DOCSLIB.ORG

SIRT1 Is Downregulated in Gastric Cancer and Leads to G1-Phase Arrest Via NF- Κb/Cyclin D1 Signaling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SIRT1 Is Downregulated in Gastric Cancer and Leads to G1-Phase Arrest Via NF- Κb/Cyclin D1 Signaling Published OnlineFirst October 9, 2013; DOI: 10.1158/1541-7786.MCR-13-0214 Molecular Cancer Cell Cycle and Senescence Research SIRT1 Is Downregulated in Gastric Cancer and Leads to G1-phase Arrest via NF-kB/Cyclin D1 Signaling Qing Yang1, Bo Wang3, Wei Gao5, Shanying Huang4, Zhifang Liu2, Wenjuan Li1, and Jihui Jia1 Abstract Sirtuin 1 (SIRT1) is a class III histone/protein deacetylase, and its activation status has been well documented to have physiologic benefits in human health. However, the function of SIRT1 in cancer remains controversial. Here, the expression and role of SIRT1 in gastric cancer is delineated. SIRT1 was present in all normal gastric mucosa specimens; however, it was only present in a portion of the matched gastric cancer tumor specimens. In SIRT1- positive tumors, both mRNA and protein levels were downregulated as compared with the corresponding nonneoplastic tissue. Ectopic expression of SIRT1 inhibited cell proliferation, diminished clonogenic potential, and induced a G1-phase cell-cycle arrest, the effects of which were not apparent when a catalytic-domain mutant form of SIRT1 was introduced, suggesting that SIRT1 functions in gastric cancer are dependent on its deacetylase activity. Further evidence was obtained from depletion of SIRT1. At the molecular level, SIRT1 inhibited the transcription of Cyclin D1 (CCND1), and inhibition of NF-kB in SIRT1-depleted cells rescued Cyclin D1 expression. Furthermore, inhibition of either NF-kB or Cyclin D1 in SIRT1-depleted cells reversed the inhibitory effects of SIRT1. The inhibitory role of SIRT1 was also verified in vivo using xenografts. This work characterizes SIRT1 status and demonstrates its inhibitory function in gastric cancer development, which involves NF-kB/ Cyclin D1 signaling, offering a therapeutic role for SIRT1 activators. Implications: The inhibitory functions of SIRT1, which involve NF-kB/Cyclin D1 signaling, suggest the utility of SIRT1 activators in the prevention and therapy of gastric cancer. Mol Cancer Res; 11(12); 1497–507. Ó2013 AACR. Introduction curable disease with a high 5-year overall survival rate (3). On the basis of incidence and mortality rate, gastric cancer Therefore, studies about new diagnostic or prognostic mar- is among the top five leading causes of cancer worldwide. In kers and therapeutic targets for gastric cancer are urgently needed. 2008, there were approximately 12.7 million cancer cases þ worldwide, and gastric cancer accounted for 8% of all Sirtuin 1 (SIRT1), a class III NAD -dependent histone cancers (1). The majority of new gastric cancer cases occur deacetylase, is the mammalian homolog of yeast silent in Eastern Asia, Eastern Europe, and South America. information regulator 2. SIRT1 substrates include not only Although gastric cancer rates have decreased globally, it histones but also nonhistone proteins. Through these tar- remains high in developing countries, especially China (1, gets, SIRT1 plays a crucial role in multiple pathways such as 2). Most of the patients with gastric cancer are not diagnosed cellular metabolism, stress response, calorie restriction, and aging (4, 5). An abundance of recent data has demonstrated until they have reached advanced stages of the disease when, fi despite the use of conventional therapies such as surgery, that activation of SIRT1 has physiologic bene ts, including increased health and longevity, and assists in certain meta- chemotherapy, and radiotherapy, patients have a poor prog- – nosis. However, early-stage gastric cancer is a potentially bolic disorders (4 6). However, the function of SIRT1 in cancer is controversial. SIRT1 was initially regarded as a potential oncogene because of its first nonhistone substrate, 1 2 p53, a well-known tumor suppressor. SIRT1 deacetylates Authors' Affiliations: Institute of Pathogen Biology, Department of