A Preliminary Molecular Phylogeny of the Ant-Decapitating Flies, Genus Apocephalus

A Preliminary Molecular Phylogeny of the Ant-decapitating Flies, Genus Apocephalus

(Diptera: Phoridae)

Christine C. Hayes, B.S.

A Thesis Submitted to the Department of Biology

California State University Bakersfield

In Partial Fulfillment for the Degree of

Master of Science

Spring 2013

Christine C. Hayes

2013

A Preliminary Molecular Phylogeny ofthe Ant-decapitating Flies, GenusApocephalus

(Diptera: Phoridae)

Christine C. Hayes

This thesis or project has been accepted on behalf of the Department of Biology by their supervisory committee:

Dr. Paul T. Smith Committee Chair

Dr. Brian V. Brown

Dr. Carl T. Kloock A Preliminary Molecular Phylogeny of the Ant-decapitating Flies, Genus Apocephalus

(Diptera: Phoridae)

Christine C. Hayes

Department of Biology

California State University, Bakersfield

Abstract

The phorid fly genus Apocephalus is the largest assemblage of ant-parasitizing Phoridae.

Apocephalus is currently organized into two subgenera: A. (Apocephalus) and A.

(Mesophora). The species of A. (Mesophora) attack a wide variety of non-ant hosts including stingless bees, spiders, wasps, bumble bees, and cantharoid beetles. The species of A.

(Apocephalus) are the true “ant-decapitating flies” and are divided into six species groups: the A. attophilus group (parasitoids of attine leaf-cutting ants), “A. miricauda group”

(parasitoids of ponerine ants), A. pergandei group (parasitoids of Camponotus carpenter ants), A. mucronatus group, A. feeneri group, and A. grandipalpus group. Here I report on a preliminary molecular phylogenetic study of Apocephalus, including representatives of both subgenera and exemplars of five currently recognized species groups. Maximum parsimony, maximum likelihood, and Bayesian phylogenies were inferred using four nuclear (AK, TPI,

CAD, 28S) and four mitochondrial (12S, 16S, COI, ND1) gene fragments (4284 bp total).

For all analyses Apocephalus was recovered as a monophyletic group relative to the outgroup taxa included in the study. In addition, subgenus A. (Mesophora) was recovered as a monophyletic group, but was not a sister group to the subgenus A. (Apocephalus). A phylogenetic hypothesis for exemplars of five Apocephalus species groups is presented and compared to hypotheses based on morphology.

Table of Contents

List of Tables.………………………………………………………………..…… vii

List of Figures……………………………………………………………………... viii

A Preliminary Molecular Phylogeny of the Ant-decapitating Flies, Genus Apocephalus

(Diptera: Phoridae)

Introduction………………………………………………………………………... 1

Methods……………...………………………………………………………....…. 6

Results and Discussion……..……………………………………………………... 8

Acknowledgments ………………………………………………………………... 12

Literature Cited……………………………………………………………………. 23

List of Tables

TABLE 1……………………………………………………………………………… 13

Taxa used in present study with current taxonomic distinctions.

TABLE 2……………………………………………………………………………… 13

Oligonucleotide primers used in this study.

TABLE 3……………………………………………………………………………… 14

Average nucleotide frequencies for all Apocephalus taxa by gene.

TABLE 4……………………………………………………………………………… 15

Absolute pairwise distance matrix of all genes for 18 Apocephalus species.

TABLE 5……………………………………………………………………………… 16

Within and between species group divergence values. Between group comparisons were calculated by averaging within group pairwise divergence values.

TABLE 6……………………………………………………………………………… 16

Descriptive statistics for maximum parsimony trees inferred from three data partitions. PICs

= parsimony informative characters, TL = tree length, EPTs = equally parsimonious trees, CI

= consistency index, and RI = retention index.

vii

List of Figures

FIGURE 1…………………………………………………………………….……….. 17

Strict consensus of three equally parsimonious trees with bootstrap support values. Tree length = 4472, CI = 0.499, RI = 0.520.

FIGURE 2……………………………………………………………………………... 18

The single most parsimonious tree resulting from the nuclear gene only partition with bootstrap support values. TL = 1805, CI = 0.550, RI = 0.638.

FIGURE 3……………………………………………………………………………... 19

Phylogenetic tree resulting from maximum likelihood analysis. Numbers at various nodes are bootstrap values in %. Final maximum likelihood optimization likelihood = log -25862.9.

FIGURE 4……………………………………………………………………………... 20

Consensus tree resulting from 15,002 trees sampled from Bayesian analysis showing posterior probabilities. The GTR+I+G model was used for all genes except CAD, where

GTR+G was determined to be the most appropriate model.

FIGURE 5……………………………………………………………………………... 21

Composite tree depicting relationships of the various Apocephalus species groups. Branch labels indicate known host association for each clade.

FIGURE 6……………………………………………………………………………... 22

The composite tree depicting relationships of the various Apocephalus species groups found in this study compared to the current phylogenetic hypothesis for the relationship of the ant host subfamilies

viii

A Preliminary Molecular Phylogeny of the Ant-decapitating Flies, Genus Apocephalus

(Diptera: Phoridae)

Introduction

The family Phoridae is a highly diverse and speciose group of insects that are in need of much additional study. Researchers have suggested that only about 10% of the family has been described (Disney 1994, Brown & Smith 2010). Phorids are generally small insects and range in size from ~0.4-7 mm. Indeed the smallest known described fly is a member of the

Phoridae (Brown 2012b). In addition to variation in size, there is also an incredible amount of morphological diversity and sexual dimorphism exhibited among the numerous phorid genera. Thus, because of their small size and extreme morphological variation, phorids are not as well studied as some other fly families.

