PDF Compressor Free Version
SCREENING PDF Compressor Free Version Methods of prenatal diagnosis
Non-invasive Invasive: Maternal serum AFP Amniocentesis Maternal serum screen Chorionic villus Ultrasonography sampling Isolation of fetal cells Cordocentesis /DNA from maternal Fetoscopy circulation Preimplatation genetic diagnosis ScreeningPDF Compressor Free Version milestones Prenatal diagnosis of First chromosomal Down syndrome analyses from amniotic fluid Raised AF-AFP associated with open Trisomy 21 identified as Neural tube defects cause of Down Syndrome
Maternal serum marker for Down syndrome Triple test introduced Association Nuchal translucency between maternal introduced age and Down syndrome d PDF Compressor Free Version Ultrasound
Hydrops <17 weeks 90 Cystic hygroma 80 A-V canal 70 Holoprosencephaly 60 OhOmphalllocele 50 Hydrops >24 weeks Cardiac defect 40 Duodenal atresia 30 Bladder outlet obstruction 20 Diappghragmatic hernia 10 Limb reduction 0 Hydrocephalus Clubbed foot Aneuploidy Risk Facial cleft MarkersPDF Compressor Freefor Version fetal aneuploidies
••Biochemical markers – Human chhiorion ic gonaddiotropin (hCG) – Free b‐subunit of hCG (Fb‐hCG) – Alpha‐fetoprotein (AFP) – Un‐conjugated estriol (uE3) – Pregnancy associated plasma protein A (PAPP‐A) – Inhibin‐A ••Ultrasound markers – Nuchal translucency (()NT) PDF Compressor Free Version Biochemical profiles for other aneupliloididies in the 2nd titrimest er
AlAneuploiididies Marker T21 T18 T13 Turner AFP L - Inc Dec hCG H VV--LL N VV--HH uE3 LLLL N Dec
IhInhibiibin A H - N V--H PDF Compressor Free Version
M. Houshmand PDF Compressor Free Version Integrated screening strategies (1st and 2nd trim) 1st trimester: 1st trimester:1st trimester: NT,,, PAPPPAPP-NT,-AA ,,, PAPP-PAPP FbFb--hCGhCG-AA Main strategies: NT, PAPP --AA, Fb--hCG No further LRNo risk estimateHigh risk screening Risk Riskestimate estimate HR CVSCVS •FlFullly Integrated Low Borderlinerisk risk 2nd trimester: •Step wise sequential FbFb--hCGhCG,,, 2ndAFP trimester:, uE3uE3,, ((± Inhibin )) ‐ FbFb--hCG,hCG,2nd trimester: AFP, uEuE33,,((±±Inhibin) Inhibin) FbFb--hCG,hCG, AFP, uEuE33,,((±±Inhibin) Inhibin)
•Contingent screenin g Final risk estimate: FinalFinal riskAll estimaterisk markers estimate:: All markersAll markers WeeksPDF Compressor Free Version Prenatal Tests
Ultrasound, basic prenatal tests, Iron count(anemia), infections, blood 6 - 8 platelet, blood type, RH type, Hepatitis B (antigen, antibody), STDs (syphilis, AIDS), Rubella 8 - 15 Ultrasound, amniocentesis, Chorionic villi sampling (if needed) Measurement of nuchal fold thickness (3D ultrasound): Early detection 11 - 13 of Down's Syndrome Triple marker test, Genetic abnormalities (Screening for Down's 15 - 20 Syndrome 60%, neural tube defect 80%) 20 - 24 LlLevel IIII UltUltrasoun d (3D, 4DltD ultrasoun d)GttilDibtd), Gestational Diabetes 26 - 28 Gestational diabetes screening Iron count(anemia) re-test, urine test for level of protein and sugar 28 (test repeated as needed) Pre deliveryyg examination and testing Iron count(anemia), infections, blood platelet, syphilis, 36 - 38 liver function, kidney function, blood coagulation test, ECG, M. Houshmand chest X-ray, fetal movement PDF Compressor Free VersionNIPT
