DOCSLIB.ORG

Quantification of the Intracellular Life Time of Water Molecules To

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Quantification of the Intracellular Life Time of Water Molecules To J Membrane Biol DOI 10.1007/s00232-017-9988-4 Quantification of the Intracellular Life Time of Water Molecules to Measure Transport Rates of Human Aquaglyceroporins 1 2 3 2 Madelene Palmgren • Malin Hernebring • Stefanie Eriksson • Karin Elbing • 1 4 1 2 3 Cecilia Geijer • Samo Lasicˇ • Peter Dahl • Jesper S. Hansen • Daniel Topgaard • Karin Lindkvist-Petersson1,2 Received: 18 May 2017 / Accepted: 7 September 2017 Ó The Author(s) 2017. This article is an open access publication Abstract Orthodox aquaporins are transmembrane chan- Introduction nel proteins that facilitate rapid diffusion of water, while aquaglyceroporins facilitate the diffusion of small Aquaporins (AQPs) are transmembrane proteins that are uncharged molecules such as glycerol and arsenic trioxide. represented throughout all kingdoms of life, including Aquaglyceroporins play important roles in human physi- animals and plants as well as in lower organisms such as ology, in particular for glycerol metabolism and arsenic yeast and bacteria. Their primary function is to facilitate detoxification. We have developed a unique system water and glycerol transport across cell membranes applying the strain of the yeast Pichia pastoris, where the (Verkman 2012). The aquaporin family is commonly endogenous aquaporins/aquaglyceroporins have been divided into three sub-groups, the orthodox aquaporins removed and human aquaglyceroporins AQP3, AQP7, and (sole water facilitators), the aquaglyceroporins (that facil- AQP9 are recombinantly expressed enabling comparative itate the transport of solutes such as glycerol, arsenic tri- permeability measurements between the expressed pro- oxide and urea), and the superaquaporins. There are 13 teins. Using a newly established Nuclear Magnetic Reso- human aquaporins abbreviated AQP0-12, which are widely nance approach based on measurement of the intracellular distributed in specific cell types in many organs and tissues life time of water, we propose that human aquaglycero- (Day et al. 2014). AQP3, 7, 9, and 10 belong to the porins are poor facilitators of water and that the water aquaglyceroporin sub-group, and in recent years, several transport efficiency is similar to that of passive diffusion reports suggest that the human aquaglyceroporins are across native cell membranes. This is distinctly different essential players in human health and disease (Hara-Chi- from glycerol and arsenic trioxide, where high glycerol kuma and Verkman 2008b; Maeda 2012). Commonly, the transport efficiency was recorded. aquaglyceroporins are stated to have dual permeability, both for water and solutes such as glycerol (Laforenza et al. Keywords Aquaporin Á Aquaglyceroporin Á Water 2016). The transport specificity of the aquaglyceroporins is transport Á NMR Á P. pastoris well-documented in the literature, frequently using either Xenopus laevis oocytes to measure the water transport rates, or artificial membranes creating liposomes with & Karin Lindkvist-Petersson inserted proteins. In both these systems, the water transport [email protected] is indirectly measured by detecting the swelling/shrinkage 1 Department of Chemistry and Molecular Biology, University of the oocytes/liposomes upon an applied change in of Gothenburg, Box 462, 405 30 Go¨teborg, Sweden osmolality, and water transport is quantified in terms of the 2 Department of Experimental Medical Science, Lund osmotic water permeability coefficient. Here, we apply a University, BMC C13, 221 84 Lund, Sweden more direct method for studying water exchange over 3 Physical Chemistry, Lund University, P.O.B. 124, biological membrane by using nuclear magnetic resonance 22100 Lund, Sweden (NMR), which allows for the transport mechanisms to be 4 CR Development, AB, Naturvetarva¨gen 14, 22362 Lund, studied in equilibrium conditions without applying an Sweden osmotic gradient (Eriksson et al. 2017). 