Perhaps one of the most spectacular features of phorid biology is the wide variety of larval feeding habits that exist. Members of this family are known to feed on a wide range of decaying organic material, while others are fungivores, herbivores, predators, parasites, and parasitoids (Binns 1980, Brown 1992, Disney 1994). In some cases, a single species may exhibit more than one type of larval feeding. For example, Megaselia scalaris, the most studied phorid species, has been known to feed on a wide variety of decaying organic material, as well as viable frog eggs (Villa & Townsend 1983, Disney 2008). Among the diverse larval feeding habits exhibited among phorids, the parasitoids of social insects are arguably the most fascinating because in some cases there has been selection for some atypical and extravagant body forms, which is an indication of some remarkable coevolutionary scenarios (Brown 1992, Feener & Brown 1992, Folgarait et al. 2002, Disney

1994).

The term parasitoid is functionally defined as an organism that develops on, or in, and extracts nourishment from another organism (usually during a specific host developmental stage); but in contrast to a basic parasite, this results in the death of the host organism

(Eggleton & Gaston 1990). In general, the hymenopteran parasitoids have been more widely studied than the dipteran parasitoids. Hymenopteran parasitoids are thought to have diverged from a single evolutionary event; however, for the lesser known dipteran parasitoids, the lifestyle is thought to have evolved independently several times, including within Phoridae

(Eggleton & Belshaw 1992, Feener & Brown 1997).

Host organisms used by phorid parasitoids include both insects (e.g., cockroaches, termites, true bugs, beetles, moths/butterflies, flies, ants/bees/wasps), and non-insect terrestrial invertebrates (e.g., worms, snails, spiders, millipedes) (Disney 1994, Feener &

Brown 1997). Some genera within Phoridae include a majority of species that specialize on a particular host group. For example, most Pseudacteon and Apocephalus species parasitize ants by laying their eggs in the body of the ant host; the larva develops by feeding on muscles and/or viscera, and then emerge from the host either prior to or following completion of pupation (Brown & Feener 1998, Mathis & Philpott 2012). Some unrelated phorid parasitoids may actually exhibit overlap in the species and/or individual host that is targeted.

In the case of the latter, phorid parasitoids may oviposit in different body parts to reduce competition and/or hyperparasitism (Brown 1999).

One of the largest and most diverse parasitoid groups in the Phoridae is the genus

Apocephalus. In addition to morphology, the taxonomic division of species into species groups appears to relate somewhat with host associations. Although species often vary in their host specificity, and the general life history of many Apocephalus species is not well

understood, previous studies on Apocephalus (e.g., Brown & Feener 1991) have shed some

light on the biology and natural history of some. For example, specific pheromonal olfactory

cues are thought to be very important for Apocephalus paraponerae in locating its ant host,

Paraponera clavata, indicating a high level of host specificity (Brown & Feener 1991).

Moreover, research conducted on this same species-pair by Morehead & Feener (2000) found

that, in addition to P. clavata, many other species could serve as suitable hosts, but that host

range may be limited by the ability of the individual to locate the host. Additional studies

such as the ones described above are sorely needed for most species of Apocephalus;

however, before progress can be made toward a better understanding of the biology and

natural history of Apocephalus in general, it is crucial to have a better understanding of the

phylogenetic relationships of species within the genus.

Apocephalus is a large (currently approximately 300 species described) yet largely

undiscovered and undescribed genus within the family Phoridae (Brown 2004, Brown

2012a). There have been some phylogenetic hypotheses proposed for this genus based on

morphology (Brown 1992, Brown 1993, Brown 1994b, Brown 1997, Brown 2000, Brown

2002), but a molecular phylogeny for the genus as a whole has not yet been published.

Apocephalus is currently organized into two subgenera: A. (Apocephalus) and A.

(Mesophora). The species of A. (Apocephalus) are the true “ant-decapitating flies” and are

divided into six species-groups: the A. attophilus group, “A. miricauda group”, A. pergandei group, A. mucronatus group, A. feeneri group, and A. grandipalpus group.

The monophyly of Apocephalus was proposed in Brown (1993), and the hypothesized synapomorphies for the genus include dark lateral margins on the anterior portion of the ovipositor and an elevated spiracular region found on larva. Brown (1997) featured a brief

3 description of the subgenera and species groups, suggesting that while the subgenus

Mesophora was likely monophyletic, the monophyly of the subgenus Apocephalus s.s. and some of the proposed species groups is not well established.

The A. attophilus group members are known to parasitize uninjured attine leaf-cutter ants and are thought, based on morphology, to have evolved from within the “A. miricauda group” (Brown 1997, Corona & Brown 2004). This species group is characterized by females having an ovipositor with a separate apical sclerite and distinctive sclerotization, with most species having an anterior v-shaped darkening (Brown 1997, Brown 2000). Brown has stated that this group should only be considered tentatively monophyletic (1997).

Members of the “A. miricauda group” mostly parasitize injured or distressed workers of the Ponerinae subfamily, and it has been suggested that this group is probably paraphyletic within the A. attophilus group (Brown 2000). The ovipositor is similar to that described in the A. attophilus group, but many “A. miricauda group” species also have an internal, sclerotized loop originating from sternite 9 (Brown 2000).

