The Genome of the the I Human Transposable Repetitive Elements Is Composed of a Basic Motif Homologous to an Ancestral Immunoglobulin Gene Sequence I

Home , Transposable element

Proc. Natl. Acad. Sci. USA Vol. 91, pp. 7967-7969, August 1994 Immunology The genome of the THE I human transposable repetitive elements is composed of a basic motif homologous to an ancestral immunoglobulin gene sequence I. HAKIM*t, N. AMARIGLIO*, Z. GROSSMAN*, F. SIMONI-BROK*, S. OHNOI, AND G. RECHAVI* *Institute of Hematology, The Chaim Sheba Medical Center, 52621 Tel-Hashomer, and Sackler School of Medicine, Tel Aviv University, Tel Aviv 69978, Israel; and tBeckman Research Institute of the City of Hope, Duarte, CA 91010 Contributed by S. Ohno, April 18, 1994

ABSTRACT Amplification of rearranged human immu- MgCl2, and 2.5 units of Taq DNA polymerase. Final primer noglobulin heavy-chain genes using the polymerase chain re- concentration was 1 ,uM. The reaction was subjected to 35 action resulted unexpectedly in the amplification of human cycles ofamplification in a Perkin-Elmer thermocycler. Each transposable repetitive element genomes. These were identified cycle consisted of denaturation at 940C for 1 min, annealing as members of the THE I (transposon-like human element I) at 50'C for 2 min, and extension at 720C for 3 min. transposable element fanily. Analysis of the THE I sequences The PCR products were separated by electrophoresis in a revealed the presence ofseveral copies ofthe ancestral bung 2% agarose gel and transferred onto a nitrocellulose filter. block described >10 years ago by Ohno and coworkers as the The VH5.2 synthetic oligonucleotide 5'-CTGGGTTGCGC- primordial immunoglobulin sequence. The frequency and de- CAGATGCCCGGGAAAGG-3' (15) was used as a probe for gree of homology of the repeats of the basic unit were similar hybridization after end-labeling with T4 polynucleotide ki- for the two genes, as well as for two murine intracisternal A nase. particles. These findings uggest that both the transposable Amplified bands were eluted from the gel and ligated into genetic elements and the immunglobulin genes originated the Sma I site of plasmid pUC18 (New England Biolabs). from a common ancestral building block. Clones which hybridized with the VH5.2 probe were sequenced with a Sequenase kit (United States Biochemical). The genes encoding the immunoglobulin chains constitute a DNA sequencing data were analyzed with the Genetics very sophisticated and unique system. For the production of Computer Group (University of Wisconsin) software pack- afunctional gene, extensive DNA rearrangements are carried age and a micro-VAX computer. out during the differentiation ofany specific B lymphocyte (1, 2). In the human immunoglobulin heavy-chain genes, for RESULTS example, one of several hundred VH gene segments is re- PCR performed on 38 total genomic DNA samples extracted combined with one of about thirty DH and one out of six JH from chronic lymphocytic leukemia cells, using the immu- gene segments. The resulting rearranged gene encodes the noglobulin heavy-chain VH- and JH-specific oligonucleotide variable part ofthe heavy chain. Further DNA rearrangement primers (VHS.1 and JH4, respectively) resulted in some cases events occur during heavy-chain class switch (3, 4). The in amplification of two discrete bands: the expected 230- to unusual ability of immunoglobulin gene segments to move 250-bp rearranged immunoglobulin gene and an additional, and rearrange is similar to that of the transposable repetitive unexpected 500-bp sequence. Hybridization of the PCR genetic elements that constitute a significant portion of the products with an internal oligonucleotide probe (VHS.2) mammalian genome (5, 6). corresponding to immunoglobulin heavy-chain VHS 3' se- We have recently used the polymerase chain reaction for quences revealed that both the expected immunoglobulin- the characterization of rearranged immunoglobulin heavy- specific band and the additional band gave a positive signal chain genes in chronic lymphocytic leukemia cells. JH- and (Fig. 1). VH-specific oligonucleotides were used for the amplification The amplified sequences were eluted from the agarose gel and hybridization reactions. In addition to the expected and cloned into pUC18 vector and sequenced. Cloned se- immunoglobulin genes, amplification of human transposable quences carrying the 230- to 250-bp segment were found to element sequences (THE I) was frequently demonstrated represent rearranged immunoglobulin heavy-chain se- (7-9). Analysis of THE I sequences has revealed that these quences. The cloned 500-bp fragment was found to contain repetitive elements contain multiple repetitions of the basic non-immunoglobulin-related sequences. Computer search ancestral sequence described by Ohno et al. (10-13) as the revealed that these sequences bear a very significant homol- primordial immunoglobulin sequence. ogy with the published sequences of the THE I human transposable repetitive elements (7-9) (Fig. 2). Three differ- MATERIALS AND METHODS ent THE I-related versions were characterized and one of them appears in Fig. 2. Rearranged immunoglobulin genes were amplified from 1 utg Two different VH-specific oligonucleotides (the primer of leukemia cell DNA as described (14) using the primers: used for the PCR and the hybridization probe) were found VHS.1 (5'-GGAGCCCCTGATTCAAATTTTGTGTCTC- to hybridize with THE I sequences. Having in mind the CCCC-3') (15) and JH4 (5'-CGGTGACCAGGGTTCCTTG- publications indicating that the sequences coding for the GCCCCAGTAGTCAAAGTAGT-3') (16). PCR was per- immunoglobulin heavy-chain variable regions apparently formed in a 100-Al reaction mixture containing 250 ,uM arose as repeats of prototype building blocks, we searched dNTPs, 10 mM Tris'HCl (pH 8.8), 50 mM KCI, 1.5 mM the THE I sequences for short blocks similar to those

