Mouse Elp3 Conditional Knockout Project (CRISPR/Cas9)

Total Page:16

File Type:pdf, Size:1020Kb

Load more

https://www.alphaknockout.com Mouse Elp3 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Elp3 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Elp3 gene (NCBI Reference Sequence: NM_001253812 ; Ensembl: ENSMUSG00000022031 ) is located on Mouse chromosome 14. 15 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 15 (Transcript: ENSMUST00000022609). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Elp3 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-233H18 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Embryos homozygous for a null gene trap mutation show severe growth retardation and die prior to E12.5. Exon 2 starts from about 4.53% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 2319 bp, and the size of intron 2 for 3'-loxP site insertion: 4109 bp. The size of effective cKO region: ~600 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 15 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Elp3 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7100bp) | A(25.51% 1811) | C(23.86% 1694) | T(29.46% 2092) | G(21.17% 1503) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr14 - 65590856 65593855 3000 browser details YourSeq 35 368 404 3000 91.7% chr13 - 45237366 45237401 36 browser details YourSeq 35 2352 2401 3000 95.0% chr12 - 53426800 53426862 63 browser details YourSeq 34 277 310 3000 100.0% chr6 - 34620418 34620451 34 browser details YourSeq 31 2361 2395 3000 97.0% chr7 + 119045542 119045580 39 browser details YourSeq 29 276 310 3000 85.3% chr9 - 92310576 92310609 34 browser details YourSeq 28 2352 2394 3000 75.7% chr4 - 138598896 138598936 41 browser details YourSeq 27 1363 1390 3000 100.0% chr10 - 124639097 124639126 30 browser details YourSeq 27 2373 2401 3000 100.0% chr11 + 109288726 109288872 147 browser details YourSeq 24 2371 2405 3000 69.3% chr15 - 28173429 28173455 27 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr14 - 65587256 65590255 3000 browser details YourSeq 336 267 2216 3000 88.9% chr10 - 120129791 120524227 394437 browser details YourSeq 260 170 2155 3000 87.6% chr17 + 7970593 8280807 310215 browser details YourSeq 214 1236 2067 3000 83.1% chr17 + 82985507 82986213 707 browser details YourSeq 210 280 2063 3000 88.7% chr17 + 6664590 6667785 3196 browser details YourSeq 188 1668 2216 3000 80.7% chr15 - 96004367 96004726 360 browser details YourSeq 182 158 542 3000 80.5% chr7 + 97317324 97317710 387 browser details YourSeq 177 1881 2241 3000 88.7% chr16 + 91891344 92049581 158238 browser details YourSeq 176 1668 2236 3000 82.5% chr19 + 24524532 24524900 369 browser details YourSeq 175 1883 2222 3000 83.5% chr6 + 90554152 90554484 333 browser details YourSeq 171 1662 2241 3000 79.4% chr7 - 142448990 142449381 392 browser details YourSeq 168 1664 2222 3000 84.1% chr3 - 107871971 107872347 377 browser details YourSeq 162 1668 2195 3000 83.2% chr13 - 52420364 52420702 339 browser details YourSeq 161 1670 2222 3000 76.1% chr2 + 158377793 158378168 376 browser details YourSeq 158 1934 2231 3000 83.8% chr18 + 36494858 36495165 308 browser details YourSeq 