NON – INVASIVE PRENATAL TEST
Testing of cff DNA (cell free fetal DNA) from maternal blood during pregnancy
for trisomy 21, 18 and 13 PDF Compressor Free Version Percent of Reported Chromosome Abnormalities
16 T21 5 T18 T13 8 Major fetal 53 aneuploidies 45,X 5 Sex trisomy 13 Other rare TrisomyPDF Compressor Free 21, Version 18, 13 screening
Trisomy 21 (Down syndrome)
Trisomy 18 (Edwards syndrome)
Trisomy 13 (Patau syndrome) CurrentPDF Compressor Diagnostic Free Version Options ‐ KtKaryotype
Trimester ‐ Test Sensitivity Specificity
1st – CVS 99.25% 98.65%
2nd ‐ Amniocentesis 99.4%2 99.5%
Definitive answers, but are invasive and come with risk to the patient Most are unnecessary due to the high rate of false positives in screening**
. PDF Compressor Free Version Spectrum of Prenatal Testing *
SCREENING DIAGNOSTIC Risk scores are generated and Results are based entirely modified based on biochemical on genetic factors analysis and population statistics
Serum Screening CVS
Combined Serum Screens, NT, Ultra- NIPT Amnio sound
SCREENING DIAGNOSTIC
*Not meant to represent percentage of accuracy
. PDF Compressor Free Version What Are the Goals of NIPT?
Reduce Reduce false exposure of positives fetus to risk
Testing that can easily Enable a be offered high to all detection pregnant rate women
. Two SourcesPDF Compressor of Free VersionFetal DNA in Maternal Blood
• FlFetal cells – 1 in a billion of total cell population – Require isolation via mechanical and/or biochemical means • Cell‐free DNA (cfDNA) – Maternal blood contains both maternal and fetal cfDNA – 2–20% of total cfDNA is fetal
. PDF Compressor Free Version Fetal Cell‐free DNA in Maternal Blood
A Reliable Analyte During Pregnancy – Released through apoptosis •Fetal cfDNA likely arises from cytotrophoblastic cells of placenta – Released into bloodstream as small DNA fragments (150‐200bp) – Reliably detected after 7+ weeks gestation – UdUndetecta ble wiihithin hours postpartum
. PDF Compressor Free Version Which Patients Should Be Offered NIPT?
Patients Wanting Early, Accurate Test And Are At High Risk Of Aneuploidy Due To:
Maternal age-related risks Positive results on maternal serum screening Abnormal ultrasound finding(s) Prior pregnancy with aneuploidy Parental Robertsonian translocation involving one of the tested chromosomes PDF Compressor Free Version
1 PDF Compressor Free Version NO NIPT for sex aneuploidies
Phenotype for sex aneuploidies is higgyhly variable
Mosaicism in the fetus is a problem
Mosaicism in the mother is a problem
NIPT for sex aneuploidies is less accurate
2 PDF Compressor Free Version NIPT is NOT the test of choice when there is : • FlFetal anomalies on ulldtrasound
•A triplet pregnancy
•Vanishing twin
•Known genetic anomalies that cannot be diagnosed by NIPT NIPT AdvantagesPDF Compressor Freeversus Version combi test with AC / CVS • High sensitivity (few false‐negatives)
• High specificity (few false‐positives)
• More than T21
• Non‐invasive : no fetal risk •CVS : Risk of miscarriage : 1‐2 % •AC : Risk of miscarriage : 0.5 % PDF NIPTCompressor Free Version results