123 M. Palmgren et al.: Quantification of the Intracellular Life Time of Water… We established a unique approach to measure transport Table 1 Primers used for cloning. Nucleic acid sequences for pri- of water, glycerol, and arsenic trioxide [As(III)] in a native mers used for creating the AGP1 deletion in P. pastoris GS115 aqy1D cell membrane using the yeast Pichia pastoris. In this strain approach, human AQP3, AQP7, and AQP9 are highly Primer# Primer sequence (50-30 - direction) expressed in an AQP deletion strain of P. pastoris, where 1 CAGTGAATTCGGAAGGTCAATCTACTACACGTG both endogenous aquaporins (Aqy1 and Agp1) have been 2 GACTGCGGCCGCGCAACTTTCACCAGCTTAGC removed by standard cloning strategies. Spheroplasts of 3 CATAGCGGCCGCTTGTGGCTTCTGCGTTCC these strains have AQP-containing lipid bilayers without 4 GGTGGCAGTTCTAGATCGAGG requiring elaborate protein purification schemes or need of 5 AAGGTTTCAGGACCTGTTGCT exchanging detergent micelle-stabilized membrane pro- teins into the lipid bilayers, necessary in liposome-based 6 TATTCTCGTCTCCTATTGGCG approaches. We applied the diffusion NMR method that 7 CACAAATCCAAGAGACTGAAGAC enables quantification of the rate of water exchange 8 CGATAGCTTGAATGTAAGTACCG between intracellular and extracellular compartments on a 9 AGCGCTTGTTCTTGAAGAGT millisecond time-scale (Eriksson et al. 2017). Interestingly, 10 ACTCTTCAAGAACAAGCGCT in our system, when human aquaglyceroporins are in their 11 CGAGTCTTCAGTCTCTTGGAT native environment (lipid bilayer) and the water transport rate is measured by the non-invasive NMR method, the water transport capability of the human aquaglyceroporins nourseothricin was cut out from the pSLnat plasmid (Ter- are not significantly different from the passive water dif- nes et al. 2011) and inserted into the NotI site of pPICZB fusion across the plasma membrane of cells without plasmid flanked by upstream and downstream regions to aquaglyceroporins expressed. Still, all aquaglyceroporins the AGP1 gene. The construct was confirmed by investigated significantly facilitate the transport of glycerol sequencing. The deletion cassette was amplified by PCR and As(III) in the same system. Thus, we suggest that (primer 5 and 6, Table 1) and transformed into P. pastoris human aquaglyceroporins are poor water facilitators com- GS115 aqy1D::HIS4 (Cregg 2007). Transformed cells were pared to orthodox aquaporins, and that their main function plated on YPD-agar plates including 1% w/v yeast extract, in the body is to facilitate transport of other solutes such as 2% w/v peptone and 2% w/v agar, 2% w/v glucose, and glycerol and arsenic trioxide. grown for 2 days at room temperature before they were replica plated onto YPDS-agar plates (YPD-agar pla- tes ? 1 M sorbitol) ? Nourseothricin (clonNAT) (15 lg/ Materials and Methods ml) (GoldBio, USA). Plates were incubated at 30 °C for 3-4 days. Transformants were re-streaked for single colo- Yeast Strains nies on YPD-agar plates ? clonNAT (15 lg/ml). Suc- cessful deletion of the AGP1 gene was verified by genomic Pichia pastoris strains used in this study derives from the PCR using 5 different primer pairs (primer 1 ? 10, X33 strain (commercially available from Thermo Fisher, 1 ? 11, 1 ? 4, 7 ? 8, and 9 ? 4, Table 1). Life Technologies, USA). The protein encoded by gene PAS_chr4_0784 in P. pastoris GS115 was identified with Protein Expression and Western Blot Analysis 35% sequence identity using Fps1 as query in a BLASTp. This protein was named Aquaglyceroporin 1 (Agp1). A The human aquaporins AQP1, AQP3, AQP7, and AQP9 double-deletion strain P. pastoris GS115 aqy1D::HIS4 with a His6 purification tag were cloned into pPICZB agp1D::NatMX was generated by inserting a deletion cas- vector using restriction enzyme EcoRI and XbaI. To sette by homologue recombination into P. pastoris GS115 identify clones that express the protein of interest, AQP aqy1D::HIS4 (Fischer et al. 2009). The double-cloning transformants were spotted on YPD-agar plates supple- approach used for deleting AGP1 was previously described mented with increasing zeocin concentrations (0, 0.5, 1.0, by Ternes and co-workers (Ternes et al. 2011). A *670 bp and 2.0 mg/ml) (Thermo Fisher, Life Technologies, USA). fragment upstream of AGP1-containing restriction sites for The five most zeocin-resistant clones of each AQP con- XbaI and NotI and a *800 bp downstream fragment struct were further analyzed for expression levels. Cells reaching into the AGP1 gene containing NotI and XbaI were pre-grown in buffered glycerol complex medium restriction sites were amplified from genomic DNA by (BMGY: 1% w/v yeast extract, 2% w/v peptone, 100 mM PCR (primer 1 ? 