DOCSLIB.ORG

Submission of the Certichem Cell Proliferation Test Method For

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Submission of the Certichem Cell Proliferation Test Method For TEST METHOD NOMINATION: MCF-7 CELL PROLIFERATION ASSAY OF ESTROGENIC ACTIVITY This nomination application includes no confidential information. TABLE OF CONTENTS Page # I Executive Summary 2 1.0 Introduction and Rationale for the Proposed Test Method 6 2.0 Test Method Protocol Components 16 3.0 Substances Used for Validation of the Proposed Test Method 44 4.0 In Vivo Reference Data Used for an Assessment of the Accuracy of CCi’s Test 47 Method 5.0 Test Method Data and Results 48 6.0 Test Method Accuracy 58 7.0 Test Method Reliability (Repeatability/Reproducibility) 62 8.0 Test Method Data Quality 66 9.0 Other Scientific Reports and Reviews 68 10.0 Animal Welfare Considerations (Refinement, Reduction, and Replacement) 70 11.0 Practical Considerations 71 12.0 References 73 13.0 Supporting Materials (Appendix A) 77 Tables 1-8 A1-8 Table 9 A9-10 Table 10 A11 Table 11A A12 Table 11B A13 Table 12 A14 Table 13 A15 Fig. 1-7 A16-22 Fig. 8-9 A23 Fig. 10-11 A24 Fig. 12 A25 1 EXECUTIVE SUMMARY Rational for the Proposed Test Method On 6/4/04, in a letter to Dr. William Stokes, CertiChem, Inc. (CCi) nominated its MCF-7 Cell Proliferation Assay in manual and robotic format for validation studies of in vitro screens for estrogenic activity (EA). CCi nominated its test method for validation by NICEATM and ICCVAM because our assay is sensitive, reproducible, reliable and accurate in manual or robotic format when our results using this assay are compared to previously published in vitro data, such as those listed in Table 4 of ICCVAM, 2003. In brief, the need for a valid EA assay, especially in robotic format, is as follows: • Recent scientific investigations have shown that many chemicals used to manufacture plastics, pharmaceuticals, pesticides, cosmetics, foodstuffs, etc. are endocrine disruptors (EDs) that interfere in various ways with the actions of estrogen, androgen or thyroid hormones (EDSTAC, 1998; NRC, 1999; EPA, 2000; ICCVAM, 2002a-c, 2003). • The most common ED activity is EA that can have significant deleterious effects on many physiological processes. Most importantly, adverse EA effects sometimes occur at very low (picomolar to nanomolar) concentrations, especially on fetal or developing mammals, including humans (EDSTAC, 1998; NRC, 1999; NTP, 2001; ICCVAM, 2002a-c, 2003; Palanza, 2002). • Since a large number of chemicals should be screened for possible EA, the EPA and ICCVAM have set a high priority on the development of high throughput, in vitro, robotic screening assays for EA (EDSTAC, 1998; ICCVAM 2002a-c, 2003). * Compared to in vivo assays, in vitro robotic assays are much cheaper and faster to run, and do not utilize live animals. ICCVAM (Interagency Coordinating Committee on the Validation of Alternative Methods) was established in 1997 by the NIEHS and EPA (Public Law P.L.103-43), in part to develop and validate new ED test methods. ICCVAM was authorized in 2000 (P.L.106-545), as a 15 agency permanent committee, to co-ordinate the development, validation and acceptance of toxicological tests. As part of this mandate, ICCVAM and NICEATM [National Toxicology Program (NTP) Interagency Center for the Evaluation of Alternate Toxicological Methods] formed an Endocrine Disruptor Working Group to assist ICCVAM in the evaluation status of assays for EDs. EDSTAC (1998) and ICCVAM (2002a,b) recommended that ER-dependent transcriptional activation (TA) assays (including cell proliferation assays) be developed because such “functional” assays are more sensitive than Relative Binding Affinity (RBA) assays, can distinguish agonists from antagonists, and can be conducted with and without exogenous metabolic activation. ICCVAM and NICEATAM have