1. Normal result : no specific follow up necessary, unless ultrasound examination of the fetus reveals anomalies
2. Test failure : in < 2 % pregnancies not enough fetal DNA : NIPT repeated at no extra cost.
3. Abnormal NIPT result : confirmation by amniocentesis or chorionic biopsy PDFScreening Compressor Free Version Options Test When Done Detection Rates 1st trimester 10-14 weeks T21 -- 83% (NT + 2 serum) T18 – 80% Ultrasound 18-20 weeks T21 -- 60%; T18 -- 85% NTD -- 70-98% Quadruple screen 15-21 weeks T21 -- 75-80%; T18 -- (4 serum analytes) 60% NTD -- 80-90% *Integrated screen 10-14 weeks T21 -- 92% (1st trimester screen 15-21 weeks T18 -- 90% + qqpuadruple screen ) NTD -- 80% Maternal serum >7 weeks T21 - >99% Other aneuploidy? DosagePDF Compressor Free Version of chromosome 21 (RNA‐SNP allelic ratio method) • Quantitative analysis of SNPs in PLAC4 mRNA
Euploid pregnancy Trisomy 21 pregnancy
T T T C C
TT:C : C TT:C : C 1 : 1 Allele Ratio 2 : 1 PDF Compressor Free Version
What’s New in Newborn Screening PurposePDF Compressor of Free Newborn Version Screening
• Program to screen for congenital and heritable disorders • These disorders may cause severe mental retardation, illness, or death if not treated early in life • If treated, infants may live relatively normal lives • Results in savings in medical costs over time PDF ResultsCompressor Free Version from Lab
•Normal Screen •Abnormal results Results – Results are – Results are sent to reportdted to C ase submitter when all Management as test are final soon as availa ble for that disorder TandemPDF Compressor Mass Free Version Spectrometer (S(MS//SMS)) •Molecules are sorted & weighed by mass • Compounds analyzed are amino acids & acylcarnitines – Amino acids: building blocks for p roteins – Acylcarnitine= Carnitine (vehicle) +fatty acid •Identified by size of fatty acid: short, medium, long and designated by initials & numbers PDF Compressor Free Version Specimen Collection to Treatment Mass Spectrometry-basedPDF Compressor Free Version Diagnosti cs • MALDI‐TOF MS： matrix‐assisted laser desorption/ionization‐time of flight mass spectrometry • SELDI ‐TOF MS： surface‐enhanced laser desorption/ionization‐ time of flight mass spectrometry PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version
Sansom, Molecular Medicine Today, March 1999
M. Houshmand PDF Compressor Free Version
M. Houshmand OrganicPDF CompressorAcid Free Version Metabolism Disorders
• IVA ‐ Isovaleric acidemia • GA I – Glutar ic acidem ia type I • HMG –3‐OH 3‐CH3 glutaric aciduria • MCD – Multiple carboxylase deficiency • MUT – Methylmalonic acidemia (mutase def) • 3MCC –3‐Methylcrotonyl‐CoA carboxylase deficiency • Cbl A,B – Methylmalonic acidemia • PROP – Propionic acidemia • BKT –Betaketothiolase deficiency ‐ M. Houshmand PDF Compressor Free Version Fatty Acid Oxidation Disorders
• MCAD – Medium‐chain acyl‐CoA dehydrogenase deficiency • VLCAD – Very long‐chain acyl‐CoA dehydrogenase deficiency • LCHAD – Long‐chain L‐3‐OH acyl‐CoA dehydrogenase deficiency • TFP – Trifunctional protein deficiency • CUD – Carnitine uptake defect Amino AcidPDF Compressor Metabolism Free Version Disorders
• PKU – Phenylketonuria • MSUD – Maple syrup urine disease • HCY – Homocystiiinuria • CIT – Citrullinemia • ASA – Argininosuccinic acidemia • TYR I – Tyrosinemia type I PDFHemoglobinopathies Compressor Free Version
• SCA – Sickle cell anemia • Hb S/Th –Hb S/ Beta‐thalassemia • Hb S/C – Hb S/C disease PDF Compressor Free VersionOthers
• HYPOTH – Congenital hypothyroidism • BIOT –Biotinidase deficiency • CAH – CiCongenital addlrenal hhlyperplasia • GALT – Galactosemia • HEAR –Hearing deficiency PDF Compressor Free Version
New Screen will not require additional blood spots PDF Compressor Free Version The Heel Test