The A. pergandei group species typically use carpenter ants of the genus Camponotus as hosts, and this group is thought to be monophyletic (Brown 2002). A distinctive lateral expansion of tergite 9 is diagnostic of this group (Brown 1997, Brown 2000, Brown 2002).

The A. mucronatus group is a small species group that has been recently revised

(Brown 2012a); they are likely monophyletic, and the only species for which the natural history is known attacks a species of carpenter ant. Due to an absence of representatives from the A. mucronatus group, we have not included it in our analysis.

All A. feeneri group members with known hosts attack ants in the large genus

Pheidole. No morphology-based phylogenetic hypotheses have yet been proposed for this

4 group (Brown 1997, Brown & LeBrun 2010). According to Brown, this group has a

“distinctive group of black spinules in the intersegmental membrane between the ovipositor and the stylet” (1997).

The A. grandipalpus group has not yet been formally treated or been subject to phylogenetic analysis. Only a few hosts have been identified, and some of these are ants belonging to the genus Pheidole (Brown 1997). This group is characterized by a short ovipositor with a dorsal sclerite narrower than the ventral sclerite, which produces a lateral concavity when viewed dorsally (Brown 1997).

The species of subgenus Mesophora attack a wide variety of non-ant hosts including bees, spiders, wasps, and beetles (Brown 1993, Brown 1994a, Brown 1996a, Brown et al.

2009). Notably, researchers have recently implicated a species of this group, Apocephalus borealis, as a possible agent of Colony Collapse Disorder in the honey bee (Core et al. 2012).

Brown (1996b) has suggested that the evolutionary host shift from ants to beetles was facilitated by first transitioning to attacking stingless bees. Brown (1996b) also proposed phylogenetic hypotheses for species of A. (Mesophora) based on these host shifts. Members of subgenus Mesophora are distinguished by patterns of fronto-orbital setae on the head, an enlarged flagellomere 1 seen in the males of many species, dark abdominal glands on most females, and larva having a spiny projection on segment 8 (Brown 1993). Additional characters associated with the ovipositor, male genitalia, and tarsomeres also support the monophyly of this group (Brown 1993).

The purpose of my thesis research is to (1) infer molecular phylogenies for selected

Apocephalus species, including both subgenera and representatives of five of the six currently recognized species groups using maximum parsimony, maximum likelihood, and

Bayesian methods; (2) compare the resulting molecular based trees to each other, as well as to phylogenetic hypotheses based on morphology for congruence; and (3) use the phylogenies to gain preliminary insight into the evolution of Apocephalus and the evolution of host use within the genus.

Methods

A list of Apocephalus and outgroup specimens is provided in Table 1. Outgroups were selected from the subfamily Metopininae, of which Apocephalus is a member. Other, more distant taxa were tested as outgroup taxa, but preliminary trials found increased clade support values when using the more closely related metopinine taxa as outgroups. Alcohol preserved specimens were ground in PBS buffer, and then DNA was extracted using the

DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer protocol. PCR was conducted in 20µL aliquots of REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich), primer dilutions, and DNA extract. I used ExoSAP-IT® (Affymetrix) to clean the PCR product, and sent off the product for sequencing at the University of Florida DNA

Sequencing Core Facility. The sequence electropherograms were assembled and edited in

Geneious version 6.1 (Biomatters).

I used four nuclear (AK (578 bp), TPI (459 bp), CAD (797 bp), 28S (385 bp)) and four mitochondrial (12S (302 bp), 16S (596 bp), COI (742 bp), ND1 (425 bp)) gene fragments for a combined total of 4284 bp to infer relationships of the Apocephalus species included in the study. The primers used in this study are listed in Table 2. These genes have been used previously to infer phylogenies within Diptera, including other Phoridae (Cook et al. 2004, Smith & Brown 2008, Brown & Smith 2010, Gibson et al. 2010, Smith & Brown

2010, Hash et al. 2011).

I used MAFFT (Katoh and Standley 2013) to align the data, using the G-INS-i strategy for coding fragments and the Q-INS-i strategy for non-coding fragments (Katoh et al. 2005). Nucleotide composition and distance statistics were calculated in MEGA version

5.10 (Tamura et al. 2011). All trees were edited in FigTree version 1.4.0 (available at http://tree.bio.ed.ac.uk/software/figtree/).

Phylogenetic trees were inferred using maximum parsimony, maximum likelihood, and Bayesian analyses. PAUP* version 4.0b10 (Swofford 2003) was used to infer the maximum parsimony tree(s), using a step-wise addition heuristic search with 1000 replicates.

Three parsimony analyses were run, including one that included all the gene fragments and two separate partitions for nuclear and mitochondrial genes only. A strict consensus tree was produced from the set equally parsimonious trees. Branch support for specific nodes on the maximum parsimony tree were inferred using bootstrapping (Felsenstein 1985) with 10,000 replications (fast-stepwise addition).

For the maximum likelihood analysis, I ran RAxML-HPC BlackBox 7.4.2 through the CIPRES Science Gateway (Miller et al. 2010) set with the default parameters, and included the bootstrapping option (Stamatakis 2006, Stamatakis et al. 2008).

