Stem Cells at Georgetown
At Georgetown, we may discuss and debate the science behind ES cells vs. adult stem cells, but there is really no argument. Because we are a Catholic university, human ES cell work is off limits Stem Cells at Georgetown
So, how does my laboratory fit in to the stem cell world?
We research mouse and/or primate embryonic stem cells and apply that information to adult stem cells
Why? So we can get adult stem cells to behave like ES cells. The Ultimate Goal
Sick Patient Healthy Cells cell for Injection
Dedifferentiation Differentiation
Patient derived Gene Correction ES like cells
• Cells are harvested from a sick patient • Dedifferentiated into an ES cell-like state • Genetically modified to correct the disease • Differentiated to form the necessary cell • Cells are injected back in to the patient What we are doing. . .
Dedifferentiation Differentiation
• How can we revert human adult • Understand the signal stem cells to an ES-like state? transduction mechanisms that dictate mouse ES cell • Which type of adult stem cells differentiation are best to use?
• spermatogonial stem cells • Manipulate these same pathways in ES-like stem cells to produce disease-specific, • What signal transduction therapeutic-quality stem cells pathways are important for this dedifferentiation? Stem Cells from Adult Tissues
• Bone marrow stem cells – Hematopoeitic – Stromal derived stem cells – Mesenchymal, Multipotent Adult Progenitor Cells (MAPCS) • Neural stem cells • Cardiac stem cells • Epidermal stem cells Spermatogonial stem cells • Umbilical cord, placenta, Stem cells from Human Exfoliated Deciduous teeth (SHED) • Amniotic fluid derived stem cells (AFS)
John Gearhart But First…
• Must understand how ES cells work in order apply that information to adult stem cells
• We look at the signal transduction pathways involved in differentiation of ES cells Pleuripotent non -beating ES cells that are allowed to form EBs begin to beat about 10 days after removal of LIF KINETWORKS TM PROTEIN KINASE A SCREEN (KPKS-1.2A) COMPARISON REPO RT Georgetown University Medical Center, Dr. Ian Galli cano, Order 490
Normalized Data Comparison Kinexus ID 3610 3611 Of Normalized Counts per Minute Scan ID 9263 9280 Beating vs Non beating Sample Name Non-beating Beating Normalization 1 1 FULL NAME O F PROTEIN ABBREV LANE TYPE Bone Marrow X kinase -56% 3-phosphoinositide dependent protein kinase 1 (PKB kina se) (56) PDK1 6 PSTK Aurora2 (48) Aurora2 17 375 364 CaMKK +30% Cancer Osaka thyroid oncogene (Tpl2) (53) COT 19 PSTK 803 971 For The Following Samples Casein kinase 2 (35) CK2 20 PSTK 2973 4145 CK1epsilon -39% Casein kinase 2 (37) CK2 20 PSTK 3565Norm 5614 C.P.M. Casein kinase 2 (39) CK2 20 PSTK 3086 3895 Cyclin-dependent kinase 1 (cdc2) (30) CDK1 4 PSTK ERK6 +59% Cyclin-dependent kinase 2 (31) CDK2 6 PSTK IKKalpha -38% Cyclin-dependent kinase 4 (30) CDK4 5 PSTK Cyclin-dependent kinase 5 (28) CDK5 3 PSTK Cyclin-dependent kinase 6 (34) CDK6 7 PSTK 374 281 JAK2 +70% Cyclin-dependent kinase 7 (35) CDK7 8 PSTK 14020 14487 Cyclin-dependent kinase 9 (35) CDK9 9 PSTK 4425 5348 Lyn +37% DNA-activated protein kinase (460) DNAPK 14 PSTK dsRNA dependent kinase (75) PKR 17 PSTK PKA -30% eEF2k(105) eEF2k 16 Extracellular regulated kinase 1 (40) ERK1 4 PSTK 7928 11505 PKG1 -64% Extracellular regulated kinase 1 (41) ERK1 4 PSTK 6619 7790 Extracellular regulated kinase 2 (37) ERK2 6 PSTK 5602 8313 RAF1 -56% Extracellular regulated kinase 2 (37) ERK2 4 PSTK 7666 8607 Extracellular regulated kinase 2 (39) ERK2 4 PSTK 3689 4764 CK2alpha +39% Extracellular regulated kinase 2 (39) ERK2 6 PSTK 2560 2333 CK2alpha’ +57% Extracellular regulated kinase 3 (52) ERK3 2 PSTK 976 540 Extracellular regulated kinase 3 (56) ERK3 2 PSTK ERK1 +45% Glycogen synthase kinase 3 alpha (44) GSK3a 18 PSTK Glycogen synthase kinase 3 beta (40) GSK3b 18 PSTK ERK2 +48% IKKbeta (87) IKKbeta 17 MAP Kinase Kinase 1 (MKK1) (40) MEK1 13 PTYK 1158 785 MEK1 -32% MAP kinase kinase 2 (MKK2) (41) MEK2 14 PTYK 1456 1320 MAP kinase kinase 4 (MEK4) (36) MEK4 15 PTYK 9204 11482 RAFB +33% MAP Kinase Kinase 6 (MEK6) (33) MEK6 16 PTYK 6100 4109 Ribosomal S6 kinase +69% p21 activated kinase 1 (PAK alpha) (62) PAK1 14 PSTK p21 activated Kinase 3 (PAK beta) (61) PAK3 15 PSTK p38 Hog MAP kinase (37) p38 MAPK 3 PSTK 15576 11758 Protein kinase B alpha (57) PKBa 4 PSTK 4824 3566 PKCalpha -38% Protein kinase B alpha (60) PKBa 4 PSTK Protein kinase C alpha (78) PKCa 5 PSTK 1366 846 PKCbeta -50% Protein kinase C Beta1 (80) PKCb 3 PSTK 11420 102 Protein kinase C delta (74) PKCd 10 PSTK 2126 2099 Protein kinase C epsilon (94) PKCe 8 PSTK 3571 5495 PKCepsilon +54% Protein kinase C epsilon (98) PKCe 8 PSTK Protein kinase C gamma (78) PKCg 7 PSTK Protein kinase C lambda (62) PKCl 11 PSTK Protein kinase C mu (115) PKCm 5 PSTK 9404 11363 Protein kinase C mu (120) PKCm 5 PSTK Protein kinase C theta (74) PKCt 12 PSTK Confocal microscopy of Beating and Nonbeating Areas