Biochemistry, Shandong University School of Medicine; 3Department of p53 with specificity for the C-terminal Lys382 residue and Traditional Chinese Medicine, 4Key Laboratory of Cardiovascular Re- silences p53 activity as a transcription factor (7, 8). In modeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital, Shandong University; and addition, two tumor suppressors, hypermethylated in cancer 5Department of Pathology, Jinan Central Hospital, Jinan, China (HIC1) and deleted in breast cancer (DBC1), have been fi Note: Supplementary data for this article are available at Molecular Cancer identi ed as negative regulators of SIRT1 (9, 10). A recently Research Online (http://mcr.aacrjournals.org/). published study has provided new evidence for the role of Corresponding Author: Jihui Jia, Institute of Pathogen Biology, Shandong SIRT1 as a tumor promoter by describing a positive feedback University School of Medicine, Jinan 250012, China. Phone: 86-531-8838- loop between C-Myc and SIRT1 in hepatocellular carcino- 2672; Fax: 86-531-8838-2502; E-mail: [email protected] mas (11). However, studies from other laboratories have doi: 10.1158/1541-7786.MCR-13-0214 indicated that SIRT1 acts as a tumor suppressor. First, Ó2013 American Association for Cancer Research. acetylation of H3K56, a substrate for SIRT1, is increased www.aacrjournals.org 1497 Downloaded from mcr.aacrjournals.org on September 29, 2021. © 2013 American Association for Cancer Research. Published OnlineFirst October 9, 2013; DOI: 10.1158/1541-7786.MCR-13-0214 Yang et al. in multiple cancers (12). Second, SIRT1 has been reported performed for genes, including SIRT1, cyclin D1, and to play a key role in repairing DNA-breaks and maintaining b-actin as previously described (18). The sequences of the genome stability (13, 14). Moreover, SIRT1 has been shown amplification primers are listed in Supplementary Table S1. to suppress the growth of colon cancer by inhibiting E2F1 or The levels of SIRT1 mRNA in clinical specimens were b C -catenin (15, 16). The role of SIRT1 in oncogenic pro- calculated on the basis of the threshold cycle ( t) values gression seems to be specific for tumor type and signaling and normalization of b-actin expression using the 2ÀDDCt pathway involved. method (19). The mRNA expression of cyclin D1 was In this study, we investigated the expression and function normalized to b-actin relative to the control using the of SIRT1 in gastric cancer. We compared the expression of 2ÀDDCt method. Experiments were performed in triplicate SIRT1 between normal and malignant gastric tissues. Then and repeated three times. we analyzed cell viability, clonogenic potential, cell-cycle distribution, and apoptosis and investigated the mechanism Western blot analysis for how SIRT1 suppresses tumorigenesis. The inhibitory Total protein from the tumor specimens or cells was activity of SIRT1 on gastric cancer development was also extracted using RIPA lysis buffer (Beyotime) as previously evaluated in vivo. described (18). The protein concentration was determined using a BCA Protein Assay Kit (Pierce). The membrane was Materials and Methods probed with antibodies against SIRT1 and b-catenin Patients and tissue specimens (Abcam), cyclin D1, cyclin D2, cyclin D3, cyclin E1, Forty-four patients with primary gastric cancer were cyclin-dependent kinase (CDK)4, bcl-2, bax, caspase-3, included in this study, which was approved by the local NF-kB p65, and c-Jun (Cell Signaling Technology), cyclin ethics committee (No. 2011008 for Ethics Approval). The D2, p21, and p16 (Santa Cruz Biotechnology). Horseradish patients underwent gastrectomy at Jinan Central Hospital peroxidase (HRP)–conjugated anti-rabbit or -mouse anti- between 2011 and 2012. The tissue specimens were col- body was used as the secondary antibody. The protein bands lected and stored as previously described (17). There were 11 were visualized using an ECL system (Pierce). b-actin (Cell female patients and 33 male patients, with a median age of 60 Signaling Technology) served as a loading control. (range, 35–82). Details of patient and disease characteristics