Polish Journal of Microbiology ORIGINAL PAPER 2020, Vol. 69, Article in Press https://doi.org/10.33073/pjm-2020-032 Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris RUI YANG1, GUOYANG XU1, XIAOYOU WANG1, ZHICHU QING2 and LIZHI FU1* 1 Chongqing Academy of Animal Science, Chongqing, China 2 Chongqing Nanchuan Animal Disease Prevention And Control Center, Chongqing, China Submitted 3 May 2020, revised 2 July 2020, accepted 8 July 2020 Abstract Proteus species are common opportunistic bacteria and foodborne pathogens. The proper detection of Proteus can effectively reduce the occurrence of food-borne public health events. Proteus mirabilis and Proteus vulgaris are the two most important pathogens in the Proteus genus. In this study, a dual TaqMan Real-Time PCR method was established to simultaneously detect and distinguish P. mirabilis and P. vulgaris in samples. The method exhibited good specificity, stability, and sensitivity. Specifically, the minimum detection concentrations of P. mirabilis and P. vulgaris in pure bacterial cultures were 6.08 × 102 colony forming units (CFU)/ml and 4.46 × 102 CFU/ml, respectively. Additionally, the minimum detectable number of P. mirabilis and P. vulgaris in meat and milk was 103 CFU/g. In addition, the method can be used to distinguish between strains of P. mirabilis and P. vulgaris within two hours. Overall, it is a sensitive, easy-to-use, and practical test for the identification and classification of Proteus in food. K e y w o r d s: Proteus mirabilis, Proteus vulgaris, TaqMan Real-Time PCR, food-borne pathogens, food poisoning Introduction such as LPS, hemolysin, and O-antigen (Drzewiecka 2016; Hamilton et al. 2018). Because people living in Bacterial food-borne diseases are an increasing pub- developed countries generally have access to improved lic health concern to the World Health Organization sanitation, food poisoning caused by Proteus is less (Johnson 2011). The consumption of food and drink- common. However, researchers from developed coun- ing water contaminated by pathogenic bacteria is the tries also recently noted that Proteus strains are closely leading cause of food-borne disease outbreaks (Park associated with GI diseases. Hamilton and coworkers et al. 2011). More than 250 types of foodborne diseases (Hamilton et al. 2018) revealed that P. mirabilis and caused by the pathogen with various virulence genes P. vulgaris were essential for the pathogenesis of infec- have been identified (Mangal et al. 2016). In recent tions in the GI tract and called on other researchers years, the number of food-borne diseases caused by to pay closer attention to the role of these two species. Proteus, including vomiting, gastroenteritis, and acute In developing countries that are highly populated (e.g., diarrhea, has been increasing. China), Proteus species are among the leading bacte- Proteus species are Gram-negative bacteria belong- rial causes of food poisoning. In 1996, the Ministry ing to the Morganellaceae family that widely exist in of Health of the People’s Republic of China issued the nature (Adeolu et al. 2016; Drzewiecka 2016). The WS/T 9-1996: Diagnostic Criteria and Principles of genus mainly includes Proteus mirabilis, Proteus vul- Management for Food Poisoning of Proteus, which garis, Proteus penneri, Proteus hauseri, Proteus terrae, remains in effect. The document explicitly states that Proteus cibarius, unnamed geomospecies 4, 5, and 6 Proteus can easily contaminate animal food, and there- (Behrendt et al. 2015, Gu et al. 2020). P. mirabilis and fore, inspections for animal food safety should include P. vulgaris are the most well-known species in the the identification and classification of Proteus strains. genus Proteus, and they carry several virulence factors In 2008, Beijing reported a case of collective food poi- that contribute to gastrointestinal (GI) pathogenesis, soning caused by P. mirabilis, in which 13 individuals * Corresponding author: L.Z. Fu, Chongqing Academy of Animal Science, Chongqing, China; e-mail: [email protected] © 2020 Rui Yang et al. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License (https://creativecommons. org/licenses/by-nc-nd/4.0/). 