2 and 3 ? 4, respectively, Table 1). potassium phosphate pH 6.0, 1.34% w/v yeast nitrogen Both fragments were simultaneously ligated into the NotI base, 0.4 mg/L biotin, 1% v/v glycerol) for 24 h, and site of a pPICZ B vector. The antibiotic resistance gene protein production was induced with methanol to a final 123 M. Palmgren et al.: Quantification of the Intracellular Life Time of Water… concentration of 0.25% v/v for 6 h (for AQP3, AQP7, 20 mM HEPES pH 7.5, re-suspended in a 1:1 v/v solution AQP9) or 1 h (for AQP1). Cells were harvested at with buffer, and transferred to 5-mm disposable NMR 20009g for 5 min and washed in 20 mM HEPES pH 7.5. tubes and centrifuged at 10009g for 10 min to achieve a Plasma membranes were purified using the protocol of pellet with high concentration of cells. The tubes were kept Panaretou and Piper (2006). Approximately, 300-ll cell on ice until measurement. The NMR diffusion measure- pellet was harvested and re-suspended in an equal volume ments were done at 0 °C for AQP1 and aqy1Dagp1D of breaking buffer (20 mM Tris–HCl pH 7.5, 0.4 M induced for 1 h and at 20 °C for strain AQP3, 7, and 9 and sucrose, 4 mM EDTA, 2 mM DTT) containing protease aqy1Dagp1D induced for 6 h. According to Eriksson et al., inhibitor (Roche Diagnostics) and glass beads. Cells were the temperatures and induction times were chosen so that broken by Fast Prep (MP Biomedical, USA), cell debris the same set of mixing times (tm) allowed a precise was removed at 6009g for 10 min at 4 °C, and the total quantification of exchange for all strains, aqy1Dagp1D, membrane was collected by centrifugation at 21,0009g for aqy1Dagp1D ? hAQP1, and aqy1Dagp1D ? AQP3,7,9 30 min at 4 °C.
Load more

Recommended publications
  • Protein Expression in Mammalian Cell Lines After Lowlevel Metal Exposure
    Montana Tech Library Digital Commons @ Montana Tech Graduate Theses & Non-Theses Student Scholarship Spring 2021 PROTEIN EXPRESSION IN MAMMALIAN CELL LINES AFTER LOWLEVEL METAL EXPOSURE Sydney Jennings Follow this and additional works at: https://digitalcommons.mtech.edu/grad_rsch PROTEIN EXPRESSION IN MAMMALIAN CELL LINES AFTER LOW- LEVEL METAL EXPOSURE by Sydney Jennings A thesis submitted in partial fulfillment of the requirements for the degree of Interdisciplinary Masters of Science Montana Tech 2021 ii Abstract Mining in Butte, Montana has been ongoing since the mid-19th century. The US Environmental Protection Agency (EPA) added the Butte Area to the National Priority List in 1983, designating it a Superfund site. Butte is currently part of the largest EPA Superfund site in the United States. The EPA lists arsenic (As), cadmium (Cd), lead (Pb), and mercury (Hg) as metal contaminants of concern for residents living in proximity to the Butte Area Superfund site. However, very limited human biomonitoring has been conducted in Butte and studies that have been published focus on Pb and, to a lesser extent, As. No synergistic, antagonistic, or additive studies have been conducted, even though it is widely accepted that the exposure in Butte is a metal mixture scenario, rather than single element exposure. Metals that are trace micronutrients, such as copper (Cu), manganese (Mn), and zinc (Zn) have been largely unrecognized as possibly having negative health effects on residents of Butte, despite the fact the metals have been historically released into the soil, water, and air through active blasting and crushing of ore and are known to be potential neurotoxins.
