Porcine Epidemic Diarrhea Virus Induces Vero Cell Apoptosis Via the P53-PUMA Signaling Pathway

viruses

Article Porcine Epidemic Diarrhea Virus Induces Vero Cell Apoptosis via the p53-PUMA Signaling Pathway

Lin Yang 1, Chenyu Wang 1, Jinqi Shu 1, Huapeng Feng 1, Yulong He 1, Jian Chen 1 and Jianhong Shu 1,2,*

1 College of Life Sciences and Medicine, Zhejiang Sci-Tech University, Hangzhou 310018, China; [email protected] (L.Y.); [email protected] (C.W.); [email protected] (J.S.); [email protected] (H.F.); [email protected] (Y.H.); [email protected] (J.C.) 2 Shaoxing Biomedical Research Institute, Zhejiang Sci-Tech University, Shaoxing 312000, China * Correspondence: [email protected]

Abstract: Porcine Epidemic Diarrhea Virus (PEDV) is the causative agent of swine epidemic diarrhea. In order to study the pathogenic mechanism of PEDV, PEDV was inoculated into Vero cells cultured in vitro, and the total RNA of Vero cells was extracted to construct a library for Illumina high- throughput sequencing and screening of differentially expressed genes (p < 0.05). Five differentially expressed genes for qRT-PCR verification analysis were randomly selected, and the verification results were consistent with the transcriptome sequencing results. The Kyoto Encyclopedia of Genes and Genomes (KEGG) signal pathway enrichment analysis was performed on the differentially expressed genes screened above. The results showed that the target gene annotations of differentially expressed genes in the African green monkey genome were mainly enriched in the TNF signaling pathway, the P53 signaling pathway, the Jak-STAT signaling pathway, the MAPK signaling pathway, and immune inflammation. In addition, it has been reported that Puma can promote apoptosis and is a key mediator of P53-dependent and non-dependent apoptosis pathways. However, there is no report Citation: Yang, L.; Wang, C.; Shu, J.; that PEDV infection can activate Puma and induce apoptosis in a P53-dependent pathway. It was Feng, H.; He, Y.; Chen, J.; Shu, J. Porcine Epidemic Diarrhea Virus found by flow cytometry that PEDV infection induced apoptosis, and by Western Blotting detection, Induces Vero Cell Apoptosis via the PEDV infection significantly increased the expression of p53, BAX, and Puma apoptosis-related p53-PUMA Signaling Pathway. proteins. Treatment Vero cells with the p53 inhibitor, PFT-α, could significantly inhibit PEDV-induced Viruses 2021, 13, 1218. https:// apoptosis. Studies have shown that PEDV infection can activate Puma and induce apoptosis in a doi.org/10.3390/v13071218 P53-dependent pathway. These findings provide data support for further elucidating the pathogenic mechanism of PEDV and developing an effective vaccine against PEDV. Academic Editors: Chao-Nan Lin and Peck Toung Ooi Keywords: porcine epidemic diarrhea virus; transcriptome sequencing; P53 signaling pathway; Puma; BAX/Bcl-2; Apoptosis Received: 10 May 2021 Accepted: 15 June 2021 Published: 24 June 2021 1. Introduction Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in PEDV belongs to the genus Nidovirales, Coronaviridae, Alpha Coronavirus, and published maps and institutional affil- is the causative agent of swine epidemic diarrhea [1,2]. PEDV infection mainly causes iations. severe diarrhea, vomiting, and dehydration in pigs, resulting in extremely high mortality. The mortality rate of piglets within 6 days of being infected by PEDV is up to 100% [3,4]. Since the disease first broke out in the United Kingdom in 1971, it has been endemic in many countries including Asia and Europe [5]. At present, PEDV has broken through the regional spread and spread across the world, resulting in tremendous economic loss for Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. global pig industry [3]. There is no effective control method for PEDV [6]. Therefore, the This article is an open access article basic research on the pathogenic mechanism of PEDV is significantly important. There distributed under the terms and have been a large number of reports about PEDV infecting Vero cells in vitro [7,8], such as conditions of the Creative Commons transcriptome [9], proteome [10], etc., but the study on repeating sequence analysis of Vero Attribution (CC BY) license (https:// cells after PEDV infection at different times has not been reported. In this study, Illumina creativecommons.org/licenses/by/ transcriptome sequencing technology was used to analyze Vero cells at different times after 4.0/). PEDV infection. The data based on transcriptome sequencing technology can be used to

Viruses 2021, 13, 1218. https://doi.org/10.3390/v13071218 https://www.mdpi.com/journal/viruses Viruses 2021, 13, 1218 2 of 16

explore differentially expressed genes and related regulatory signaling pathways involved in PEDV infection after Vero cells, which contribute to investigating the pathogenesis of PEDV and providing data for vaccine development. The tumor-suppressor protein 53 (p53) is a sequence-specific DNA-binding protein that plays the role of a transcription factor to regulate cellular processes such as cell cycle arrest, senescence, and apoptosis [11]. Studies have reported that the H3N2 canine influenza virus that infects MDCK cells and the novel H7N9 influenza A virus that infects A549 cells can induce apoptosis by activating p53 [12,13]. Under normal circumstances, p53 can be stabilized at low levels, such as in MDM2, which acts as a ubiquitin ligase to assist p53 degradation, and these processes will change when cellular stress responds to external stimuli. Activated and phosphorylated p53 translocate to the nucleus to regulate transcription [14]. Puma is expressed at a low level in normal cells, but when the cells are stimulated in a stressed state, Puma is quickly transcribed and translated, resulting in increasing expression efficiently and promoting apoptosis [15]. This was also verified in the results of this transcriptome sequencing. The expression level of Puma in normal Vero cells was extremely low, but after PEDV infection for 24 h, the expression level of Puma significantly increased. Puma is a member of the BH3-only subfamily of the Bcl-2 family. Yu et al. [15] and Nakanoo et al. [16] analyzed gene expression profiles in two laboratories in 2001 and found that Puma is a target gene downstream of p53, it is p53-dependent, and is a key mediator dependent on the apoptosis pathway [16–18]. In this study, Illumina transcriptome sequencing technology was used to analyze Vero cells after PEDV infection at different times, and the differentially expressed genes and related regulatory signaling pathways involved in PEDV-infected Vero cells were screened. The transcriptome sequencing data showed that the expression level of p53 and Puma genes was significantly upregulated after being infected by PEDV for 24 h. It is speculated that PEDV infection may be induced by Puma and induce apoptosis in a p53-dependent pathway. The experiments have shown that PEDV infection can activate Puma and induce apoptosis in a P53-dependent pathway. These findings provide data support for further elucidating the pathogenic mechanism of PEDV and developing an effective vaccine against PEDV.