M. Houshmand PDF Compressor Free Version
44 PDF Compressor Free Version
M. Houshmand PDF Compressor Free Version
M. Houshmand PDF Compressor Free Version What makes a good spot?
M. Houshmand PDF Compressor Free Version Looking into the future PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version
Carrier Status DNA • Screens patients for more than 70 recessive genetic diseases • Supported by rigorous science using clinically- reltllevant, welll-validat ed mark ers and assays • Enables physicians to offer calculated guidance on pre- and pos tnat al h ealth PDF Compressor Free Version
Ashkenazi Jewish Conditions Bloom syndrome ACOG-Recommended Conditions* Canavan disease Beta-thalassemia Cystic fibrosis Canavan disease Factor XI deficiency Cystic fibrosis Familial dysautonomia Fam ilial dtdysautonomi a Fanconi anemia Sickle cell disease Gaucher disease Tay-Sachs disease Glycogen storage disease , Alpha-thalassemia type 1A Fragile X syndrome Maple syrup urine disease Spinal muscular atrophy (SMA) Mucolipidosis IV Niemann-Pick disease Tay-Sachs disease Tyrosinemia Additional Conditions PDF Compressor Free Version Dubin-Johnson syndrome 3-Methylcrotonyl-CoA carboxylase deficiency Familial Mediterranean fever Acrodermatitis enteropathica Galactokinase deficiency Alpha-1 antitrypsin deficiency Galactosemia Amyotrophic lateral sclerosis Glutaric acidemia, type 1 Argininosuccinate lyase deficiency GM1-gggangliosidosis AtiAutoimmune polldllyglandular syndtdrome, type I Hemochromatosis Bartter syndrome, type 4A Hemoglobin C Beta-ketothiolase deficiency Hemoglobin E Biotinidase deficiency HMG-CoA lyase deficiency Carnitine deficiency, primary systemic Homocystinuria, cblE type Cerebrotendinous xanthomatosis Homocystinuria, classic Citrullinemia, type I HlHurler synd rome Crigler-Najjar syndrome Methylmalonic acidemia Diabetes, permanent neonatal Mucolipidosis II Dihyypdropyyrimidine dehyygdrogenase deficienc y Mucolipidosis III Ehlers-Danlos syndrome, hypermobility Multiple carboxylase deficiency Hearing loss, DFNB1 and DFNB9 nonsyndromic Hearing loss, DFNB59 nonsyndromic Phenylketonuria PDF Compressor Free Version Polycystic kidney disease Pompe disease Prekallikrein deficiency Propionic acidemia Prothrombin deficiency Rh-null syndrome Rickets, pseudovitamin D-deficiency Sandhoff disease Sick sinus syndrome Spherocytosis, hereditary Tay-Sachs pseudodeficiency Thbhrombocytopeni a, congeni tal amegakikaryocytic Lipoprotein lipase deficiency, familial Medium-chain acyl-CoA dehydrogenase deficiency Ehlers-Danlos syndrome, dermatosparaxis Ehlers-Danlos syndrome, kyphoscoliotic Nephrotic syndrome, steroid-resistant Short-chain acyl -CoA dehydrogenase deficiency Very long-chain acyl-CoA dehydrogenase deficiency Von Willebrand disease, type 2 Normandy Von Willebrand disease, type 3 PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version
Cardiac DNA provides information that allows the physician to: Better monitor a patient’s specific health condition.
Prescribe a more optimal medication and dosage for a patient.