Species group delimitation tests, as implemented in Geneious version 6.1 (Biomatters) were conducted for all species groups using the maximum likelihood topology and the method of

Rosenberg (2007).

Prior to conducting the Bayesian analysis, I performed jModelTest 2.1.3 on each gene separately to determine the appropriate model(s) (Darriba et al. 2012). Following model selection, I ran the Bayesian analysis using MrBayes 3.1.2 on XSEDE run through the

CIPRES Science Gateway (Huelsenbeck and Ronquist 2001, Miller et al. 2010). I partitioned

7 the data and ran the analysis with four chains, 10,000,000 generations sampled every 1000 generations, with burn in set at 2,500,000. A Bayesian consensus tree was created by sampling from 15,002 retained trees.

Results and Discussion

Nucleotide summary statistics and various pairwise divergence values are shown in

Tables 3-5. Using a simple genetic distance approach, the pairwise species group divergence values presented in Table 5 offer some preliminary insight into which species groups are most closely related. In this regard, the “A. miricauda” and A. pergandei groups were the most distantly related pair, with a divergence value of 13.7%. The most closely related pairwise comparisons were those between the A. feeneri and A. grandipalpus groups and the

A. feeneri and A. (Mesophora) subgenus, both with a divergence value of ~9.0%. Within group comparisons varied from 3.0% to 9.0% (Table 5).

The phylogenetic trees resulting from the maximum parsimony, maximum likelihood, and Bayesian analysis using the entire set of genes were largely congruent in topology (Figs.

1, 3, and 4). In all trees, the genus Apocephalus was recovered as monophyletic, and A.

(Mesophora) and all species groups except the A. feeneri group were recovered as monophyletic groups. The two representatives of the A. feeneri group, which specialize on

Pheidole ants, were recovered as sequential sister taxa to the monophyletic A. grandipalpus group (Figs. 1, 3, and 4). Although the molecular data recovered A. (Mesophora) as monophyletic, the subgenus was not recovered as sister to A. (Apocephalus) in any of the analyses (Figs. 1-4). Indeed most trees A. (Mesophora) was embedded within subgenus

Apocephalus s.s. and showed close phylogenetic affinity to the “A. miricauda group” (Figs.

1, 3, and 4).

In general the trees derived from maximum likelihood and Bayesian analysis were more similar to each other than to the tree based on maximum parsimony. Parsimony analysis of all the genes combined recovered three equally parsimonious trees of length 4472.

A strict consensus of the three equally parsimonious trees is shown in Figure 1. The main difference between the parsimony tree and the maximum likelihood and Bayesian trees concerned the relationship of A. (Mesophora) to the “A. miricauda”, A. grandipalpus, and A. feeneri groups (Fig. 1). In the parsimony tree the relationships of these four groups to each other is largely unresolved, whereas in the maximum likelihood and Bayesian trees A.

(Mesophora) is a sister group to the “A. miricauda” group.

Differential parsimony analyses involving various partitions of the genes resulted in similar topologies. For example, the data was partitioned separately into mitochondrial and nuclear genes in an effort obtain gain some preliminary insight into the impact the two sets of genes are having on the topology (Table 6). In general, the topologies were similar to the topology resulting from the full data set. This was especially true for the nuclear partition

(Fig. 2) which was nearly identical to the topology presented in Figure 1, with the notable exception of the A. feeneri group being resolved as monophyletic. The mitochondrial partition resulted in four equally parsimonious trees, a consensus of which recovered most groups as monophyletic, but failed to resolve the relationships of the various groups to each other (trees not shown).

The maximum likelihood and Bayesian topologies were nearly identical, recovering the same relationships among the species groups (Fig. 3 and 4). Subgenus Mesophora was recovered as a monophyletic sister group to the “A. miricauda group”. The A. (Mesophora) +

“A. miricauda” clade was sister to the A. grandipalpus/A. feeneri clade. The A. attophilus and

A. pergandei groups were recovered as monophyletic and were joined as sequential sister

groups to all other Apocephalus taxa (Figs. 3 and 4).

I used a variation of the species delimitation test described by Rosenberg (2007) to conduct pairwise monophyly tests on those Apocephalus species groups that were recovered as monophyletic in the maximum likelihood tree (Fig. 3) All monophyletic species groups exhibited significant Rosenberg’s PAB and Rodrigo’s P(RD) values (P < 0.05). Rosenberg’s

PAB tests the null hypothesis that a monophyly can be explained by random branching, and

Rodrigo’s P(RD) assesses the probability that taxonomic distinctions are due to random

coalescence (Rosenberg 2007). As all pair-wise comparisons among monophyletic taxa

resulted in significant P-values for both statistics, it is likely that the recovered monophyletic

clades are explained not by random branching or coalescence, but by evolutionary

relatedness.

A composite tree based on maximum likelihood and Bayesian analysis depicting the

evolutionary relationships of the various Apocephalus species groups is shown in Figure 5.

To summarize the results of my analyses: Apocephalus was monophyletic and A.

(Mesophora) was not supported as a distinct subgenus, but was embedded within the A.

(Apocephalus) clade. These results suggest that while A. (Mesophora) is a monophyletic group as suggested by Brown (1993) based on morphology, it cannot be designated as a subgenus without rendering the A. (Apocephalus) subgenus paraphyletic. Therefore, I propose A. (Mesophora) no longer be recognized as a distinct subgenus, but rather as a distinct species group (i.e., the A. atennatus group) within the genus Apocephalus.

