DOCSLIB.ORG

Establishment and Application of a Dual Taqman Real-Time PCR Methodfor Proteus Mirabilis and Proteus Vulgaris

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Establishment and Application of a Dual Taqman Real-Time PCR Methodfor Proteus Mirabilis and Proteus Vulgaris Polish Journal of Microbiology ORIGINAL PAPER 2020, Vol. 69, Article in Press https://doi.org/10.33073/pjm-2020-032 Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris RUI YANG1, GUOYANG XU1, XIAOYOU WANG1, ZHICHU QING2 and LIZHI FU1* 1 Chongqing Academy of Animal Science, Chongqing, China 2 Chongqing Nanchuan Animal Disease Prevention And Control Center, Chongqing, China Submitted 3 May 2020, revised 2 July 2020, accepted 8 July 2020 Abstract Proteus species are common opportunistic bacteria and foodborne pathogens. The proper detection of Proteus can effectively reduce the occurrence of food-borne public health events. Proteus mirabilis and Proteus vulgaris are the two most important pathogens in the Proteus genus. In this study, a dual TaqMan Real-Time PCR method was established to simultaneously detect and distinguish P. mirabilis and P. vulgaris in samples. The method exhibited good specificity, stability, and sensitivity. Specifically, the minimum detection concentrations of P. mirabilis and P. vulgaris in pure bacterial cultures were 6.08 × 102 colony forming units (CFU)/ml and 4.46 × 102 CFU/ml, respectively. Additionally, the minimum detectable number of P. mirabilis and P. vulgaris in meat and milk was 103 CFU/g. In addition, the method can be used to distinguish between strains of P. mirabilis and P. vulgaris within two hours. Overall, it is a sensitive, easy-to-use, and practical test for the identification and classification of Proteus in food. K e y w o r d s: Proteus mirabilis, Proteus vulgaris, TaqMan Real-Time PCR, food-borne pathogens, food poisoning Introduction such as LPS, hemolysin, and O-antigen (Drzewiecka 2016; Hamilton et al. 2018). Because people living in Bacterial food-borne diseases are an increasing pub- developed countries generally have access to improved lic health concern to the World Health Organization sanitation, food poisoning caused by Proteus is less (Johnson 2011). The consumption of food and drink- common. However, researchers from developed coun- ing water contaminated by pathogenic bacteria is the tries also recently noted that Proteus strains are closely leading cause of food-borne disease outbreaks (Park associated with GI diseases. Hamilton and coworkers et al. 2011). More than 250 types of foodborne diseases (Hamilton et al. 2018) revealed that P. mirabilis and caused by the pathogen with various virulence genes P. vulgaris were essential for the pathogenesis of infec- have been identified (Mangal et al. 2016). In recent tions in the GI tract and called on other researchers years, the number of food-borne diseases caused by to pay closer attention to the role of these two species. Proteus, including vomiting, gastroenteritis, and acute In developing countries that are highly populated (e.g., diarrhea, has been increasing. China), Proteus species are among the leading bacte- Proteus species are Gram-negative bacteria belong- rial causes of food poisoning. In 1996, the Ministry ing to the Morganellaceae family that widely exist in of Health of the People’s Republic of China issued the nature (Adeolu et al. 2016; Drzewiecka 2016). The WS/T 9-1996: Diagnostic Criteria and Principles of genus mainly includes Proteus mirabilis, Proteus vul- Management for Food Poisoning of Proteus, which garis, Proteus penneri, Proteus hauseri, Proteus terrae, remains in effect. The document explicitly states that Proteus cibarius, unnamed geomospecies 4, 5, and 6 Proteus can easily contaminate animal food, and there- (Behrendt et al. 2015, Gu et al. 2020). P. mirabilis and fore, inspections for animal food safety should include P. vulgaris are the most well-known species in the the identification and classification of Proteus strains. genus Proteus, and they carry several virulence factors In 2008, Beijing reported a case of collective food poi- that contribute to gastrointestinal (GI) pathogenesis, soning caused by P. mirabilis, in which 13 individuals * Corresponding author: L.Z. Fu, Chongqing Academy of Animal Science, Chongqing, China; e-mail: [email protected] © 2020 Rui Yang et al. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License (https://creativecommons. org/licenses/by-nc-nd/4.0/). 2 Yang R. et al. 3 displayed symptoms related to food poisoning, including Table I fever, vomiting, and diarrhea (Wang et al. 2010). China Bacterial strains used in the specificity assessment. recorded 2,795 foodborne illness outbreaks between Strain Origin FAM HEX 2003 and 2008; in particular, there were 110 (3.93%) public health crises caused by Proteus species as food- Proteus mirabilis CVCC4106 + – borne pathogens, resulting in 3,093 individuals to have Proteus mirabilis CVCC1969 + – symptoms of food poisoning (Wu et al. 2018). Proteus mirabilis ATCC35659 + – In developed countries, researchers generally do not Proteus mirabilis CMCC49001 + – consider Proteus as a foodborne pathogen, and thus, Proteus mirabilis Isolated by lab + – they pay little attention to the identification of Proteus Proteus mirabilis Isolated by lab + – in food. Surprisingly, no study has reported the use Proteus mirabilis Isolated by lab + – of quantitative fluorescence PCR (Q-PCR) to identify Proteus mirabilis Isolated by lab + – P. vulgaris even though the technique has already been Proteus vulgaris ATCC6896 – + applied to the detection of P. mirabilis (Liu et al. 2019). Proteus vulgaris CMCC 49008 – + At present, 16S ribosomal RNA (rRNA) sequencing, Proteus vulgaris CMCC49027 – + selective media, biochemical identification, and sero- Proteus vulgaris CMCC 49105 – + logical tests remain the mainstay modalities for dis- Proteus vulgaris Isolated by lab – + tinguishing between strains of P. mirabilis and P. vul- Proteus vulgaris Isolated by lab – + garis (O’Hara et al. 2000). In this study, we used a dual Proteus vulgaris Isolated by lab – + TaqMan Real-Time PCR for the rapid and accurate identification and classification of P. mirabilis and Proteus penneri ATCC 33519 – – P. vulgaris in food samples. Proteus penneri NTCC 35198 – – Providencia rettgeri ATCC 31052 – – Providencia rettgeri CVCC3947 – – Experimental Morganella morganii ATCC9237 – – Morganella morganii CICC71786 – – Materials and Methods Salmonella ATCC14028 – – Salmonella CVCC2227 – – Reagents, instruments and bacterial strains. Bac- Salmonella Isolated by lab – – terial strains: thirty-six strains, including eight strains Salmonella Isolated by lab – – of P. mirabilis (four standard strains, and four clinical Escherichia coli CICC52719 – – isolates), seven strains of P. vulgaris (four standard Escherichia coli Isolated by lab – – strains, and three clinical isolates) and 21 other strains Escherichia coli Isolated by lab – – (Table I), were used in this study. Bacteria were cultured Staphylococcus aureus ATCC25923 – – according to Bergey’s Manual of Systematic Bacterio- Staphylococcus aureus Isolated by lab – – logy (9th edition) (Garrity et al. 2004). Reagents: The Premix Ex TaqTM (Probe qPCR) Campylobacter jejuni CICC 22936 – – was purchased from TaKaRa (Japan), Bacterial DNA Campylobacter jejuni Isolated by lab – – and Gel Extraction Kits were purchased from OMEGA Mannheimia haemolytica ATCC29695 – – (USA), and the QIAamp PowerFecal QIAcube HT Kit Pseudomonas aeruginosa Isolated by lab – – was from QIAGEN (Germany). Lactobacillus acidophilus CICC6074 – – Instruments: The LightCycler96 fluorescence quan- Bacillus