are documented in Table 1. Immunohistochemistry The tumor specimens from patients with gastric cancer and Cell lines, plasmids, and siRNA the nude mice were deparaffinized, rehydrated, and antigen Human gastric cancer cell lines AGS, MGC-803 (Cell retrieved. The antibodies against SIRT1 (1:200; Santa Cruz Resource Center, Shanghai Institute of Biochemistry and Biotechnology) and Ki67 (1:500; Abcam) were added to the Cell Biology at the Chinese Academy of Sciences, Shanghai, sections and then incubated overnight at 4C. HRP-conju- China), BGC-823, and SGC-7901 (China Center for Type gated anti-rabbit immunoglobulin G (IgG) and 3,30-diami- Culture Collection, Wuhan, China) were cultured in F12 nobenzidine (DAB) staining were used to visualize the (AGS) or RPMI 1640 (BGC-823, SGC-7901, and MGC- primary antibody. Then, the slides were counterstained with 803) containing 10% FBS, 100 U/mL penicillin and 2 hematoxylin and imaged by an Olympus light microscope mmol/L L-glutamine at 37 C in a humidified atmosphere using cellSens Dimension software. The percentages of Ki67- fi containing 5% CO2. Both of the cell banks routinely positive cells were counted under microscope (magni cation, perform cell line authentication by short tandem repeat Â400) and five fields were counted for each section. (STR) profiling and all of the cell lines were passaged in our laboratory for no more than 6 months after receipt. High- MTS assay purity cycloheximide (CHX; 3-[2-(3,5-dimethyl-2-oxocy- The CellTiter96 AQueous One Solution Cell Prolifera- clohexyl)2-hydroxyethyl-]-glutarimide) was purchased tion Assay (Promega) was performed to indicate cell prolif- from Beyotime, dissolved in dimethyl sulfoxide (DMSO), eration. Briefly, 2 Â 103 cells were seeded in a 96-well plate and added into the culture medium at a concentration of 20 and were allowed to grow for 24 hours. Twenty-four hours mg/mL. The vectors expressing wild-type SIRT1 (pECE- later, 20 mL MTS was added to each well. After incubation SIRT1) and the catalytic-domain mutant form of SIRT1 for 3 hours at 37 C, the absorbance at 490 nm was recorded (pECE-SIRT1-H363Y) were purchased from Addgene on a Varioskan Flash Multiplate Reader (Thermo Scientific).
Load more

Recommended publications
  • T-Cell Protein Tyrosine Phosphatase Attenuates STAT3 and Insulin
    ORIGINAL ARTICLE T-Cell Protein Tyrosine Phosphatase Attenuates STAT3 and Insulin Signaling in the Liver to Regulate Gluconeogenesis Atsushi Fukushima,1 Kim Loh,1 Sandra Galic,1 Barbara Fam,2 Ben Shields,1 Florian Wiede,1 Michel L. Tremblay,3 Matthew J. Watt,4 Sofianos Andrikopoulos,2 and Tony Tiganis1 OBJECTIVE—Insulin-induced phosphatidylinositol 3-kinase (PI3K)/Akt signaling and interleukin-6 (IL-6)-instigated JAK/ STAT3-signaling pathways in the liver inhibit the expression of ype 2 diabetes has reached epidemic propor- gluconeogenic genes to decrease hepatic glucose output. The tions, afflicting roughly 170 million people world- insulin receptor (IR) and JAK1 tyrosine kinases and STAT3 can wide. Although the underlying genetic causes serve as direct substrates for the T-cell protein tyrosine phos- Tand the associated pathologic symptoms are phatase (TCPTP). Homozygous TCPTP-deficiency results in peri- heterogenous, a common feature is high blood glucose due natal lethality prohibiting any informative assessment of to peripheral insulin resistance. Circulating insulin re- TCPTP’s role in glucose homeostasis. Here we have used leased from ␤-cells in the pancreas serves to lower blood Ptpn2ϩ/Ϫ mice to investigate TCPTP’s function in glucose glucose by triggering the translocation of the facilitative homeostasis. GLUT4 to the plasma membrane in muscle and adipose RESEARCH DESIGN AND METHODS—We analyzed insulin tissue (1). Insulin also acts in the liver to promote glycogen sensitivity and gluconeogenesis in chow versus high-fat–fed synthesis and lipogenesis and to suppress hepatic glucose (HFF) Ptpn2ϩ/Ϫ and Ptpn2ϩ/ϩ mice and insulin and IL-6 production (HGP) by inhibiting gluconeogenesis and gly- signaling and gluconeogenic gene expression in Ptpn2ϩ/Ϫ and cogenolysis (1).
