IFN-Λ Determines the Intestinal Epithelial Antiviral Host Defense

IFN-λ determines the intestinal epithelial antiviral host defense

Johanna Potta, Tanel Mahlakõivb,c,1, Markus Mordsteinb,c,1, Claudia U. Duerra, Thomas Michielsd, Silvia Stockingera,2, Peter Staehelib,2, and Mathias W. Hornefa,2

aInstitute for Medical Microbiology and Hospital Epidemiology, Hannover Medical School, 30625 Hannover, Germany; bDepartment of Virology, and cThe Spemann Graduate School of Biology and Medicine, University of Freiburg, 79104 Freiburg, Germany; and dde Duve Institute, Université Catholique de Louvain, 1200 Brussels, Belgium

Edited by John Hiscott, McGill University, Montreal, Canada, and accepted by the Editorial Board April 4, 2011 (received for review January 16, 2011) Type I and type III IFNs bind to different cell-surface receptors but plicated more efficiently in the lung of mice lacking both receptor induce identical signal transduction pathways, leading to the systems than in the lung of mice lacking only functional type I IFN expression of antiviral host effector molecules. Despite the fact receptors. However, unlike IFNAR-deficient mice, single-knockout that type III IFN (IFN-λ) has been shown to predominantly act on mice lacking functional type III IFN receptors showed only mucosal organs, in vivo infection studies have failed to attribute slightly enhanced virus susceptibility (12). a specific, nonredundant function. Instead, a predominant role of Rotavirus represents one of the most common causes of in- type I IFN was observed, which was explained by the ubiquitous fectious gastroenteritis in humans worldwide with significant expression of the type I IFN receptor. Here we comparatively an- morbidity and mortality, particularly in countries with limited ac- alyzed the role of functional IFN-λ and type I IFN receptor signaling cess to medical care (13). Rotavirus exhibits a strong epithelial cell in the innate immune response to intestinal rotavirus infection in tropism with predominant replication in the epithelium of the vivo, and determined viral replication and antiviral gene expres- small intestine. Recent work demonstrated that rotavirus-infected sion on the cellular level. We observed that both suckling and adult STAT1-deficient mice shed substantially more virus than adult mice lacking functional receptors for IFN-λ were impaired wild-type controls (14). In contrast, IFNAR1-deficient mice ex- in the control of oral rotavirus infection, whereas animals lacking hibited no enhanced rotavirus susceptibility (15). These results functional receptors for type I IFN were similar to wild-type mice. prompted us to examine whether IFN-λ might be responsible for Using Mx1 protein accumulation as marker for IFN responsiveness rotavirus protection. We found that mice lacking functional IFN-λ of individual cells, we demonstrate that intestinal epithelial cells, receptors are indeed highly susceptible to rotavirus infection. Our which are the prime target cells of rotavirus, strongly responded work demonstrates that IFN-λ is a functionally nonredundant λ to IFN- but only marginally to type I IFN in vivo. Systemic treat- component of the mucosal antiviral innate immune system. ment of suckling mice with IFN-λ repressed rotavirus replication in the gut, whereas treatment with type I IFN was not effective. Results λ These results are unique in identifying a critical role of IFN- in Enhanced Susceptibility to Rotavirus in Mice Lacking Functional IFN-λ the epithelial antiviral host defense. Receptors. Activation of the enteric IFN system after oral rotavirus infection was determined in freshly isolated intestinal epi- FNs play a critical role in the antimicrobial host defense. thelial cells (IECs) from suckling mice. Ifn-β and Ifn-λ mRNA IWhereas lymphocyte-derived type II IFN (also called IFN-γ)is levels were strongly enhanced at day 4 postinfection and still associated with resistance against a broad range of intracellular slightly enhanced at day 11 postinfection (Fig. 1A). The infected microorganisms, type I and III IFN primarily mediate antiviral epithelium readily responded to virus-induced IFN, illustrated by protection. IFN-α, IFN-β, and all other type I IFN family members enhanced expression levels of the IFN-stimulated genes Isg15 use the same heterodimeric receptor complex (IFNAR) for sig- and Oasl2 (Fig. 1B), suggesting that rotavirus infection repre- naling. Receptor engagement leads to activation of the Jak/STAT sents a suitable model to study the biological importance of type signaling pathway and expression of IFN-stimulated genes (ISG), I and type III IFN. Therefore, we compared virus replication in which mediate the antiviral state (1). The type III IFN family the intestinal tract of mice lacking functional receptors for IFN-λ consists of three members in humans, IFN-λ1, -λ2, and -λ3 that are with animals deficient in type I IFN recognition. Wild-type, also named IL29, IL28A, and IL28B, respectively, whereas mice IL28Rα0/0, IFNAR10/0,andIFNAR10/0IL28Rα0/0 double-knockout only express IFN-λ2and-λ3. Type III IFN are structurally dif- mice were orally infected with rotavirus and the extent of virus ferent from type I IFN and bind to a distinct heterodimeric re- replication was determined at day 4 postinfection. Immunohis- ceptor (IL28R), consisting of the IL28Rα, also called IFN-λ tochemical analysis of thin sections of paraffin-embedded small receptor 1 (IFN-λR1), and the IL10Rβ chains (2–4). Type I and III intestinal tissue revealed abundant viral antigen at the villus IFN are both induced following stimulation of pattern recognition epithelium of IL28Rα0/0 and IFNAR10/0IL28Rα0/0 mice, but not receptors of the innate immune system, such as Toll-like receptors wild-type and IFNAR10/0 mice (Fig. 2 A and B). Additionally, and RIG-like helicases (5–7). IFN-λ–triggered signal transduction events and gene activation profiles are virtually indistinguishable from those of the type I IFN system (2, 3, 8, 9). However, the type Author contributions: J.P., S.S., P.S., and M.W.H. designed research; J.P., T. Mahlakõiv, I and type III IFN systems differ strikingly with regard to the M.M., C.U.D., T. Michiels, and S.S. performed research; T. Michiels contributed new reagents/analytic tools; J.P., T. Mahlakõiv, M.M., S.S., P.S., and M.W.H. analyzed data; and spectrum of responsive cell types. Whereas receptors for type I J.P., S.S., P.S., and M.W.H. wrote the paper. IFN seem to be present on most if not all nucleated cells, func- The authors declare no conflict of interest. tional receptors for type III IFN are preferentially expressed on This article is a PNAS Direct Submission. J.H. is a guest editor invited by the Editorial epithelial cells (10). Board. Recent studies investigating the role of type III IFN in vivo 1T. Mahlakõiv and M.M. contributed equally to this work. demonstrated a high degree of redundancy of the type I and type 2To whom correspondence may be addressed. E-mail: [email protected], III IFN systems (6, 11, 12). Available data suggest that the type [email protected], or [email protected]. III IFN system supports but cannot functionally replace the type I This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. IFN system. For example, influenza and other respiratory viruses re- 1073/pnas.1100552108/-/DCSupplemental.