    [Show full text]
  • Comparative Analysis of Sequences, Polymorphisms and Topology of Yeasts Aquaporins and Aquaglyceroporins
    FEMS Yeast Research, 16, 2016, fow025 doi: 10.1093/femsyr/fow025 Advance Access Publication Date: 20 March 2016 Minireview MINIREVIEW Comparative analysis of sequences, polymorphisms Downloaded from https://academic.oup.com/femsyr/article/16/3/fow025/2467777 by guest on 30 September 2021 and topology of yeasts aquaporins and aquaglyceroporins Farzana Sabir1,2,∗,†, Maria C. Loureiro-Dias1 and Catarina Prista1 1LEAF, Instituto Superior de Agronomia, University of Lisbon, Tapada da Ajuda, 1349-017 Lisbon, Portugal and 2Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, University of Lisbon, 1649-003 Lisbon, Portugal ∗Corresponding author: LEAF, Instituto Superior de Agronomia, Universidade de Lisboa, Tapada da Ajuda, 1349-017 Lisboa, Portugal. Tel: (+351)-213653207; Fax: (+351)-213653195; E-mail: [email protected] One sentence summary: This review summarizes a detailed analysis of water and glycerol channels in yeasts and explores the relationship between their existence and adaptation of yeasts in various ecological niches. Editor: Jens Nielsen †Farzana Sabir, http://orcid.org/0000-0002-0181-989X ABSTRACT Efficient homeostasis of water and glycerol is a prerequisite for osmoregulation and other aspects of yeasts life. The cellular status of these molecules is often associated with functional presence of aquaporins and aquaglyceroporins. The present study provides a detailed updated analysis of aquaporins and aquaglyceroporins in 47 yeast species. A comprehensive analysis of aquaporins and aquaglyceroporins in 38 strains of Saccharomyces cerevisiae from different ecological niches is also presented. The functionality of specific aquaporins in yeasts has been associated with their adaptation requirements in different environmental conditions. In the present study, various inactivating mutations in aquaporin sequences were found in strains of S.
    [Show full text]
  • Nuclear Receptor Regulation of Aquaglyceroporins in Metabolic Organs
    International Journal of Molecular Sciences Review Nuclear Receptor Regulation of Aquaglyceroporins in Metabolic Organs Matteo Tardelli ID , Thierry Claudel, Francesca Virginia Bruschi ID and Michael Trauner * Hans Popper Laboratory of Molecular Hepatology, Division of Gastroenterology & Hepatology, Internal Medicine III, Medical University of Vienna, Währinger Gürtel 18-20, A-1090 Vienna, Austria; [email protected] (M.T.); [email protected] (T.C.); [email protected] (F.V.B.) * Correspondence: [email protected]; Tel.: +43-1-40-40047410; Fax: +43-1-40-4004735 Received: 16 May 2018; Accepted: 13 June 2018; Published: 15 June 2018 Abstract: Nuclear receptors, such as the farnesoid X receptor (FXR) and the peroxisome proliferator-activated receptors gamma and alpha (PPAR-γ,-α), are major metabolic regulators in adipose tissue and the liver, where they govern lipid, glucose, and bile acid homeostasis, as well as inflammatory cascades. Glycerol and free fatty acids are the end products of lipid droplet catabolism driven by PPARs. Aquaporins (AQPs), a family of 13 small transmembrane proteins, facilitate the shuttling of water, urea, and/or glycerol. The peculiar role of AQPs in glycerol transport makes them pivotal targets in lipid metabolism, especially considering their tissue-specific regulation by the nuclear receptors PPARγ and PPARα. Here, we review the role of nuclear receptors in the regulation of glycerol shuttling in liver and adipose tissue through the function and expression of AQPs. Keywords: aquaporins; nuclear receptors; glycerol; metabolism 1. Introduction Glycerol is a necessary constituent of triglyceride (TG) backbones. TGs are the main source of energy storage for the human body, taking part in metabolic processes such as fatty acid oxidation, and the biosynthesis of other lipid molecules and lipoproteins [1].