subtilis CICC20445 – – titative polymerase chain reaction (PCR) instrument ATCC – American Type Culture Collection; CICC – China Center of was purchased from Roche (Switzerland), the QIAcune Industrial Culture Collection; CMCC – China Medical Culture Col- HT automatic nucleic acid extraction system was lection; CVCC – China Veterinary Culture Collection Center, NTCC purchased from QIAGEN (Germany), and the Nano- – National Type Culture Collection, China drop-2000 ultramicro nucleic acid protein analyzer was from Thermo Fisher (USA). and all primers were compared and analyzed by BLAST Target genes, primers, and probes. We analyzed the to ensure their specificity. The primers and probes were gene sequences of Proteus species published in Gene- synthesized by Sangon Biotech (Shanghai) Co., Ltd., and Bank, compared the nucleotide sequences of the 16s the nucleotide sequences are shown in Table II. rRNA, tuf, rpoB, atpD, ureR, blaA, and blaB genes, and Genomic DNA extraction. The Bacterial DNA Kit the ureR and blaB were selected as the target genes for was used to extract DNA from fresh bacterial culture the test. Primer Premier 6.0 (Premier Biosoft, CA, USA) medium (24 h). The QIAamp PowerFecal QIAcube was used to design two pairs of primers and two probes, HT Kit was used to extract bacterial DNA from meat 3 A dual method for Proteus 3 Table II Primer and TaqMan probe sequences used in this study. Target Accession Primer Amplicon Pathogen Sequence (5’ → 3’) gene number (position) length (bp) 64F ACTACCCATCAGATTATGTCAT Proteus mirabilis ureR CP044134.1 165R CTGTTTGAGGAAAATGCAATTTA 101 136P FAM-ATTCACACCCTACCCAACATTCAT-BHQ1 503F TCGTAAAGAGCCTGAATTAA Proteus vulgaris blaB D37831.1 732R ATCACCACTACCGGTTTTATC 229 532P HEX-TCATGGTGATCCTCGTGATACTA-BHQ1 and milk according to the manufacturer’s instructions. soy agar plates (three parallel controls were prepared). The purity and concentration of template DNA were The number of colony-forming units (CFU)/ml was detected using a Nanodrop-2000. determined by plate counting. Then, the genomic DNA Preparation of
Load more

Recommended publications
  • Proteus Vulgaris
    48 Monte Carlo Crescent Kyalami Business Park Kyalami, Johannesburg, 1684, RSA Tel: +27 (0)11 463 3260 Fax: + 27 (0)86 557 2232 Email: [email protected] www.thistle.co.za Please read this section first The HPCSA and the Med Tech Society have confirmed that this clinical case study, plus your routine review of your EQA reports from Thistle QA, should be documented as a “Journal Club” activity. This means that you must record those attending for CEU purposes. Thistle will not issue a certificate to cover these activities, nor send out “correct” answers to the CEU questions at the end of this case study. The Thistle QA CEU No is: MT- 16/009 Each attendee should claim THREE CEU points for completing this Quality Control Journal Club exercise, and retain a copy of the relevant Thistle QA Participation Certificate as proof of registration on a Thistle QA EQA. MICROBIOLOGY LEGEND CYCLE 41 ORGANISM 3 Proteus Vulgaris Proteus Vulgaris is a rod shaped Gram-Negative chemoheterotrophic bacterium. The size of the individual cells varies from 0.4 to 0.6 micrometers by 1.2 to 2.5 micrometers. P. vulgaris possesses peritrichous flagella, making it actively motile. It inhabits the soil, polluted water, raw meat, gastrointestinal tracts of animals and dust. In humans, Proteus species most frequently cause urinary tract infections, but can also produce severe abscesses and is widely associated with nosocomial infections. Isolation of Organism With basic microbiological technique, samples believed to contain P. vulgaris are first incubated on nutrient agar to form colonies. To test the Gram-Negative and oxidase-negative characteristics of Enterobacteriaceae, Gram stains and oxidase tests are performed.