As hypothesized in previous morphological studies (Brown 1997, Brown 2002) the A. attophilus and A. pergandei species groups were found to be monophyletic across the

10 molecular estimations of phylogeny presented here. Brown (2000) considered the possibility that the “A. miricauda” species group may be paraphyletic to the A. attophilus group. The molecular data supports the monophyly of these two groups; however, I recognize that the molecular result is based on limited taxon sampling when compared to the thorough morphological study of Brown (2000).

Overall, the host group associations appear to be good predictors of the phylogenetic relationships of Apocephalus taxa (Fig. 5). A noteworthy example concerns the A. feeneri and A. grandipalpus groups, as members of both species groups attack members of the same ant genus, Pheidole. Figure 6 shows a comparison between the composite tree from Figure 5 compared to a tree showing the current phylogenetic hypothesis of the relationships of the ant host subfamilies from several studies (Urbani et al. 1992, Ohnishi et al. 2003, Moreau et al.

2006, Ward 2007). At this taxonomic level, there is little indication of coevolution. However, cospeciation or coevolution at other taxonomic levels may still be occurring. Due to the structural changes of the ovipositor that seem to correlate to host shifts, the use of complex host location cues by the flies, and the development of ant defensive behaviors, this is likely the case (Brown & Feener 1991, Brown et al. 2010, Brown & LeBrun 2010). Further studies including more taxa and the incorporation of morphological character data are needed to make a more robust phylogenetic estimation of the relationships within this genus. The addition of more taxa will also facilitate coevolutionary studies between the various

Apocephalus species groups and their ant hosts.

Acknowledgements

This research was supported by a National Science Foundation grant DEB-1025922 to Brian

V. Brown and Paul T. Smith. Thanks to Giar-Ann Kung for help with specimen collection,

John Hash for technical assistance, and Gilberto Uribe Valdez for help with editing and support. I would also like to thank my advisor, Dr. Paul Smith, and the other members of my committee, Dr. Brian Brown and Dr. Carl Kloock, for their comments and suggestions for revisions.

TABLE 1. Taxa used in present study with current taxonomic distinctions. Taxa Species group/Subgenus Apocephalus angustistylus Mesophora subgenus Apocephalus apivorus Mesophora subgenus Apocephalus arizonensis Grandipalpus species group Apocephalus clarilocus Pergandei species group Apocephalus conecitonis Miricauda species group Apocephalus dichromatus Attophilus species group Apocephalus euryterminus Pergandei species group Apocephalus flexiseta Pergandei species group Apocephalus guapilensis Attophilus species group Apocephalus indeptus Miricauda species group Apocephalus lizanoi Mesophora subgenus Apocephalus orthocladus Feeneri species group Apocephalus setitarsus Attophilus species group Apocephalus spinosus Attophilus species group Apocephalus tritarsus Mesophora subgenus Apocephalus Feeneri group sp 1 Feeneri species group Apocephalus Grandipalpus group sp 1 Grandipalpus species group Apocephalus Grandipalpus group sp 3 Grandipalpus species group Beckerina luteola Outgroup Gymnophora spiracularis Outgroup Melaloncha boliviana Outgroup Melaloncha horologia Outgroup

TABLE 2. Oligonucleotide primers used in this study. Gene Sequence 5' to 3' Reference Mitochondrial ND1-F ATCATAACGAAATCGAGGTAA Smith et al. (1999) ND1-PUB-R GTAGCTCAAACTATTTCTTATGAAG 16S-F CGCCTGTTTATCAAAAACAT Simon et al. (1994) 16S-R CTCCGGTTTGAACTCAGATCA APO-12S-F TTAATAATAAGAGTGACGGG New APO-12S-R AAATTTGGCGGTATTTTAGT (CO1) C1-J-2183 CAACATTTATTTTGATTTTTTGG Simon et al. (1994) (CO1) TL2-N-3014 TCCATTGCACTAATCTGCCATATTA Nuclear CAD-320-F ATHTTYGGNATYTGYYTGGGNCAYCA Moulton and Wiegmann (2004) CAD-338-F ATGAARTAYGGYAATCGTGGHCAYAA CAD-680-R AANGCRTCNCGNACMACYTCRTAYTC (28S1) rc28C1 GCTATCCTGAGGGAAACTTCGG Wiegmann et al. (2000) (28S1) 28P1 GCCTAGAAGTGTTTGGCGTAAGCC AK-F1 CAARTCNYTGYTSAARAAGTA New AK-R1 GATKCCRTCRTNCATYTCCTT MAKF GGATGCTGAAGCNTACTC New MAKR CCCAAGTTNGTTGGACAGAA TPI-Dipt-2276F GGAACTGGAAGATGAACGG Gibson el al. (2011) TPI-Dipt-2735R GCCCASCASGGYTCGTASGC 1 Presented as reverse complement of the sequence in original publication. 13

TABLE 3. Average nucleotide frequencies for all Apocephalus taxa by gene. Gene fragment T(U) C A G Mitochondrial 12S 39.5 13.8 39.0 7.7 16S 37.2 14.6 38.6 9.6 COI 39.0 16.1 31.7 13.2 ND1 29.7 15.5 47.1 7.7 Nuclear 28S 27.9 17.2 28.7 26.2 AK 26.1 24.9 27.0 21.9 CAD 27.0 21.2 31.6 20.2 TPI 25.9 22.0 27.7 24.4