2. Materials and Methods 2.1. Cell Culture and PEDV Infection Vero cells and the porcine epidemic diarrhea virus are preserved by the College of Life Sciences and Medicine, Zhejiang Sci-Tech University. Vero cells were cultured in Dulbecco’s Modiﬁed Eagle Medium (DMEM; Gibco, Grand Island, NE, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco, Grand Island, NE, USA), 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA) at ◦ 37 C in a 5% CO2 atmosphere in an incubator. Vero cells infected with PEDV usually induce typical cytopathic effect (CPE). Vero cells were cultured in a 6-well cell culture plate. PEDV was inoculated in Vero at 0.5 MOI when the cells grew to 95% conﬂuence, then cultured for 12, 24, 36, and 48 h. The morphological changes of PEDV-infected Vero cells were observed to determine the sample conditions for transcriptome sequencing.

2.2. Total RNA Extraction and Quality Inspection of Vero Cell Total RNA was extracted by the Trizol reagent (Invitrogen, Carlsbad, CA, USA) on the basis of the manufacturer’s protocol. The concentration and purity of total RNA were assessed by Nanodrop (Thermo Fisher Scientiﬁc, Waltham, MA, USA), and the integrity of total RNA was detected by agarose gel electrophoresis.

2.3. cDNA Library Construction and High-Throughput Sequencing The total RNA of the three groups of 9 samples (uninfected with PEDV, infected with PEDV for 12 h, infected with PEDV for 24 h) was sent to Majorbio Technology Co., Ltd. Viruses 2021, 13, 1218 3 of 16

(Shanghai, China) for transcriptome sequencing analysis. First, the library construction was performed using the Illumina TruseqTM RNA sample prep Kit (Illumina, San Diego, CA, USA) method. After the library was qualiﬁed, 9 samples were sequenced by Illumina high-throughput sequencing technology.

2.4. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis KEGG enrichment analysis showed that CDKN1A, MDM2, FAS, CASP3, CDK1, puma, CCNB1, and other genes were enriched in the p53 signaling pathway. In order to conﬁrm the result of transcriptome sequencing, 5 genes with higher expression levels above were randomly selected for real-time quantitative PCR. The above ﬁve genes’ primers were designed by using Primer select software in DNAStar software and referring to the principle of designing qRT-PCR primers, as shown in Table1. β-actin was used as the house-keeping gene for internal normalization for qRT-PCR experiments. The designed primer sequences of the 6 groups of genes were sent to Sangon Biotech Co., Ltd. (Shanghai, China) for synthesis.

Table 1. Oligonucleotide primers used for RT-qPCR.

Primer Primer Sequence (50 to 30) β-actin F CTTCCTGGGTGAGTGGAGAC β-actin R GAAGGTAGTTTCATGGATGCC CDKN1A F CAGGAGGCTCGTGAACGATG CDKN1A R CCTGTGGGAAGGTAGAGCTTG CTPS1 F CAAGGAACGGAAAGGAGATTACTTGG CTPS1 R CACGGTTCCACCAAGCTCAATAAC SQSTM1 F CCTTCGGGCACCTGTCTGAG SQSTM1 R GATGGACCAGCAGCTGATTC TK1 F CCTTCGGGCACCTGTCTGAG TK1 R GATGGACCAGCAGCTGATTC

For RT-qPcR analysis, the Prime Script Reagent kit (Takara Bio, Inc., Otsu, Japan) was used for cDNA synthesis in a reverse transcription reaction. The standard sample reaction system is: 5 × PrimerScript Buffer (for Real Time) 4 µL; PrimerScript RT Enzyme Mix I 1 µL; RT Primer Mix 1 µL; total RNA 300 ng; and add RNase Free ddH2O to a total volume of 10 µL. The reaction was incubated at 37 ◦C for 15 min and at 85 ◦C for 5 s and then amplified by gene-specific primers for qPCR. The qPCR analysis was set up with SYBR Premix Ex Taq (Takara Bio, Inc., Otsu, Japan) and performed using the 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The qPCR reaction system is: SYBR®Premix Ex TaqTM II (2×) 10 µL; ROX Reference Dye II (50×) 0.4 µL; PCR Forward Primer (10 µM) 0.8 µL; PCR Reverse Primer (10 µM) 0.8 µL; cDNA 2.0 µL; and add RNase Free ddH2O to a total volume of 10 µL. After initial denaturation at 95 ◦C for 30 s, cDNA was amplified in 40 cycles. Amplification conditions were: 3 s of denaturation at 95 ◦C, 30 s of annealing at 60 ◦C, and 30 s of extension at 72 ◦C, followed by a final extension step at 72 ◦C for 10 min. The experimental data are analyzed using the 2−∆∆CT method, and β-actin was used as the house-keeping gene for internal normalization.

2.5. GO Function Annotation Analysis of Differentially Expressed Genes The differentially expressed genes were classiﬁed and annotated according to the biological process (BP), molecular function (MF), and cellular component (CC) by the GO database. Through GO annotation, we can understand the functional classiﬁcation of differentially expressed genes. Viruses 2021, 13, 1218 4 of 16

2.6. KEGG Enrichment Analysis of Differentially Expressed Genes R language was used to write script to analyze KEGG pathway enrichment of genes in the gene set. When the p value (p value_uncorrected) < 0.05, it was considered to be signiﬁcant.

2.7. Apoptotic Rate Measurement Cell apoptosis was measured according to the manufacturer’s protocol with the FITC Annexin V Apoptosis detection kit (Becton Dickinson Biosciences, Franklin Lakes, NJ, USA). Brieﬂy, cells were rinsed twice with PBS and re-suspended in 100 µL binding buffer, followed by the addition of 5 µL of Annexin V-FITC and 5 µL of PI. After incubation in the dark for 15 min at 37 ◦C, 400 µL of the binding buffer was added. Moreover, 10,000 cells were acquired, and a percentage of positive cells was analyzed by ﬂow cytometry (Bec- ton Dickinson).