    [Show full text]
  • Sirt7 Promotes Adipogenesis in the Mouse by Inhibiting Autocatalytic
    Sirt7 promotes adipogenesis in the mouse by inhibiting PNAS PLUS autocatalytic activation of Sirt1 Jian Fanga,1, Alessandro Iannia,1, Christian Smolkaa,b, Olesya Vakhrushevaa,c, Hendrik Noltea,d, Marcus Krügera,d, Astrid Wietelmanna, Nicolas G. Simonete, Juan M. Adrian-Segarraa, Alejandro Vaqueroe, Thomas Brauna,2, and Eva Bobera,2 aDepartment of Cardiac Development and Remodeling, Max Planck Institute for Heart and Lung Research, D-61231 Bad Nauheim, Germany; bMedizin III Kardiologie und Angiologie, Universitätsklinikum Freiburg, D-79106 Freiburg, Germany; cDepartment of Medicine, Hematology/Oncology, Goethe University, D-60595 Frankfurt am Main, Germany; dInstitute for Genetics, Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), D-50931 Köln, Germany; and eCancer Epigenetics and Biology Program, Bellvitge Biomedical Research Institute (IDIBELL), 08908 L’Hospitalet de Llobregat, Barcelona, Catalonia, Spain Edited by C. Ronald Kahn, Section of Integrative Physiology, Joslin Diabetes Center, Harvard Medical School, Boston, MA, and approved August 23, 2017 (received for review April 26, 2017) Sirtuins (Sirt1–Sirt7) are NAD+-dependent protein deacetylases/ adipogenesis and accumulation of lipids in 3T3-L1 adipocytes by ADP ribosyltransferases, which play decisive roles in chromatin deacetylation of FOXO1, which represses PPARγ (10). The role of silencing, cell cycle regulation, cellular differentiation, and metab- Sirt6 in the regulation of adipogenic differentiation is less clear olism. Different sirtuins control similar cellular processes, suggest- although it is known that Sirt6 knockout (KO) mice suffer from ing a coordinated mode of action but information about potential reduced adipose tissue stores, while Sirt6 overexpressing mice cross-regulatory interactions within the sirtuin family is still lim- are protected against high-fat diet-induced obesity (11, 12).
    [Show full text]
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
    [Show full text]
  • A Review of the Recent Advances Made with SIRT6 and Its Implications on Aging Related Processes, Major Human Diseases, and Possible Therapeutic Targets
    biomolecules Review A Review of the Recent Advances Made with SIRT6 and its Implications on Aging Related Processes, Major Human Diseases, and Possible Therapeutic Targets Rubayat Islam Khan †, Saif Shahriar Rahman Nirzhor † and Raushanara Akter * Department of Pharmacy, BRAC University, 1212 Dhaka, Bangladesh; [email protected] (R.I.K.); [email protected] (S.S.R.N.) * Correspondence: [email protected]; Tel.: +880-179-8321-273 † These authors contributed equally to this work. Received: 10 June 2018; Accepted: 26 June 2018; Published: 29 June 2018 Abstract: Sirtuin 6 (SIRT6) is a nicotinamide adenine dinucleotide+ (NAD+) dependent enzyme and stress response protein that has sparked the curiosity of many researchers in different branches of the biomedical sciences. A unique member of the known Sirtuin family, SIRT6 has several different functions in multiple different molecular pathways related to DNA repair, glycolysis, gluconeogenesis, tumorigenesis, neurodegeneration, cardiac hypertrophic responses, and more. Only in recent times, however, did the potential usefulness of SIRT6 come to light as we learned more about its biochemical activity, regulation, biological roles, and structure Frye (2000). Even until very recently, SIRT6 was known more for chromatin signaling but, being a nascent topic of study, more information has been ascertained and its potential involvement in major human diseases including diabetes, cancer, neurodegenerative diseases, and heart disease. It is pivotal to explore the mechanistic workings
    [Show full text]
  • Targeting the Gastrointestinal Tract to Treat Type 2 Diabetes
    230 3 P V BAUER and F A DUCA Gut treatment for diabetes 230:3 R95–R113 Review Targeting the gastrointestinal tract to treat type 2 diabetes Correspondence should be addressed 1,2 and 1 Paige V Bauer Frank A Duca to F A Duca 1Toronto General Hospital Research Institute and Department of Medicine, UHN, Toronto, ON, Canada Email 2Department of Physiology, University of Toronto, Toronto, ON, Canada frank.duca@uhnres. utoronto.ca Abstract The rising global rates of type 2 diabetes and obesity present a significant economic and Key Words social burden, underscoring the importance for effective and safe therapeutic options. f gut The success of glucagon-like-peptide-1 receptor agonists in the treatment of type 2 f metformin diabetes, along with the potent glucose-lowering effects of bariatric surgery, highlight f gut sensing the gastrointestinal tract as a potential target for diabetes treatment. Furthermore, f gut microbiota recent evidence suggests that the gut plays a prominent role in the ability of metformin f bile acids to lower glucose levels. As such, the current review highlights some of the current and potential pathways in the gut that could be targeted to improve glucose homeostasis, such as changes in nutrient sensing, gut peptides, gut microbiota and bile acids. Endocrinology A better understanding of these pathways will lay the groundwork for novel of gut-targeted antidiabetic therapies, some of which have already shown initial promise. Journal of Endocrinology (2016) 230, R95–R113 Journal Introduction The incidence of type 2 diabetes has more than doubled Interestingly, this is not the only evidence for a since 1980, with over 382 million affected individuals therapeutic role of the gut in diabetes treatment.