concluded that "no validation studies have been completed on the [Transcriptional Activation (TA)] assays for EA being considered" (ICCVAM, 2002b, page 2) and have expressed a general preference (ICCVAM, 2002b, page 31) for the use of human ER subtypes in any in vitro TA screening assay. Given the large number of chemicals that should be screened for possible EA, the EPA, NIEHS and other congressionally- mandated interagency bodies (ICCVAM, NICEATM) for some years have also set a high priority on the development of high throughput, in vitro, robotic assays for EA (EDSTAC, 1998; ICCVAM 2002 a,b,c). 2 CCi’s response to these needs expressed by ICCVAM and NICEATM CCi, in a Phase I SBIR grant (R44 ESO11469-01), demonstrated the feasibility of developing a very sensitive, rapid, inexpensive in vitro, robotic assay for EA/anti-EA using proliferation of MCF-7 human breast cancer cells that meets published standards (ICCVAM, 2002a,b,c) for transcriptional activation (TA) assays of EA. CCi has started a Phase II SBIR grant (R44 ESO11469-02) to prepare this assay for commercialization in robotic format. Both Phase I&II grants received very favorable reviews from NIH Study Sections. Overview of Test Method CCi chose this assay because MCF-7 cells are perhaps the most widely used model of estrogen action in vitro. The MCF-7 cell line was derived from a human breast cancer (Soule et al., 1973). Estrogen-dependent cell proliferation by this cell line (Lippman et al., 1975, 1976) and the presence of estrogen receptors (ERs) were described simultaneously (Horwitz et al., 1975). ER-α and ER-β bind a large number of chemical ligands (Gorski et al. 1986; Kuiper et al., 1996, 1997, 1998). While binding affinities differ between estrogenic ligands (Kuiper, 1997), ER ligands typically bind to both receptors (ICCVAM, 2002a, 2003a; Routhledge et al., 2003). Both ERs bind to estrogen response elements, which are located upstream of the promoter regions of estrogen-activated genes (Paech et al., 1997; McDonnell and Norris, 2002). Chemicals with EA or anti-EA can bind to nuclear or extra-nuclear receptors (Fig. 3, page 14; Hewitt et al., 2005; Evinger and Levin, 2005). Our MCF-7 cell line contains both ER-α and ER-β, with ER-α dominating (V.C Jordan, personal communication). CCi’s test method meets or exceeds all ICCVAM standards for TA assays of EA. CCi’s test method uses equipment and chemicals that are commercially available. Briefly, MCF-7 cells are maintained at 37oC in RMPI with Phenol Red for routine culture. An aliquot of cells maintained at 37oC are grown for two days in phenol-free media containing 5% charcoal stripped fetal bovine serum in a 25 cm2 flask. Using a robotic dispenser such as an epMotion 5070 unit, MCF-7 cells are then seeded at 400 cells per well in 0.2 ml of this hormone- free medium in Corning 96-well plates. In its robotic format, the cells are adapted for 3 days in hormone-free culture medium prior to adding test chemicals. The media is changed daily for 6 days. At the end of the 7 day exposure, the media is removed, the wells are washed once with 0.2 ml of HBSS, and then assayed to quantify amounts of DNA/ well using a micro-plate modification of the Burton diphenylamine (DPA) assay (Burton, 1956; Natarajan et al., 1994). [The MCF-7 assay is more accurate, and less variable, when run in this robotic format.] Substances Used for Validation of Proposed Test Method CCi has tested about 45 chemicals to date from the list of 78 EA positive and EA negative reference chemicals recommended by ICCVAM (2003a) to assess the accuracy of TA assays for EA. Other chemicals tested are from a previous list of reference chemicals (ICCVAM, 2002c) to assess the accuracy of TA assays for EA. Yet other chemicals are from ICCVAM lists of reference chemicals recommended to assess the accuracy of in vitro assays for toxicity (ICCVAM) or chemicals that would