157 1672 2242 3000 81.0% chr2 + 31175555 31175932 378 browser details YourSeq 156 1966 2241 3000 83.0% chr3 - 58795640 58795894 255 browser details YourSeq 155 438 833 3000 89.4% chr13 - 63413055 63413477 423 browser details YourSeq 153 1886 2232 3000 86.4% chr10 - 111392169 111392824 656 browser details YourSeq 150 1668 2195 3000 81.0% chr7 + 65614739 65615089 351 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Elp3 elongator acetyltransferase complex subunit 3 [ Mus musculus (house mouse) ] Gene ID: 74195, updated on 10-Oct-2019 Gene summary Official Symbol Elp3 provided by MGI Official Full Name elongator acetyltransferase complex subunit 3 provided by MGI Primary source MGI:MGI:1921445 See related Ensembl:ENSMUSG00000022031 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as KAT9; 2610507P14Rik Expression Ubiquitous expression in CNS E18 (RPKM 31.8), CNS E14 (RPKM 30.9) and 28 other tissues See more Orthologs human all Genomic context Location: 14; 14 D1 See Elp3 in Genome Data Viewer Exon count: 15 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 14 NC_000080.6 (65530446..65593112, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 14 NC_000080.5 (66149293..66211847, complement) Chromosome 14 - NC_000080.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 3 transcripts Gene: Elp3 ENSMUSG00000022031 Description elongator acetyltransferase complex subunit 3 [Source:MGI Symbol;Acc:MGI:1921445] Gene Synonyms 2610507P14Rik, KAT9 Location Chromosome 14: 65,530,449-65,593,075 reverse strand. GRCm38:CM001007.2 About this gene This gene has 3 transcripts (splice variants), 199 orthologues, is a member of 1 Ensembl protein family and is associated with 2 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Elp3- ENSMUST00000022609.6 2851 566aa ENSMUSP00000022609.5 Protein coding CCDS56965 Q9CZX0 TSL:1 201 GENCODE basic Elp3- ENSMUST00000225355.1 2771 547aa ENSMUSP00000153462.1 Protein coding - Q9CZX0 GENCODE 203 basic APPRIS P1 Elp3- ENSMUST00000224743.1 2914 553aa ENSMUSP00000153177.1 Nonsense mediated - A0A286YDB8 - 202 decay 82.63 kb Forward strand 65.54Mb 65.56Mb 65.58Mb 65.60Mb Genes Nuggc-202 >protein coding (Comprehensive set... Contigs < AC158983.2 AC122274.4 > Genes (Comprehensive set... < Elp3-201protein coding < Elp3-203protein coding < Elp3-202nonsense mediated decay Regulatory Build 65.54Mb 65.56Mb 65.58Mb 65.60Mb Reverse strand 82.63 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000022609 < Elp3-201protein coding Reverse strand 62.63 kb ENSMUSP00000022... TIGRFAM Elongator complex protein 3-like Superfamily SSF102114 Acyl-CoA N-acyltransferase SMART Elp3/MiaB/NifB SFLD SFLDG01086 Elongator complex protein 3-like Pfam Radical SAM Radical SAM, C-terminal extension GNAT domain PROSITE profiles GNAT domain PIRSF Elongator complex protein 3-like PANTHER ELP3/YhcC Elongator complex protein 3-like Gene3D Radical SAM, alpha/beta horseshoe 3.40.630.30 CDD cd01335 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 480 566 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Recommended publications
  • Variants of the Elongator Protein 3 (ELP3) Gene Are Associated with Motor Neuron Degeneration

