DOCSLIB.ORG

Organic Solvent Tolerance of Halophilic Archaea

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Organic Solvent Tolerance of Halophilic Archaea Biosci. Biotechnol. Biochem., 67 (8), 1809–1812, 2003 Note Organic Solvent Tolerance of Halophilic Archaea Ron USAMI,† Tadamasa FUKUSHIMA,ToruMIZUKI,AkiraINOUE,YasuhikoYOSHIDA, and Koki HORIKOSHI Department of Applied Chemistry, Faculty of Engineering, Toyo University, 2100 Kujirai, Kawagoe-shi, Saitama 350-8585, Japan Received January 9, 2003; Accepted April 29, 2003 Organic solvent tolerance was tested in type strains of borinquense JCM 10706T, Halorubrum saccharovo- type species of the sixteen genera of Halobacteriaceae, rum JCM 8865T, Natrialba asiatica JCM 9576T, the halophilic archaea. Most of the strains were Natrinema pellirubrum JCM 10476T,and T observed to grow in the presence of hexylether (log Pow Halomicrobium mukohataei JCM 9738 were ＝5.1), but none grew in the presence of n-octane cultivated in JCM medium 168 consisting of (log Pow＝4.9) except Halogeometricum borinquense Casamino acids, yeast extract, 20z NaCl etc. JCM 10706T and Halorubrum saccharovorum JCM (http://www.jcm.riken.go.jp). Halobaculum gomor- 8865T. On the other hand, two strains, Haloarcula spp. rense JCM 9908T was grown in JCM medium 225, OHF-1 and 2 isolated from a French solar salt were Halorhabdus utahensis JCM 11049T in JCM medium found to show stronger tolerance even to isooctane 294, and Haloterrigena turkmenica JCM 9101T in (log Pow＝4.8). Growth of some strains was retarded JCM medium 169. Alkaliphilic strains Natronobac- by the presence of n-decane but reached to the same terium gregoryi JCM 8860T, Natronococcus occultus cell densities at late stationary phase. Final cell densities JCM 8859T, Natronomonas pharaonis JCM 8858T, of some strains were greatly repressed by the presence and Natronorubrum bangense JCM 10635T were of the solvent. cultured in JCM medium 167, which contained 0.5z sodium carbonate to raise the pH to around 9.5. All Key words: halophilic archaea; strains OHF-1 and of these strains are devoid of a peptidoglycan layer, OHF-2, and log Pow value and stain Gram negative, except for Gram-variable Halococcus morrhuae and Natronococcus occultus.7) The tolerance of microorganisms to organic sol- The strains were inoculated in to 2 ml of the liquid vents has been studied extensively since the discovery media in test tubes and 1 ml of an individual organic of the toluene-tolerant Pseudomonas putida strain solvent (n-decane, n-nonane, hexylether, n-octane, IH-2000.1) In fact, the solvent tolerance has been isooctane, or cyclooctane) was added. After vigorous detected in many microbes,2) and mechanism of toler- shaking (140 rpm) at 309C, growth was estimated by 3) ance has been investigated. measuring the OD660 nm of 80 ml of cultures. In some Extremophiles are microorganisms adapted to experiments, cultures were done in 100-ml Erlenmey- conditions of extreme temperature, pH, salinity, etc. er ‰asks containing 20 ml of medium, overlaid with Some organic solvents originating from crude 10 ml of solvent, shaken at 110 rpm at 309C. Samples petroleum also create natural extreme environments. were taken periodically to measure OD660 nm. Recently, a few halophilic strains were isolated from Tolerance of bacteria, including archaea, to sol- a plot of the Kalamkass oil ˆeld ˆlled with saturated vent has been estimated by the solvent parameter 4,5) brine and oil, and from an estuary polluted with log Pow (common logarithm of the partition crude oil.6) No report, however, has been published coe‹cient of a given solvent in a mixture of n-oc- concerning organic solvent tolerance of representa- tanolandwater),whichisanindexofbiological tive strains of halophilic archaea. In this report we toxicity.2) Lower values represent higher toxicity. investigated organic solvent tolerance of type strains Table 1 shows the growth of strains in the presence of of extreme halophiles of the family Halobacteria- various organic solvents. All strains of halophilic ceae.7) archaea showed good