2.8. Western Blotting Analysis The cells were washed twice with PBS, then treated with RIPA Lysis Buffer with 1 mM phenylmethanesulfonyl ﬂuoride (PMSF). Protein concentrations were measured by BCA Protein Assay Reagent. Equal quantities of the total protein (40 µg) were separated on a 12% SDS-PAGE gel at 120 V for 1 h. Subsequently, proteins were transferred to polyvinylidene diﬂuoride (PVDF) membranes (Millipore Corp., Atlanta, GA, USA) at 300 mA for 90 min at 4 ◦C. The membranes were blocked in Tris-buffered saline with 0.1% Tween 20 (TBST) containing 5% skimmed milk powder at room temperature for 2 h, and then incubated with the indicated primary antibodies dissolved in bovine serum albumin (BSA) overnight at 4 ◦C, followed by culturation with HRP-conjugated secondary antibodies at room temperature for 1 h. The signal was detected using the ECL reagent (GE Healthcare).

2.9. MTT Treatments Pifithrin-α can reversibly inhibit p53-dependent gene transcription activation, such as cyclin G, p21/waf1, and MDM2 protein. Pifithrin-α not only inhibits p53-mediated apoptosis induced by cytotoxins, but also inhibits p53-mediated cell apoptosis [19]. MTT assay was used to exclude the effect of PFT-α on cell activity (Roche Applied Science). Vero cells plated into 96-well plates, at around 90% confluence, were treated with a corresponding concentration of the inhibitor and incubated for 24 h, then 10 µL of MTT at a concentration of 5 mg/mL was added to each well and incubated at 37 ◦C for 4 h. Subsequently, 100 µL of DMSO was added and the absorbance at 490 nm was measured in a Micro plate reader.

2.10. Inhibitor Treatments Piﬁthrin-α (PFT-α) was stored as a 10 mM stock solution in DMSO and was diluted to the working concentration of 10 µM with the cell maintenance medium. When Vero cells were treated with PFT-α, the supernatant was discarded, washed 3 times with PBS, 1 mL of PFT-α was added to each well, and the negative control and blank control were set up, pretreated for 1 h, and then inoculated with 1 MOI of PEDV. After virus adsorption for 90 min, the virus solution was removed, washed twice with PBS, 1 mL of PFT-α was added, ◦ and it was placed in a 5% CO2 atmosphere at 37 C in an incubator for 24 h. Different treatments were carried out according to the needs of the experiment.

3. Results 3.1. PEDV Infection Induced the Pathological Effect of Vero Cells at Different Time Points Inverted ﬂuorescence microscopy was used to observe the cytopathic effect at 12, 24, 36, and 48 h after Vero cells were inoculated with PEDV (MOI = 0.5). It showed that the cells in the uninfected control group had no cytopathic effect. When infected with PEDV for 12 h, the cells showed little change compared with the uninfected group. After being infected with PEDV for 24 h, some cells presented severe pathological effects, but Viruses 2021, 13, x FOR PEER REVIEW 5 of 17

3. Results 3.1. PEDV Infection Induced the Pathological Effect of Vero Cells at Different Time Points Inverted fluorescence microscopy was used to observe the cytopathic effect at 12, 24, 36, and 48 h after Vero cells were inoculated with PEDV(MOI = 0.5). It showed that the cells in the uninfected control group had no cytopathic effect. When infected with PEDV for 12 h, the cells showed little change compared with the uninfected group. After being infected with PEDV for 24 h, some cells presented severe pathological effects, but the cells

Viruses 2021were, 13, 1218 not broken and shed. The cells infected with PEDV for 36 h presented a considerable5 of 16 pathological effect, and were also broken and shed. When infected for 48 h, 90% of Vero cells presented a pathological effect and were accompanied by cell breakage and shedding. Therefore, inthe this cells study, were notthe brokencell samples and shed. of Thethe cellsuninfect infecteded withcontrol PEDV group, for 36 the h presented 12 h a infected group, andconsiderable the 24 h infected pathological group effect, were and wereselected also brokenas analysis and shed. samples When infectedfor subse- for 48 h, quent transcriptome90% sequencing, of Vero cells presentedand the uninfected a pathological group effect andwas were used accompanied as the control. by cell breakage and shedding. Therefore, in this study, the cell samples of the uninfected control group, 3.2. Quality Test of Totalthe 12 RNA h infected group, and the 24 h infected group were selected as analysis samples for subsequent transcriptome sequencing, and the uninfected group was used as the control.

The concentration3.2. Quality and purity Test of Totalof the RNA extracted total RNA were detected by Nanodrop. The results showed thatThe the concentration concentration and purity of total of the RNA extracted extracted total RNA from were the detected three by sets Nanodrop. of samples to be sequencedThe results was showed ≥50 ng/μL, that the and concentration the OD of260/280 total RNA was extracted 1.8–2.2. from Gel the electropho- three sets of samples to be sequenced was ≥50 ng/µL, and the OD 260/280 was 1.8–2.2. Gel electrophoresis resis detection showed clear 28 S rRNA and 18 S rRNA bands, as shown in Figure 1. This detection showed clear 28 S rRNA and 18 S rRNA bands, as shown in Figure1. This indicates that the totalindicates RNA that extracted the total RNAfrom extracted each group from eachof cells group has of good cells has integrity good integrity and can and can be used for subsequentbe used library for subsequent construction library and construction sequencing. and sequencing.