PKC JAK2
A B
C Inhibition of STAT3 decreases beating Foshay et al., 2005 Stable Transfection of Stable Transfection of dominant negative STAT3, dominant negative STAT3, STAT3STAT3 ββ, results in highly , results in highly significant reduction in significant reduction in beatingbeating Manipulate Signal Transduction Manipulate ES-cell differentiation Regulation of STAT3 • Activation – Tyrosine 706 phosphorylation – Serine 727 phosphorylation • Inhibition – Transcriptional Activation • STAT3β – dominant negative isoform – Recruitment to the receptor • Suppressors Of Cytokine Signaling (SOCS) – DNA binding • Protein Inhibitor of Activated STATs (PIAS) – Translation • miRNA ????? Hypothesis
As STAT3 regulation by several different means appears to be critical for proper ES cell differentiation, we hypothesize that miRNAs may represent an additional mechanism necessary for controlling this process. Regulation of STAT3 During ES Cell Differentiation: A New Role for microRNAs miR 17 family miRNA sequences and STAT3 binding sites
Mmu miR 20a uaaagugcu uau agugcagguag Mmu miR 20b caaagugcu cau agugcaggua Mmu miR 17 caaagugcu uac agugcagguag u Mmu miR 93 caaagugcu guuc gugcagguag Mmu miR 106a caaagugcu aac agugcaggua Mmu miR 106b uaaagugcu gac agugcag au
STAT3 3’ UTR 2701 tttttttttttaatttcctacttctgctat ctttgggcaatctgggcacttttt aa aata . . .gctgataccccaggctgggaa ctcctggctctgcactttc 3001 STAT3, ES cells and miRNAs
• miRNA Binding Prediction Programs – miRBASE Sanger Institute, UK – microInspector – IMBB, Greece – Custom Program – Bill Foshay
• Predicted STAT3 binding partners – miR 20a, miR 20b, miR 17 5p, miR 93, miR 106a, miR 106b pMIR Constructs (for transfection into ES cells or adult stem cells)
• pMIR HoxA11 CMV Luciferase HoxA11 3’UTR • pMIR S3
CMV Luciferase STAT3 3’ UTR • pMIR S3 s1mt CMV Luciferase XXX • pMIR S3 s2mt CMV Luciferase XXX • pMIR S3 2xmt CMV Luciferase XXX XXX Endogenous microRNAs bind the STAT3 3’UTR during the period of decreased STAT3 activity miR 93 and miR 20 inhibitors delay ES cell differentiation
o es M do en
to Ec Semi-quanitative RT-PCR • Why three levels of STAT3 regulation?
– Phosphorylation – protein activation – STAT3 β – transcriptional inhibition – miR 93 – mRNA silencing
• Timing – all three mechanisms target a different level of STAT3 function, which in combination, allow for rapid decreases and increased in STAT3 activity
• Dosing – specific levels of protein are important for control of differentiation and fate determination Now to start applying our ES cell findings to Adult Stem Cells
• Can we turn on/off the same pathways (e.g. JAK/STAT ) at the correct time to produce significantly more therapuetic cell types than by present means??? Gallicano Lab members
• Kara Foshay -STAT3 miRNA • Angel Miera -Desmoplakin • August Stuart -Cancer Stem Cells • Nick Fingland -Spermatoginial Stem Cells • Steven Mobley -PKG in ES cell Differentiation
Collaborations • Dr. Martin Dym -Spermatogonial Stem Cells • Dr. Kevin FitzGerald S.J. –stem cell ethics • Dr. Lopa Mishra –Cancer stem cells • Dr. Vassilli Papadopoulos -Spermatogenesis • Dr. Prascilla Furth –Cancer Stem Cells miRNAS and Early Mouse Development
We expect to see high expression of miR 93 and possibly miR 20 in differentiating cells and lower expression in pluripotent or rapidly proliferating cells of the mouse embryo miRNA in situ hybridization
miR 20: expressed throughout the ICM (yellow arrow) miR 93: localized to the trophectoderm and the primitive endoderm (white arrows) miR 93 and STAT3 have opposite expression patterns in the blastocyst GU Stem Cell Research and Regenerative Medicine Initiative & Journal Club, began Jan ‘06
Chair, Ian Gallicano, Cell Biology Vassili Papadopoulos, Biochemistry Martine Culty, Biochemistry Robert I. Glazer, Oncology Gloria Chepko, Oncology Kevin Fitzgerald, Oncology Jean Wrathall, Neuroscience Larry Kromer, Neuroscience Stefano Vincini, Physiology Lopa Mishra, Surgery Donald Massaro, Medicine et al.