not be expected to exhibit EA from QSAR studies and other considerations. This relatively large sample size was chosen to enable a rather accurate assessment of the rate of false negatives and false positives (the accuracy) of this MCF-7 cell proliferation assay to assess EA. In vivo Reference Data This nomination application does not discuss similarities or differences in the endpoint measured in CCi’s assay [MCF-7 cell proliferation] versus currently used in vivo test methods, other in vitro test methods, or human data because no such validated data exist, to the best of our knowledge. This nomination application includes no validation studies or references to other 3 validation studies, as such studies have not yet been performed or published by any laboratory or agency, to the best of our knowledge. Accuracy and Reliability of the Proposed Test Method Our results show that CCi’s EA assay is very consistent (reliable, repeatable) when analyzing the same set of 9-10 chemicals in three different laboratories for a 3-12 month period (Appendix A Figures 1-3 and Table 1, 4-5). Furthermore, Appendix A Figures 4-5 and Appendix A Tables 7 show that CCi’s EA assay gives very similar data when run in robotic or manual format. Table 6 in Appendix A shows the comparison of the EC50s for 18 ICCVAM chemicals published by ICCVAM in a meta-study and from our assay in robotic format. CCi’s robotic assay produces lower EC50s for most chemicals compared to the EC50s published by ICCVAM, indicating that CCi’s robotic assay is relatively more sensitive than other assays referenced in ICCVAM’s (2003a) meta-study. Appendix A Tables 7-9 and Appendix A Figures 4-5 show mean EC50 values from CCi’s assay and median EC50 values for the same set of chemicals compiled by ICCVAM (2003a) in a meta-analysis to provide a set of reference chemicals to be used to test the accuracy of EA TA assays.
Load more

Recommended publications
  • Glossary of Terms
    Glossary of Terms Acceptable Daily Intake or Allowed Daily Intake (ADI) → Dose- Response Relationship/Curve Allergen The allergen is a material which triggers an allergic reaction. Allopathy The term allopathy was created by Christian Friedrich Samuel Hahnemann (1755– 1843) (from the Greek prefix άλλος, állos, “other”, “different” and the suffix πάϑος, páthos, “suffering”) in order to distinguish his technique (homeopathy) from the traditional medicine of his age. Today, allopathy means a medicine based on the principles of modern pharmacology. Anaphylactic shock Anaphylaxis (or an anaphylactic shock) is a whole-body, rapidly developing aller- gic reaction, which may lead to lethal respiratory and circulatory failure. Antibody Antibodies are proteins produced by the immune system to neutralize exogenous (external) substances. Chromatography, chromatogram Chromatography is the common name of different techniques used to separate mix- tures of compounds. HPLC stands for high-performance liquid chromatography. A chromatogram is the pattern of separated substances obtained by chromatography. Colloidal sol A colloidal sol is a suspension of very small solid particles in a continuous liquid medium. Colloidal sols are quite stable and show the Tyndall effect (light scatter- ing by particles in a colloid). They can be quite stable. Examples include blood, pigmented ink, and paint. Colloidal sols can change their viscosity quickly if they © Springer International Publishing Switzerland 2014 311 L. Kovács et al., 100 Chemical Myths, DOI 10.1007/978-3-319-08419-0 312 Glossary of Terms are thixotropic. Examples include quicksand and paint, both of which become more fluid under pressure. Concentrations: parts per notations In British/American practice, the parts-per notation is a set of pseudo-units to de- scribe concentrations smaller than thousandths: 1 ppm (parts per million, 10−6 parts) One out of 1 million, e.g.