Figure 1. The gel electrophoresis diagram of total RNA from Vero cell. M: Marker; Line 1–3: The uninfected control group; Figure 1. The gel electrophoresis diagram of total RNA from Vero cell. M: Marker; line 1–3: The Line 4–6: Infected with PEDV for 12 h; Line 7–9: Infected with PEDV for 24 h. uninfected control group; line 4–6: Infected with PEDV for 12 h; Line 7–9: Infected with PEDV for 24 h. 3.3. Analysis of Differentially Expressed Genes in Infected Vero Cells Compared to the Uninfected Cells 3.3. Analysis of DifferentiallyIllumina Expressed high-throughput Genes in sequencingInfected Vero technology Cells Compared was used to to the sequence the three groups of samples, and DESeq2 software was performed to identify genes that were differ- Uninfected Cells entially expressed between groups. Compared with the uninfected control, there were four Illumina highdifferentially-throughput expressed sequencing genes in technology the group infected was usedwith PEDV to sequence for 12 h, including the three one up- groups of samples,regulated and DESeq2 gene and software three down-regulated was performed genes to (p identify< 0.05). Meanwhile, genes that 1498 were differentially dif- expressed genes were showed in the group infected with PEDV for 24 h, of which 956 genes ferentially expressedwere between upregulated groups. and 542 Compared genes were downregulatedwith the uninfected (p < 0.05). control, Compared there with were the group four differentially infectedexpressed with genes PEDV in for the 12 h, group there were infected 1643 differentially with PEDV expressed for 12 h, genes including in the group one up-regulated geneinfected and with three PEDV down for 24-regulated h, including genes 1079 upregulated (p < 0.05). genesMeanwhile, and 564 downregulated1498 differentially expressedgenes genes (p < 0.05)were (Table showed2). The in discovery the group of these infected differentially with PEDV expressed for genes24 h, laid of the which 956 genes werefoundation upregulated for ﬁnding and speciﬁc 542 targetgenes genes. were downregulated (p < 0.05). Com- pared with the groupTable 2.infectedNumbers withof differentially PEDV expressed for 12 h, genes there (DEGs). were 1643 differentially expressed genes in the group infected with PEDV for 24 h, including 1079 upregulated genes All DEGs Down-Regulated Genes Up-Regulated Genes and 564 downregulated genes (p < 0.05) (Table 2). The discovery of these differentially Mock vs. PEDV 12 h 4 1 3 expressed genes laidMock the vs.foundation PEDV 24 h for finding 1498 specific target 956genes. 542 PEDV 12 h vs. PEDV 1643 1079 564 24 h

3.4. qRT-PCR Verification of 5 Seleted Differentially Expressed Genes The relative expression of five genes (CDKN1A, CTPS1, SQSTM1, TK1, UBE2S) in Vero cells uninfected with PEDV, infected with PEDV for 12 h, and for 24 h was verified by

Viruses 2021, 13, x FOR PEER REVIEW 6 of 17

Table 2. Numbers of differentially expressed genes (DEGs). All DEGs Down-Regulated Genes Up-Regulated Genes Mock vs. PEDV 12 h 4 1 3 Mock vs. PEDV 24 h 1498 956 542 PEDV 12 h vs. PEDV 24 h 1643 1079 564

Viruses 2021, 13, 1218 3.4. qRT-PCR Verification of 5 Seleted Differentially Expressed Genes 6 of 16 The relative expression of five genes (CDKN1A, CTPS1, SQSTM1, TK1, UBE2S) in Vero cells uninfected with PEDV, infected with PEDV for 12 h, and for 24 h was verified by qRT-PCR (Figure 2). The five genes were stably expressed in Vero cells and the trend of theqRT-PCR expression (Figure level2 ).was The consistent ﬁve genes with were the sequencing stably expressed results. in Vero cells and the trend of the expression level was consistent with the sequencing results.

Figure 2. qRT-PCR veriﬁcation of CDKN1A, CTPS1, SQSTM1, TK1, and UBE2S. ns, not signiﬁcant; Figure 2. qRT-PCR verification of CDKN1A, CTPS1, SQSTM1, TK1, and UBE2S. ns, not significant; p p p **, p**, < 0.01;< 0.01; ***, p ***, < 0.001;< 0.001;****, p ****,< 0.0001.< 0.0001. 3.5. Analysis of GO Function Annotation of Differentially Expressed Genes 3.5. Analysis of GO Function Annotation of Differentially Expressed Genes As Asshown shown in Figure in Figure 3, the3 ,GO the function GO function annotation annotation analysis analysisof the differentially of the differentially ex- ex- pressedpressed genes genes involves involves three threeaspects: aspects: Biological Biological process, process,cell composition, cell composition, and molecular and molecular function,function, and andinvolves involves cellular cellular process, process, biological biological regulation, regulation, metabolicmetabolic process, cellular process, cellular composition,composition, organelle organelle composition, composition, and catalytic and catalytic activity. activity.Due to the Due large to abscissa the large value abscissa value Viruses 2021, 13, x FOR PEER REVIEWin Figurein Figure 3a, 3thea, theGO GOfunction function annotation annotation of differentially of differentially expressed expressed 7genes of 17 of genes Mockof vs Mock 12 vs. 12 h

h isis listed listed separately separately Figure Figure 3b. 3b.

Figure 3. Cont.

Viruses 2021, 13, 1218 7 of 16 Viruses 2021, 13, x FOR PEER REVIEW 8 of 17

FigureFigure 3. 3. GOGO function function annotation annotation of differentially of differentially expressed expressed genes of PEDV genes 12h of vs PEDV PEDV 12 24 hh vs.and PEDV 24 h and MockMock vs vs. 24h 24h (a) (Mocka) Mock vs 12 vs. h (b 12). h (b).

3.6.3.6. KEGG Enrichment Enrichment Analysis Analysis of Differentially of Differentially Expressed Expressed Genes Genes TheThe KEGG KEGG enrichment enrichment analysis analysis of the ofdifferentially the differentially expressed expressed genes screened genes above screened above is shown in Figure 4. The smaller the FDR and the larger the -log10 (FDR) value, the more is shown in Figure4. The smaller the FDR and the larger the −log10 (FDR) value, the significantly the KEGG pathway is enriched. Compared with the mock, where the Vero morecells infect significantly PEDV for the12 h, KEGG the target pathway gene annotations is enriched. of four Compared differentially with expressed the mock, where the Verogenes cells in the infect African PEDV green for monkey 12 h, genome the target were gene only annotationsenriched in the of NOD-like four differentially receptor expressed genessignaling in the pathway African and green microRNAs monkey in the genome cancer were signaling only pathway. enriched After in the Vero NOD-like cells receptor signalingwere infected pathway for 24 h, the and target microRNAs gene annotations in the of cancer differentially signaling expressed pathway. genes in Afterthe Vero cells wereAfrican infected green monkey for 24 h,genome the target are mainly gene enriched annotations in the of TNF differentially signaling pathway, expressed the genes in the Africanp53 signaling green pathway, monkey the genomeJak-STAT aresignaling mainly pathway, enriched the MAPK in the signaling TNF signaling pathway, pathway, the and immune inflammation. Vero cells infected for 24 hours were compared with Vero p53cells signalinginfected for pathway,12 hours, and the showed Jak-STAT that the signaling TNF signaling pathway, pathway the and MAPK pathways signaling in pathway, andcancer immune are significantly inflammation. enriched. Vero cells infected for 24 h were compared with Vero cells infected for 12 h, and showed that the TNF signaling pathway and pathways in cancer are significantly enriched.

