Biosci. Biotechnol. Biochem., 67 (8), 1809–1812, 2003

Note Organic Solvent Tolerance of Halophilic

Ron USAMI,† Tadamasa FUKUSHIMA,ToruMIZUKI,AkiraINOUE,YasuhikoYOSHIDA, and Koki HORIKOSHI

Department of Applied Chemistry, Faculty of Engineering, Toyo University, 2100 Kujirai, Kawagoe-shi, Saitama 350-8585, Japan

Received January 9, 2003; Accepted April 29, 2003

Organic solvent tolerance was tested in type strains of borinquense JCM 10706T, Halorubrum saccharovo- type of the sixteen genera of , rum JCM 8865T, Natrialba asiatica JCM 9576T, the halophilic archaea. Most of the strains were Natrinema pellirubrum JCM 10476T,and T observed to grow in the presence of hexylether (log Pow Halomicrobium mukohataei JCM 9738 were ＝5.1), but none grew in the presence of n-octane cultivated in JCM medium 168 consisting of

(log Pow＝4.9) except Halogeometricum borinquense Casamino acids, yeast extract, 20z NaCl etc. JCM 10706T and Halorubrum saccharovorum JCM (http://www.jcm.riken.go.jp). Halobaculum gomor- 8865T. On the other hand, two strains, Haloarcula spp. rense JCM 9908T was grown in JCM medium 225, OHF-1 and 2 isolated from a French solar salt were Halorhabdus utahensis JCM 11049T in JCM medium found to show stronger tolerance even to isooctane 294, and Haloterrigena turkmenica JCM 9101T in

(log Pow＝4.8). Growth of some strains was retarded JCM medium 169. Alkaliphilic strains Natronobac- by the presence of n-decane but reached to the same terium gregoryi JCM 8860T, Natronococcus occultus cell densities at late stationary phase. Final cell densities JCM 8859T, Natronomonas pharaonis JCM 8858T, of some strains were greatly repressed by the presence and bangense JCM 10635T were of the solvent. cultured in JCM medium 167, which contained 0.5z sodium carbonate to raise the pH to around 9.5. All Key words: halophilic archaea; strains OHF-1 and of these strains are devoid of a peptidoglycan layer,

OHF-2, and log Pow value and stain Gram negative, except for Gram-variable Halococcus morrhuae and Natronococcus occultus.7) The tolerance of microorganisms to organic sol- The strains were inoculated in to 2 ml of the liquid vents has been studied extensively since the discovery media in test tubes and 1 ml of an individual organic of the toluene-tolerant Pseudomonas putida strain solvent (n-decane, n-nonane, hexylether, n-octane, IH-2000.1) In fact, the solvent tolerance has been isooctane, or cyclooctane) was added. After vigorous detected in many microbes,2) and mechanism of toler- shaking (140 rpm) at 309C, growth was estimated by 3) ance has been investigated. measuring the OD660 nm of 80 ml of cultures. In some Extremophiles are microorganisms adapted to experiments, cultures were done in 100-ml Erlenmey- conditions of extreme temperature, pH, salinity, etc. er ‰asks containing 20 ml of medium, overlaid with Some organic solvents originating from crude 10 ml of solvent, shaken at 110 rpm at 309C. Samples petroleum also create natural extreme environments. were taken periodically to measure OD660 nm. Recently, a few halophilic strains were isolated from Tolerance of bacteria, including archaea, to sol- a plot of the Kalamkass oil ˆeld ˆlled with saturated vent has been estimated by the solvent parameter 4,5) brine and oil, and from an estuary polluted with log Pow (common logarithm of the partition crude oil.6) No report, however, has been published coe‹cient of a given solvent in a mixture of n-oc- concerning organic solvent tolerance of representa- tanolandwater),whichisanindexofbiological tive strains of halophilic archaea. In this report we toxicity.2) Lower values represent higher toxicity. investigated organic solvent tolerance of type strains Table 1 shows the growth of strains in the presence of of extreme halophiles of the family Halobacteria- various organic solvents. All strains of halophilic ceae.7) archaea showed good growth in media containing n- The following type strains of each type species of decane, while most type strains showed no growth in the sixteen genera were cultivated as follows. Haloar- the presence of organic solvents which had log Pow cula vallismortis JCM 8877T, Halobacterium salina- value, below 4.9, except H. borinquense JCM 10706T rum JCM 8978T, Halococcus morrhuae JCM 8876T, and H. saccharovorum JCM 8865T. Gram-negative Haloferax volcanii JCM 8879T, Halogeometricum bacteria, Escherichia coli and P. putida for example,