7944–7949 | PNAS | May 10, 2011 | vol. 108 | no. 19 www.pnas.org/cgi/doi/10.1073/pnas.1100552108 Downloaded by guest on September 30, 2021 Fig. 1. IECs express type I and III IFN genes after rotavirus challenge. Suckling C57BL/6 mice were orally infected with murine rotavirus strain EDIM (5 μL of 1:100 diluted virus stock). IECs were isolated at day 4 (n =5) and day 11 (n = 5) postinfection (pi, black bars) or from uninfected control mice (open bars, n = 4) and analyzed by quantitative RT-PCR for expression of (A) Ifn-β, Ifn-λ2/3, and (B) Isg15 and Oasl2 genes. Results are representative for at least two independent experiments.

average rotavirus antigen levels in colon homogenates of IL28Rα0/0 and IFNAR10/0IL28Rα0/0 mice were significantly higher compared with wild-type mice. In contrast, virus antigen levels in colons of infected IFNAR10/0 mice were comparable to wild-type mice (Fig. 2C). Enhanced rotavirus susceptibility of mice lacking functional receptors for IFN-λ was also associated with more severe pathology. Epithelial vacuolization, villus deformation, and epithelial cell disruption were more pronounced in IL28Rα0/0 single- knockout and IFNAR10/0IL28Rα0/0 double-knockout mice than in wild-type and IFNAR10/0 animals (Fig. 2 D and E). We next asked if rotavirus restriction was also dependent on functional receptors for IFN-λ in adult mice that usually exhibit a higher degree of natural resistance to rotavirus than suckling mice (16). Groups of 4- to 6-wk-old wild-type and mutant mice were orally infected with rotavirus, and kinetics and extent of rotavirus shedding were assessed. As expected, feces of all wild-type mice contained very low or even undetectable levels of rotavirus antigen at all times. In contrast, seven of eight infected IL28Rα0/0 mice shed high concentrations of rotavirus antigen. Virus shedding typically lasted several days, with some variation between individual animals (Fig. 2F). Six of eight infected IFNAR10/0 mice exhibited detectable Fig. 2. Enhanced rotavirus replication and IEC damage in mice lacking functional IFN-λ receptors. (A–E) Suckling wild-type (n = 12), IL28Rα0/0 (n = levels of rotavirus antigen in the feces on at least one occasion, 14), IFNAR10/0 (n = 14), and IFNAR10/0IL28Rα0/0 (dKO, n = 12) mice were orally but the extent and duration of virus shedding were substantially infected with murine rotavirus strain EDIM (5 μL of 1:100 diluted stock). 0/0 reduced compared with IL28Rα mice. Rotavirus shedding of Animals were killed 4 d later. (A) Immunostaining for rotavirus antigen (red) 0/0 0/0 IFNAR1 IL28Rα double-knockout mice was indistinguishable in thin sections of paraffin-embedded intestinal tissue. Counterstaining was from IL28Rα0/0 single-knockout mice (Fig. 2F). performed with wheat germ agglutinin (WGA, green) and DAPI (blue). (Scale bars, 50 μm.) (B) Epithelial rotavirus antigen staining intensity was IFN-λ–Mediated Resistance to Rotavirus Is Attributed to an Epithelial measured to obtain the relative fluorescence intensity (RFI) of villus/crypt Cell-Specific Response. In an attempt to understand the basis for the epithelium. (C) Viral antigen levels in colon homogenates were determined surprising observation that IFN-λ rather than IFN-α/β determines by ELISA. Combined results of three independent experiments are shown. To facilitate comparison, OD450nm readings were normalized to the mean values rotavirus resistance, we visualized the type I and type III IFN obtained from wild-type mice of each experiment. (D) Histological score of responses at the cellular level. Mx1 is an IFN-induced protein that virus-induced small intestinal tissue alterations and (E) H&E stainings of ro- rapidly accumulates in the nucleus of cells from mice that carry tavirus-infected tissue. [Scale bars, 50 μm(Top and Middle), 10 μm(Bottom).] α0/0 0/0