    Variants of the Elongator Protein 3 (ELP3) Gene Are Associated with Motor Neuron Degeneration

    Human Molecular Genetics, 2009, Vol. 18, No. 3 472–481 doi:10.1093/hmg/ddn375 Advance Access published on November 7, 2008 Variants of the elongator protein 3 (ELP3) gene are associated with motor neuron degeneration Claire L. Simpson1,{, Robin Lemmens4,{, Katarzyna Miskiewicz6,7, Wendy J. Broom8, Valerie K. Hansen1, Paul W.J. van Vught9, John E. Landers8, Peter Sapp8,11, Ludo Van Den Bosch4,5, Joanne Knight3, Benjamin M. Neale3, Martin R. Turner1, Jan H. Veldink9, Roel A. Ophoff10,12, Vineeta B. Tripathi1, Ana Beleza1, Meera N. Shah1, Petroula Proitsi2, Annelies Van Hoecke4,5, Peter Carmeliet5, H. Robert Horvitz11, P. Nigel Leigh1, Christopher E. Shaw1, Leonard H. van den Berg9, Pak C. Sham13, John F. Powell2, Patrik Verstreken6,7, Robert H. Brown Jr8, Wim Robberecht4,5 and Ammar Al-Chalabi1,Ã 1Department of Neurology, 2Department of Neuroscience, MRC Centre for Neurodegeneration Research and 3MRC Social, Genetic and Developmental Psychiatry Centre, Institute of Psychiatry, King’s College London, London SE5 8AF, UK, 4Service of Neurology (University Hospital Leuven) and Laboratory for Neurobiology, Section of Experimental Neurology, University of Leuven, Leuven B-3000, Belgium, 5Vesalius Research Center, Flanders Institute for Biotechnology (VIB) and 6Center for Human Genetics, Laboratory of Neuronal Communication, KU Leuven, Leuven B-3000, Belgium, 7Department of Molecular and Developmental Genetics, VIB, Leuven B-3000, Belgium, 8Cecil B Day Laboratory for Neuromuscular Research, Massachusetts General Hospital East, Charlestown, MA,
  • Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure

    Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure

    ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy.
  • A Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic Buffering of Doxorubicin Sean M

    A Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic Buffering of Doxorubicin Sean M

    Santos and Hartman Cancer & Metabolism (2019) 7:9 https://doi.org/10.1186/s40170-019-0201-3 RESEARCH Open Access A yeast phenomic model for the influence of Warburg metabolism on genetic buffering of doxorubicin Sean M. Santos and John L. Hartman IV* Abstract Background: The influence of the Warburg phenomenon on chemotherapy response is unknown. Saccharomyces cerevisiae mimics the Warburg effect, repressing respiration in the presence of adequate glucose. Yeast phenomic experiments were conducted to assess potential influences of Warburg metabolism on gene-drug interaction underlying the cellular response to doxorubicin. Homologous genes from yeast phenomic and cancer pharmacogenomics data were analyzed to infer evolutionary conservation of gene-drug interaction and predict therapeutic relevance. Methods: Cell proliferation phenotypes (CPPs) of the yeast gene knockout/knockdown library were measured by quantitative high-throughput cell array phenotyping (Q-HTCP), treating with escalating doxorubicin concentrations under conditions of respiratory or glycolytic metabolism. Doxorubicin-gene interaction was quantified by departure of CPPs observed for the doxorubicin-treated mutant strain from that expected based on an interaction model. Recursive expectation-maximization clustering (REMc) and Gene Ontology (GO)-based analyses of interactions identified functional biological modules that differentially buffer or promote doxorubicin cytotoxicity with respect to Warburg metabolism. Yeast phenomic and cancer pharmacogenomics data were integrated to predict differential gene expression causally influencing doxorubicin anti-tumor efficacy. Results: Yeast compromised for genes functioning in chromatin organization, and several other cellular processes are more resistant to doxorubicin under glycolytic conditions. Thus, the Warburg transition appears to alleviate requirements for cellular functions that buffer doxorubicin cytotoxicity in a respiratory context.
  • ELP3 (D5H12) Rabbit Mab A

    ELP3 (D5H12) Rabbit Mab A

    Revision 1 C 0 2 - t ELP3 (D5H12) Rabbit mAb a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 8 2 Web: [email protected] 7 www.cellsignal.com 5 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source/Isotype: UniProt ID: Entrez-Gene Id: WB H M R Endogenous 62 Rabbit IgG Q9H9T3 55140 Product Usage Information 9. Okada, Y. et al. (2010) Nature 463, 554-8. Application Dilution Western Blotting 1:1000 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA, 50% glycerol and less than 0.02% sodium azide. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity ELP3 (D5H12) Rabbit mAb recognizes endogenous levels of total ELP3 protein. Species Reactivity: Human, Mouse, Rat Species predicted to react based on 100% sequence homology: Hamster, Bovine, Dog, Pig, Horse Source / Purification Monoclonal antibody is produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Gly431 of human ELP3 protein. Background Elongator is a highly conserved transcription elongation factor complex that was first identified in yeast as part of the hyperphosphorylated RNA polymerase II (RNAPII) holoenzyme (1). The Elongator complex consists of 6 subunits, ELP1-6, and has been shown to have acetyltransferase activity (2). The acetylation targets of Elongator include histone H3, which is linked to the transcription elongation function of the complex, and α- tubulin, which is associated with regulation of migration and maturation of projection neurons (3-6).
  • Role of SSD1 in Phenotypic Variation of Saccharomyces Cerevisiae Strains Lacking DEG1-Dependent Pseudouridylation