† To whom correspondence should be addressed. Fax: ＋81-492-31-1031; E-mail: usaron＠mail.cc.eng.toyo.ac.jp 1810 R. USAMI et al.

Table 1. Organic Solvent Tolerance of Halophilic Archaea

Organic solvent n-decane n-nonane hexylether n-octane isooctane cyclooctane growth Strains patterns log Pow value 6.0 5.5 5.1 4.9 4.8 4.4 Haloferax volcanii JCM 8879T ＋＋ ± ＋＋ －－ － Natrialba asiatica JCM 9576T ＋＋ ＋ ＋＋ －－ － Natrinema pellirubrum JCM 10476T ＋＋ ＋＋ ＋＋ －－ － Halogeometricum borinquense JCM 10706T ＋＋ ＋＋ ＋＋ ＋ －－A Natronomonas pharaonis JCM 8858T ＋ － ＋ －－ － Natronorubrum bangense JCM 10635T ＋＋ ＋ ＋＋ －－ － Haloarcula sp. strain OHF-2 ＋＋ ＋＋ ＋＋ ＋＋ ＋ ±

Haloarcula vallismortis JCM 8877T ＋ ± ＋ －－ － Halobacterium salinarum JCM 8978T ＋＋ ＋＋ ＋＋ －－ － Halorubrum saccharovorum JCM 8865T ＋＋ ＋ ＋ ＋ －－ Halococcus morrhuae JCM 8876T ＋＋ ＋ ＋＋ －－ － Haloterrigena turkmenica JCM 9101T ＋＋ ± ＋ －－ － Halorhabdus utahensis JCM 11049T ＋＋ ±－－－－ B Halobaculum gomorrense JCM 9908T ＋＋ ＋ －－－ － Halomicrobium mukohataei JCM 9738T ＋ ± ＋ －－ － Natronobacterium gregoryi JCM 8860T ＋＋ ±－－－－ Natronococcus occultus JCM 8859T ＋ －－－－－ Haloarcula argentinensis JCM 9737T ＋＋ ± ＋ －－ － Haloarcula sp. strain OHF-1 ＋＋ ＋＋ ＋＋ ＋ ±－

＋＋: good growth, ＋, ±:growth,－:nogrowth. This table shows the growth of the sixteen type strains, Har. argentinensis JCM 9737T and two isolates OHF-1 and OHF-2, in the presence of various organic solvents. Growth patterns A and B shows the diŠerent growth curves show in Fig. 1A and B, respectively.

have been shown to be tolerant up to log Pow of 3.8 NaCl. Ten colonies were picked up at random and (propylbenzene) and 3.1 ( p-xylene), respectively. were tested for the solvent tolerance as described Thus, the organic solvent tolerance of the halophilic above. Two isolates, OHF-1 and OHF-2, showed archaea seems to be weaker than that of Gram-nega- tolerance to isooctane (log Pow＝4.8), while the other tive bacteria.2) eight isolates showed tolerance only up to hexylether