3.7. PEDV Infection Induces Apoptosis in a Dose-Dependent Manner Flow cytometry was used to detect the apoptosis rate of Vero cells infected with PEDV at 0, 0.1, 0.5, and 1 MOI by Annexin-PI double staining at 24 h post-infection. The results are shown in Figure5. Compared with the non-infected PEDV group, the groups infected with PEDV at different MOIs all showed different degrees of apoptosis, and the higher the dose that Vero cells were infected with, the more apoptosis, indicating that PEDV infection induces Vero cell apoptosis in a dose-dependent manner. When Vero cells were infected with 1 MOI PEDV, the apoptosis rate reached about 50%. Viruses 2021, 13, x FOR PEER REVIEW 9 of 17 Viruses 2021, 13, 1218 8 of 16

(a)

(b)

(c)

FigureFigure 4. KEGG 4. KEGG enrichment enrichment map of differentially map of differentially expressed genesexpressed of Mock genes vs. PEDVof Mock 12 hvs (a )PEDV Mock vs.12 h PEDV (a) Mock 24 h ( b) and PEDVvs 12 PEDV h vs. PEDV 24 h ( 24b) hand (c). PEDV 12 h vs PEDV 24 h (c).

Viruses 2021, 13, x FOR PEER REVIEW 10 of 17

Viruses 2021, 13, 1218 9 of 16 PEDV infection induces Vero cell apoptosis in a dose-dependent manner. When Vero cells were infected with 1 MOI PEDV, the apoptosis rate reached about 50%.

(a)

(b)

FigureFigure 5. Detection 5. Detection of Vero of cell Vero apoptosis cell apoptosis rate after PEDVrate after infection PEDV by infection ﬂow cytometry by flow at differentcytometry MOIs at bydifferent Flow cytometry (a) andMOIs the percentageby Flow cytometry of apoptosis (a) cells and ( bthe). **, percentagep < 0.01. of apoptosis cells (b). **, p < 0.01.

3.8. PEDV Infection 3.8.Affects PEDV the Infection Expression Affects Level the of Expression Apoptosis Level-Related of Apoptosis-Related Proteins Proteins Western blotting wasWestern used blotting to detect was the used expression to detect theof apoptosis expression-related of apoptosis-related proteins at proteins at different times (0 h,different 12 h, 24 times h) in (0Vero h, 12 cells h, 24 that h) in were Vero not cells infected that were with not infectedPEDV and with infected PEDV and infected with PEDV. As shownwith PEDV.in Figure As shown6, compared in Figure with6, compared the uninfected with the group, uninfected the expression group, the expression levels of P53, Puma, BAX, and Bcl-2 did not change significantly when Vero cells were levels of P53, Puma, BAX, and Bcl-2 did not change significantly when Vero cells were infected with PEDV for 12 h (p > 0.05). When Vero cells were infected with PEDV for 24 h, infected with PEDVthe for protein 12 h (p expression > 0.05). When of P53, Vero Puma, cells and were BAX infected increased with significantly, PEDV for 24 and h, the protein the protein expressionexpression of P53, of Bcl-2Puma, decreased and BAX significantly. increased significantly, and the protein expression of Bcl-2 decreased significantly.

Viruses 2021, 13, x FOR PEER REVIEW 11 of 17 Viruses 2021, 13, 1218 10 of 16

(a)

(b)

Figure 6. 6.Effect Effect of PEDVof PEDV infection infection on p53 on signaling p53 signaling pathway-related pathway protein-related expression protein by expression Western blotting by West- (a) and the ernintensity blotting band ( ratioa) and of Western the intensity blotting band (b). *, pratio< 0.05; of**, Westernp < 0.01; ***,blottingp < 0.001. (b). *, p < 0.05; **, p < 0.01; ***, p < 0.001. 3.9. The Effect of Inhibitor PFT-α on Proteins of p53, Puma, BAX and Bcl-2 3.9. The Effect of Inhibitor PFTWestern-α on blotting Proteins was of used p53, to Puma, detect BAX the changes and Bcl of-2 proteins p53, Puma, BAX, and Bcl-2 under PFT-α (10 mM) treatment for 24 h. As shown in Figure7, PEDV infection Western blottingcan was significantly used to promotedetect the the changes expression of of proteins p53 and Puma, p53, andPuma, upregulate BAX, and the ratio of Bcl-2 under PFT-α (10BAX/Bcl-2. mM) treatment Treatment for with 24 PFT- h. Asα can shown significantly in Figure reduce 7, thePEDV expression infection of p53 can and Puma, significantly promoteand the downregulate expression the of ratio p53 of andBAX/Bcl-2, Puma, and and the downregulatedupregulate the ratios ratio of Puma of and BAX/Bcl-2. TreatmentBAX/Bcl-2 with PFT indicate-α can that significantly inhibition of p53 reduce can significantly the expression reverse the of apoptosis p53 and induced by PEDV. Puma, and downregulate the ratio of BAX/Bcl-2, and the downregulated ratios of Puma and BAX/Bcl-2 indicate that inhibition of p53 can significantly reverse the apoptosis induced by PEDV.