TABLE 4 TABLE 8 rniapsgops Gadplu) .2 .0 .8 .4 .4 .5 .4 .4 .5 .2 .4 .9 .7 .5 .0 .0 0.09 0.10 0.10 0.15 0.10 0.17 0.11 0.09 0.12 0.14 0.14 0.12 0.09 0.15 0.13 0.14 0.11 0.14 0.12 0.15 0.12 0.14 0.13 0.14 0.13 0.08 0.13 0.10 0.13 0.12 Grandipalpus 0.08 group sp 3 (Grandipalpus)18 0.08 0.11 Grandipalpus group sp 1 (Grandipalpus)17 16 15 14 13 12 11 10 1 9 8 7 6 5 4 3 2 A. tritarsus A. spinosusA. setitarsus A. orthocladusA. lizanoiA. .indeptus A guapilensisA. flexiseta A. euryterminusA. dichromatus A. conecitonisA. clarilocusA. arizonensisA. apivorus A. angustistylusA. Feenerigroup (Feeneri) 1 sp . Absolute . pairwise distance matrix of all genes for 18 (Mesophora)

(Mesophora) (Attophilus) (Miricauda) (Pergandei) (Mesophora) (Pergandei) (Attophilus) (Attophilus)

(Attophilus) (Attophilus) (Miricauda)

Gadplu) .0 0.07 0.10 (Grandipalpus) (Feeneri) (Attophilus) (Mesophora) (Pergandei) .5 .3 .3 .4 .5 .0 .4 .4 .0 .4 .6 0.14 0.16 0.14 0.10 0.14 0.14 0.10 0.15 0.14 0.13 0.13 0.15 0.05 0.13 0.14 0.01 0.13 0.10 0.14 0.10 0.04 0.13 0.11 0.11 0.14 .6 .6 .9 .1 .1 .2 .2 .0 .1 .9 .9 .9 .3 0.11 0.13 0.09 0.09 0.09 0.09 0.12 0.11 0.14 0.10 0.12 0.12 0.06 0.12 0.13 0.11 0.13 0.11 0.08 0.09 0.11 0.14 0.06 0.10 0.13 0.06 0.12 0.11 0.10 0.10 0.12 0.12 0.13 0.13 0.13 0.14 0.12 0.14 0.11 0.12 0.14 0.08 0.13 0.12 0.08 0.13 0.14 0.10 0.13 0.11 0.13 0.06 0.09 0.13 0.13 0.09 0.09 0.10 0.14 0.08 0.13 0.10 0.11 0.10 0.13 0.15 0.13 0.11 0.11 0.14 0.14 0.12 0.10 0.12 0.11 0.10 0.14 0.08 .0 .6 .9 .1 .1 .1 .2 .1 .2 .9 .1 .8 .3 .1 0.09 0.11 0.13 0.08 0.11 0.09 0.12 0.11 0.12 0.11 0.11 0.11 0.09 0.06 0.10 2 4 6 8 1 11 31 51 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1

Apocephalus species.

TABLE 5. Within and between species group divergence values. Between group comparisons were calculated by averaging within group pairwise divergence values. Between Groups Within Groups 1 2 3 4 5 1 Mesophora 0.08 2 Grandipalpus 0.105 0.08 3 Pergandei 0.121 0.126 0.03 4 Miricauda 0.107 0.119 0.137 0.06 5 Attophilus 0.127 0.133 0.132 0.136 0.09 6 Feeneri 0.093 0.093 0.113 0.103 0.123 0.08

TABLE 6. Descriptive statistics for maximum parsimony trees from the three data partitions. PICs = parsimony informative characters, TL = tree length, EPTs = equally parsimonious trees, CI = consistency index, and RI = retention index. Partition Total characters PICs TL EPTs CI RI All genes 4284 1183 4472 3 0.499 0.520 Mitochondrial only 2065 652 2605 4 0.418 0.437 Nuclear only 2219 531 1805 1 0.550 0.638

FIGURE 1. Strict consensus of three equally parsimonious trees with bootstrap support values. TL = 4472, CI = 0.499, RI = 0.520.

FIGURE 2. The single most parsimonious tree resulting from the nuclear gene only partition with bootstrap support values. TL = 1805, CI = 0.550, RI = 0.638.

FIGURE 3. Phylogenetic tree resulting from maximum likelihood analysis. Numbers at various nodes are bootstrap values in %. Final maximum likelihood optimization likelihood = log -25862.9.

FIGURE 4. Consensus tree resulting from 15,002 trees sampled from Bayesian analysis showing posterior probabilities. The GTR+I+G model was used for all genes except CAD, where GTR+G was determined to be the most appropriate model.

FIGURE 5. Composite tree depicting relationships of the various Apocephalus species groups. Branch labels indicate known host association for each clade.

FIGURE 6. The composite tree depicting relationships of the various Apocephalus species groups found in this study compared to the current phylogenetic hypothesis for the relationship of the ant host subfamilies.

Literature Cited

Binns, E. S. (1980). Mating behaviour, fecundity and feeding in the mushroom phorid, Megaselia halterata (Wood) (Dipt.). Entomologist's Monthly Magazine, 116, 45-57.

Brown, B. V. (1992). Generic revision of Phoridae of the Nearctic region and phylogenetic classification of Phoridae, Sciaoceridae, and Ironmyiidae (Diptera: Phoridea). Memoirs of the Entomological Society of Canada, 164, 1–144.