Growth of some strains was measured periodically (log Pow＝5.1). inthepresenceofn-decane and two patterns were ob- To identify OHF-1 and OHF-2, the 16S rRNA tained. In pattern A, the growth rate at exponential encoding genes were ampliˆed by PCR with the phase was considerably lower in the presence of n- following forward and reverse primers: 5?-ATTCC- decane but the ˆnal cell density reached above 83z GGTTGATCCTGCCGG (positions 6–25 in E. coli of that in the absence of n-decane. In pattern B, both numbering) and 5?-AGGAGGTGATCCAGCCGC- growth rate and the ˆnal cell density were low in the AG (positions 1540–1521). The ampliˆed 16S rDNAs presence of n-decane (65–75z). Representative were cloned into pCR2.1 T-vector (Invitrogen) and growth curves of N. bangense (pattern A) and N. sequenced using the Big Dye Sequencing Kit (Applied gregoryi (patternB)areshowninFig.1.Other Biosystems) by the ABI 377 DNA sequencer (Applied strains tested are also divided into patterns A and B Biosystems). Sequencing primers used were 1: 5?- (Table 1). DiŠerences in growth patterns in the ATTCCGGTTGATCCTGCCGG (positions 6–25 in presence of n-decane may suggest there is a diŠerence E. coli numbering), 6: 5?-AGGAGGTGATCCAGC- between these two patterns in the expression of genes CGCAG (positions 1540–1521), 7: 5?-ATTGGGCC- responsible for the solvent tolerance. Tolerance may TAAAGCGTCCGTA (positions 563–585), -20: 5?- be induced in the presence of organic solvents in GGAAACAGCTATGACCATG (vector side's pattern A, while not in pattern B. primer) and Rev: 5?-GTAAAACGACGGCCAGT To investigate if there exist any halophilic archaea (vector side's primer). The sequences of strains with stronger solvent tolerance, we isolated some OHF-1 and OHF-2 had very high similarities with extreme halophiles from a commercially available that of Haloarcula argentinensis,99.1z and 99.3z, French solar salt (Sel Marin DE NOIRMOUTIER). respectively, suggesting that the two strains belonged The salt sample was dissolved in 50 ml of a sterile to Har. argentinensis. DDBJ accession numbers of medium (consisting of Casamino acids, yeast extract, OHF-1 and OHF-2 are AB098536 and AB098337, 0.2z KCl, and 2z magnesiumsulfate,pH7.4)ata respectively. concentration of 25z, and incubated at 379Cfor3 Unexpectedly, the type strain of Har. argentinen- weeks without shaking. The culture was then spread sis, JCM 9737T, showed tolerance only up to 5.1, as on an agar plate of the same medium containing 25z do most other type strains of other genera. It was Organic Solvent Tolerant Halophiles 1811

Fig. 1. Growth Curves of Halophilic Archaea. Growth curves of Natronorubrum bangense (A) and Natronobacterium gregoryi (B). Cultures were done in 100-ml ‰asks containing 20 ml of medium, with () or without ()10mlofn-decane, shaken at 110 rpm at 309C. Samples were taken periodically to measure