Suggest early lifestyle and diet interventions to help combat or prevent certain health conditions. PDF Compressor Free Version
Cardiac DNA Insight analyzes a patient ’s unique genetic markers, which influence a broad range of heart-related conditions, including ApoE, HDL and LDL cholesterol levels, and risks for hypertension and myocardial infarction. This simple saliva or blood - based test is supported by scientifically validated genetic testing technologies using clinically relevant markers and assays. PDF Compressor Free Version
Heart Disease/Atrial Fibrillation Atrial fibrillation Beta-blockers, LVEF response Caffeine metabolism Coronary artery disease Myocardial infarction Simvastatin-induced myopathy Verapamil and QTc interval PDF Compressor Free Version
Peripheral Arterial Disease/Venous Thrombosis Clop idogrel metablibolism (Pli)(Plavix) Estrogen supplementation (risk of venous thrombosis) PihPeriphera l arteri ilal didisease Venous thrombosis WfiWarfarin PDF Compressor Free Version
Hypertension Beta-blockers Hypertension Metoprolol metabolism Perindopril (ACE inhibitor-therapeutic benefit) Verapamil vs . atenolol (benefit of) PDF Compressor Free Version
Cardiovascular Health ApoE and cardiovascular disease Genetic risk for decreased folate Genetic risk for decreased HDL cholesterol Genetic risk for elevated LDL cholesterol Genetic risk for elevated triglycerides Sickle cell anemia PDF Compressor Free Version
Mental Health DNA analyzes a patient’s DNA to identify genetic variants that affect the metabolism and efficacy of psychiatric medications. Genetic research suggests that categorizing individuals based on genotypes will make the pharmacologic treatment of psychiatric illnesses more predictable and effective. Mental Health DNA can help a physician predict a patient’s response to more than 40 common antidepressants, mood stabilizers and antipsychotic medications. The report provides outcomes in a clear color-coded chart. PDF Compressor Free Version
This test can enable a physician to choose an appropriate medication with less trial and error as well as minimizing a patient’s risk of adverse side effects. Mental Health DNA Insight is supported by scientifically validated genetic testing technologies using clinically relevant markers and assays. Antipsychotics Antidepressants MoodPDF Stabilizers Compressor Free Version Amitryptyline Carbamazepine Aripiprazole Buspirone Gabapentin Asenapine Citalopram Lamotrigine Chlorpromazine Clomipramine Oxcarbazepine Clozapine Desipramine Topiramate Fluphenazine Doxepin Valproic acid HlHaloper idlidol Duloxetine Iloperidone Escitalopram Loxapine Fluoxe tine Lurasidone Fluvoxamine Olanzapine Mirtazapine Paliperidone Nortriptyline Perphenazine Paroxetine Quetiapine Sertraline Risperidone Trazodone Thioridazine Trimipramine Thiothixene Venlafaxine Trifluoperazine Ziprasidone Zuclopenthixol PDF Compressor Free Version PDF Compressor Free Version
Healthy Weight DNA may help with: Weight management Disease prevention Maximizing energy Improvement to overall health Understanding a person’s genetic propensity to specific diets, eating behaviors, nutritional needs, exercise activity and health conditions is important to true, long -term success in weight management . Eating Behaviors PDF CompressorWeight Free Version and Diet Eating disinhibition Genetic risk for decreased adiponectin Food desire Genetic risk for decreased omega-6 and Satiety – feeling full omega-3 Snacking Matching diet type Sweet tooth Metabolism Health Conditions Obesity Diabetes,,yp type 2 Response to monounsaturated fats Osteoarthritis Response to polyunsaturated fats Venous thrombosis Weight loss – regain Medication Response Me tab oli c H ealth F act ors Clopidogrel metabolism (Plavix) Genetic risk for decreased HDL Simvastatin-induced myopathy cholesterol WfiWarfarin Genetic risk for elevated LDL Exercise Response cholesterol Endurance training Genetic risk for elevated triglycerides HDL (good) cholesterol response to exercise Insulin sensitivity response to exercise PDF Compressor Free Version
Nutritional Needs Genetic risk for decreased vitamin A Genetic risk due to decreased vitamin B2 Genetic risk for decreased vitamin B 6 Genetic risk for decreased vitamin B12 Genetic risk for decreased vitamin C GtGenetiiic risk ffdor decreased di vittiDamin D Genetic risk for increased vitamin E Genetic risk for decreased folate PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version Looking into the future PDF Compressor Free Version