functional Mx1 alleles (17). We previously demonstrated that (F) Virus shedding in feces of adult wild-type, IL28R , IFNAR1 ,and IMMUNOLOGY staining for Mx1 in IFNAR10/0 or IL28Rα0/0 mice represents a IFNAR10/0IL28Rα0/0 (dKO) mice (n = 8 for each group) after oral infection with powerful tool to identify cells that speciﬁcally respond to IFN-λ or murine rotavirus strain EDIM. Each line represents the OD450nm values of one IFN-α/β (12). individual mouse during the observed time period. In tissue sections of the small intestine from rotavirus-infected suckling wild-type mice, we observed only few virus antigen- epithelial cell marker E-cadherin, identifying them as lamina positive cells but strong Mx1 staining in the nucleus of epithelial propria cells (Fig. 3, second row). In contrast, rotavirus antigen- cells (Fig. 3, Top). In infected IL28Rα0/0 mice, however, rotavirus positive cells were rare in infected IFNAR10/0 mice, and Mx1 antigen was abundantly present in epithelial cells. Mx1-positive staining was restricted to E-cadherin–positive cells (Fig. 3, third cells were also detected but, interestingly, did not stain for the row). As expected, in infected IFNAR10/0IL28Rα0/0 mice, many

Pott et al. PNAS | May 10, 2011 | vol. 108 | no. 19 | 7945 Downloaded by guest on September 30, 2021 Fig. 3. IECs of infected mice mainly respond to virus-induced IFN-λ. Intestinal tissue from rotavirus-infected suckling wild-type, IL28Rα0/0, IFNAR10/0,and IFNAR10/0IL28Rα0/0 (dKO) mice was harvested at day 4 postinfection. Paraffin-embedded samples were subjected to simultaneous staining for Mx1 (green), rotavirus antigen (white), and E-cadherin (red). Counterstaining was performed with DAPI (blue). (Right) Zoom column represents larger magnifications of the adjacent boxed areas. (Scale bars, 50 μminfirst three columns; 20 μm in the zoom column.)