    [Show full text]
  • (+)-Catechin and Quercetin from Pawpaw Pulp A
    Characterization of (+)-Catechin and Quercetin from Pawpaw Pulp A thesis presented to the faculty of the College of Health Sciences and Professions of Ohio University In partial fulfillment of the requirements for the degree Master of Science Jinsoo Ahn June 2011 © 2011 Jinsoo Ahn. All Rights Reserved. 2 This thesis titled Characterization of (+)-Catechin and Quercetin from Pawpaw Pulp by JINSOO AHN has been approved for the School of Applied Health Sciences and Wellness and the College of Health Sciences and Professions by Robert G. Brannan Assistant Professor of Applied Health Sciences and Wellness Randy Leite Interim Dean, College of Health Sciences and Professions 3 ABSTRACT AHN, JINSOO, M.S., June 2011, Human and Consumer Sciences, Food and Nutrition Characterization of (+)-Catechin and Quercetin from Pawpaw Pulp Director of Thesis: Robert G. Brannan This thesis investigates the concentration of total phenolics and total flavonoids in pulp extracts of pawpaw harvested in 2008, 2009, and 2010, and the concentration of (+)- catechin and quercetin flavonoids in 2010 pawpaw pulp extracts using high performance liquid chromatography (HPLC). Next, influence of frozen storage and air or vacuum packaging of pawpaw pulp on the concentration of (+)-catechin and quercetin flavonoids was examined. In addition, properties of pawpaw pulp such as moisture content, lipid content, percent sugar, color, and pH were measured. Total phenolics were determined using the Folin-Ciocalteu assay and reported as µmol gallic acid equivalent (GAE)/ g wet tissue. The concentration was observed in the order of 2009 sample (3.91 ± 1.61) < 2008 sample (11.19 ± 0.57) < 2010 sample (14.11 ± 1.90).
    [Show full text]
  • A New Coumestan Glucoside from Eclipta Prostrata
    Natural Product Sciences 26(4) : 289-294 (2020) https://doi.org/10.20307/nps.2020.26.4.289 A New Coumestan Glucoside from Eclipta prostrata Young Ju Seo†, Hyun Woo Kil†, Taewoong Rho, and Kee Dong Yoon* College of Pharmacy and Integrated Research Institute of Pharmaceutical Sciences, The Catholic University of Korea, Bucheon-si, Gyeonggi-do 14662, Korea Abstract Eclipta prostrata is an annual herb, belonging to Asteraceae family, and has been traditionally used to improve immunity and treat hepatitis and bacterial disease in Korea. In this study, a new coumestan glucoside (1) along with ten known compounds (2 – 11) was isolated from E. prostrata. The chemical structures of isolates were elucidated to be wedelolactone-9-O--D-glucopyranoside (1), wedelolactone (2), demethylwedelolactone (3), apigenin (4), apigenin-7-sulfate (5), luteolin (6), luteolin-7-sulfate (7), luteolin-7-O--D-glucopyranoside (8), pratensein-7-O--D-glucopyranoside (9), 3,4-di-O-caffeoylquinic acid (10) and 3,5-di-O-caffeoylquinic acid (11) based on the spectroscopic evidence. Keywords Eclipta prostrata, Asteraceae, Phenolic compounds, Wedelolactone-9-O--D-glucopyranoside Introduction infrared spectroscopy (FT-IR). Eclipta prostrata is an annual herb, belonging to Experimental Asteracea family, and distributed in the tropical and subtropical areas, especially Asia and Africa.1 Eclipta General experimental procedures – The preparative prostrata has been traditionally used to improve immunity HPLC was performed using a Gilson HPLC system and treat hepatitis and bacterial diseases in Korea.2 In (Middleton, WI, USA) composed of a binary pump, a India, E. prostrata has been used to treat body pain, fever, liquid handler, and a UV/Vis detector with a Luna C18(2) hair loss, jaundice, liver enlargement and skin diseases.3 (21.2 × 250 mm I.D., 5 μm, Phenomenex, Torrance, CA, Recent biological evidence revealed that the E.