Immunculus ((gImmunologic Homunculus) and prognostic medicine Would youPDF Compressor Freelike Version to know the future of your health
Is it possible ? Yes, certainly! by using multiple auto-Abs evaluations PDF Compressor Free Version Immune The maintenance of system molllhecular homeost asiifs of
Each 10th the body by different ways cell of the andhd mechanisms body (!) is lymphocyte Includinggg clearance of organism from Is it main waste products of apoptotically died function cells ? (anti-microbe struggle is only small part of the main homeostatic function of the immune system)
Struggle against microbes The main points:PDF Compressor Free Version Indiv idu al differences in apoptosis in cells of Liver , Kidneys , Heart , or other organs is minimal in health state
Therefore: Individual variability in productions of antigenic wastage is minimal
Antigen-dependent regulation of Ab production (by feedback principle)
Therefore: Nearly the same levels of production of auto-Abs – scavengers in each healthy person PDF Compressor Free Version Abnormal elevation of apoptosis in organ (because any form of pathology) leads to quantitative deviations in contents of according auto-Abs
An illustrative example:
Preparative Isoelectrofocusing / ELISA: Minimal individual differences in content of different “cardiotropic” auto- Abs may be seen in serum of healthy persons (black lines). Heart pathology has accompanied by quantitative changes in pattern of auto-Abs (cardiomyopathy – red dotted line) The health state ofPDF the Compressor Body Free Version ha s been mirrored by the General system of autoauto--AbsAbs or ««ImmunculusImmunculus»»
Because: 11.. Serum level of auto-auto-AbsAbs of any specificity is nearly the same in each healthy person..person 22. Quantit ati ve d evi ati ons i n cont ent s of some auto-auto-AbsAbs are marker signs of pathology (abnormal elevation of apoptosis) in according organ
Each form of pathology: cancer and hepatic problems, neurodegeneration and cardial pathology etc., has been reflected by “Magic Mirror of Immunculus” PDF Compressor Free Version
Stages of Pathology Development:
1. Most early events Activation of apoptosis which reflects by auto‐Abs Weeks or months later
2. Biochemical (laboratory detected) and/or functional changes in organ Months or years later 3. Clinical manifestation of the disease PDF Compressor Free Version (March 2007) Sci. Amer. Dr. Abner Notkins write: During the next 10 or 20 years evalu-ation a lot of auto -Abs will became habitual diagnos tic proced ure (for prediction of the future changes in patient’s health) Not after 10 or 20PDF years,Compressor Free butVersion now We used evaluation of some dozens of auto-Abs for diagnostic and prognostic purposes Eli-Viscero-Test ((evaluationevaluation of the health state of heart,heart, vessels, lungs, liver, kidneys, stomach, gut, pancreaspancreas,, thyroidthyroid,, prostateprostate,, adrenalsadrenals))
ELIELI--N N--TestTest ((NervousNervous system health state)state)
ELIELI--P P--ComCom plex ((ReproductiveReproductive health evaluation)evaluation) PDF Compressor Free Version
What is “Personalized Medicine”? The GoalPDF Compressor Free of Version Personalized MdMediiicine
• The Right Dose of • The Right Drug for • The Right Indication for • The Right Patient at • The Right Time. PharmacologyPDF Compressor Free• VersionPharmacokinetics (PK): the study of the time course of substances and their relationship with an organism or system (Journey of drugs) – Absorption – Distribution – Metabolism – Excretion
• Pharmacodynamics (PD): the study of the biochemical and physiological effects of drugs and the mechanisms of drug action and the relationship between drug concentration and effect (Drug effect on the body) Every aspect may affect the final drug effect PharmacogeneticsPDF Compressor Free Version & Pharmacogenomi cs • Pharmacogenetics: study of individual gene- drug interactions, usually one or two genes that have dominant effect on a drug response (SIMPLE relationship)
• Pharmacogenomics: study of genomic ifinflluence on drug response, o fftten us ing hhiihgh- throughput data (sequencing, SNP chip, expressition, proteomics - COMPLEX interactions) WhatPDF Disciplines Compressor Free Version are Involved?