Viruses 2021, 13, x FOR PEER REVIEW 12 of 17

Viruses 2021, 13, 1218 11 of 16

(a)

(b)

Figure 7. 7.Effect Effect of inhibitorof inhibitor PFT-α PFTon proteins-α on proteins of p53, Puma, of p53, BAX, Puma, and Bcl-2 BAX, by Western and Bcl blotting-2 by Western (a) and the blotting intensity band ratio(a) and of Western the intensity blotting (bandb). ns, ratio not signiﬁcant; of Western *, p

3.10. The Inhibitor PFT-α Treatment Inhibits PEDV-Induced Apoptosis with no Effect on 3.10. The Inhibitor PFTCell-α ViabilityTreatment Inhibits PEDV-Induced Apoptosis with no Effect on Cell Viability Flow cytometry was used to detect the apoptosis rate of each experimental group Flow cytometryunder was theused treatment to detect of PFT- theα apoptosis(10 mM) for rate 24 h. of As each shown experimental in Figure8, compared group with under the treatment theof PFT PEDV-uninfected-α (10mM) for group, 24 h. PEDV As shown infection in signiﬁcantly Figure 8, compared increased the with apoptosis the rate. α PEDV-uninfected group,Compared PEDV with infection the PEDV-infected significantly group, increased PFT- treatment the apoptosis signiﬁcantly rate. reduced Com- the PEDV- induced apoptosis rate. In order to exclude the effect of the inhibitor of PFT-α on cell pared with the PEDVviability,-infected the MTTgroup, method PFT was-α treatment used to detect significantly the inhibitory reduced effect of PFT- theα PEDVon cell- activity. induced apoptosis rate.As shownIn order in Figure to exclude9, different the concentrationseffect of the inhibitor of PFT- α (5 of mM, PFT 10-α mM, on 15cell mM, via- 20 mM)- bility, the MTT methodtreated was cells used for 24to hdetect did not the affect inhibitory the cell viability. effect of PFT-α on cell activity. As shown in Figure 9, different concentrations of PFT-α (5 mM, 10 mM, 15 mM, 20 mM)- treated cells for 24 h did not affect the cell viability.

VirusesViruses2021 2021, 13, 13, 1218, x FOR PEER REVIEW 1213 of of 16 17 Viruses 2021 , 13, x FOR PEER REVIEW 13 of 17

(a) (b) (a) (b) Figure 8. Detection of PFT by MTT- α Inhibition of cell activity (a) and percentage of apoptosis cells (b). **, p < 0.01. Figure 8.Figure Detection 8. Detection of PFT by of MTT PFT- by α MTT-Inhibitionα Inhibition of cell activity of cell activity(a) and percentage (a) and percentage of apoptosis of apoptosis cells (b). cells **, p ( b< ).0.01. **, p < 0.01.

Figure 9. Effects of different concentrations of PFT-α treatment on cell viability (#, p < 0.05). Figure 9. Effects of different concentrations of PFT-α treatment on cell viability (#, p < 0.05.). Figure 9.4. Effects Discussion of different concentrations of PFT-α treatment on cell viability (#, p < 0.05.). 4. DiscussionAlthough porcine epidemic diarrhea only causes mild symptoms such as weight loss 4. Discussion and lowAlthough mortality porcine when epidemic infecting diarrhea adult pigs, only it shows causes a mild high symptoms incidenceof such 100% as andweight a high loss Althoughmortalityand low porcine mortality rate up epidemic to when 90–100% infectingdiarrhea when onlyadult it infects causes pigs, newborn it mild shows symptoms piglet a high [20 incidence ].such PEDV as weight of has 100% been loss and reported a high and low mortality when infecting adult pigs, it shows a high incidence of 100% and a high tomortality be prevalent rate up in to the 90 world,–100% causingwhen it hugeinfects economic newborn losses piglet to [20] the. PEDV swine has industry been reported all over mortalitytheto rate be world prevalent up to and 90– seriously100% in the when world, affecting it infectscausing the newborn development huge economic piglet of [20] thelosses. world’sPEDV to the has pig swine been industry. reportedindustry Therefore, all over to be prevalentbasicthe world research in theand onworld, seriously PEDV causing is affecting particularly huge the economic development important. losses ofto thethe world’s swine industry pig industry. all over Therefore, the worldbasic andAnalysis research seriously of on transcriptomeaffecting PEDV is the particularly development sequencing important. data of the showed world’s that pig when industry. PEDV Therefore, infected the Vero basic researchcells forAnalysis on 12 PEDV h, there of is transcriptome particularly were only four important. sequencing differentially data expressed showed that genes, when of which PEDV the infected MDGA1 the AnalysisgeneVero was cells of transcriptomesignificantly for 12 h, there upregulated, sequencing were only and data four GBP2, showed differentia MN1, that andlly when expressed BMF PEDV genes genes,infected were significantly of the which the Vero cellsdownregulated.MDGA1 for 12 gene h, there was However, weresignificantly only when four PEDVupregulated, differentia infected andlly the expressedGBP2, Vero cells MN1, genes,for and 24 h, ofBMF the which GBP2genes the genewere was sig- MDGA1significantlynificantly gene was downregulated. significantly upregulated upregulated, (p However,< 0.05). when and GBP2, PEDV MN1,infected and the BMF Vero genes cells forwere 24 sig-h, the GBP2 nificantlygene downregulated. was significantly However, upregulated when PEDV (p < 0.05). infected the Vero cells for 24 h, the GBP2 gene was significantly upregulated (p < 0.05).

Viruses 2021, 13, 1218 13 of 16

The cyclin-dependent kinase inhibitor 1A (CDKN1A) is a cell cycle inhibitor, directly controlled by p53-dependent or independent pathways, and is involved in terminal differentiation, stem cell renewal, apoptosis, and cell migration [21,22]. However, the specific role and mechanism of CDKN1A in PEDV are still unclear. GBP-2 belongs to a family of 65–67 kDa GTPases, the guanylate binding proteins (GBP), induced by IFNs. GBP genes have been used as markers for IFN responsiveness in both cells and organisms because they are some of the most highly expressed genes after IFN-γ stimuli, being induced within a few minutes to transcription induction by IFN-γ. However, to date, the biological function of GBP-2 has received little attention, and there are no data on its involvement in PEDV. It has been previously reported that the expression of GBP-2 gene continues to increase in a p53-dependent manner, and RNA interference inhibits p53 expression to confirm this. Previous results suggest that GBP-2 is not a conventional transcriptional target of p53 but that its effect may be related to the capacity of cells to maintain a sustained proliferative and survival capacity. Thus, GBP-2 is upregulated in a p53-dependent manner through a mechanism that may involve complex formation between the wild-type form of p53 and the transcription factor IRF-1 (interferon regulatory factor-1) [23]. Upregulation of the GBP2 demonstrated that GBP2 is an important candidate gene for disease resistance. In the gene expression profile analysis of Salmonella choleraesuis infection, it was found that both GBP1 and GBP2 of pigs were significantly upregulated by nearly 10 times [24]. Current studies on the GBPs family have confirmed that it has an antiviral effect, but the underlying mechanism is not yet clear [25,26]. Studies have shown that high expression of porcine GBP1 and GBP2 genes can inhibit the proliferation of porcine reproductive and respiratory syndrome virus (PRRSV) and pseudorabies virus (PRV), but whether high expression of GBP1 and GBP2 genes can inhibit the PEDV replication in Vero cells needs further study. Studies have shown that apoptosis occurs in cells after PEDV infection [8]. Among the differentially expressed genes screened in this study, there are also differential expression of apoptosis-related genes, such as p53, BAX, Bcl-2, Puma, etc. It is worth noting that the Puma gene is a member of the BH3-only subfamily of the Bcl-2 family, which can promote cell apoptosis and is a key mediator of p53-dependent and independent apoptosis pathways. More and more studies have shown that Puma is a key mediator of apoptosis. Based on the significant upregulation of the expression of P53 and Puma genes when PEDV infects Vero cells for 24 h, it is speculated that PEDV infection may be caused by activating Puma and inducing apoptosis through a p53-dependent pathway. Above all, as shown in Figure 10, we found that PEDV infection may activate Puma and induce apoptosis in a p53-dependent pathway in this study. Viruses 2021, 13, x FORViruses PEER2021, 13REVIEW, 1218 14 of 1615 of 17