    [Show full text]
  • Regulation and Transport Mechanisms of Eukaryotic Aquaporins
    Regulation and Transport Mechanisms of Eukaryotic Aquaporins Madelene Palmgren AKADEMISK AVHANDLING Akademisk avhandling för filosofie doktorsexamen i Naturvetenskap, som med tillstånd från Naturvetenskapliga fakulteten kommer att offentligt försvaras fredag den 1, februari, 2013 kl. 09:30 i Arvid Carlsson, Institutionen för kemi och molekylärbiologi, Medicinaregatan 3, Göteborg. Regulation and Transport Mechanisms of Eukaryotic Aquaporins Doctoral thesis. Department of Chemistry and Molecular Biology, Microbiology, University of Gothenburg, Box 462, SE-405 30 Göteborg, Sweden. ISBN 978-91-628-8607-3 First edition Copyright © 2013 Cover illustration: Tiles representing high resolution structure of Aqy1 from P. pastoris. Glycerol uptake in three different strains; P. pastoris X33 (wild type), P. pastoris GS115 aqy1∆ and P. pastoris GS115 aqy1∆agp1∆. Circular dichroism spectra of purified human AQP3 and human AQP7 as detergent protein complex and reconstituted into proteliposomes. Printed and bound by Ineko AB 2013. “There is no such thing as failure. There are only results” - Tony Robins List of publication Paper I Crystal structure of yeast aquaporin at 1.15Å reveals novel gating mechanism Gerhard Fischer, Urszula Kosinska-Eriksson, Camilo Aponte-Santamaría, Madelene Palmgren, Cecilia Geijer, Kristina Hedfalk, Stefan Hohmann, Bert L. de Groot, Richard Neutze, Karin Lindkvist-Petersson (2009) PLoS Biol 7, e1000130 Paper II Yeast aquaglyceroporins use the transmembrane core to restrict glycerol transport. Geijer C, Ahmadpour D, Palmgren M, Filipsson C, Klein DM, Tamás MJ, Hohmann S, Lindkvist-Petersson K J Biol Chem. 2012 Jul 6;287(28):23562-70 Paper III Differences in transport efficiency and specificity of aquaglyceroporins explain novel roles in human health and disease Madelene Palmgren, Cecilia Geijer, Stefanie Eriksson, Samo Lasic, Peter Dahl, Karin Elbing, Daniel Topgaard, Karin Lindkvist-Petersson Submitted to J Biol Chem.
    [Show full text]
  • Aquaporin 9 Is the Major Pathway for Glycerol Uptake by Mouse Erythrocytes, with Implications for Malarial Virulence
    Aquaporin 9 is the major pathway for glycerol uptake by mouse erythrocytes, with implications for malarial virulence Yangjian Liu*†, Dominique Promeneur*†, Aleksandra Rojek‡, Nirbhay Kumar§, Jørgen Frøkiær‡, Søren Nielsen‡, Landon S. King¶, Peter Agre*ʈ, and Jennifer M. Carbrey*ʈ *Department of Cell Biology, Duke University Medical Center, Durham, NC 27710; †Department of Biological Chemistry and ¶Division of Pulmonary and Critical Care Medicine, Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; ‡Water and Salt Research Center, University of Aarhus, DK-8000 Aarhus, Denmark; and §Department of Molecular Microbiology and Immunology and Malaria Research Institute, The Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205 Contributed by Peter Agre, June 11, 2007 (sent for review October 24, 2006) Human and rodent erythrocytes are known to be highly permeable to facilitates the release of glycerol, which can then be transported glycerol. Aquaglyceroporin aquaporin (AQP)3 is the major glycerol through the blood to the liver, where it is taken up by hepatocytes channel in human and rat erythrocytes. However, AQP3 expression for gluconeogenesis via AQP9, which is also up-regulated by has not been observed in mouse erythrocytes. Here we report the fasting (6, 7). AQP7-null mice have been shown to exhibit presence of an aquaglyceroporin, AQP9, in mouse erythrocytes. AQP9 reduced glycerol release from adipocytes into the bloodstream levels rise as reticulocytes mature into erythrocytes and as neonatal during prolonged fasting (8), and these mice develop adult-onset pups develop into adult mice. Mice bearing targeted disruption of obesity (9, 10). As expected, the serum glycerol concentration is both alleles encoding AQP9 have erythrocytes that appear morpho- higher in AQP9-null mice compared with WT mice (11).