The publication costs of this article were defrayed in part by page charge Abbreviation: IAP, intracisternal A particle. payment. This article must therefore be hereby marked "advertisement" *Present address: Department of Oncology, Stanford University, in accordance with 18 U.S.C. §1734 solely to indicate this fact. Stanford, CA 94305.

7967 Downloaded by guest on September 29, 2021 7968 Immunology: Hakim et al. Proc. Natl. Acad. Sci. USA 91 (1994)

1 2 3 !X22AGPC AACAa 2PtrA.W-7 r - .5 - - 7~~~~~~~~~2

ITI'J~T~Lrrr-T1 rxTw: 4ER,.11. 'all IEPCJV--Y' CR '-!i7:ALA-D'%-."- 24C 500bp > 173112.1 fA:- 3 " IMT7 kk-,TA --ci LTW, M&ZM= 3 F.". 250bp * ".. - a2.=1Zrl -.,

FIG. 1. Hybridization of the VH5.2 oligonucleotide probe with JAAA'7C2A:7% - --. -~d -'4 PCR products obtained by using the VH5.1 and JH4 primers to amplify a human chronic lymphocytic leukemia genomic DNA sample. described by Ohno et al. (10-13) in the immunoglobulin VH gene. When the THE I sequences were analyzed for the 84j presence of motifs homologous to the 21-base prototype ~~~~ I .-_-- ]~-g sequence ACTGGATATGACCTGGAGTGG, 29 sites ex- 7- . ,g;. were hibiting >48% (10 out of21 bases) sequence homology ffirffifro~j~~::AAP A '-DtLCA~~7: AOCtXIWM2 G&TPA2M=M 902 found (Fig. 3). The frequency and homology of the repeats of the 21-base prototype sequence in the THE I sequences are similar to those found in an immunoglobulin VH sequence (Fig. 4), a 405-bp segment of the VHS gene starting at the acceptor site ofthe RNA splicing position (15). Table -~ P Baja~~~~72A2...... =7P~A~2AC777iA7.ALG- 1 summarizes the representation of the basic repeat unit in DINGIT Bait =2;2T;-MAdz~~~~~~~~~~'t":~A 2; both immunoglobulin and THE I sequences as a function of the degree of homology. @ 1 B e A = ;54L,~~~~~~~~~~~~~~~26 A comparison of the sequence of another abundant trans- AAnti-a.H,,asT, -,,---- or~ posable element, the murine intracisternal A particle (IAP), revealed a pattern similar to the one identified in the THE I sot.A.qaIsPP - -- .>- <' C9T , ZM'Y =-, o rlo element. Two distinct IAP elements, a 1071-bp type I 1AP (18) and a 1419-bp type II IAP (19), both contained exactly the same frequency of repeats of the basic prototype unit, with I - AAO. 7 _ _ _J. _ _. - .- 24 kx I :: .44: 48% homology as the THE I element (Table 2). 152,0 The evolution of DNA sequences from a basic unit can be rATA the result oftandem duplications ofthe basic motif as well as ~~a cn..mcA:7mv:^. Y ofthe motif's inverted repeat. Both the basic 21-base unit and !623 its inverted repeat version were located in the THE I and immunoglobulin sequences. Of the 1844 bp in the THE I element, 1111 bp were found to represent ancestral unit- :aXWICI-AC:A X7C27W CCAT---,--AA,-jA rA7rrYr= U.i!.