Figure 10. SchematicFigure 10. diagramSchematic of diagram PEDV ofactivating PEDV activating Puma and Puma inducing and inducing apoptosis apoptosis in a p53 in a-depend- p53- ent pathway.dependent pathway.

Author ContributionAuthor Contributions:s: ConceptualizationConceptualization,, Y.H. Y.H. and and J.S. J.S. (Jianhong(Jianhong Shu); Shu) methodology,; methodology, J.C., Y.H. J.C. and, Y.H. and J.S. (JianhongJ.S. (Jianhong Shu) Shu);; validation, validation, Y.H. Y.H. and and J.S. (Jianhong(Jianhong Shu); Shu) formal; formal analysis, analysis, L.Y.; investigation, L.Y.; investigation, L.Y.; L.Y.; resources,resources, J.C., J.C., Y.H. Y.H. and and J.S. J.S. (Jianhong (Jianhong Shu); Shu) data; data curation, curation, L.Y. and L.Y. J.S. and (Jinqi J. Shu);S. (Jinqi writing—original Shu); writing— draft preparation, L.Y.; writing—review and editing, H.F., C.W. and J.S. (Jinqi Shu); visualization, L.Y. original draft preparation, L.Y.; writing—review and editing, H.F., C.W. and J.S. (Jinqi Shu); visual- and C.W.; supervision, Y.H. and J.S. (Jianhong Shu); project administration, Y.H. and J.S. (Jianhong ization, L.Y.Shu); and funding C.W.; acquisition,supervision, J.C., Y.H. and and J.S. J.S. (Jianhong (Jianhong Shu). Shu) All authors; project have administration, read and agreed to Y.H. the and J.S. (Jianhongpublished Shu); versionfunding of theacquisition, manuscript. J.C., Y.H. and J.S. (Jianhong Shu). All authors have read and agreed to the published version of the manuscript. Funding: This work was funded by the Key Research and Development Program of Zhejiang Funding: ThisProvince work [No. was 2019C02043]; funded by Publicthe Key Welfare Research Technology and Development Application Research Program Project of ofZhejiang Zhejiang Prov- Province [No. LGF21C080001]. ince [No. 2019C02043]; Public Welfare Technology Application Research Project of Zhejiang Prov- ince [No. LGF21C080001].Institutional Review Board Statement: Ethical review and approval were waived for this study, due to no laboratory animals are used. Institutional Review Board Statement: Ethical review and approval were waived for this study, Informed Consent Statement: Not applicable. due to no laboratory animals are used. Informed Consent Statement: Not applicable. Data Availability Statement: The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions. Acknowledgments: I thank Zhejiang Province, Zhejiang Sci-Tech University and Shaoxing Biomed- ical Research Institute for giving financial support for this study. In addition, I would like to thank the anonymous reviewers who have helped to improve the paper. Conflicts of Interest: The authors declare no conflict of interest.

Viruses 2021, 13, 1218 15 of 16

Data Availability Statement: The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions. Acknowledgments: I thank Zhejiang Province, Zhejiang Sci-Tech University and Shaoxing Biomedi- cal Research Institute for giving financial support for this study. In addition, I would like to thank the anonymous reviewers who have helped to improve the paper. Conflicts of Interest: The authors declare no conflict of interest.