    [Show full text]
  • Arsenic and Antimony Transporters in Eukaryotes
    Int. J. Mol. Sci. 2012, 13, 3527-3548; doi:10.3390/ijms13033527 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Review Arsenic and Antimony Transporters in Eukaryotes Ewa Maciaszczyk-Dziubinska *, Donata Wawrzycka and Robert Wysocki * Department of Genetics and Cell Physiology, Institute of Plant Biology, University of Wroclaw, Kanonia 6/8, 50-328 Wroclaw, Poland; E-Mail: [email protected] * Authors to whom correspondence should be addressed; E-Mails: [email protected] (E.M.-D.); [email protected] (R.W.); Tel.: +48-713-754-126 (R.W.); Fax: +48-713-754-118 (R.W.). Received: 10 February 2012; in revised form: 29 February 2012 / Accepted: 7 March 2012 / Published: 15 March 2012 Abstract: Arsenic and antimony are toxic metalloids, naturally present in the environment and all organisms have developed pathways for their detoxification. The most effective metalloid tolerance systems in eukaryotes include downregulation of metalloid uptake, efflux out of the cell, and complexation with phytochelatin or glutathione followed by sequestration into the vacuole. Understanding of arsenic and antimony transport system is of high importance due to the increasing usage of arsenic-based drugs in the treatment of certain types of cancer and diseases caused by protozoan parasites as well as for the development of bio- and phytoremediation strategies for metalloid polluted areas. However, in contrast to prokaryotes, the knowledge about specific transporters of arsenic
    [Show full text]
  • Comparative Functional Analysis of Aquaporins/Glyceroporins in Mammals and Anurans" (2007)
    University of Dayton eCommons Biology Faculty Publications Department of Biology 7-2007 Comparative Functional Analysis of Aquaporins/ Glyceroporins in Mammals and Anurans Carissa M. Krane University of Dayton, [email protected] David L. Goldstein Wright State University Follow this and additional works at: https://ecommons.udayton.edu/bio_fac_pub Part of the Biology Commons, Biotechnology Commons, Cell Biology Commons, Genetics Commons, Microbiology Commons, and the Molecular Genetics Commons eCommons Citation Krane, Carissa M. and Goldstein, David L., "Comparative Functional Analysis of Aquaporins/Glyceroporins in Mammals and Anurans" (2007). Biology Faculty Publications. 134. https://ecommons.udayton.edu/bio_fac_pub/134 This Article is brought to you for free and open access by the Department of Biology at eCommons. It has been accepted for inclusion in Biology Faculty Publications by an authorized administrator of eCommons. For more information, please contact [email protected], [email protected]. Comparative functional analysis of aquaporins/glyceroporins in mammals and anurans Carissa M. Krane and David L. Goldstein Abstract Maintenance of fluid homeostasis is critical to establishing and maintaining normal physiology. The landmark discovery of membrane water channels (aquaporins; AQPs) ushered in a new area in osmoregulatory biology that has drawn from and contributed to diverse branches of biology, from molecular biology and genomics to systems biology and evolution, and from microbial and plant biology to animal and translational physiology. As a result, the study of AQPs provides a unique and integrated backdrop for exploring the relationships between genes and genome systems, the regulation of gene expression, and the physiologic consequences of genetic variation. The wide species distribution of AQP family members and the evolutionary conservation of the family indicate that the control of membrane water flux is a critical biological process.
    [Show full text]
  • AQPX-Cluster Aquaporins and Aquaglyceroporins Are
    ARTICLE https://doi.org/10.1038/s42003-021-02472-9 OPEN AQPX-cluster aquaporins and aquaglyceroporins are asymmetrically distributed in trypanosomes ✉ ✉ Fiorella Carla Tesan 1,2, Ramiro Lorenzo 3, Karina Alleva 1,2,4 & Ana Romina Fox 3,4 Major Intrinsic Proteins (MIPs) are membrane channels that permeate water and other small solutes. Some trypanosomatid MIPs mediate the uptake of antiparasitic compounds, placing them as potential drug targets. However, a thorough study of the diversity of these channels is still missing. Here we place trypanosomatid channels in the sequence-function space of the large MIP superfamily through a sequence similarity network. This analysis exposes that trypanosomatid aquaporins integrate a distant cluster from the currently defined MIP 1234567890():,; families, here named aquaporin X (AQPX). Our phylogenetic analyses reveal that trypano- somatid MIPs distribute exclusively between aquaglyceroporin (GLP) and AQPX, being the AQPX family expanded in the Metakinetoplastina common ancestor before the origin of the parasitic order Trypanosomatida. Synteny analysis shows how African trypanosomes spe- cifically lost AQPXs, whereas American trypanosomes specifically lost GLPs. AQPXs diverge from already described MIPs on crucial residues. Together, our results expose the diversity of trypanosomatid MIPs and will aid further functional, structural, and physiological research needed to face the potentiality of the AQPXs as gateways for trypanocidal drugs. 1 Universidad de Buenos Aires, Facultad de Farmacia y Bioquímica, Departamento de Fisicomatemática, Cátedra de Física, Buenos Aires, Argentina. 2 CONICET-Universidad de Buenos Aires, Instituto de Química y Fisicoquímica Biológicas (IQUIFIB), Buenos Aires, Argentina. 3 Laboratorio de Farmacología, Centro de Investigación Veterinaria de Tandil (CIVETAN), (CONICET-CICPBA-UNCPBA) Facultad de Ciencias Veterinarias, Universidad Nacional del Centro ✉ de la Provincia de Buenos Aires, Tandil, Argentina.