Pharmacology Genomics Pharmaco- epidemiology Personalized/ Molecular Stratified/ bio logy Predictive Medicine Bioinformatics
BioStatistics Bioethics Cancer PharmacogenomicsPDF Compressor Free Version (PGx)
• The study of how variation in an individual’s germline and/or tumor genome are related to their metabolism and physiological response to drugs used in cancer treatment – Single Nucleotide Polymorphisms (substitutions) – Insertions and deletions – Copy number Variations – Methylation patterns – Molecular biomarkers – Gene expression PDF Compressor Free Version
Cancer Pharmacogenetics GERMLINE Cancer Pharmacogenomics SOMATIC or TUMOUR Biomarkers Predictive PROTEINS, IMAGING fDfor Drug OtOutcomes
RADIATION THERAPY Biomarkers Predictive for Treatment Outcomes Gene MutationsPDF Compressor Free Version — Inherited or AiAcquired • Hereditary (germline) mutations
– alterations in DNA inherited from a parent and are found in the DNA of virtually all of your cells.
• Acquired (somatic) mutations
– alterati ons in DNA tha t dldevelop throug hou t a person’s life Pharmacogenetics: A Case Stud y PDF Compressor Free Version Pharmacogenetics: A Case Stud y PDF Compressor Free Version Pharmacogenetics: A Case Stud y PDF Compressor Free Version PersonalizedPDF Compressor Free Version Drugs
• Herceptin (breast cancer, target: Her2/neu) • Erbitux (l(colorecta l cancer, target: EGFR) • Tarceva (lung cancer, target: EGFR) • Strattera (attention‐deficit/hyperactivity disorder, Metabolism: P4502D6) • 6‐MP (leukemia, Metabolism: TPMT) • Antiiivira ls (i.e. resi stance bdbased on form of HIV) • etc. and the list is growing rapidly ... FDA RequiresPDF Compressor Free Version Genetic Tests for Certain Therapies PDF Compressor Free Version
• We are all 99.9% similar in our DNA .
• Individuals vary by only 0.1%.
• Individual variations may correla with different responses to medicines and
magnitude of disease risk . PDF Compressor Free Version PotentialPDF Compressor of FreePharmacogenomics Version
All patients with same diagnosis
1 Non-responders and toxic responders
Treat with alternative 2 drug or dose Responders and patients not predisposed to toxicity Treat with conventional drug or dose PDF Compressor Free Version PersonalizedPDF Compressor Freeor Version Predictive Medicine
Respond to treatment Patients with same diagnosis
No response to treatment
Experience adverse events PDF Compressor Free Version Human Genome has 3 billion DNA base-pairs
…GGG G T A A CCG T G…
Polymorphic …G G C A A C T G...
Some people have a different base at a given location: This is a Single Nucleotide Polymorphism or SNP
102 PDF Compressor Free Version
103 PDF Compressor Free Version دارو در بدن : 99 جذ 99 توزيع 99 مت بوليسم 99 حذف
ااکسيداسيون ف ز احيااا مت بوليسم ھيدروليز گگللوک ورونيدداسيونان ف ز سولفاسيون استياسيون متياسيون مت بوليسم % از داروھ توسط ف ز و از اين مقدار ٨ % توسط CYP مت بوليزه ميشود. 104 PDF Compressor Free Version
Somatic vs. Germline Mutation Testing PDF Compressor Free Version Detection of HER2/neu Amplication in Breast Cancer by FISH BRCA PEDIGREE PDF Compressor Free Version PDF Compressor Free Version Sequence Analysis of BRCA1 and BRCA2 Can Fin d the Nee dle in the Hays tac k
• BRCA1: 22 codingg, exons, > 5,500 bp