    [Show full text]
  • Transposon Mutagenesis in Proteus Mirabilist
    JOURNAL OF BACTERIOLOGY, OCt. 1991, p. 6289-6293 Vol. 173, No. 19 0021-9193/91/196289-05$02.00/0 Copyright © 1991, American Society for Microbiology NOTES Transposon Mutagenesis in Proteus mirabilist ROBERT BELAS,1,2* DEBORAH ERSKINE,1 ANID DAVID FLAHERTY1 Center of Marine Biotechnology, The University of Maryland, 600 East Lombard Street, Baltimore, Maryland 21202,1* and Department ofBiological Sciences, University of Maryland Baltimore County, Baltimore, Maryland 212282 Received 21 June 1991/Accepted 24 July 1991 A technique of transposon mutagenesis involving the use of TnS on a suicide plasmid was developed for Proteus mirabilis. Analysis of the resulting exconjugants indicated that TnS transposed in P. mirabilis at a frequency of ca. 4.5 x 10-6 per recipient cell. The resulting mutants were stable and retained the transposon-encoded antibiotic resistance when incubated for several generations under nonselective conditions. The frequency of auxotrophic mutants in the population, as well as DNA-DNA hybridization to transposon sequences, confirmed that the insertion of the transposon was random and the Proteus chromosome did not contain significant insertional hot spots of transposition. Approximately 35% of the mutants analyzed possessed plasmid-acquired ampicillin resistance, although no extrachromosomal plasmid DNA was found. In these mutants, insertion of the Tn5 element and a part or all of the plasmid had occurred. Application of this technique to the study of swarmer cell differentiation in P. mirabilis is discussed. Proteus mirabilis is a motile gram-negative bacterium with Media and growth conditions. Escherichia coli and P. the unique ability to move over agar surfaces by a locomo- mirabilis strains were grown in L broth (10 g of tryptone, 5 tive process referred to as swarming motility (12).
    [Show full text]
  • Uncommon Pathogens Causing Hospital-Acquired Infections in Postoperative Cardiac Surgical Patients
    Published online: 2020-03-06 THIEME Review Article 89 Uncommon Pathogens Causing Hospital-Acquired Infections in Postoperative Cardiac Surgical Patients Manoj Kumar Sahu1 Netto George2 Neha Rastogi2 Chalatti Bipin1 Sarvesh Pal Singh1 1Department of Cardiothoracic and Vascular Surgery, CN Centre, All Address for correspondence Manoj K Sahu, MD, DNB, Department India Institute of Medical Sciences, Ansari Nagar, New Delhi, India of Cardiothoracic and Vascular Surgery, CTVS office, 7th floor, CN 2Infectious Disease, Department of Medicine, All India Institute of Centre, All India Institute of Medical Sciences, New Delhi-110029, Medical Sciences, Ansari Nagar, New Delhi, India India (e-mail: [email protected]). J Card Crit Care 2020;3:89–96 Abstract Bacterial infections are common causes of sepsis in the intensive care units. However, usually a finite number of Gram-negative bacteria cause sepsis (mostly according to the hospital flora). Some organisms such as Escherichia coli, Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus are relatively common. Others such as Stenotrophomonas maltophilia, Chryseobacterium indologenes, Shewanella putrefaciens, Ralstonia pickettii, Providencia, Morganella species, Nocardia, Elizabethkingia, Proteus, and Burkholderia are rare but of immense importance to public health, in view of the high mortality rates these are associated with. Being aware of these organisms, as the cause of hospital-acquired infections, helps in the prevention, Keywords treatment, and control of sepsis in the high-risk cardiac surgical patients including in ► uncommon pathogens heart transplants. Therefore, a basic understanding of when to suspect these organ- ► hospital-acquired isms is important for clinical diagnosis and initiating therapeutic options. This review infection discusses some rarely appearing pathogens in our intensive care unit with respect to ► cardiac surgical the spectrum of infections, and various antibiotics that were effective in managing intensive care unit these bacteria.