    [Show full text]
  • This Article Was Originally Published in Hormones, Brain and Behavior 2Nd
    This article was originally published in Hormones, Brain and Behavior 2nd edition, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non- commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who you know, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial Gore A C and Crews D Environmental Endocrine Disruption of Brain and Behavior. In: Donald W. Pfaff, Arthur P. Arnold, Anne M. Etgen, Susan E. Fahrbach and Robert T. Rubin, editors. Hormones, Brain and Behavior, 2nd edition, Vol 3. San Diego: Academic Press; 2009. pp. 1789-1816. Author's personal copy 56 Environmental Endocrine Disruption of Brain and Behavior A C Gore and D Crews, University of Texas at Austin, Austin, TX, USA ß 2009 Elsevier Inc. All rights reserved. Chapter Outline 56.1 Introduction to Endocrine Disruption 1790 56.1.1 Critical Issues about Endocrine Disruption 1791 56.1.1.1 Life stage and timing 1791 56.1.1.2 Latency of effects 1791 56.1.1.3 Sensitivity to EDCs 1792 56.1.1.4 Degradation and metabolism,
    [Show full text]
  • Analysis of the Most Appropriate Risk Management Option (Rmoa) ______
    ANALYSIS OF THE MOST APPROPRIATE RISK MANAGEMENT OPTION (RMOA) _________________________________________________________________ Analysis of the most appropriate risk management option (RMOA) Substance Name: 2,6-di-tert-butyl-p-cresol EC Number: 204-881-4 CAS Number: 128-37-0 Authority: France Date: March 2016 Cover Note 2,6-di-tert-butyl-p-cresol (butylated hydroxytoluene (BHT)) belongs to the broad group of alkyl phenols and as alkyl phenol ethoxylates BHT is on the Danish EPA “List of Undesirable Substances” latest updated in 2009. The group was recently reviewed in a report: “Survey of alkyl phenols and alkyl phenol ethoxylates (Danish EPA 2012). The group includes substances that are hazardous to the environment and substances that have or may have endocrine disrupting effects. The substance is also listed in the Danish inventory of carcinogenic substances. BHT is included in the framework on the French national Strategy on Endocrine Disruptors (Stratégie Nationale sur les Perturbateurs Endocriniens or SNPE) in 2015. ANSES was commissioned by the French Competent Authority (Ministry of Ecology, Sustainable Development and Energy) and identified BHT as a good candidate for working further on its ED properties. Consequently, France initiated a RMOA on BHT, mainly focused on the ED properties of this substance. EC no 204-881-4 Anses (on behalf FR-MSCA) Page 1 sur 48 ANALYSIS OF THE MOST APPROPRIATE RISK MANAGEMENT OPTION (RMOA) _________________________________________________________________ Indeed, alerts on BHT come from different sources. BHT shares common uses with BHA, that was analysed within the framework of SNPE in 2014 and which has been identified numerous times as a potential endocrine disruptors: European Commission on Endocrine Disruption (EDC Database): Listed BHA as a Category 1 priority substance, based on evidence that it interferes with hormone function.