    [Show full text]
  • The Sirtuin Family's Role in Aging and Age-Associated Pathologies
    The sirtuin family’s role in aging and age-associated pathologies Jessica A. Hall, … , Yoonjin Lee, Pere Puigserver J Clin Invest. 2013;123(3):973-979. https://doi.org/10.1172/JCI64094. Review Series The 7 mammalian sirtuin proteins compose a protective cavalry of enzymes that can be invoked by cells to aid in the defense against a vast array of stressors. The pathologies associated with aging, such as metabolic syndrome, neurodegeneration, and cancer, are either caused by or exacerbated by a lifetime of chronic stress. As such, the activation of sirtuin proteins could provide a therapeutic approach to buffer against chronic stress and ameliorate age- related decline. Here we review experimental evidence both for and against this proposal, as well as the implications that isoform-specific sirtuin activation may have for healthy aging in humans. Find the latest version: https://jci.me/64094/pdf Review series The sirtuin family’s role in aging and age-associated pathologies Jessica A. Hall, John E. Dominy, Yoonjin Lee, and Pere Puigserver Department of Cancer Biology, Dana-Farber Cancer Institute and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts, USA. The 7 mammalian sirtuin proteins compose a protective cavalry of enzymes that can be invoked by cells to aid in the defense against a vast array of stressors. The pathologies associated with aging, such as metabolic syndrome, neuro- degeneration, and cancer, are either caused by or exacerbated by a lifetime of chronic stress. As such, the activation of sirtuin proteins could provide a therapeutic approach to buffer against chronic stress and ameliorate age-related decline.
    [Show full text]
  • Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers
    1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1.
    [Show full text]
  • Analysis of Sirtuin 1 Expression Reveals a Molecular Explanation of IL-2–Mediated Reversal of T-Cell Tolerance
    Analysis of sirtuin 1 expression reveals a molecular explanation of IL-2–mediated reversal of T-cell tolerance Beixue Gao, Qingfei Kong, Kyeorda Kemp, Yuan-Si Zhao, and Deyu Fang1 Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 Edited by Arthur Weiss, University of California, San Francisco, CA, and approved December 8, 2011 (received for review November 9, 2011) The type III histone deacetylase sirtuin 1 (Sirt1) is a suppressor of both ably allowing accelerated T-cell proliferation and differentiation. innate and adoptive immune responses. We have recently found that Because Sirt1 is required for maintaining and IL-2 reverses T-cell Sirt1 expression is highly induced in anergic T cells. However, the peripheral tolerance, our findings here provide a possible explana- transcriptional program to regulate Sirt1 expression in T cells remains tion about the IL-2–mediated switch from anergy to activation. uncharacterized. Here we report that the early responsive genes 2 and 3, which can be up-regulated by T-cell receptor-mediated activa- Results tion of nuclear factor of activated T-cell transcription factors and are Differential Sirt1 Expression in Mouse Primary T Cells. We have re- involved in peripheral T-cell tolerance, bind to the sirt1 promoter to cently reported that sirt1 gene transcription is induced by TCR- transcript sirt1 mRNA. In addition, the forkhead transcription factor, mediated anergic signaling, and this increased Sirt1 expression is FoxO3a, interacts with early responsive genes 2/3 on the sirt1 pro- required to maintain peripheral T-cell tolerance (9). To further moter to synergistically regulate Sirt1 expression.