    [Show full text]
  • Aquaglyceroporin Expression and Regulation in Erythrocytes From
    AQUAGLYCEROPORIN EXPRESSION AND REGULATION IN ERYTHROCYTES FROM FREEZE TOLERANT COPE’S GRAY TREEFROG, HYLA CHRYSOSCELIS Dissertation Submitted to The College of Arts and Sciences of the UNIVERSITY OF DAYTON In Partial Fulfillment of the Requirements for The Degree Doctor of Philosophy in Biology By Venkateshwar Mutyam UNIVERSITY OF DAYTON Dayton, Ohio May, 2013 AQUAGLYCEROPORIN EXPRESSION AND REGULATION IN ERYTHROCYTES FROM FREEZE TOLERANT COPE’S GRAY TREEFROG, HYLA CHRYSOSCELIS. Name: Mutyam, Venkateshwar APPROVED BY: Carissa M. Krane, Ph.D. Faculty Advisor David Goldstein, Ph.D. Committee Member Amit Singh, Ph.D. Committee Member Panagiotis A. Tsonis, Ph.D. Committee Member Shirley J. Wright, Ph.D. Committee Member ii © Copyright by Venkateshwar Mutyam All rights reserved 2013 iii ABSTRACT AQUAGLYCEROPORIN EXPRESSION AND REGULATION IN ERYTHROCYTES FROM FREEZE TOLERANT COPE’S GRAY TREEFROG, HYLA CHRYSOSCELIS. Name: Mutyam, Venkateshwar University of Dayton Advisor: Dr. Carissa M. Krane, Ph.D. Cope’s gray treefrog, Hyla chrysoscelis is a freeze tolerant anuran that accumulates glycerol as a cryoprotectant during cold acclimation. Aquaporins, members of the major intrinsic protein (MIP) family of transmembrane water pores, may play an important role in the mechanism of freeze tolerance by mediating glycerol and water transport across cell membranes. Thus, we hypothesize that HC-3, an ortholog of mammalian aquaglyceroporin AQP3, enhances membrane permeability to glycerol, facilitating the cellular response to osmotic gradients formed when extracellular water freezes. To address the hypothesis, erythrocytes from H. chrysoscelis were used as an in vitro cell culture model to study the regulation of HC-3 protein expression. Compared with warm- acclimated frogs, erythrocytes from cold-acclimated frogs showed abundant HC-3 protein and enhanced plasma membrane localization of HC-3.
    [Show full text]
  • The Ionophores CCCP and Gramicidin but Not Nigericin Inhibit Trypanosoma Brucei Aquaglyceroporins at Neutral Ph
    cells Article The Ionophores CCCP and Gramicidin but Not Nigericin Inhibit Trypanosoma brucei Aquaglyceroporins at Neutral pH Lea Madlen Petersen and Eric Beitz * Pharmaceutical and Medicinal Chemistry, Christian-Albrechts-University Kiel, 24118 Kiel, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-431-880-1809 Received: 25 September 2020; Accepted: 20 October 2020; Published: 21 October 2020 Abstract: Human African trypanosomiasis (HAT) is caused by Trypanosoma brucei parasites. The T. brucei aquaglyceroporin isoform 2, TbAQP2, has been linked to the uptake of pentamidine. Negative membrane potentials and transmembrane pH gradients were suggested to promote transport of the dicationic antitrypanosomal drug. Application of ionophores to trypanosomes further hinted at direct inhibition of TbAQP2 by carbonyl cyanide m-chlorophenyl hydrazone (CCCP). Here, we tested for direct effects of three classical ionophores (CCCP, nigericin, gramicidin) on the functionality of TbAQP2 and the related TbAQP3 at conditions that are independent from the membrane potential or a proton gradient. We expressed TbAQP2 and TbAQP3 in yeast, and determined permeability of uncharged glycerol at neutral pH using stopped-flow light scattering. The mobile proton carrier CCCP directly inhibited TbAQP2 glycerol permeability at an IC50 of 2 µM, and TbAQP3 to a much lesser extent (IC50 around 1 mM) likely due to different selectivity filter layouts. Nigericin, another mobile carrier, left both isoforms unaffected. The membrane-integral pore-forming gramicidin evenly inhibited TbAQP2 and TbAQP2 in the double-digit micromolar range. Our data exemplify the need for suitable controls to detect unwanted ionophore side effects even when used at concentrations that are typically recommended to disturb the transmembrane ion distribution.