References 1. Pensaert, M.B.; De Bouck, P.A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 1978, 58, 243–247. [CrossRef] 2. Takahashi, K.; Okada, K.; Ohshima, K.-I. An outbreak of swine diarrhea of a new-type associated with coronavirus-like particles in Japan. Jpn. J. Vet. Sci. 1983, 45, 829–832. [CrossRef] 3. Fan, B.; Jiao, D.; Zhang, R.; Zhou, J.; Guo, R.; Yu, Z.; Shi, D.; Zhao, Y.; Gu, J.; Niu, B.; et al. Origin and epidemic status of porcine epidemic diarrhea virus variants in China. Transbound. Emerg. Dis. 2020, 67, 1364–1370. [CrossRef] 4. Li, W.; Li, H.; Liu, Y.; Pan, Y.; Deng, F.; Song, Y.; Tang, X.; He, Q. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg. Infect. Dis. 2012, 18, 1350–1353. [CrossRef] 5. Brian, D.A.; Baric, R.S. Coronavirus Genome Structure and Replication. Curr. Top. Microbiol. Immunol. 2005, 287, 1–30. [CrossRef] 6. Choi, H.-J.; Kim, J.-H.; Lee, C.-H.; Ahn, Y.-J.; Song, J.-H.; Baek, S.-H.; Kwon, D.-H. Antiviral activity of quercetin 7-rhamnoside against porcine epidemic diarrhea virus. Antivir. Res. 2009, 81, 77–81. [CrossRef] 7. Shi, W.; Fan, W.; Bai, J.; Tang, Y.; Wang, L.; Jiang, Y.; Tang, L.; Liu, M.; Cui, W.; Xu, Y.; et al. TMPRSS2 and MSPL Facilitate Trypsin-Independent Porcine Epidemic Diarrhea Virus Replication in Vero Cells. Viruses 2017, 9, 114. [CrossRef] 8. Zhang, X.; Li, P.; Zheng, Q.; Hou, J. Lactobacillus acidophilus S-layer protein-mediated inhibition of PEDV-induced apoptosis of Vero cells. Vet. Microbiol. 2019, 229, 159–167. [CrossRef] 9. Cai, Y.; Wang, D.; Zhou, L.; Ge, X.; Guo, X.; Han, J.; Yang, H. Application of RNAscope technology to studying the infection dynamics of a Chinese porcine epidemic diarrhea virus variant strain BJ2011C in neonatal piglets. Vet. Microbiol. 2019, 235, 220–228. [CrossRef] 10. Sun, D.; Shi, H.; Guo, D.; Chen, J.; Shi, D.; Zhu, Q.; Zhang, X.; Feng, L. Analysis of protein expression changes of the Vero E6 cells infected with classic PEDV strain CV777 by using quantitative proteomic technique. J. Virol. Methods 2015, 218, 27–39. [CrossRef] 11. Sun, P.; Wu, H.; Huang, J.; Xu, Y.; Yang, F.; Zhang, Q.; Xu, X. Porcine epidemic diarrhea virus through p53-dependent pathway causes cell cycle arrest in the G0/G1 phase. Virus Res. 2018, 253, 1–11. [CrossRef][PubMed] 12. Yan, Y.; Du, Y.; Wang, G.; Deng, Y.; Li, R.; Li, K. The Novel H7N9 Influenza A Virus NS1 Induces p53-Mediated Apoptosis of A549 Cells. Cell. Physiol. Biochem. 2016, 38, 1447–1458. [CrossRef] 13. Zhou, P.; Tu, L.; Lin, X.; Hao, X.; Zheng, Q.; Zeng, W.; Zhang, X.; Zheng, Y.; Wang, L.; Li, S. cfa-miR-143 Promotes Apoptosis via the p53 Pathway in Canine Influenza Virus H3N2-Infected Cells. Viruses 2017, 9, 360. [CrossRef] 14. Inamura, N.; Araki, T.; Enokido, Y.; Nishio, C.; Aizawa, S.; Hatanaka, H. Role of p53 in DNA strand break-induced apoptosis in organotypic slice culture from the mouse cerebellum. J. Neurosci. Res. 2000, 60, 450–457. [CrossRef] 15. Yu, J.; Zhang, L.; Hwang, P.M.; Kinzler, K.W.; Vogelstein, B. PUMA Induces the Rapid Apoptosis of Colorectal Cancer Cells. Mol. Cell 2001, 7, 673–682. [CrossRef] 16. Nakano, K.; Vousden, K.H. PUMA, a Novel Proapoptotic Gene, Is Induced by p53. Mol. Cell 2001, 7, 683–694. [CrossRef] 17. Spender, L.C.; Carter, M.J.; O’Brien, D.I.; Clark, L.J.; Yu, J.; Michalak, E.M.; Happo, L.; Cragg, M.S.; Inman, G.J. Transforming growth factor-beta directly induces p53-up-regulated modulator of apoptosis (PUMA) during the rapid induction of apoptosis in myc-driven B-cell lymphomas. J. Biol. Chem. 2013, 288, 5198–5209. [CrossRef] 18. Han, J.-W.; Flemington, C.; Houghton, A.B.; Gu, Z.; Zambetti, G.P.; Lutz, R.J.; Zhu, L.; Chittenden, T. Expression of bbc3, a pro-apoptotic BH3-only gene, is regulated by diverse cell death and survival signals. Proc. Natl. Acad. Sci. USA 2001, 98, 11318–11323. [CrossRef] 19. Xu, X.; Xu, Y.; Zhang, Q.; Yang, F.; Yin, Z.; Wang, L.; Li, Q. Porcine epidemic diarrhea virus infections induce apoptosis in Vero cells via a reactive oxygen species (ROS)/p53, but not p38 MAPK and SAPK/JNK signalling pathways. Vet. Microbiol. 2019, 232, 1–12. [CrossRef] 20. Oh, J.; Lee, K.-W.; Choi, H.-W.; Lee, C. Immunogenicity and protective efficacy of recombinant S1 domain of the porcine epidemic diarrhea virus spike protein. Arch. Virol. 2014, 159, 2977–2987. [CrossRef][PubMed] 21. Kreis, N.N.; Louwen, F.; Yuan, J. The Multifaceted p21 (Cip1/Waf1/CDKN1A) in Cell Differentiation, Migration and Cancer Therapy. Cancers 2019, 11, 1220. [CrossRef] 22. Hu, K.; Li, J.; Wu, G.; Zhou, L.; Wang, X.; Yan, Y.; Xu, Z. The novel roles of virus infection-associated gene CDKN1A in chemoresistance and immune infiltration of glioblastoma. Aging 2021, 13, 6662–6680. [CrossRef] 23. Guimaraes, D.P.; Oliveira, I.M.; De Moraes, E.; Paiva, G.R.; Souza, D.M.; Barnas, C.; Olmedo, D.B.; Pinto, C.E.; Faria, P.A.; Gallo, C.V.D.M.; et al. Interferon-inducible guanylate binding protein (GBP)-2: A novel p53-regulated tumor marker in esophageal squamous cell carcinomas. Int. J. Cancer 2009, 124, 272–279. [CrossRef][PubMed] Viruses 2021, 13, 1218 16 of 16

24. Zhao, S.-H.; Kuhar, D.; Lunney, J.K.; Dawson, H.; Guidry, C.; Uthe, J.J.; Bearson, S.M.; Recknor, J.; Nettleton, D.; Tuggle, C.K. Gene expression proﬁling in Salmonella Choleraesuis-infected porcine lung using a long oligonucleotide microarray. Mamm. Genome 2006, 17, 777–789. [CrossRef][PubMed] 25. Anderson, S.L.; Carton, J.M.; Lou, J.; Xing, L.; Rubin, B.Y. Interferon-Induced Guanylate Binding Protein-1 (GBP-1) Mediates an Antiviral Effect against Vesicular Stomatitis Virus and Encephalomyocarditis Virus. Virology 1999, 256, 8–14. [CrossRef][PubMed] 26. Carter, C.C.; Gorbacheva, V.Y.; Vestal, D.J. Inhibition of VSV and EMCV replication by the interferon-induced GTPase, mGBP-2: Differential requirement for wild-type GTP binding domain. Arch. Virol. 2005, 150, 1213–1220. [CrossRef]