    [Show full text]
  • Omega-3 Fatty Acids Upregulate SIRT1/3, Activate PGC-1Α Via Deacetylation, and Induce Nrf1 Production in 5/6 Nephrectomy Rat Model
    marine drugs Article Omega-3 Fatty Acids Upregulate SIRT1/3, Activate PGC-1α via Deacetylation, and Induce Nrf1 Production in 5/6 Nephrectomy Rat Model Sung Hyun Son 1,† , Su Mi Lee 2,† , Mi Hwa Lee 3, Young Ki Son 2, Seong Eun Kim 2 and Won Suk An 2,* 1 Department of Internal Medicine, BHS Han Seo Hospital, Busan 48253, Korea; [email protected] 2 Department of Internal Medicine, Dong-A University, Busan 49201, Korea; [email protected] (S.M.L.); [email protected] (Y.K.S.); [email protected] (S.E.K.) 3 Department of Anatomy and Cell Biology, Dong-A University, Busan 49201, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-51-240-2811 † These authors contributed equally to this work. Abstract: Mitochondrial dysfunction contributes to the pathogenesis of kidney injury related with cardiovascular disease. Peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC- 1α) protects renal tubular cells by upregulating nuclear factor erythroid 2-related factor 2 (Nrf2). AMP- activated protein kinase (pAMPK)-mediated phosphorylation and sirtuin 1/3 (SIRT1/3)-mediated deacetylation are required for PGC-1α activation. In the present study, we aimed to investigate whether omega-3 fatty acids (FAs) regulate the expression of mediators of mitochondrial biogenesis in 5/6 nephrectomy (Nx) rats. Male Sprague-Dawley rats were assigned to the following groups: sham control, Nx, and Nx treated with omega-3 FA. The expression of PGC-1α, phosphorylated PGC- Citation: Son, S.H.; Lee, S.M.; Lee, 1α (pPGC-1α), acetylated PGC-1α, and factors related to mitochondrial biogenesis was examined M.H.; Son, Y.K.; Kim, S.E.; An, W.S.
    [Show full text]
  • The Soluble Adenylyl Cyclase Inhibitor LRE1 Prevents Hepatic Ischemia/Reperfusion Damage Through Improvement of Mitochondrial Function
    International Journal of Molecular Sciences Article The Soluble Adenylyl Cyclase Inhibitor LRE1 Prevents Hepatic Ischemia/Reperfusion Damage Through Improvement of Mitochondrial Function João S. Teodoro 1,2,* , João A. Amorim 1,3,4 , Ivo F. Machado 1,2 , Ana C. Castela 1,2, Clemens Steegborn 5, David A. Sinclair 4,6, Anabela P. Rolo 1,2 and Carlos M. Palmeira 1,2,* 1 Center for Neurosciences and Cell Biology of the University of Coimbra, 3004-504 Coimbra, Portugal; [email protected] (J.A.A.); [email protected] (I.F.M.); [email protected] (A.C.C.); [email protected] (A.P.R.) 2 Department of Life Sciences of the University of Coimbra, 3000-456 Coimbra, Portugal 3 IIIUC—Institute of Interdisciplinary Research of the University of Coimbra, 3030-789 Coimbra, Portugal 4 Department of Genetics, Blavatnik Institute, Paul F. Glenn Center for the Biology of Aging, Harvard Medical School, Boston, MA 02115, USA; [email protected] 5 Department of Biochemistry, University of Bayreuth, 95440 Bayreuth, Germany; [email protected] 6 Laboratory for Ageing Research, Department of Pharmacology, School of Medical Sciences, The University of New South Wales, Sydney 2052, Australia * Correspondence: [email protected] (J.S.T.); [email protected] (C.M.P.); Tel.: +351-239-240-700 (J.S.T. & C.M.P.) Received: 13 May 2020; Accepted: 5 July 2020; Published: 11 July 2020 Abstract: Hepatic ischemia/reperfusion (I/R) injury is a leading cause of organ dysfunction and failure in numerous pathological and surgical settings. At the core of this issue lies mitochondrial dysfunction.
    [Show full text]