AA GGCTTTAGGCTTTAGGCTTTAGGCTTTAAAGTATCCATGTATCCATGTATCCATAGTATCCAT • BRCA2: 26 coding exons, > 11,000 bp PDF Compressor Free Version اﺛﺮ ﻣﺘﻘﺎﺑﻞ ﺑﻴﻦ دارو وﺑﺪن
109 در ايران Compressor Free VersionCYP2C9*4 فراوانیPDF ژنوتيپ
110 PDF Compressor Free Version
Allel e Azarif requency Genotype frequency
Caspian Fars
Kurd Allele frequency Genotype frequency Allele frequency Lure Genotype frequency Genotype frequency Allele frequency
Allele frequency Genotype frequency
Allele frequency Genotype frequency Baloch Allele frequency Arab Genotype frequency
111 PDF CompressorNorth Free Version
Allele frequency Genotype frequency
Allele frequency
West Center Genotype frequency East Allele frequency
Genotype frequency Allele frequency Genotype frequency
Allele frequency GfGenotype frequency
South 112 R521K GenotypePDF Compressor Free Version Frequencies in Iran Homozygous Homozygous (Normal) AA, 7.7 (Mutant)
GG, 38. 7 GA, 53.6
Genotype FlFemale MlMale
A/A 7.33 8 Heterozygous G/A 52 54.67
G/G 40.67 37.33
113 PDF Compressor FreeConclusion Version
Safe Effective
Cetuximab
A/A Genotype (in R521K EGFR polymorphism)
Arabs
Gilaki – Mazandarani groups 114 PDF Compressor FreeConclusion Version
Safe not Effective
G/G and G/A Genotypes Cetuximab (in R521K EGFR polymorphism)
Kurds Lures Fars Turks 115 PDF Compressor Free Version
Ethnicity A/A (%) G/A (%) G/G (%)
Fars 8.3 51.5 40.2
Turk 6.5 58.44 35.06
Kurd 0 53. 85 46. 15
Lure 0 70.59 29.41
Arab 16.67 33.33 50
Caspian 16.67 50 33.33
R521K genotype distribution in different ethnic groups of Iranian Population
9 The genotype A/A was not detected in Kurds and Lure groups
9 High frequencies of A/A genotype in Arabs and Caspian groups
116 PDF Compressor Free Version
117 PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version PDF Compressor Free Version
Genetic Counselor Treating Biocurator Team
Analysis Outside MP/MG Faculty Team Expert (prn)
Test Request Review by Genetic Establish questions being Patient and Test Consultation posed by physician Service patient and treating team request • Genetic Counselor • Genetic? genome • Molecular • Candidate variants and sequencing PhliPathologist analysis approach for heritable • Medical Geneticist • Clinical use disease through EMR The Rare Disease Primer Kit PDF Compressor Free Version PDF Compressor Free Version
PharmacoGenetic Card
Name: SEYED MASSOUD Surname: HOUSHMAND ID No: 093‐766781‐1 Date of birth: 22 JAN 62
5 FLUORO GLEEVEC / IRESSA / VARIOUS FLT3 BETA2‐ ‐ IRINOTECAN THIOPURINE HERCEPTIN ABACAVIR URACIL IMATINIB GEFITINIB INHIBITORS AGONISTS
CYP2D6 CYP2C19 CYP2C9 CYP1A2 CYP2A6 CYP2B6 CYP2C8 CYP2C9 CYP2E1
CYP2J2 CYP3A4 CYP3A5 CYP3A7 CYP4B1 EPHX1 EPHX2 TPMT UGT1A1 PDF Compressor Free Version
HLA Typing Card
Name: SEYED MASSOUD Surname: HOUSHMAND ID No: 093‐766781‐1 Date of birth: 22 JAN 62
HLA‐ HLA‐AHLA‐BHLA‐CHLA B27 HLA‐DPA1 HLA‐DPB1 DRB3/B4/ B5 PDF Compressor Free Version
GtGenetiic IDID CdCard
Name: SEYED MASSOUD Surname: HOUSHMAND ID No: 093‐766781‐1 Date of birth: 22 JAN 62
D20S1082 D6S474 D12ATA63 D22S1045 D10S1248 D1S1677 D11S4463 D4S2364 D9S1122
D2S1176 D10S1435 D3S3053 D5S2500 D1S1627 D2S4529 D2S441 D17S974 D6S1017
AMELOGENI D4S2408 D9S2157 D17S1301 D1GATA113 D18S113 D18S8853 D20S482 D14S1434 N PDF Compressor Free Version PDF Compressor Free Version