    [Show full text]
  • Table S4. Phylogenetic Distribution of Bacterial and Archaea Genomes in Groups A, B, C, D, and X
    Table S4. Phylogenetic distribution of bacterial and archaea genomes in groups A, B, C, D, and X. Group A a: Total number of genomes in the taxon b: Number of group A genomes in the taxon c: Percentage of group A genomes in the taxon a b c cellular organisms 5007 2974 59.4 |__ Bacteria 4769 2935 61.5 | |__ Proteobacteria 1854 1570 84.7 | | |__ Gammaproteobacteria 711 631 88.7 | | | |__ Enterobacterales 112 97 86.6 | | | | |__ Enterobacteriaceae 41 32 78.0 | | | | | |__ unclassified Enterobacteriaceae 13 7 53.8 | | | | |__ Erwiniaceae 30 28 93.3 | | | | | |__ Erwinia 10 10 100.0 | | | | | |__ Buchnera 8 8 100.0 | | | | | | |__ Buchnera aphidicola 8 8 100.0 | | | | | |__ Pantoea 8 8 100.0 | | | | |__ Yersiniaceae 14 14 100.0 | | | | | |__ Serratia 8 8 100.0 | | | | |__ Morganellaceae 13 10 76.9 | | | | |__ Pectobacteriaceae 8 8 100.0 | | | |__ Alteromonadales 94 94 100.0 | | | | |__ Alteromonadaceae 34 34 100.0 | | | | | |__ Marinobacter 12 12 100.0 | | | | |__ Shewanellaceae 17 17 100.0 | | | | | |__ Shewanella 17 17 100.0 | | | | |__ Pseudoalteromonadaceae 16 16 100.0 | | | | | |__ Pseudoalteromonas 15 15 100.0 | | | | |__ Idiomarinaceae 9 9 100.0 | | | | | |__ Idiomarina 9 9 100.0 | | | | |__ Colwelliaceae 6 6 100.0 | | | |__ Pseudomonadales 81 81 100.0 | | | | |__ Moraxellaceae 41 41 100.0 | | | | | |__ Acinetobacter 25 25 100.0 | | | | | |__ Psychrobacter 8 8 100.0 | | | | | |__ Moraxella 6 6 100.0 | | | | |__ Pseudomonadaceae 40 40 100.0 | | | | | |__ Pseudomonas 38 38 100.0 | | | |__ Oceanospirillales 73 72 98.6 | | | | |__ Oceanospirillaceae
    [Show full text]
  • Original Article COMPARISON of MAST BURKHOLDERIA CEPACIA, ASHDOWN + GENTAMICIN, and BURKHOLDERIA PSEUDOMALLEI SELECTIVE AGAR
    European Journal of Microbiology and Immunology 7 (2017) 1, pp. 15–36 Original article DOI: 10.1556/1886.2016.00037 COMPARISON OF MAST BURKHOLDERIA CEPACIA, ASHDOWN + GENTAMICIN, AND BURKHOLDERIA PSEUDOMALLEI SELECTIVE AGAR FOR THE SELECTIVE GROWTH OF BURKHOLDERIA SPP. Carola Edler1, Henri Derschum2, Mirko Köhler3, Heinrich Neubauer4, Hagen Frickmann5,6,*, Ralf Matthias Hagen7 1 Department of Dermatology, German Armed Forces Hospital of Hamburg, Hamburg, Germany 2 CBRN Defence, Safety and Environmental Protection School, Science Division 3 Bundeswehr Medical Academy, Munich, Germany 4 Friedrich Loeffler Institute, Federal Research Institute for Animal Health, Jena, Germany 5 Department of Tropical Medicine at the Bernhard Nocht Institute, German Armed Forces Hospital of Hamburg, Hamburg, Germany 6 Institute for Medical Microbiology, Virology and Hygiene, University Medicine Rostock, Rostock, Germany 7 Department of Preventive Medicine, Bundeswehr Medical Academy, Munich, Germany Received: November 18, 2016; Accepted: December 5, 2016 Reliable identification of pathogenic Burkholderia spp. like Burkholderia mallei and Burkholderia pseudomallei in clinical samples is desirable. Three different selective media were assessed for reliability and selectivity with various Burkholderia spp. and non- target organisms. Mast Burkholderia cepacia agar, Ashdown + gentamicin agar, and B. pseudomallei selective agar were compared. A panel of 116 reference strains and well-characterized clinical isolates, comprising 30 B. pseudomallei, 20 B. mallei, 18 other Burkholderia spp., and 48 nontarget organisms, was used for this assessment. While all B. pseudomallei strains grew on all three tested selective agars, the other Burkholderia spp. showed a diverse growth pattern. Nontarget organisms, i.e., nonfermentative rod-shaped bacteria, other species, and yeasts, grew on all selective agars.