epithelial cells contained high levels of rotavirus antigen but vivo was explained in transwell chamber experiments with po- lacked Mx1 staining (Fig. 3, fourth row). These results suggested larized intestinal epithelial IEC-6 cells, which demonstrated that that IECs vigorously respond to IL28R stimulation but are only STAT1 phosphorylation occurs only after apical but not baso- weakly stimulated by type I IFN in vivo, a finding that was con- lateral stimulation with type I IFN. In contrast, IFN-λ readily firmed by quantitative RT-PCR for Isg15 and Mx1 expression in induced STAT1 phosphorylation in IEC-6 cells from both, the primary IECs isolated from infected mice (Fig. S1). apical and basolateral site (Fig. 4E). The results presented above seemed to violate the accepted concept that most if not all nucleated cells express type I IFN IFN-λ Confers Protection from Rotavirus Infection. Next, we de- receptors (reviewed in ref. 18). To exclude rotavirus-induced in- termined if administration of exogenous IFN-λ would ameliorate hibitory effects on the epithelial type I IFN response, the in vivo rotavirus resistance of suckling mice. Groups of 10-d-old wild-type IFN responsiveness of IECs was investigated in the absence of mice received subcutaneous injections of mouse IFN-λ2 or human viral infection. Therefore, muscle cells of mice were transfected in IFN-αB/D. IFN-αB/D induced enhanced expression of the IFN vivo with expression plasmids for either mouse IFN-α or mouse response genes Isg15 and Oasl2 in spleen and liver tissue but not IFN-λ, leading to prolonged synthesis and systemic spread of bi- IECs. In contrast, IFN-λ2 treatment led to enhanced expression of ologically active IFN (10). Epithelial Mx1 expression was low in Isg15 and Oasl2 in IECs but not spleen and liver cells (Fig. S3). IL28Rα0/0 mice expressing a plasmid encoding IFN-α, whereas Mice received mouse IFN-λ2 or human IFN-αB/D 8 h before oral lamina propria cells contained high levels of Mx1 (Fig. 4A). In infection with a high or low dose of rotavirus. Additional doses of contrast, IECs stained very strongly for nuclear Mx1 in IFNAR10/0 mouse IFN-λ2 and human IFN-αB/D were administered on days 1 mice expressing a plasmid encoding IFN-λ (Fig. 4B). Control and 2 postinfection and viral antigen load in the colon was de- experiments in which a plasmid encoding IFN-λ was adminis- termined at day 3 postinfection. Virus antigen levels were uni- tered to IL28Rα0/0 mice, a plasmid encoding IFN-α was ad- formly high in mock-treated control animals infected with the high ministered to IFNAR10/0 mice, or empty control vectors were virus dose and uniformly low in IFN-λ-treated animals (Fig. 5A). administered to either mouse strain, yielded no specificstaining Of the 10 animals that received human IFN-αB/D, eight failed to for Mx1 (Fig. 4 A and B,andFig. S2). control the infection, whereas the other two contained little virus Interestingly, freshly isolated IECs responded well to ex vivo antigen in the colon. If a low dose of rotavirus was used for in- treatment with mouse IFN-β and mouse IFN-λ2, as visualized by fection (Fig. 5B), viral antigen levels in the mock-treated group pronounced tyrosine phosphorylation of the transcription factor were less uniform but all 10 animals became ELISA-positive. STAT1 (Fig. 4C). The response of macrophage-like RAW264.7 Under low-dose infection conditions, treatment with mouse IFN-λ2 cells was restricted to type I IFN (Fig. 4D). The observed dif- was very effective and viral antigen levels in the colon of all 10 ference in type I responsiveness of primary IECs in vivo and ex animals of this group remained below the detection limit of the

7946 | www.pnas.org/cgi/doi/10.1073/pnas.1100552108 Pott et al. Downloaded by guest on September 30, 2021 Fig. 4. IFN-λ induces an epithelial cell-specific response. (A and B) The spatial response to in vivo electroporation of plasmids encoding mouse IFN-λ or mouse IFN-α was monitored by immunofluorescence staining for Mx1 in duodenal tissue sections of (A) IFNAR10/0 or IL28Rα0/0 mice expressing IFN-α,and(B)in IL28Rα0/0 and IFNAR10/0 mice expressing IFN-λ. (Scale bar, 50 μm.) (C–E) Stat1 tyrosine phosphorylation was detected by immunoblotting after stimulation with IFN (human IFN-αB/D, 2,000 U/mL; mouse IFN-β, 500 U/mL; or mouse IFN-λ, 20 ng/mL). (C) IECs isolated from adult C57BL/6 wild-type mice were stimulated ex vivo for 1 h with the indicated IFN. Unstimulated IECs served as negative control. The images show triplicates for each condition. (D) Mouse macrophage-like RAW 264.7 cells were stimulated for the indicated time. (E) Rat intestinal epithelial IEC-6 cells were grown to confluency on transwell filters and left untreated or stimulated either apically or basolaterally with the indicated IFN. Actin staining was included to demonstrate equal protein loading. The images are representative of three independent experiments.