Brown, B. V. (1993). Taxonomy and preliminary phylogeny of the parasitic genus Apocephalus, subgenus Mesophora (Diptera: Phoridae). Systematic Entomology, 18, 191–230.

Brown, B. V. (1994a). Life history parameters and new host records of phorid (Diptera: Phoridae) parasitoids of fireflies (Coleoptera: Lampyridae). The Coleopterists Bulletin, 48, 145–147.

Brown, B. V. (1994b). Revision and new species of the Apocephalus (Mesophora) Truncaticercus-infragroup (Diptera: Phoridae). Contributions in Science, 449, 1–7.

Brown, B. V. (1996a). A further species of Apocephalus, subgenus Mesophora (Diptera, Phoridae) parasitic on stingless bees. Studia Dipterologica, 3, 231-35.

Brown, B. V. (1996b). Preliminary analysis of a host shift: revision of the Neotropical species of Apocephalus, subgenus Mesophora (Diptera: Phoridae). Contributions in Science, 462, 1–13.

Brown, B. V. (1997). Revision of the Apocephalus attophilus-group of ant-decapitating flies (Diptera: Phoridae). Contributions in Science, 468, 1–60.

Brown, B. V. (1999). Differential host use by Neotropical phorid flies (Diptera: Phoridae) that are parasitoids of ants (Hymenoptera: Formicidae). Sociobiology, 33, 95–103.

Brown, B. V. (2000). Revision of the “Apocephalus miricauda-group” of ant-parasitizing flies (Diptera: Phoridae). Contributions in Science, 482, 1–62.

Brown, B. V. (2002). Revision of the Apocephalus pergandei-group of ant-decapitating flies (Diptera: Phoridae). Contributions in Science, 496, 1–57.

Brown, B. V. (2004). Diversity of ant-decapitating flies (Diptera: Phoridae: Apocephalus) from the ALAS Project: new results and projections. Sociobiology, 44, 683–688.

Brown, B. V. (2012a). Revision of the Apocephalus mucronatus group of ant decapitating flies (Diptera: Phoridae). Zootaxa, 3413, 19–28.

Brown, B. V. (2012b). Small size no protection for acrobat ants: world’s smallest fly is a parasitic phorid (Diptera: Phoridae). Annals of the Entomological Society of America, 105, 550–554.

Brown, B. V., Disney, R. H. L., Elizalde, L., & Folgarait, P. J. (2010). New species and new records of Apocephalus Coquillett (Diptera: Phoridae) that parasitize ants (Hymenoptera: Formicidae) in America. Sociobiology, 55, 165–190.

Brown, B. V., & Feener Jr., D. H. (1991). Behavior and host location cues of Apocephalus paraponerae (Diptera: Phoridae), a parasitoid of the giant tropical ant, Paraponera clavata (Hymenoptera: Formicidae). Biotropica, 23, 182–187.

Brown, B. V., & Feener Jr., D. H. (1998). Parasitic phorid flies (Diptera: Phoridae) associated with army ants (Hymenoptera: Formicidae: Ecitoninae, Dorylinae) and their conservation biology. Biotropica, 30, 482–487.

Brown, B. V., Frierson Faust, L., & Cicero, J. M. (2009). A cantharid beetle host for a parasitic phorid fly new to the Nearctic region (Coleoptera: Cantharidae; Diptera: Phoridae). Proceedings of the Entomological Society of Washington, 111, 000–000.

Brown, B. V., & LeBrun, E. G. (2010). Ant-decapitating flies, Apocephalus, subgenus Apocephalus Coquillett (Insecta: Diptera: Phoridae), of Arizona. Contributions in Science, 519, 1–24.

Brown, B. V., & Smith, P. T. (2010). The bee-killing flies, genus Melaloncha Brues (Diptera: Phoridae): a combined molecular and morphological phylogeny. Systematic Entomology, 35, 649–657.

Cook, C. E., Austin, J. J., & Disney, R. H. L. (2004). A mitochondrial 12S and 16S rRNA phylogeny of critical genera of Phoridae (Diptera) and related families of Aschiza. Zootaxa, 593, 1–11.

Core, A., Runckel, C., Ivers, J., Quock, C., Siapno, T., DeNault, S., Brown, B. V., DeRisi, J., Smith, C. D., & Hafernik, J. (2012). A new threat to honey bees, the parasitic phorid fly Apocephalus borealis. PLoS ONE, 7, e29639.

Corona, E. M., & Brown, B. V. (2004). Two new species of the Apocephalus attophilus- group of ant-decapitating flies (Diptera: Phoridae). Sociobiology, 44, 689–693.

Darriba, D., Taboada G. L., Doallo, R., & Posada, D. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nature Methods, 9, 772.

Disney, R. H. L. (1994) Scuttle flies: the Phoridae. Chapman & Hall, London.

Disney, R. H. L. (2008). Natural history of the scuttle fly, Megaselia scalaris. Annual Review of Entomology, 53, 39–60.

Eggleton, P., & Belshaw, R. (1992). Insect parasitoids: an evolutionary overview. Philosophical Transactions: Biological Sciences, 337, 1–20.

Eggleton, P., & Gaston, K. (1990). “Parasitoid” species and assemblages: convenient definitions or misleading compromises? Oikos, 59, 417–421.