    [Show full text]
  • Supplementary Material Hydrogen-Rich Water-Alleviated
    10.1071/FP15204_AC © CSIRO 2015 Supplementary Material: Functional Plant Biology, 42(12), 1141–1157. Supplementary Material Hydrogen-rich water-alleviated ultraviolet-B-triggered oxidative damage is partially associated with the manipulation of the metabolism of (iso)flavonoids and antioxidant defence in Medicago sativa Yanjie XieA, Wei ZhangA, Xingliang DuanA, Chen DaiA, Yihua ZhangA, Weiti CuiA, Ren WangB and Wenbiao ShenA,C ACollege of Life Sciences, Laboratory Center of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. BInstitute of Botany, Jiangsu Province and the Chinese Academy of Sciences, Nanjing 210014, China. CCorresponding author. Email: [email protected] 1 Table S1. The sequences of primers for real-time RT-PCR M. truncatula tentative consensus Primer name or accession number Sequences Forward: CTTGATGAGGTGAAGCGTAT PAL X58180 Reverse: ACCGTAACTGTCCGTGCC Forward: TGTTTGTGAATACATGGCACCTT CHS AW776018 Reverse: TGACTTTGGTTGACCCCATTCT Forward: TACTTGAGACCCTTGACTT CHI KF765782 Reverse: GGTGATTGCCTGTAGAAA Forward: CTTGATGAGGTGAAGCGTAT FLS XM_003601032 Reverse: ACCGTAACTGTCCGTGCC Forward: AATGGAGAAATCATAGAGGGCGAGCAG IFS AY167424 Reverse: GTTGATGAGCTCTGCCAAAGTCCATTC Forward: ACATGGAAAGCCTATGACTGTTC 6IOMT DQ419913 Reverse: ACACAACTCCAGTCCCACCTG Forward: TAATTGCTGATGCCAACG Cu/Zn-SOD AF056621 Reverse: ACCACAGGCTAATC TTCCAC Forward: TGTCATCAGCG GCGTA ATCAT Mn-SOD AY145894 Reverse: GGGCTTCCTTTGGTGGTTCA Forward: TCAATCGTACGTGGTGTGCT POD 1A X90692 Reverse: TGCACTTTGCTCGCTCACTA Forward: AGCTGCATTTGCTGCTCAAG POD 1B X90693
    [Show full text]
  • Molecular Docking Study on Several Benzoic Acid Derivatives Against SARS-Cov-2
    molecules Article Molecular Docking Study on Several Benzoic Acid Derivatives against SARS-CoV-2 Amalia Stefaniu *, Lucia Pirvu * , Bujor Albu and Lucia Pintilie National Institute for Chemical-Pharmaceutical Research and Development, 112 Vitan Av., 031299 Bucharest, Romania; [email protected] (B.A.); [email protected] (L.P.) * Correspondence: [email protected] (A.S.); [email protected] (L.P.) Academic Editors: Giovanni Ribaudo and Laura Orian Received: 15 November 2020; Accepted: 1 December 2020; Published: 10 December 2020 Abstract: Several derivatives of benzoic acid and semisynthetic alkyl gallates were investigated by an in silico approach to evaluate their potential antiviral activity against SARS-CoV-2 main protease. Molecular docking studies were used to predict their binding affinity and interactions with amino acids residues from the active binding site of SARS-CoV-2 main protease, compared to boceprevir. Deep structural insights and quantum chemical reactivity analysis according to Koopmans’ theorem, as a result of density functional theory (DFT) computations, are reported. Additionally, drug-likeness assessment in terms of Lipinski’s and Weber’s rules for pharmaceutical candidates, is provided. The outcomes of docking and key molecular descriptors and properties were forward analyzed by the statistical approach of principal component analysis (PCA) to identify the degree of their correlation. The obtained results suggest two promising candidates for future drug development to fight against the coronavirus infection. Keywords: SARS-CoV-2; benzoic acid derivatives; gallic acid; molecular docking; reactivity parameters 1. Introduction Severe acute respiratory syndrome coronavirus 2 is an international health matter. Previously unheard research efforts to discover specific treatments are in progress worldwide.
    [Show full text]
  • Propyl Gallate
    PROPYL GALLATE Prepared at the 46th JECFA (1996), published in FNP 52 Add 4 (1996) superseding specifications prepared at the 41st JECFA (1993), published in FNP 52 Add 2 (1993). Metals and arsenic specifications revised at the 61st JECFA (2003). An ADI of 0-1.4 mg/kg bw was established at the 46th JECFA (1996) SYNONYMS INS No. 310 DEFINITION Chemical names Propyl gallate, propyl ester of gallic acid, n-propyl ester of 3,4,5- trihydroxybenzoic acid, propyl 3,4,5-trihydroxybenzoate C.A.S. number 121-79-9 Chemical formula C10H12O5 Structural formula Formula weight 212.20 Assay Not less than 98.0% and not more than 102.0% on the dried basis DESCRIPTION White or creamy-white, crystalline odourless solid FUNCTIONAL USES Antioxidant CHARACTERISTICS IDENTIFICATION Solubility (Vol. 4) Slightly soluble in water; freely soluble in ethanol, ether and propane-1,2- diol Melting range (Vol. 4) 146 - 150o after drying Gallic acid Dissolve about 0.5 g of the sample in 10 ml of sodium hydroxide TS and boil for 30 min under nitrogen. Maintaining a stream of nitrogen, cool the mixture and acidify to pH 2-3 with sulfuric acid TS. Filter the precipitate through a sintered glass crucible, wash with a minimum amount of water and then dry at 110ºfor 2 h. The melting point of the gallic acid so obtained is about 240º, with decomposition. TLC-separation of gallate Use a thin-layer plate prepared with silica gel G. Prepare a sample solution esters by dissolving 10 mg of sample in 10 ml ethanol.