2 Yang R. et al. 3 displayed symptoms related to food poisoning, including Table I fever, vomiting, and diarrhea (Wang et al. 2010). China Bacterial strains used in the specificity assessment. recorded 2,795 foodborne illness outbreaks between Strain Origin FAM HEX 2003 and 2008; in particular, there were 110 (3.93%) public health crises caused by Proteus species as food- Proteus mirabilis CVCC4106 + – borne pathogens, resulting in 3,093 individuals to have Proteus mirabilis CVCC1969 + – symptoms of food poisoning (Wu et al. 2018). Proteus mirabilis ATCC35659 + – In developed countries, researchers generally do not Proteus mirabilis CMCC49001 + – consider Proteus as a foodborne pathogen, and thus, Proteus mirabilis Isolated by lab + – they pay little attention to the identification of Proteus Proteus mirabilis Isolated by lab + – in food. Surprisingly, no study has reported the use Proteus mirabilis Isolated by lab + – of quantitative fluorescence PCR (Q-PCR) to identify Proteus mirabilis Isolated by lab + – P. vulgaris even though the technique has already been Proteus vulgaris ATCC6896 – + applied to the detection of P. mirabilis (Liu et al. 2019). Proteus vulgaris CMCC 49008 – + At present, 16S ribosomal RNA (rRNA) sequencing, Proteus vulgaris CMCC49027 – + selective media, biochemical identification, and sero- Proteus vulgaris CMCC 49105 – + logical tests remain the mainstay modalities for dis- Proteus vulgaris Isolated by lab – + tinguishing between strains of P. mirabilis and P. vul- Proteus vulgaris Isolated by lab – + garis (O’Hara et al. 2000). In this study, we used a dual Proteus vulgaris Isolated by lab – + TaqMan Real-Time PCR for the rapid and accurate identification and classification of P. mirabilis and Proteus penneri ATCC 33519 – – P. vulgaris in food samples. Proteus penneri NTCC 35198 – – Providencia rettgeri ATCC 31052 – – Providencia rettgeri CVCC3947 – – Experimental Morganella morganii ATCC9237 – – Morganella morganii CICC71786 – – Materials and Methods Salmonella ATCC14028 – – Salmonella CVCC2227 – – Reagents, instruments and bacterial strains. Bac- Salmonella Isolated by lab – – terial strains: thirty-six strains, including eight strains Salmonella Isolated by lab – – of P. mirabilis (four standard strains, and four clinical Escherichia coli CICC52719 – – isolates), seven strains of P. vulgaris (four standard Escherichia coli Isolated by lab – – strains, and three clinical isolates) and 21 other strains Escherichia coli Isolated by lab – – (Table I), were used in this study. Bacteria were cultured Staphylococcus aureus ATCC25923 – – according to Bergey’s Manual of Systematic Bacterio- Staphylococcus aureus Isolated by lab – – logy (9th edition) (Garrity et al. 2004). Reagents: The Premix Ex TaqTM (Probe qPCR) Campylobacter jejuni CICC 22936 – – was purchased from TaKaRa (Japan), Bacterial DNA Campylobacter jejuni Isolated by lab – – and Gel Extraction Kits were purchased from OMEGA Mannheimia haemolytica ATCC29695 – – (USA), and the QIAamp PowerFecal QIAcube HT Kit Pseudomonas aeruginosa Isolated by lab – – was from QIAGEN (Germany). Lactobacillus acidophilus CICC6074 – – Instruments: The LightCycler96 fluorescence quan- Bacillus subtilis CICC20445 – – titative polymerase chain reaction (PCR) instrument ATCC – American Type Culture Collection; CICC – China Center of was purchased from Roche (Switzerland), the QIAcune Industrial Culture Collection; CMCC – China Medical Culture Col- HT automatic nucleic acid extraction system was lection; CVCC – China Veterinary Culture Collection Center, NTCC purchased from QIAGEN (Germany), and the Nano- – National Type Culture Collection, China drop-2000 ultramicro nucleic acid protein analyzer was from Thermo Fisher (USA). and all primers were compared and analyzed by BLAST Target genes, primers, and probes. We analyzed the to ensure their specificity. The primers and probes were gene sequences of Proteus species published in Gene- synthesized by Sangon Biotech (Shanghai) Co., Ltd., and Bank, compared the nucleotide sequences of the 16s the nucleotide sequences are shown in Table II. rRNA, tuf, rpoB, atpD, ureR, blaA, and blaB genes, and Genomic DNA extraction. The Bacterial DNA Kit the ureR and blaB were selected as the target genes for was used to extract DNA from fresh bacterial culture the test. Primer Premier 6.0 (Premier Biosoft, CA, USA) medium (24 h). The QIAamp PowerFecal QIAcube was used to design two pairs of primers and two probes, HT Kit was used to extract bacterial DNA from meat 3 A dual method for Proteus 3 Table II Primer and TaqMan probe sequences used in this study. Target Accession Primer Amplicon Pathogen Sequence (5’ → 3’) gene number (position) length (bp) 64F ACTACCCATCAGATTATGTCAT Proteus mirabilis ureR CP044134.1 165R CTGTTTGAGGAAAATGCAATTTA 101 136P FAM-ATTCACACCCTACCCAACATTCAT-BHQ1 503F TCGTAAAGAGCCTGAATTAA Proteus vulgaris blaB D37831.1 732R ATCACCACTACCGGTTTTATC 229 532P HEX-TCATGGTGATCCTCGTGATACTA-BHQ1 and milk according to the manufacturer’s instructions. soy agar plates (three parallel controls were prepared). The purity and concentration of template DNA were The number of colony-forming units (CFU)/ml was detected using a Nanodrop-2000. determined by plate counting. Then, the genomic DNA Preparation of