    [Show full text]
  • Clinical Antibiotic Guidelines†
    CLINICAL ANTIBIOTIC GUIDELINES† ACYCLOVIR IV*/PO *RESTRICTED TO ANTIBIOTIC FORM Predictable activity: Unpredictable activity: No activity: Herpes Simplex Cytomegalovirus Epstein Barr Virus Herpes Zoster Indicated: IV: 1. Therapy for suspected or documented Herpes simplex encephalitis 2. Therapy for suspected or documented Herpes simplex infection of a newborn or immunocompromised patient 3. Therapy for primary varicella infection in immunocompromised patients 4. Therapy for severe or disseminated varicella-zoster infections in immunocompromised or immunocompetent patient 5. Therapy for primary genital herpes with neurologic complications Oral: 1. Therapy for primary Herpes simplex infections (oral/genital) 2. Suppressive (preventative) therapy for recurrent (³ 6 episodes/year) severe Herpes simplex infections (oral/genital) 3. Episodic therapy for recurrent (³ 6 episodes/year) Herpes simplex genital infections (initiate within 24 hours of prodrome onset) 4. Prophylaxis for HSV in bone marrow transplants where patient is seropositive 5. Therapy and suppressive therapy for Eczema Herpeticum 6. Therapy for varicella-zoster infections in immunocompetent and immunocompromised patients (if not severe) 7. Therapy for primary varicella infections in pregnancy 8. Therapy for varicella in immunocompetent patients > 13 years old (initiate within 24 hours of rash onset) 9. Therapy for varicella in patients < 13 years old (initiate within 24 hours of rash onset) if there is a chronic cutaneous or pulmonary disorder, long term salicylate therapy, or short, intermittent or aerosolized corticosteroid use Not Indicated: 1. Therapy for acute Epstein-Barr infections (acute mononucleosis) 2. Therapy for documented CMV infections CLINICAL ANTIBIOTIC GUIDELINES† AMIKACIN RESTRICTED TO ANTIBIOTIC FORM Predictable activity: Unpredictable activity: No activity: Enterobacteriaceae Staphylococcus spp Streptococcus spp Pseudomonas spp Enterococcus spp some Mycobacterium spp Alcaligenes spp Anaerobes Indicated: 1.
    [Show full text]
  • The Enterotube System in the Identification of Enterohacteriaceae and Yersinia
    13 February 1974 S.A. MEDICAL JOURNAL 257 (Supplement-South African Journal of Laboratory and Clinical Medicine) LCM 9 The Enterotube System in the Identification of Enterohacteriaceae and Yersinia M. H. FINLAYSON, B. GIBBS SUMMARY Dulcitol agar for detection of acid production, absent in Proteus sp., most Enterobacters sp., Hafnia and Serratia, A trial of the Enterotube system for the identification of A rizona and Edwardsiella. Enterobacteriaceae and a comparison with the methods Urea agar for detection of urea cleavage, absent in at present in use in the Tygerberg Hospital Microbiology Escherichia, Shigella, Providencia, Enterobacter aerogenes, Laboratory, were carried out. One hunded cultures be­ Hafnia, Salmonella, A rizona and Edwardsiella. longing to the family Enterobacteriaceae including Phenylalanine agar for detection of phenylalanine Escherichia coli, Proteus mirabilis, Proteus vulgaris, deaminase by production of a green colouration after Proteus morgani, Proteus rettgeri, Providencia, Edward­ addition of ferric chloride solution. This reaction is posi­ siella, Shigella, Klebsiella, Enterobacter, Serratis, Sal­ tive only in the Proteus and Pro\'idencia groups. monella, Citrobacter and Arizona were tested with con­ ventional procedures and also with the Enterotube. The Hydrogen sulphide and indole agar for detection of conventional procedures, designed to identify the hydrogen sulphide and indole, the latter being detected organisms within 24 hours after isolation, were used. Three after the addition of Kovac's reagent to the compartment. of the cultures examined were not identified by the Hydrogen sulphide is produced by some Proteus strains Enterotube technique when their identity was established and by Salmonella, Citrobacter, Arizona and Edwardsie/la by routine conventional methods. These were non­ while indole is produced by Escherichia, .some Proteus urease-producing non-motile organisms which may have strains, Providencia and Edwardsiella.