assay. Human IFN-αB/D was also partially effective under these type I IFN induced epithelial stimulation in vivo after rotavirus less stringent virus challenge conditions (Fig. 5B). infection or administration of an IFN-α–expressing vector. Thus, our results are in accordance with previous studies that suggested Discussion that all nucleated cell types express the IFN-α/β receptor (18). Our work is unique in providing direct experimental evidence for These results, however, also explain why parenteral administration a distinct and critical role of IFN-λ in the mucosal antiviral host of type I IFN in our study, as well as work published by Angel et al. defense that cannot be compensated for by IFN-α/β. Previous in- (15), did not result in an improved outcome after rotavirus infection studies in which respiratory viruses were used to dissect the fection in suckling mice. Finally, these results illuminate why the role of IFN-λ indicated only a minor contribution of IFN-λ to gastrointestinal tissue failed to respond to parenteral IFN-α/β ad- antiviral protection that appeared largely masked by the type I IFN ministration in an in vivo reporter system (22). system (6, 11, 12). The apparent discrepancy between the con- A previous report, which was difficult to interpret at the time, clusions of the current and previous studies may be a result of the indicated that rotavirus replicates much better in STAT1- exceptional tissue tropism of rotavirus. Rotavirus replicates mostly, deficient than IFNAR1-deficient mice (14, 15). Our results suggest if not exclusively, in epithelial cells of the small intestine (19). that IFN-λ represents the elusive additional STAT1-dependent Strikingly, our results suggest that the small intestinal epithelium mechanism of antiviral host defense and offer a simple explanation responds far more strongly to IFN-λ than to type I IFN. The epi- for the seemingly discrepant published findings. Similar to the thelium-specificresponsetoIFN-λ is presumably because of the situation after rotavirus infection, STAT1-deficient mice also restricted receptor expression (10, 20, 21). The poor respon- exhibited a more susceptible phenotype after oral norovirus chal- siveness to type I IFN after either viral infection or systemic ad- lenge compared with mice lacking functional receptors for type ministration, in contrast, may result from the subcellular restriction I and type II IFN (23). Furthermore, after infection with re- of the type I IFN receptor at the intestinal epithelium. The finding spiratory syncytial virus, lung tissue from IFN-α/β and IFN-λ re- that the type I IFN response of polarized IECs depends on whether ceptor double-deficient and STAT1-deficient mice contained IFN acts from the apical or from the basolateral site, provides an similarly high virus titers, which were clearly exceeding the titers explanation for the apparent contradiction between type I IFN found in IFNAR1-deficient animals (12). Thus, STAT1-mediated susceptibility of in vitro stimulated primary IECs and the lack of signaling through IFN-λ appears to contribute to antiviral protection both at the lung and intestinal mucosa. Although the presence of IFN-λ signaling critically determined the viral load in the course of infection, clearance of the infection in adult animals did not depend on IFN signaling and no mortality was observed in IFN receptor-deficient mice. In accordance, − − STAT1 / mice harbored higher virus titers during the acute phase of rotavirus infection but viral clearance was not delayed and correlated with the appearance of the specific IgA response (14). Despite the strong link between type I interferons, the –

clonal expansion of CD8 T cells (24 26), and the development of IMMUNOLOGY humoral immunity (27), rotavirus clearance therefore appears to be independent of the IFN-mediated instruction of the adaptive Fig. 5. Administration of IFN-λ mediates rotavirus protection. Suckling wild- immune system. type mice (10 animals per group) were given subcutaneous injections of In conclusion, our results are unique in revealing a distinct, λ μ α μ mouse IFN- 2(1 g per injection), human hybrid IFN- B/D (1 g per injection), nonredundant function of IFN-λ in vivo. Using the model of oral or buffer only (mock) 8 h before oral infection with (A) high dose (5 μLof ﬁ 3 μ 4 rotavirus infection, we demonstrate a striking cell-type speci city 1:10 diluted virus stock) or (B) low dose (5 L of 1:10 diluted virus stock) of λ– ﬁ murine rotavirus strain EDIM. The IFN treatment was repeated on days 1 and of the IFN- mediated antiviral host response and its signi cant

2 postinfection. OD450nm values representing the viral antigen levels in colon role in the antiviral immune defense at the intestinal epithelium. homogenates on day 3 postinfection are shown. IL-28Rα–induced signaling might therefore represent a promis-