    Role of SSD1 in Phenotypic Variation of Saccharomyces Cerevisiae Strains Lacking DEG1-Dependent Pseudouridylation

    International Journal of Molecular Sciences Article Role of SSD1 in Phenotypic Variation of Saccharomyces cerevisiae Strains Lacking DEG1-Dependent Pseudouridylation Bahar Khonsari, Roland Klassen * and Raffael Schaffrath * Institut für Biologie, Fachgebiet Mikrobiologie, Universität Kassel, Heinrich-Plett-Str. 40, D-34132 Kassel, Germany; [email protected] * Correspondence: [email protected] (R.K.); [email protected] (R.S.) Abstract: Yeast phenotypes associated with the lack of wobble uridine (U34) modifications in tRNA were shown to be modulated by an allelic variation of SSD1, a gene encoding an mRNA-binding protein. We demonstrate that phenotypes caused by the loss of Deg1-dependent tRNA pseudouridy- lation are similarly affected by SSD1 allelic status. Temperature sensitivity and protein aggregation are elevated in deg1 mutants and further increased in the presence of the ssd1-d allele, which encodes a truncated form of Ssd1. In addition, chronological lifespan is reduced in a deg1 ssd1-d mutant, and the negative genetic interactions of the U34 modifier genes ELP3 and URM1 with DEG1 are aggravated by ssd1-d. A loss of function mutation in SSD1, ELP3, and DEG1 induces pleiotropic and overlapping phenotypes, including sensitivity against target of rapamycin (TOR) inhibitor drug and cell wall stress by calcofluor white. Additivity in ssd1 deg1 double mutant phenotypes suggests independent roles of Ssd1 and tRNA modifications in TOR signaling and cell wall integrity. However, other tRNA Citation: Khonsari, B.; Klassen, R.; modification defects cause growth and drug sensitivity phenotypes, which are not further intensified Schaffrath, R. Role of SSD1 in in tandem with ssd1-d. Thus, we observed a modification-specific rather than general effect of SSD1 Phenotypic Variation of Saccharomyces status on phenotypic variation in tRNA modification mutants.
  • Spreading of Sir3 Protein in Cells with Severe Histone H3 Hypoacetylation

    Spreading of Sir3 Protein in Cells with Severe Histone H3 Hypoacetylation

    Spreading of Sir3 protein in cells with severe histone H3 hypoacetylation Arnold Kristjuhan*†, Birgitte Ø. Wittschieben*†‡, Jane Walker*, Douglas Roberts§, Bradley R. Cairns§, and Jesper Q. Svejstrup*¶ *Mechanisms of Transcription Laboratory, Cancer Research UK London Research Institute, Clare Hall Laboratories, South Mimms, Hertfordshire EN6 3LD, United Kingdom; and §Howard Hughes Medical Institute and Department of Oncological Science, Huntsman Cancer Institute, University of Utah, Salt Lake City, UT 84112 Communicated by Roger D. Kornberg, Stanford University School of Medicine, Stanford, CA, April 17, 2003 (received for review November 18, 2002) Heterochromatin formation in yeast involves deacetylation of H4 in the underlying chromatin then create a structure with the histones, but the precise relationship between acetylation and the characteristics of heterochromatin (3, 4). association of proteins such as Sir3, Sir4, and the histone deacety- The precise role of histones and histone hypoacetylation in lase Sir2 with chromatin is still unclear. Here we show that Sir3 heterochromatin formation and maintenance is still not entirely protein spreads to subtelomeric DNA in cells lacking the transcrip- clear. Sir3 and Sir4 bind to the tails of histones H3 and H4, and tion-related histone acetyltransferases GCN5 and ELP3. Spreading mutation of histone H4 amino-terminal lysine residues to un- correlates with hypoacetylation of lysines in the histone H3 tail and charged residues (thought to mimic acetylation) is sufficient to results in deacetylation of lysine 16 in histone H4. De-repression of disrupt H4–Sir3 interactions in vitro and significantly reduce genes situated very close to the ends of the chromosomes in gcn5 silencing in vivo (9).
  • ELP3 (NM 018091) Human Tagged ORF Clone Product Data