    [Show full text]
  • Worldwide Links Between Proteus Mirabilis and Rheumatoid Arthritis
    al of Arth rn ri u ti o s J Journal of Arthritis Wilson et al., J Arthritis 2015, 4:1 10.4172/2167-7921.1000142 ISSN: 2167-7921 DOI: Review Open access Worldwide Links between Proteus mirabilis and Rheumatoid Arthritis Clyde Wilson1*, Taha Rashid2 and Alan Ebringer2 1Department of Pathology, King Edward VII Memorial Hospital, Paget DV 07, Bermuda 2Analytical Sciences Group, King’s College London, Stamford Road, London SE1 9NN, UK *Corresponding author: Dr. Clyde Wilson, Department of Pathology, King Edward VII Memorial Hospital, Paget DV 07, Bermuda, USA, Tel: +1-4412391011; Fax: +1-4412392193; Email: [email protected] Rec date: November 26, 2014; Acc date: January 9, 2015; Pub date: January 15, 2015 Copyright: © 2015 Wilson C, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Rheumatoid arthritis (RA) is a systemic and arthritic autoimmune disease affecting millions of people throughout the world. During the last 4 decades extensive data indicate that subclinical urinary tract infection by Proteus mirabilis has a role in the aetiopathogenesis of RA based on cross-reactivity or molecular mimicry between Proteus haemolysin and RA-associated HLA-DRB1 alleles as well as between Proteus urease and type XI collagen. Studies from 15 countries have shown that antibodies against Proteus microbes were elevated significantly in patients with active RA in comparison to healthy and non-RA disease controls. Proteus microbes could also be isolated more frequently in the urine of patients with RA than in controls.
    [Show full text]
  • Endosymbiont Diversity and Evolution Across Weevil Tree of Life
    bioRxiv preprint doi: https://doi.org/10.1101/171181; this version posted August 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Endosymbiont diversity and evolution across weevil tree of life Guanyang Zhang1#, Patrick Browne1,2#, Geng Zhen1#, Andrew Johnston4, Hinsby Cadillo-Quiroz5, and Nico Franz1 1 School of Life Sciences, Arizona State University, Tempe, Arizona, USA 2 Department of Environmental Science, Aarhus University, 4000 Roskilde, Denmark # These authors contributed equally to this work ABSTRACT As early as the time of Paul Buchner, a pioneer of endosymbionts research, it was shown that weevils host diverse bacterial endosymbionts, probably only second to the hemipteran insects. To date, there is no taxonomically broad survey of endosymbionts in weevils, which preclude any systematic understanding of the diversity and evolution of endosymbionts in this large group of insects, which comprise nearly 7% of described diversity of all insects. We gathered the largest known taxonomic sample of weevils representing four families and 17 subfamilies to perform a study of weevil endosymbionts. We found that the diversity of endosymbionts is exceedingly high, with as many as 44 distinct kinds of endosymbionts detected. We recovered an ancient origin of association of Nardonella with weevils, dating back to 124 MYA. We found repeated losses of this endosymbionts, but also cophylogeny with weevils. We also investigated patterns of coexistence and coexclusion. INTRODUCTION Weevils (Insecta: Coleoptera: Curculionoidea) host diverse bacterial endosymbionts.
    [Show full text]
  • Study of Some Virulence Factors of Proteus Mirabilis Isolated from Urinary Stones Patients
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by International Institute for Science, Technology and Education (IISTE): E-Journals Journal of Biology, Agriculture and Healthcare www.iiste.org ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.5, No.23, 2015 Study of Some Virulence Factors of Proteus mirabilis Isolated from Urinary Stones Patients Mohanad J. Al-Dawah 1* Adnan H. Al-Hamadany 2 Eman M. Al-Jarallah 3 1. Al-Qasim Green University, College of Biotechnology-Genetic Engineering Department, Al-Qasim city, Babylon, Iraq 2. Al-Qadissiya University, College of Medicine-Microbiology Department 3. Babylon University, College of Science-Biology Department Abstract A total of 125 specimens of stones and urine were collected from urinary stone patients from (June to December, 2012). According to primary identification, which based on macroscopic and microscopic characteristics and biochemical tests, 25 (20%) and 100 (80%) of isolates were identified as Proteus and non-Proteus , respectively. The 25 Proteus isolates were finally identified as Proteus mirabilis based on Vitek 2 system and polymerase chain reaction (PCR) technique by using target gene 16S rRNA . The multiple logistic regressions results showed that the age ˃ 40 years old was a risk factors that significantly associated with increased incidence of P. mirabilis in urinary stone patients, as P = 0.02, and Odd’s ratio (OR) was 4.889 (1.7-14.057), while in relation to gender, the analysis revealed that they were statistically non-significant as OR was 1.174 (0.488-2.822) as well as P=0.720.