Pott et al. PNAS | May 10, 2011 | vol. 108 | no. 19 | 7947 Downloaded by guest on September 30, 2021 ing therapeutic target to protect the intestinal epithelium from time PCR was quantified using Sybr green (Invitrogen) and analyzed using viral infection. the Pfaffl method to express relative expression of the target gene to the housekeeping gene Gapdh (33). The following primers were used in this Materials and Methods study: Isg15 (gagctagagcctgcagcaat, ttctgggcaatctgcttctt), Mx1 (tctgagga- gagccagacgat, actctggtccccaatgacag), Oasl2 (ggatgcctgggagagaatcg, tcgcct- Mice and Reagents. Standard C57BL/6 mice were obtained from Charles River. gctcttcgaaactg), Ifn-λ 2/3 (agctgcaggccttcaaaaag, tgggagtgaatgtggctcag), B6.A2G-Mx1 wild-type mice carrying intact Mx1 alleles (WT), B6.A2G-Mx1- Ifn-β (tcagaatgagtggtggttgc, gacctttcaaatgcagtagattca), and Gapdh (tgcac- IFNAR10/0 mice lacking functional type I IFN receptors (IFNAR10/0), B6.A2G- caccaactgcttagc, ggcatggactgtggtcatgag) (10, 34). Mx1-IL28Rα0/0 mice lacking functional type III IFN receptors (IL28Rα0/0), and B6.A2G-Mx1-IL28Rα0/0IFNAR10/0 double-knockout mice (IL28Rα0/0IFNAR10/0) lacking functional receptors for both type I and type III IFN and SV129 mice In Vivo Plasmid Electrotransfer. Plasmid electrotransfer-mediated expression fi were bred locally (11). Animals were housed in accordance with the guide- of IFN was performed as described previously (10). Twenty- ve micrograms of α λ lines defined by the Federation for Laboratory Animal Science Associations empty plasmid or plasmid expressing either IFN- 6T or IFN- 3 was injected in (www.felasa.eu/recommendations) and the national animal welfare body the left and right tibialis anterior muscles and electric pulses were admin- Die Gesellschaft für Versuchstierkunde (www.gv-solas.de/index.html), and istered using a Cliniporator system. At day 7 after electrotransfer, organs experiments were performed in compliance with the German animal pro- were harvested for histological analysis as described in ref. 10. tection law (TierSchG) and approved by the local animal welfare committees of the universities of Freiburg, Hanover, and Brussels. Human hybrid IFN-αB/D Immunohistology. Antigen retrieval in deparaffinized paraformaldehyde- (28), mouse IFN-β (PBL), and mouse IFN-λ2 (IL-28A; PeproTech) were used at fixed tissue sections was performed with 0.01 M sodium citrate buffer. Slides the concentrations indicated in the figure legends. Human IFN-αB/D was were blocked with normal donkey serum (Jackson ImmunoResearch) and previously shown to be highly active on many mouse cell types in vitro and in stained with the rabbit anti-Mx1 polyclonal antiserum (AP5) (35), a mouse vivo (29, 30). monoclonal anti–E-cadherin antibody (BD Bioscience Pharmingen), or a polyclonal goat anti-rotavirus antiserum (NCDV; Meridian LS) followed by Virus Infection and Monitoring. Murine rotavirus strain EDIM was provided by the appropriate AF555-, AF488-, Cy3-, or Cy5-conjugated secondary antibody Lennart Svensson (Molecular Virology, Linköping University, Sweden). Virus (Molecular Probes, Jackson ImmunoResearch). Counterstaining was per- stocks for infection experiments were prepared from pooled colon contents formed with fluorescein-conjugated wheat germ agglutinin (Vector Labo- collected 4 d postinfection of suckling mice. Suckling mice (4–15 days old) ratories) and slides were mounted in DAPI-containing Vectashield (Vector were infected by oral application of 5-μL samples of diluted virus stock Laboratories). Tissue sections were visualized using an ApoTome-equipped (1:100–1:10,000 dilutions as indicated in the figure legends). Age-matched Axioplan 2 microscope connected to an AxioCam Mr digital Camera (Carl animals were used for individual experiments. Adult mice (4–6 wk old) were Zeiss MicroImaging, Inc.). The rotavirus antigen staining intensity at the level orally infected with 20 μL of 20-fold diluted virus stock. A comparative ELISA of the villus and crypt epithelium was analyzed separately over a total area measurement using a dilution series of a rhesus rotavirus stock with known of greater than 7 × 104 μm2 per mouse using the Axiovision software (Carl fluorescence focus units in parallel with the virus stock used in this study Zeiss). The fluorescence intensity per square micrometer of the villus epi- indicated a virus titer of ∼3 ×108 IU/mL. This approach, however, appeared thelium was divided by the respective value determined for the crypt epi- to somewhat underestimate the number of infectious viral particles, because thelium to obtain relative fluorescence intensity. H&E staining was in vivo challenge of neonatal mice resulted in ELISA-positive fecal shedding performed according to Mayer’s protocol with reagents from Roth. Epithe- after oral challenge with as little as 5 μL of a 1:108 dilution of the virus stock. lial vacuolization (grade 0–3), villus deformation (grade 0–1), and breakage To determine the viral antigen concentration in colon homogenates or stool of the epithelial barrier (number of sites with lost epithelial integrity) per samples, the samples were homogenized in the dilution buffer supplied with villus were recorded in a blinded fashion in eight visual fields in two tissue the RIDASCREEN Rotavirus ELISA Kit from R-Biopharm and the ELISA was sections per mouse, with three mice per experimental group. The grades performed according to the manufacturer’s instructions. Samples were di- recorded were normalized to the maximal value obtained for each indi- luted to allow measurement within the linear range of the assay. vidual criterium to obtain a balanced histological score.