    [Show full text]
  • Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species
    Molecules 2014, 19, 3883-3897; doi:10.3390/molecules19043883 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species Eerdunbayaer 1, Mohamed A. A. Orabi 1,2, Hiroe Aoyama 1, Teruo Kuroda 3 and Tsutomu Hatano 1,* 1 Department of Natural Product Chemistry, Okayama University, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mails: [email protected] (E.); [email protected] (M.A.A.O.); [email protected] (H.A.) 2 Faculty of Pharmacy, Al-Azhar University, Assiut 71524, Egypt 3 Drug Discovery Technology Center, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +81-86-251-7936; Fax: +81-86-251-7926. Received: 28 February 2014; in revised form: 17 March 2014 / Accepted: 21 March 2014 / Published: 28 March 2014 Abstract: Since our previous study revealed that several licorice phenolics have antibacterial effects on methicillin-resistant Staphylococcus aureus (MRSA), and suppressive effects on the oxacillin resistance of MRSA, we further investigated effectiveness of licorice constituents on vancomycin-resistant Enterococcus (VRE) bacteria, and purified 32 phenolic compounds. Two flavonoids among them were characterized structurally, and identified their structures as demethylglycyrol (31) and 5,7-di-O-methylluteone (32), respectively. Examination of antibacterial effects of licorice phenolics showed that 3-arylcoumarins such as licoarylcoumarin (9) and glycycoumarin (26), and 2-arylcoumarones such as gancaonin I (17), have moderate to potent antibacterial effects on the VRE strains used in this study.
    [Show full text]
  • Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza Glabra L., Paeonia Lactiflora Pall., and Eriobotrya Japonica (Thunb.) Lindl
    Medicines 2019, 6, 43; doi:10.3390/medicines6020043 S1 of S35 Supplementary Materials: Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza glabra L., Paeonia lactiflora Pall., and Eriobotrya japonica (Thunb.) Lindl. Extracts Jun-Xian Zhou, Markus Santhosh Braun, Pille Wetterauer, Bernhard Wetterauer and Michael Wink T r o lo x G a llic a c id F e S O 0 .6 4 1 .5 2 .0 e e c c 0 .4 1 .5 1 .0 e n n c a a n b b a r r b o o r 1 .0 s s o b b 0 .2 s 0 .5 b A A A 0 .5 0 .0 0 .0 0 .0 0 5 1 0 1 5 2 0 2 5 0 5 0 1 0 0 1 5 0 2 0 0 0 1 0 2 0 3 0 4 0 5 0 C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( g /m l) Figure S1. The standard curves in the TEAC, FRAP and Folin-Ciocateu assays shown as absorption vs. concentration. Results are expressed as the mean ± SD from at least three independent experiments. Table S1. Secondary metabolites in Glycyrrhiza glabra. Part Class Plant Secondary Metabolites References Root Glycyrrhizic acid 1-6 Glabric acid 7 Liquoric acid 8 Betulinic acid 9 18α-Glycyrrhetinic acid 2,3,5,10-12 Triterpenes 18β-Glycyrrhetinic acid Ammonium glycyrrhinate 10 Isoglabrolide 13 21α-Hydroxyisoglabrolide 13 Glabrolide 13 11-Deoxyglabrolide 13 Deoxyglabrolide 13 Glycyrrhetol 13 24-Hydroxyliquiritic acid 13 Liquiridiolic acid 13 28-Hydroxygiycyrrhetinic acid 13 18α-Hydroxyglycyrrhetinic acid 13 Olean-11,13(18)-dien-3β-ol-30-oic acid and 3β-acetoxy-30-methyl ester 13 Liquiritic acid 13 Olean-12-en-3β-ol-30-oic acid 13 24-Hydroxyglycyrrhetinic acid 13 11-Deoxyglycyrrhetinic acid 5,13 24-Hydroxy-11-deoxyglycyirhetinic
    [Show full text]
  • Phytoestrogens in Foods in the Nordic Market