    ELP3 (NM 018091) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201491 ELP3 (NM_018091) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ELP3 (NM_018091) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ELP3 Synonyms: KAT9 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 ELP3 (NM_018091) Human Tagged ORF Clone – RC201491 ORF Nucleotide >RC201491 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGCAGAAGCGGAAAGGAGATCTCAGCCCTGCTGAGCTGATGATGCTGACTATAGGAGATGTTATTA AACAACTGATTGAAGCCCACGAGCAGGGGAAAGACATCGATCTAAATAAGGTGAAAACCAAGACAGCTGC CAAATATGGCCTTTCTGCCCAGCCCCGCCTGGTGGATATCATTGCTGCCGTCCCTCCTCAGTATCGCAAG GTCTTGATGCCCAAGTTAAAGGCGAAACCCATCAGAACTGCTAGTGGGATTGCTGTCGTGGCTGTGATGT GCAAACCCCACAGATGTCCACACATCAGTTTTACAGGAAATATATGTGTATACTGCCCTGGTGGACCTGA TTCTGATTTTGAGTATTCCACCCAGTCTTACACTGGCTATGAGCCAACCTCCATGAGAGCTATCCGTGCC AGATATGACCCTTTCCTACAGACAAGACACCGAATAGAACAGTTAAAACAACTTGGTCATAGTGTGGATA AAGTGGAGTTTATTGTGATGGGTGGAACGTTTATGGCCCTTCCAGAAGAATACAGAGATTATTTTATTCG AAATTTACATGATGCCTTATCAGGACATACTTCCAACAATATTTACGAGGCAGTCAAGTATTCTGAGAGA AGCCTCACAAAGTGTATTGGAATTACTATTGAAACCAGACCAGATTACTGCATGAAGCGACATTTAAGTG
  • Title: a Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic

    Title: a Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic

    bioRxiv preprint doi: https://doi.org/10.1101/517490; this version posted January 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Title Page: 2 3 Title: A yeast phenomic model for the influence of Warburg metabolism on genetic 4 buffering of doxorubicin 5 6 Authors: Sean M. Santos1 and John L. Hartman IV1 7 1. University of Alabama at Birmingham, Department of Genetics, Birmingham, AL 8 Email: [email protected], [email protected] 9 Corresponding author: [email protected] 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 1 bioRxiv preprint doi: https://doi.org/10.1101/517490; this version posted January 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 26 Abstract: 27 Background: 28 Saccharomyces cerevisiae represses respiration in the presence of adequate glucose, 29 mimicking the Warburg effect, termed aerobic glycolysis. We conducted yeast phenomic 30 experiments to characterize differential doxorubicin-gene interaction, in the context of 31 respiration vs. glycolysis. The resulting systems level biology about doxorubicin 32 cytotoxicity, including the influence of the Warburg effect, was integrated with cancer 33 pharmacogenomics data to identify potentially causal correlations between differential 34 gene expression and anti-cancer efficacy.
  • Elp3 Modulates Neural Crest and Colorectal Cancer Migration Requiring Functional Integrity of HAT and SAM Domains