OD660nm. also noted that OHF-1 showed pattern B while OHF-2 showed pattern A, thus there was little corre- References lation between growth patterns and the genera. Strains OHF-1 and 2 maintained their tolerance to 1) Inoue, A., and Horikoshi, K., A Pseudomonas organic solvent even after repeated sub-culturing in thrives in high concentrations of toluene. Nature, solvent-free medium, suggesting that chromosomes 338, 264–266 (1989). contain genes for organic solvent tolerance. Further 2) Inoue, A., and Horikoshi, K., Estimation of solvent- tolerance of bacteria by the solvent parameter log P. studies of the genomes of type strains may reveal any J. Ferment. Bioeng., 71, 194–196 (1991). relationships. 3) Kobayashi, H., Takami, H., Hirayama, H., Kobata, In bacteria, genes relevant to solvent tolerance K., Usami, R., and Horikoshi, K., Outer membrance 8) have been identiˆed, such as ostAofE. coli K-12, changes in a toluene-sensitive mutant of toluene- and ttgRofP. putida coding for organic solvent tolerant Pseudomonas putida IH-2000. J. Bacteriol., eŒux pumps.9) Halobacterium sp. NRC-1 is the only 181, 4493–4498 (1999). halophilic archaea the complete gene sequence of 4) Zvyagintseva, I. S., Belyaev, S. S., Borzenkov, I. A., which has been published.10) No homolgues of ostA Kostrikina, N. A., Milekhina, E. I., and Ivanov, M. and ttgR, however, were not detected in the genomes V., Halophilic archaebacterium from the kalamkass of either NRC-1 or any other archaea by FASTA and oil ˆeld. Mikrobiologya, 64, 83–87 (1995). 5) Kulichevskaya, I. S., Milekhina, E. I., Borzenkov, I. BLAST searches. Although the type strain of Hbt. A., Zvyagintseva, I. S., and Belyaev, S. S., Oxidation salinarum used in this work is JCM 8978 (＝NRC of petroleum hydrocarbons by extremely halophilic 34002),thisstrainisbelievedtobecloselyrelatedto archaebacteria. Mikrobiologiya, 60, 860–866 (1991). the strain NRC-1. Possibly, the mechanism of organ- 6) Raghavan, T. M., and Furtado, I., Tolerance of an ic solvent tolerance of archaea may be diŠerent from estuarine halophilic Archaebacterium to crude oil and those in bacteria. constituent hydrocarbons. Bull. Environ. Contam. The fact that strains OHF-1 and 2 are tolerant to Toxicol., 65, 725–731 (2000). two diŠerent extraordinary environmental factors, 7) Grant, W. D., Kamekura, M., McGenity, T. J., and high salt concentrations and organic solvents, may be Ventosa, A., Class III. Halobacteria class. nov. In useful not only for industrial applications but for ``Bergey's Manual of Systematic Bacteriology'' vol. investigating the mechanism of how the halophilic 1,2nded.,eds.Boone,D.R.,Castenholz,R.W., and Garrity, G. M., Springer-Verlag, pp. 294–299 archaea acquired the tolerance. (2001). 8)Aono,R.,Negishi,T.,Aibe,K.,Inoue,A.,and Acknowledgments Horikoshi, K., Mapping of organic solvent tolerance gene ostAinEscherichia coli K-12. Biosci. The authors thank Dr. Kamekura of the Noda In- Biotechnol. Biochem., 58, 1231–1235 (1994). stitute for Scientiˆc Research for supplying some 9) Duque, E., Segura, A., Mosqueda, G., and Ramos, strains used in this study and for critical reading of J. L., Global and cognate regulators control the ex- the manuscript. pression of the organic solvent eŒux pumps TtgABC and TtgDEF of Pseudomonas putida. Mol. 1812 R. USAMI et al. Microbiol., 39, 1100–1106 (2001). Isenbarger, T. A., Peck, R. F., Pohlschroder, M., 10)Ng,W.V.,Kennedy,S.P.,Mahairas,G.G., Spudish, J. L., Jung, K. H., Alam, M., Freitas, T., Berquist, B., Pan, M., Shukla, H. D., Lasky, S. R., Hou,S.,Daniels,C.J.,Dennis,P.P.,Omer,A.D., Baliga, N. S., Thorsson, V., Sbrogna, J., Swartzell, Ebhardt, H., Lowe, T. M., Liang, P., Riley, M., S.,Weir,D.,Hall,J.,Dahl,T.A.,Welti,R.,Goo, Hood, L., and Sarma, S. D., Genome sequence of Y. A., Leithauser, B., Keller, K., Cruz, R., Danson, Halobacterium species NRC-1. Proc.Natl.Acad.Sci. M.J.,Hough,D.W.,Maddocks,D.G.,Jablonski, USA, 97, 12176–12183 (2000). P.E.,Krebs,M.P.,Angevine,C.M.,Dale,H.,