[;;I 17`c related sequences (60%). Of the 405 bp in the VH5 sequence, 300 bp were found to be related to the ancestral unit. A0V0A-am I. i AL. .>.w_ - JAn -r By3 TrAPEDcAr A TIF s 1130 THE1 ATGACCTAGA TGTGAGACGT TGG ...... AGTCAAA GGAGATAATT p101 G-----A... -G-TT.-C- ---CCCCAGT------T--T-C--- FIG. 3. Complete sequence ofthe THE I element. The sequences homologous to the basic building block (ACTGGATATGACCTG- THE1 GGAGATAATT TTTGAACTTT AAAATTTGAC TGCCCTGATG GATTTGCAAC GAGTGG) and its inverted version (CCACTCCAGGTCATATC- p101 -T--T-C--- --G--G------G------CAC-- -C---TGG-- CAGT) are enclosed in boxes. Numbers refer to the published THE THE1 TTGGCTTGAA GCCTGTACTC CCTTTGTTTT GGCCAATTTC TCTCTTTTGG I sequence (17). p1l0 --.T-A--GG C------AC------A----- THE1 AACACTGTAT ATTTACCTAA TGACTGT..GCC CATTGTATCT AGGAAGCTAA DISCUSSION p101 ---.GGC-G------C------GA----ACC-- G------The application of the PCR for the amplification of a specific THE1 CCAACTAGTT TTGATTTTAC ATGCTCATAG GCTGAAGGGA CTTGCCTTGT p101 -T-G--T-C------T -G------A------gene segment results frequently in the amplification of additional, unexpected "nonspecific" sequences (20). We noted THE1 CTCAGATGAG ACTTTGAACT ATGGACTTTT GAGTTAATGC TGAAATGAGT p101 -----G------G--- G------C AG------A------T--- a consistent amplification of THE I sequences when immu- THE1 TAAGACTTCG AG.GGCTGTTG GGAAGGCCAT GATTGGTCTT GAAATGTGAG noglobulin heavy-chain VH and JH gene segment-specific p101 ------T- G-A-A ------T------oligonucleotides were used as primers in the PCR. The THE1 GATATGAGAC TTAGGGGGCC CAGGGGTAGA ATGATATGGT TTGGCTTGAT amplified THE I segments hybridized specifically with an plO1 --C------T --G-A---G -..------GTG- internal 3' VH oligonucleotide probe. Therefore, three dif- THE1 CCCCACCTAA ATCTCATCTT GAATTGTAGC TCCCATAATC CCACATGTTG ferent regions of the THE I genome demonstrated a signifi- p101 ------C------A------T------G---- -T-TG----- cant sequence homology with three different immunoglobulin THE1 TGGGAGGGAG CTAGTGGGAG .....GTAATTGAAT CATGGAGGTG heavy-chain variable-region sequences. p101 ------GC -C--G----- ACACAAA-T------G--GCTCC Over ten years ago it was suggested by Ohno et al. (10-13) VHS. 1 that the coding sequence for the 97-amino acid immunoglob- FIG. 2. Comparison of the 500-bp amplified segment (p101) and ulin heavy-chain variable (VH) regions of the mouse appar- the published THE I sequence (17). The sequences corresponding to ently arose as repeats of two short, 21-base and 14- to the amplification primers are underlined. 15-base, prototype building blocks. Copies demonstrating Downloaded by guest on September 29, 2021 Immunology: Hakim et al. Proc. Natl. Acad. Sci. USA 91 (1994) 7969