    TemaNord 2017:541 Phytoestrogens in foods on the Nordic market the Nordic on foods in 2017:541 Phytoestrogens TemaNord Nordic Council of Ministers Nordens Hus Ved Stranden 18 DK-1061 Copenhagen K www.norden.org Phytoestrogens in foods on the Nordic market Phytoestrogens are plant-derived compounds that may bind to estrogen receptors, but with less affinity than the natural ligand estradiol. They may be biologically active as such or after metabolization in our body. To investigate the occurrence and level of phytoestrogens, scientific literature was screened for data on isoflavones, lignans, stilbenes and coumestans in raw and processed foods of plant origin. The review presents data based both on analytical methods hydrolysing glucosides and non-destructive methods. Many phytoestrogens are phytoalexins. Their production is induced when plants are exposed to abiotic and/or biotic stress. This could explain the rather different levels reported in plants by various investigators, and indicates that many samples are required to describe the levels generally occurring in foodstuffs. The influence of food processing was also considered. Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson TemaNord 2017:541 Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson ISBN 978-92-893-5046-4 (PRINT) ISBN 978-92-893-5047-1 (PDF) ISBN 978-92-893-5048-8 (EPUB) http://dx.doi.org/10.6027/TN2017-541 TemaNord 2017:541 ISSN 0908-6692 Standard: PDF/UA-1 ISO 14289-1 © Nordic Council of Ministers 2017 Cover photo: Unsplash.com Print: Rosendahls Printed in Denmark Although the Nordic Council of Ministers funded this publication, the contents do not necessarily reflect its views, policies or recommendations.
    [Show full text]
  • Supporting Document 1
    Supporting document 1 Safety assessment – Application A1085 Food derived from Reduced Lignin Lucerne Line KK179 Summary and conclusions Background A genetically modified (GM) lucerne line, KK179, has been developed that has reduced biosynthesis of guaiacyl lignin (G lignin), a major subunit of lignin. Lignin is a non- carbohydrate phenolic polymer deposited in plant cell walls, particularly in the vascular tissue, and is a contributor to the quality of forage eaten by grazing animals. The Applicants claim that growers will have the option of being able to harvest KK179 several days later than conventional lucerne without appreciable loss of forage quality typical in conventional lucerne at the same growth stage. The reduced level of lignin in lucerne KK179 has been achieved through the introduction of a partial caffeoyl CoA 3-O-methyltransferase (CCOMT) gene sequence derived from lucerne (Medicago sativa). The gene transcript acts, via suppression of the endogenous CCOMT gene, to reduce the lignin level. It is not intended that KK179 enter the food supply. However, a food approval is sought in case this inadvertently occurs. In conducting a safety assessment of food derived from lucerne line KK179, a number of criteria have been addressed including: a characterisation of the transferred genetic material and its origin, function and stability in the lucerne genome; compositional analyses; and evaluation of intended and unintended changes. This safety assessment report addresses only food safety and nutritional issues associated with the GM line. It therefore does not address: environmental risks related to the environmental release of GM plants used in food production the safety of animal feed or animals fed with feed derived from GM plants the safety per se of food derived from the non-GM (conventional) plant.
    [Show full text]