Cell Culture and Isolation of Primary IECs and Gene-Expression Analysis. The rat Western Blot Analysis. Cell lysates were prepared as recently described (32), intestinal epithelial cell line IEC-6 was kindly provided by E. Cario (Gastro- separated by SDS-PAGE, and transferred onto nitrocellulose membranes enterology and Hepatology, University Duisburg/Essen, Germany) (31) and (Millipore). Membranes were incubated with polyclonal rabbit antibody cultured in DMEM (Invitrogen) supplemented with 4 mM glutamine (Invi- recognizing phosphorylation at tyrosine 701 of STAT1 (Cell Signaling) and trogen), 10% FCS (Sigma), 0.1 units/mL insulin (Sigma), and 4.5 g/L glucose monoclonal mouse actin antibodies (Sigma). Horseradish peroxidase-labeled (Sigma). For stimulation experiments, cells were differentiated 4 to 6 d on secondary antibodies were purchased from Jackson Immunoresearch and transwells (pore size 0.4 μm, Greiner Bio-One). RAW264.7 were cultured in detected using the chemiluminescence detection system from Pierce. DMEM (Invitrogen) supplemented with 4 mM glutamine (Invitrogen) and 10% FCS (Sigma). For isolation of adult IECs, intestinal tissue was removed, Statistical Analysis. Results are presented as means ± SD. The Mann-Whitney U cut into 3-cm long pieces, and inverted with the mucosal surface outwards. test was used for statistical analysis using the GraphPad Prism Software 4.00. Inverted tissues were pulled on a plastic stick, incubated for 10 min in 30 mM P values are indicated as follows: ***P < 0.001; **P < 0.01, and *P < 0.05. EDTA and subjected to centrifugal force using a motor-driven biovortexer ∼ purchased from Sigma using eight pulses with 1- to 2-s duration. Epithelial ACKNOWLEDGMENTS. We thank Lennart Svensson, Gerry McInerney, Elke cell aggregates were separated from contaminating lymphoid and myeloid Cario, and André Bleich for technical support, and Heinz-Kurt Hochkeppel for cells by threefold sedimentation at 1 × g for 20 min. All steps except the providing human IFN-αB/D. This work was supported in part by the individual incubation in EDTA were performed at 4 °C (32). For the preparation of Grant Ho2236/5-3 and the Collaborative Research Center SFB621 and SFB900 neonatal IECs, total small intestinal tissue was cut in small pieces and in- from the German Research Foundation and Grants DLR 01GU0825 and cubated for 10 min in 30 mM EDTA. After vigorous shaking, epithelial cells 01KI0752 from the Federal Ministry of Education and Research (to M.W.H.); were separated from the underlying tissue by ﬁltration through a 100-μm a grant of the International Research Training Group IRTG 1273 (to C.U.D.); a Federation of European Biochemical Societies postdoctoral fellowship (to pore size cell strainer (BD Falcon). This method resulted in a somewhat less S.S.) and an Austrian Programme for Advanced Research and Technology pure fraction of IECs. RNA was isolated from isolated epithelial cell prepa- fellowship from the Austrian Academy of Sciences at Hannover Medical rations, spleen, and liver tissue with TRIzol (Invitrogen) according to the School (to S.S.); German Research Foundation Grant SFB 620 (to P.S.); and manufacturer’s instructions. Reverse transcription was performed using 1 to Grant FRSM 3.4576.08 from Fonds de la Recherche Scientiﬁque Médicale (to 2 μg of total RNA with RevertAid reverse transcriptase (Fermentas). Real- T. Michiels).

1. Perry AK, Chen G, Zheng D, Tang H, Cheng G (2005) The host type I interferon 5. Onoguchi K, et al. (2007) Viral infections activate types I and III interferon genes response to viral and bacterial infections. Cell Res 15:407–422. through a common mechanism. J Biol Chem 282:7576–7581. 2. Kotenko SV, et al. (2003) IFN-lambdas mediate antiviral protection through a distinct 6. Ank N, et al. (2008) An important role for type III interferon (IFN-lambda/IL-28) in TLR- – class II cytokine receptor complex. Nat Immunol 4:69 77. induced antiviral activity. J Immunol 180:2474–2485. 3. Sheppard P, et al. (2003) IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat 7. Yang K, et al. (2005) Human TLR-7-, -8-, and -9-mediated induction of IFN-alpha/beta – Immunol 4:63 68. and -lambda Is IRAK-4 dependent and redundant for protective immunity to viruses. 4. Gad HH, et al. (2009) Interferon-lambda is functionally an interferon but structurally Immunity 23:465–478. related to the interleukin-10 family. J Biol Chem 284:20869–20875.