    Elp3 Modulates Neural Crest and Colorectal Cancer Migration Requiring Functional Integrity of HAT and SAM Domains

    BIOCELL Tech Science Press 2021 Elp3 modulates neural crest and colorectal cancer migration requiring functional integrity of HAT and SAM domains XIANGCAI YANG1,2,*;YA XU3;SHUTING MEI1;JIEJING LI3,* 1 Department of R&D, Biotech & Science Company of UP, Guangzhou Branch, Guangzhou, 510000, China 2 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, China 3 Laboratory of Developmental Disease and Natural Medicine, Medical Faculty, Kunming University of Science and Technology, Kunming, 650000, China Key words: Elp3, Neural crest, Colorectal cancer cells, Migration, HAT domain, SAM domain Abstract: Cell migration is a finely tuned biological process that often involves epithelial-mesenchymal transition (EMT). EMT is typically characterized by the upregulation of mesenchymal markers such as Snail1. This process has been shown to be of critical importance to normal developmental processes, including neural crest migration and invasion. Interestingly, similar mechanisms are utilized in disease processes, such as tumor metastasis and migration. Notably, EMT and EMT-like processes confer tumor cells with the ability to migrate, invade, and adopt stem cell-like properties that largely account for immunosuppression and tumor recurrence. Therefore, identifying sensitive EMT markers may contribute to cancer prognosis and diagnosis in many facets. Previously, we showed that Elp3 plays an essential role during neural crest migration by stabilizing Snail1. In the current study, we further elucidate the molecular mechanism underlying colorectal cancer migration. We found that mElp3 exerted an identical function to xElp3 in modulating neural crest migration, and both HAT and SAM domains are imperative during this migratory process.
  • Integrative Framework for Identification of Key Cell Identity Genes Uncovers

    Integrative Framework for Identification of Key Cell Identity Genes Uncovers

    Integrative framework for identification of key cell PNAS PLUS identity genes uncovers determinants of ES cell identity and homeostasis Senthilkumar Cinghua,1, Sailu Yellaboinaa,b,c,1, Johannes M. Freudenberga,b, Swati Ghosha, Xiaofeng Zhengd, Andrew J. Oldfielda, Brad L. Lackfordd, Dmitri V. Zaykinb, Guang Hud,2, and Raja Jothia,b,2 aSystems Biology Section and dStem Cell Biology Section, Laboratory of Molecular Carcinogenesis, and bBiostatistics Branch, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709; and cCR Rao Advanced Institute of Mathematics, Statistics, and Computer Science, Hyderabad, Andhra Pradesh 500 046, India Edited by Norbert Perrimon, Harvard Medical School and Howard Hughes Medical Institute, Boston, MA, and approved March 17, 2014 (received for review October 2, 2013) Identification of genes associated with specific biological pheno- (mESCs) for genes essential for the maintenance of ESC identity types is a fundamental step toward understanding the molecular resulted in only ∼8% overlap (8, 9), although many of the unique basis underlying development and pathogenesis. Although RNAi- hits in each screen were known or later validated to be real. The based high-throughput screens are routinely used for this task, lack of concordance suggest that these screens have not reached false discovery and sensitivity remain a challenge. Here we describe saturation (14) and that additional genes of importance remain a computational framework for systematic integration of published to be discovered. gene expression data to identify genes defining a phenotype of Motivated by the need for an alternative approach for iden- interest. We applied our approach to rank-order all genes based on tification of key cell identity genes, we developed a computa- their likelihood of determining ES cell (ESC) identity.
  • ENZYMES THAT CATALYZE WOBBLE Trna MODIFICATION PROMOTE MELANOMAGENESIS Aberrant Mrna Translation Can Promote Tumo- but Rapidly Develop Acquired Resistance