    [Show full text]
  • Diversity of Culturable Gut Bacteria of Diamondback Moth, Plutella Xylostella (Linnaeus) (Lepidoptera: Yponomeutidae) Collected
    Diversity of Culturable Gut Bacteria of Diamondback Moth, Plutella Xylostella (Linnaeus) (Lepidoptera: Yponomeutidae) Collected From Different Geographical Regions of India Mandeep Kaur ( [email protected] ) Dr Yashwant Singh Parmar University of Horticulture and Forestry https://orcid.org/0000-0002-6118- 9447 Meena Thakur Dr Yashwant Singh Parmar University of Horticulture and Forestry Vinay Sagar ICAR-CPRI: Central Potato Research Institute Ranjna Sharma Dr Yashwant Singh Parmar University of Horticulture and Forestry Research Article Keywords: Plutella xylostella, Bacteria, DNA, Phylogeny Posted Date: May 25th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-510613/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Diamondback moth, Plutella xylostella is one of the important pests of cole crops, the larvae of which cause damage to leaves from seedling stage to the harvest thus reducing the quality and quantity of the yield. The insect gut posses a large variety of microbial communities among which, the association of bacteria is the most spread and common. Due to variations in various agro-climatic factors, the insect often assumes the status of major pest. These geographical variations in insects inuence various biological parameters including insecticide resistance due to diversity of microbes/bacteria. The diverse role of gut bacteria in insect tness traits has now gained perspectives for biotechnological exploration. The present study was aimed to determine the diversity of larval gut bacteria of diamondback moth collected from ve different geographical regions of India. The gut bacteria of this pest were found to be inuenced by different geographical regions.
    [Show full text]
  • Confirmation of Presumptive Salmonella Colonies Contaminated
    medigraphic Artemisaen línea MICROBIOLOGÍA ORIGINAL ARTICLE cana de i noamer i sta Lat Confirmation of presumptive Salmonella colonies i Rev Vol. 49, Nos. 1-2 contaminated with Proteus swarming using the January - March. 2007 April - June. 2007 pp. 19 - 24 Polymerase Chain Reaction (PCR) method Rosalba Gutiérrez Rojo,* Edith Torres Chavolla* ABSTRACT. In México, zero tolerance regulation is practiced re- RESUMEN. En México las regulaciones sanitarias exigen tolerancia garding Salmonella in food products, the presence of which is ver- cero para Salmonella en productos alimenticios y la presencia de ified by the procedure described in NOM 114-SSA-1994. During Salmonella es verificada de acuerdo con el procedimiento descrito en the period between August 2002 and March 2003, 245 food sam- la NOM 114-SSA-1994. Durante el periodo comprendido entre ag- ples were tested using this procedure in the Central Laboratories of osto del 2002 y marzo del 2003, fueron obtenidas 245 muestras de the Department of Health for the State of Jalisco (CEESLAB). Of alimento y analizadas utilizando este procedimiento en el Centro Es- these 245 samples, 35 showed presumptive colonies contaminated tatal de Laboratorios (CEESLAB) de la Secretaría de Salud. De las with Proteus swarm cells even after selective isolation. These swarm 245 muestras, 35 presentaron colonias sospechosas de Salmonella cells make Salmonella recovery and biochemical identification dif- contaminadas con swarming de Proteus en la etapa de aislamiento ficult due to the occurance of atypical biochemical profiles which selectivo. Este fenómeno dificulta tanto la recuperación como la generally correspond to that of Proteus. Out of the 35 samples con- identificación bioquímica de Salmonella, produciendo un perfil bio- taminated with Proteus, 65 presumptive colonies were isolated.
    [Show full text]