GAGTCTGTGC CGAGGTGCCTI iQTUGAU ! UlUGAGUAUA GGTAA Table 2. Comparison of the degree of homology in the representation of the basic building block between the 51 qCCGGGGAGT CTCTGAAGAT CTCCTGTAAG GGTCTGGAT ACAGCTTTA 1844-bp THE I element and two murine IAP elements, 101 Cd[ACTGG CCGGCTGGG TGCGCCAGAT GCCCGGGAAA GGCTTGGAGTI as a function of the number of mismatches 151 tGATGGGGAT CAT"T TOOT GGAO G ATACCAGATA CAGCCCGTCC No. of Percent No. of basic repeat units mismatches homology THE-1 IAP 1 IAP 2 201 ITCCAAGGCC AGGTCACCATCTCA CCGAC AAGTCCTCA GCACCGCCTA 11 48 29 16 20 251 qCTGCAGTGG tGCAGCCTGA AGGCCTCGGACACCGCCATO TATA 10 52 12 5 16 9 57 6 6 6 301 (GAGACTGGA GGGG GTGGA TAqACTGGCT ATGCCCTCA7ITA7I T IAP I is 1071 bp long and IAP II is 1419 bp long. 351 GACTACTG3 G CCAAGGAAC CCTGGTCACC GTCTCCTCAGC GIAAGPATGG fication of the prototype sequence is not restricted to this 401 CCTCT particular transposable element but was also demonstrated in the murine IAPs. This indicates that the prototype sequences FIG. 4. Sequence of a rearranged VHS gene (15). The sequences homologous to the basic building block (ACTGGATATGACCTG- existed in the common mammalian ancestor. GAGTGG) and its inverted version (CCACTCCAGGTCATATC- Two hypotheses can be suggested based on these findings: CAGT) are enclosed in boxes. (i) the same basic motif served as a common building block for both genes, and they diversified during evolution, and (ii) >57.2% (12 out of21) base sequence homology to the 21-base the ancestral unit formed the basis of the repetitive element prototype sequence ACTGGATATGACCTGGAGTGG whose evolution led to the development of immunoglobulin were invariably found to occupy three fixed positions within genes. The second hypothesis can offer an explanation for the the 5' half of all VH coding sequences examined. Additional ability of immunoglobulin gene to transpose and rearrange, copies may be found in the 3' half of some, but not all, of the which is one ofthe mechanisms for the generation ofantibody VH coding sequences. It was speculated that this prototype diversity. sequence originally contributed to the entire length of immunoglobulin coding sequences. Yet its recognizable copies are 1. Leder, P. (1982) Sci. Am. 246, 102-115. found neither in adjacent noncoding sequences nor in atten- 2. Tonegawa, S. (1983) Nature (London) 302, 575-581. dant hydrophobic leader coding sequences of the published 3. Ravetch, J. V., Kirsch, I. R. & Leder, P. (1980) Proc. Natl. immunoglobulin VH DNA sequences examined. The 14- to Acad. Sci. USA 77, 6734-6738. 15-base prototype building block, by contrast, was found to 4. Davis, M. M., Kim, S. K. & Hood L. E. (1980) Science 209, be quite free-wheeling. Several recognizable copies demon- 1360-1365. strating >60% base sequence homology to this shorter pro- 5. Amariglio, N. & Rechavi, G. (1993) Environ. Mol. Mutagen. 21, totype building block are found scattered in coding as well as 212-218. in adjacent noncoding sequences. It was further suggested 6. Singer, M. F. (1982) Cell 28, 433-434. that variable regions of immunoglobulin light and heavy 7. Paulson, K. E., Deka, N., Schmid, C. W., Misra, R., Schind- chains were originally encoded by two complementary ler, C. W., Rush, M. G., Kadyk, L. & Leinwand, L. (1985) strands of the same dou- Nature (London) 316, 359-361 sequence. Accordingly, prototype 8. Deka, N., Willard, C. R., Wong, E. & Schmid, C. W. (1988) ble-stranded DNA simultaneously is an ancestor for both Nucleic Acids Res. 16, 1143-1151. light- and heavy-chain genes. 9. Deka, N., Wong, E., Matera A. G., Kraft, R., Leinwand, L. A. The unexpected homology of three different regions of & Schmid C. W. (1988) Gene 71, 123-134. immunoglobulin heavy-chain variable-region gene sequences 10. Ohno, S., Kato, K., Hozumi, T. & Matsunaga (1982) Proc. and the THE I repetitive element sequences led us to the Natl. Acad. Sci. USA 79, 132-136. search for the presence ofthe immunoglobulin-specific motif 11. Ohno, S. & Matsunaga, T. (1982) Proc. Natl. Acad. Sci. USA in the THE I sequences. As depicted in Fig. 3 and Table 1, 79, 2338-2341. great similarity was found in both the number of repetitions 12. Ohno, S. Matsunaga, T. & Wallace, R. B. (1982) Proc. Natl. and the degree ofhomology between the immunoglobulin VH Acad. Sci. USA 79, 1999-2002. sequences and the THE I sequences. Moreover, the identi- 13. Ohno, S. & Yazaki, A. (1983) Proc. Natl. Acad. Sci. USA 80, 2337-2340. Table 1. Comparison of the degree of homology in the 14. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, representation of the basic building block between the R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science 1844-bp THE I element and the 405-bp VH5 sequence, 239, 487-491. as a function of the number of mismatches 15. Shen, A., Humphries, C., Tucker, P. & Blattner, F. (1987) Proc. Natl. Acad. Sci. USA 84, 8563-8567. No. of basic 16. Ravetch, J. V., Sienblist, U., Korsmeyer, S., Waldmann, T. A. No of repeat units & Leder, P. (1981) Cell 27, 583-591. Percent 17. Misra, R., Shih, A. & Rush, M. (1987) J. Mol. Biol. 196, mismatches homology THE-1 VH5 233-243. 11 48 29 8 18. Lueders, K. K., Grossman, Z. & Fewell, J. W. (1989) Nucleic 10 52 12 3 Acids Res. 17, 9267-9277. 9 57 6 2 19. Lueders, K. K. & Mietz, J. A. (1986) Nucleic Acids Res. 14, 8 62 1 1495-1510. 20. Ehrlich, H. A., Gelfand, D. & Sninsky, J. J. (1991) Science 252, 7 67 1 1643-1651. Downloaded by guest on September 29, 2021