    [Show full text]
  • Plant Aquaporins: the Origin of Nips
    bioRxiv preprint doi: https://doi.org/10.1101/351064; this version posted July 2, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Plant aquaporins: the origin of NIPs Adrianus C. Borstlap Poppelenburg 50, 4191ZT Geldermalsen, The Netherlands [email protected] ______________________________________________________________________ Many of the aquaporin genes in Cyanobacteria belong to the AqpN-clade. This clade was also the cradle of plant NIPs (nodulin-26 like intrinsic proteins) whose members are transporters for glycerol and several hydroxylated metalloids. The superphylum of Archaeplastida acquired the primordial NIP-gene most likely from the cyanobacterium that, some 1500 million years ago, became the ancestor of all plastids. Nodulin-26 is the major protein in the peribacteroid membrane of soybean nodules. Its coding gene was identified in 1987 and appeared to be related to the gene of the major intrinsic protein of the bovine eye lens and that of the glycerol facilitator of Escherichia coli [1,2]. After the protein CHIP28 from erythrocytes joined the club [3] and was characterized as the first water channel or aquaporin protein [4], the family of ‘Major Intrinsic Proteins (MIPs)’ or ‘Aquaporins’ came into view. The protein family consists of two major clades: the clade of aquaporins sensu stricto, which function mainly as water channels, and that of the glycerol facilitators (GlpF clade or GIPs, GlpF-like intrinsic proteins). Representatives of both clades are widely distributed in all life forms [5-9].
    [Show full text]
  • Annual Report 2014 Contents
    IMPACT 64th Lindau Nobel Laureate Meeting Physiology & Medicine 5th Lindau Meeting on Economic Sciences Outreach Projects & Mission Education Annual Report 2014 Contents Preface 4 Outreach Projects & Mission Education Articles, Interviews & Contributions Lindau Mediatheque The Origin of Ideas 8 Understanding Better How People Make Choices 72 The 2014 Lindau Meetings Interview with Oliver Smithies – A record of Daniel McFadden’s lecture Historical lectures 101 a testimony of intellectual experiences 64th Lindau Nobel Laureate Meeting 24 Innovation and Human Flourishing 74 Mini Lectures 96 The Importance of Scientific Advice 10 According to Edmund Phelps, a loss of dynamism 5th Lindau Meeting on Economic Sciences 34 Nobel Labs 360° 94 Keynote address by Federal Chancellor Angela Merkel threatens our prosperity Application in School Education 96 The Sages of the Future 14 A Tough Balance: Cancer Research and Motherhood 78 The Economist editor Geoffrey Carr on An interview with a Lindau alumna on her experiences Participants, Partners, Supporters the value of intergenerational dialogue Could a Cow Virus Cause Colon Cancer? 82 Teaching Spirit 98 Different Generations – One Passion 16 Nobel Laureates 25 35 A closer look on Harald zur Hausen’s arguments Lindau Alumni Network 115 A plea for intergenerational dialogue Young Scientists 44 44 How Markets Can Overcome the Yuk Factor 84 Exhibition “The Lindau Nobel Laureate 102 The Fascination of How Things Work 18 Academic Partners 39 41 A summary of Alvin Roth’s lecture Meetings: Now and Then” Interview with Erwin Neher on the motives of being a scientist Supporters 134 136 Collaboration in Research 86 Exhibition “Sketches of Science” 108 Retrospect on the 64th Lindau Nobel Laureate Meeting 22 Reflections on the advantages of joint graduate papers “NOBELS” – Nobel Laureates photographed 30 by the Scientific Chairmen Klas Kärre and Stefan H.E.
    [Show full text]