7948 | www.pnas.org/cgi/doi/10.1073/pnas.1100552108 Pott et al. Downloaded by guest on September 30, 2021 8. Dumoutier L, et al. (2004) Role of the interleukin (IL)-28 receptor tyrosine residues for 22. Pulverer JE, et al. (2010) Temporal and spatial resolution of type I and III interferon antiviral and antiproliferative activity of IL-29/interferon-lambda 1: Similarities with responses in vivo. J Virol 84:8626–8638. type I interferon signaling. J Biol Chem 279:32269–32274. 23. Karst SM, Wobus CE, Lay M, Davidson J, Virgin HW, 4th (2003) STAT1-dependent 9. Zhou Z, et al. (2007) Type III interferon (IFN) induces a type I IFN-like response in innate immunity to a Norwalk-like virus. Science 299:1575–1578. a restricted subset of cells through signaling pathways involving both the Jak-STAT 24. Aichele P, et al. (2006) CD8 T cells specific for lymphocytic choriomeningitis virus pathway and the mitogen-activated protein kinases. J Virol 81:7749–7758. require type I IFN receptor for clonal expansion. J Immunol 176:4525–4529. 10. Sommereyns C, Paul S, Staeheli P, Michiels T (2008) IFN-lambda (IFN-lambda) is 25. Curtsinger JM, Valenzuela JO, Agarwal P, Lins D, Mescher MF (2005) Type I IFNs expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. provide a third signal to CD8 T cells to stimulate clonal expansion and differentiation. PLoS Pathog 4:e1000017. J Immunol 174:4465–4469. 11. Mordstein M, et al. (2008) Interferon-lambda contributes to innate immunity of mice 26. Kolumam GA, Thomas S, Thompson LJ, Sprent J, Murali-Krishna K (2005) Type I fl against in uenza A virus but not against hepatotropic viruses. PLoS Pathog 4:e1000151. interferons act directly on CD8 T cells to allow clonal expansion and memory 12. Mordstein M, et al. (2010) Lambda interferon renders epithelial cells of the respiratory formation in response to viral infection. J Exp Med 202:637–650. – and gastrointestinal tracts resistant to viral infections. JVirol84:5670 5677. 27. Le Bon A, et al. (2006) Cutting edge: Enhancement of antibody responses through 13. WHO (2004) Global Deaths Under Age Five Attributable to Rotavirus Infection (World direct stimulation of B and T cells by type I IFN. J Immunol 176:2074–2078. Health Organization, Geneva, Switzerland). 28. Horisberger MA, de Staritzky K (1987) A recombinant human interferon-alpha B/D 14. Vancott JL, McNeal MM, Choi AH, Ward RL (2003) The role of interferons in rotavirus hybrid with a broad host-range. J Gen Virol 68:945–948. infections and protection. J Interferon Cytokine Res 23:163–170. 29. Pichlmair A, et al. (2004) Thogoto virus lacking interferon-antagonistic protein ML is 15. Angel J, Franco MA, Greenberg HB, Bass D (1999) Lack of a role for type I and type II strongly attenuated in newborn Mx1-positive but not Mx1-negative mice. J Virol 78: interferons in the resolution of rotavirus-induced diarrhea and infection in mice. 11422–11424. J Interferon Cytokine Res 19:655–659. 30. Tumpey TM, et al. (2007) The Mx1 gene protects mice against the pandemic 1918 and 16. Franco MA, Greenberg HB (2000) Immunity to homologous rotavirus infection in fl – adult mice. Trends Microbiol 8:50–52. highly lethal human H5N1 in uenza viruses. J Virol 81:10818 10821. 17. Dreiding P, Staeheli P, Haller O (1985) Interferon-induced protein Mx accumulates in 31. Quaroni A, Wands J, Trelstad RL, Isselbacher KJ (1979) Epithelioid cell cultures from nuclei of mouse cells expressing resistance to influenza viruses. Virology 140:192–196. rat small intestine. Characterization by morphologic and immunologic criteria. J Cell – 18. Randall RE, Goodbourn S (2008) Interferons and viruses: An interplay between induction, Biol 80:248 265. signalling, antiviral responses and virus countermeasures. J Gen Virol 89:1–47. 32. Lotz M, et al. (2006) Postnatal acquisition of endotoxin tolerance in intestinal 19. Boshuizen JA, et al. (2003) Changes in small intestinal homeostasis, morphology, and epithelial cells. J Exp Med 203:973–984. fl fi gene expression during rotavirus infection of infant mice. J Virol 77:13005–13016. 33. Pfaf MW (2001) A new mathematical model for relative quanti cation in real-time 20. Lasfar A, et al. (2006) Characterization of the mouse IFN-lambda ligand-receptor RT-PCR. Nucleic Acids Res 29(9):e45. system: IFN-lambdas exhibit antitumor activity against B16 melanoma. Cancer Res 66: 34. Stockinger S, et al. (2004) IFN regulatory factor 3-dependent induction of type I IFNs 4468–4477. by intracellular bacteria is mediated by a TLR- and Nod2-independent mechanism. 21. Brand S, et al. (2005) IL-28A and IL-29 mediate antiproliferative and antiviral signals in J Immunol 173:7416–7425. intestinal epithelial cells and murine CMV infection increases colonic IL-28A expression. 35. Meier E, et al. (1988) A family of interferon-induced Mx-related mRNAs encodes Am J Physiol Gastrointest Liver Physiol 289:G960–G968. cytoplasmic and nuclear proteins in rat cells. J Virol 62:2386–2393. IMMUNOLOGY

Pott et al. PNAS | May 10, 2011 | vol. 108 | no. 19 | 7949 Downloaded by guest on September 30, 2021