    Published OnlineFirst June 29, 2018; DOI: 10.1158/2159-8290.CD-RW2018-109 RESEARCH WATCH Transcription Major finding: Low-complexity domains Concept: Transcription factor LCD Impact: Rapid, reversible LCD–LCD in- (LCD) in transcription factors can form hubs stabilize DNA binding and recruit teractions may represent a fundamental high-concentration interaction hubs. RNA Pol II to activate transcription. mechanism of transcriptional control. TRANSCRIPTION FACTOR LOW-COMPLEXITY DOMAIN HUBS DRIVE TRANSCRIPTION Although many transcription factors have well-structured could be disrupted by 1,6-hexanediol, a chemical that dissolves DNA binding domains, their transactivation domains often various intracellular membrane-less compartments. Although harbor low-complexity sequence domains (LCD) that adopt LCD–LCD interactions could form independent of DNA, tran- an intrinsically disordered conformation, hampering conven- scription factor–DNA interactions maintained a high local tional structural determination and pharmacologic targeting. concentration of transcription factor LCDs, stabilizing both Mutations in transcription factor LCDs have been implicated LCD–LCD interactions and transcription factor–DNA interac- in transcriptional disruption and cancer. However, it is unclear tions. EWS–FLI1, a fusion protein that drives Ewing sarcoma how transcription factor LCDs drive transactivation. Chong tumorigenesis, harbors an LCD and binds to GGAA microsat- and colleagues used high-resolution imaging strategies to char- ellites in the human genome. The EWS LCD–LCD interactions acterize the dynamic behavior of transcription factor LCDs at facilitated formation of EWS–FLI1 hubs at GGAA microsatel- target genomic loci under physiologic conditions. Integrating lite DNA elements in Ewing sarcoma cells, and were required a synthetic Lac operator array into cells that express various for the EWS–FLI1-mediated transcriptional activation to drive tagged transcription factor LCDs fused to LacI resulted in oncogenic gene expression.
  • Elongator Controls Cortical Interneuron Migration by Regulating Actomyosin Dynamics

    Cell Research (2016) 26:1131-1148. © 2016 IBCB, SIBS, CAS All rights reserved 1001-0602/16 $ 32.00 ORIGINAL ARTICLE www.nature.com/cr Elongator controls cortical interneuron migration by regulating actomyosin dynamics Sylvia Tielens1, 2, *, Sandra Huysseune1, 2, *, Juliette D Godin1, 2, Alain Chariot2, 3, 4, Brigitte Malgrange1, 2, Laurent Nguyen1, 2 1GIGA-Neurosciences, 4000 Liège, Belgium, 2Interdisciplinary Cluster for Applied Genoproteomics (GIGA-R), 4000 Liège, Bel- gium, 3GIGA-Molecular Biology of Diseases, 4000 Liège, Belgium, 4Walloon Excellence in Lifesciences and Biotechnology (WEL- BIO), University of Liège, CHU Sart Tilman, 4000 Liège, Belgium The migration of cortical interneurons is a fundamental process for the establishment of cortical connectivity and its impairment underlies several neurological disorders. During development, these neurons are born in the gangli- onic eminences and they migrate tangentially to populate the cortical layers. This process relies on various morpho- logical changes that are driven by dynamic cytoskeleton remodelings. By coupling time lapse imaging with molecular analyses, we show that the Elongator complex controls cortical interneuron migration in mouse embryos by regulat- ing nucleokinesis and branching dynamics. At the molecular level, Elongator fine-tunes actomyosin forces by regulat- ing the distribution and turnover of actin microfilaments during cell migration. Thus, we demonstrate that Elongator cell-autonomously promotes cortical interneuron migration by controlling actin cytoskeletal dynamics. Keywords: cortical interneurons; cerebral cortex; actomyosin; cofilin Cell Research (2016) 26:1131-1148. doi:10.1038/cr.2016.112; published online 27 September 2016 Introduction neuron within the forebrain parenchyma by sensing the surrounding microenvironment [8, 9]. Interneurons sub- The cerebral cortex is an evolutionarily advanced sequently undergo nucleokinesis and retract their trailing structure of the brain that computes higher cognitive process, which ultimately leads to the net movement of functions [1].