Feener Jr., D. H., & Brown, B. V. (1992). Reduced foraging of Solenopsis geminata (Hymenoptera: Formicidae) in the presence of parasitic Pseudacteon spp. (Diptera: Phoridae). Annals of the Entomological Society of America, 85, 80–84.

Feener Jr., D. H., & Brown, B. V. (1997). Diptera as parasitoids. Annual Review of Entomology, 42, 73–97.

Felsenstein, J. (1985). Phylogenies and the comparative method. American Naturalist, 125, 1–15.

Folgarait, P. J., Bruzzone, O. A., Patrock, R. J. W., & Gilbert, L. E. (2002). Developmental rates and host specificity for Pseudacteon parasitoids (Diptera: Phoridae) of fire ants (Hymenoptera: Formicidae) in Argentina. Journal of Economic Entomology, 95, 1151–1158.

Geneious version 6.1 created by Biomatters. Available from http://www.geneious.com/

Gibson, J. F., Skevington, J. H., & Kelso, S. (2010). Placement of Conopidae (Diptera) within Schizophora based on mtDNA and nrDNA gene regions. Molecular Phylogenetics and Evolution, 56, 91–103.

Gibson, J. F., Kelso, S., Jackson, M. D., Kits, J. H., Miranda, G. F. G., & Skevington, J. H. (2011). Diptera-specific polymerase chain reaction amplification primers of use in molecular phylogenetic research. Annals of the Entomological Society of America 104, 976–997.

Hash, J. M., Brown, B. V., & Smith, P. T. (2011). Preliminary use of DNA sequences for Dohrniphora (Diptera: Phoridae) phylogeny and taxonomy. Zootaxa, 2991, 13–20.

Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17, 754–755.

Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution, 30, 772-780.

Katoh, K., Kuma, K., Toh, H., & Miyata, T. (2005). MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Research, 33, 511-518.

Mathis, K. A. & Philpott, S. M. (2012). Current understanding and future prospects of host selection, acceptance, discrimination, and regulation of phorid fly parasitoids that attack ants. Psyche: A Journal of Entomology, 2012, 1–9.

Miller, M. A., Pfeiffer, W., & Schwartz, T. (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic tree. Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA pp 1 - 8.

Moreau, C. S., Bell, C. D., Vila, R., Archibald, S. B., & Pierce, N. E. (2006). Phylogeny of the ants: diversification in the age of angiosperms. Science, 312, 101–4.

Morehead, S. A., & Feener Jr., D. H. (2000). An experimental test of potential host range in the ant parasitoid Apocephalus paraponerae. Ecological Entomology, 25, 332–340.

Moulton, J. K., & Wiegmann, B. M. (2004). Evolution and phylogenetic utility of CAD (rudimentary) among Mesozoic-aged Eremoneuran Diptera (Insecta). Molecular Phylogenetics and Evolution, 31, 363–378.

Ohnishi, H., Imai, H.T., & Yamamoto, M.-T. (2003). Molecular phylogenetic analysis of ant subfamily relationship inferred from rDNA sequences. Genes & Genetic Systems, 78, 419–25.

Rosenberg, N. A. (2007). Statistical tests for taxonomic distinctiveness from observations of monophyly. Evolution, 61, 317-323.

Simon, C., Frati, F., Beckenback, A., Crespi, B., Liu, H., & Flook, P. (1994). Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America, 87, 651-701.

Smith, P. T., & Brown, B. V. (2008). Utility of DNA sequences for inferring phylogenetic relationships and associating morphologically dissimilar males and females of the bee-killing flies, genus Melaloncha (Diptera: Phoridae). Annals of the Entomological Society of America, 101, 713–721.

Smith, P. T., & Brown, B. V. (2010). A molecular phylogenetic analysis of genus Anevrina (Diptera: Phoridae), with the description of a new species and updated world key. Zootaxa, 2397, 29–40.

Smith, P. T., Kambhampati, S., Völklb, W., & Mackauer, M. (1999). A Phylogeny of aphid parasitoids (Hymenoptera: Braconidae: Aphidiinae) inferred from mitochondrial NADH 1 dehydrogenase gene sequence. Molecular Phylogenetics and Evolution, 11, 236–245.

Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688-2690.

Stamatakis, A., Hoover, P., & Rougemont, J. (2008). A fast bootstrapping algorithm for the RAxML web servers. Systematic Biology, 57, 758-771.

Swofford, D. L. (2003) PAUP*: phylogenetic analysis using parsimony (and other methods). Version 4.0b10 Sinauer; Sunderland, MA.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28, 2731-2739.

Urbani, C. B., Bolton, B., & Ward, P. S. (1992). The internal phylogeny of ants (Hymenoptera: Formicidae). Systematic Entomology, 17, 301–329.

Villa, J., & Townsend, D. S. (1983). Viable frog eggs eaten by phorid fly larvae. Journal of Herpetology, 17, 278–281.

Ward, P. S. (2007). Phylogeny, classification, and species-level taxonomy of ants (Hymenoptera: Formicidae). Zootaxa, 1668, 549–563.

Wiegmann, B. M., Tsaur, S., Webb, D. W., Yeates, D. K.., & Cassel, B. K. (2000). Monophyly and relationships of the Tabanomorpha (Diptera: Brachycera) based on 28S ribosomal gene sequence. Annals of the Entomological Society of America, 93, 1031– 1038.