and ERCC1 expression in resectable pancreatic Clin Oncol 26:15S, 2008 (suppl; abstr 6003). adenocarcinoma. Oncogene 2009;28:2903–9. 40. Austin M, Schmidt R, Parvathaneni U, Bauman J, Hayes D, Papagikos 30. Niedernhofer LJ, Bhagwat N, Wood RD. ERCC1 and non–small-cell M, et al. editors. Expression of p16, ERCC1, and EGFR amplification as lung cancer. N Engl J Med 2007;356:2538–40. predictors of responsiveness of locally advanced squamous cell 31. Besse B, Olaussen KA, Soria JC. ERCC1 and RRM1: ready for prime carcinomas of head and neck (SCCHN) to cisplatin, radiotherapy, and time? J Clin Oncol 2013;31:1050–60. erlotinib: a phase II randomized trial. J Clin Oncol 30, 2012 (suppl; abstr 32. Bhagwat NR, Roginskaya VY, Acquafondata MB, Dhir R, Wood RD, 5515). Niedernhofer LJ. Immunodetection of DNA repair endonuclease 41. Olaussen KA, Soria JC. Validation of ERCC1-XPF immunodetection— ERCC1-XPF in human tissue. Cancer Res 2009;69:6831–8. letter. Cancer Res 2010;70:3851–2. 33. McCabe A, Dolled-Filhart M, Camp RL, Rimm DL. Automated quan- 42. Arbogast S, Behnke S, Opitz I, Stahel RA, Seifert B, Weder W, et al. titative analysis (AQUA) of in situ protein expression, antibody con- Automated ERCC1 immunohistochemistry in non–small cell lung can- centration, and prognosis. J Natl Cancer Inst 2005;97:1808–15. cer: comparison of anti-ERCC1 antibodies 8F1, D-10, and FL-297. 34. Van Putten W. CART: Stata module to perform Classification And Appl Immunohistochem Mol Morphol 2011;19:99–105. Regression Tree analysis. Chestnut Hill, MA: Department of Econom- 43. Bhagwat N, Olsen AL, Wang AT, Hanada K, Stuckert P, Kanaar R, et al. ics, Boston College, 2006. XPF-ERCC1 participates in the Fanconi anemia pathway of cross-link 35. Fountzilas G, Bamias A, Kalogera-Fountzila A, Karayannopoulou G, repair. Mol Cell Biol 2009;29:6427–37. Bobos M, Athanassiou E, et al. Induction chemotherapy with docetaxel 44. Murray D, Macann A, Hanson J, Rosenberg E. ERCC1/ERCC4 50- and cisplatin followed by concomitant chemoradiotherapy in patients endonuclease activity as a determinant of hypoxic cell radiosensitivity. with inoperable non-nasopharyngeal carcinoma of the head and neck. Int J Radiat Biol 1996;69:319–27. Anticancer Res 2009;29:529–38. 45. Murray D, Rosenberg E. The importance of the ERCC1/ERCC4[XPF] 36. Mooradian AD. Biomarkers of aging: do we know what to look for? complex for hypoxic-cell radioresistance does not appear to derive J Geront 1990;45:B183–6. from its participation in the nucleotide excision repair pathway. Mutat 37. Miura M, Nakamura S, Sasaki T, Takasaki Y, Shiomi T, Yamaizumi M. Res 1996;364:217–26. Roles of XPG and XPF/ERCC1 endonucleases in UV-induced immu- 46. Vaezi A, Wang X, Buch S, Gooding W, Wang L, Seethala RR, et al. nostaining of PCNA in fibroblasts. Exp Cell Res 1996;226:126–32. XPF expression correlates with clinical outcome in squamous 38. Hao D, Lau HY, Eliasziw M, Box A, Diaz R, Klimowicz AC, et al. cell carcinoma of the head and neck. Clin Cancer Res 2011;17: Comparing ERCC1 protein expression, mRNA levels, and genotype 5513–22.

www.aacrjournals.org Clin Cancer Res; 2013 OF11

Quantification of Excision Repair Cross-Complementing Group 1 and Survival in p16-Negative Squamous Cell Head and Neck Cancers

Ranee Mehra, Fang Zhu, Dong-Hua Yang, et al.

Clin Cancer Res Published OnlineFirst October 2, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-13-0152

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2013/10/02/1078-0432.CCR-13-0152.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2013/11/01/1078-0432.CCR-13-0152. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.