growth in media containing n- The following type strains of each type species of decane, while most type strains showed no growth in the sixteen genera were cultivated as follows. Haloar- the presence of organic solvents which had log Pow cula vallismortis JCM 8877T, Halobacterium salina- value, below 4.9, except H. borinquense JCM 10706T rum JCM 8978T, Halococcus morrhuae JCM 8876T, and H. saccharovorum JCM 8865T. Gram-negative Haloferax volcanii JCM 8879T, Halogeometricum bacteria, Escherichia coli and P. putida for example, † To whom correspondence should be addressed. Fax: ＋81-492-31-1031; E-mail: usaron＠mail.cc.eng.toyo.ac.jp 1810 R. USAMI et al. Table 1. Organic Solvent Tolerance of Halophilic Archaea Organic solvent n-decane n-nonane hexylether n-octane isooctane cyclooctane growth Strains patterns log Pow value 6.0 5.5 5.1 4.9 4.8 4.4 Haloferax volcanii JCM 8879T ＋＋ ± ＋＋ －－ － Natrialba asiatica JCM 9576T ＋＋ ＋ ＋＋ －－ － Natrinema pellirubrum JCM 10476T ＋＋ ＋＋ ＋＋ －－ － Halogeometricum borinquense JCM 10706T ＋＋ ＋＋ ＋＋ ＋ －－A Natronomonas pharaonis JCM 8858T ＋ － ＋ －－ － Natronorubrum bangense JCM 10635T ＋＋ ＋ ＋＋ －－ － Haloarcula sp. strain OHF-2 ＋＋ ＋＋ ＋＋ ＋＋ ＋ ± Haloarcula vallismortis JCM 8877T ＋ ± ＋ －－ － Halobacterium salinarum JCM 8978T ＋＋ ＋＋ ＋＋ －－ － Halorubrum saccharovorum JCM 8865T ＋＋ ＋ ＋ ＋ －－ Halococcus morrhuae JCM 8876T ＋＋ ＋ ＋＋ －－ － Haloterrigena turkmenica JCM 9101T ＋＋ ± ＋ －－ － Halorhabdus utahensis JCM 11049T ＋＋ ±－－－－ B Halobaculum gomorrense JCM 9908T ＋＋ ＋ －－－ － Halomicrobium mukohataei JCM 9738T ＋ ± ＋ －－ － Natronobacterium gregoryi JCM 8860T ＋＋ ±－－－－ Natronococcus occultus JCM 8859T ＋ －－－－－ Haloarcula argentinensis JCM 9737T ＋＋ ± ＋ －－ － Haloarcula sp. strain OHF-1 ＋＋ ＋＋ ＋＋ ＋ ±－ ＋＋: good growth, ＋, ±:growth,－:nogrowth. This table shows the growth of the sixteen type strains, Har. argentinensis JCM 9737T and two isolates OHF-1 and OHF-2, in the presence of various organic solvents. Growth patterns A and B shows the diŠerent growth curves show in Fig. 1A and B, respectively. have been shown to be tolerant up to log Pow of 3.8 NaCl. Ten colonies were picked up at random and (propylbenzene) and 3.1 ( p-xylene), respectively. were tested for the solvent tolerance as described Thus, the organic solvent tolerance of the halophilic above. Two isolates, OHF-1 and OHF-2, showed archaea seems to be weaker than that of Gram-nega- tolerance to isooctane (log Pow＝4.8), while the other tive bacteria.2) eight isolates showed tolerance only up to hexylether Growth of some strains was measured periodically (log Pow＝5.1). inthepresenceofn-decane and two patterns were ob- To identify OHF-1 and OHF-2, the 16S rRNA tained. In pattern A, the growth rate at exponential encoding genes were ampliˆed by PCR with the phase was considerably lower in the presence of n- following forward and reverse primers: 5?-ATTCC- decane but the ˆnal cell density reached above 83z GGTTGATCCTGCCGG (positions 6–25 in E. coli of that in the absence of n-decane. In pattern B, both numbering) and 5?-AGGAGGTGATCCAGCCGC- growth rate and the ˆnal cell density were low in the AG (positions 1540–1521). The ampliˆed 16S rDNAs presence of n-decane (65–75z). Representative were cloned into pCR2.1 T-vector (Invitrogen) and growth curves of N. bangense (pattern A) and N. sequenced using the Big Dye Sequencing Kit (Applied gregoryi (patternB)areshowninFig.1.Other Biosystems) by the ABI 377 DNA sequencer (Applied strains tested are also divided into patterns A and B Biosystems). Sequencing primers used were 1: 5?- (Table 1). DiŠerences in growth patterns in the ATTCCGGTTGATCCTGCCGG (positions 6–25 in presence of n-decane may suggest there is a diŠerence E. coli numbering), 6: 5?-AGGAGGTGATCCAGC- between these two patterns in the expression of genes CGCAG (positions 1540–1521), 7: 5?-ATTGGGCC- responsible for the solvent tolerance. Tolerance may TAAAGCGTCCGTA (positions 563–585), -20: 5?- be induced in the presence of organic solvents in GGAAACAGCTATGACCATG (vector side's pattern A, while not in pattern B. primer) and Rev: 5?-GTAAAACGACGGCCAGT To investigate if there exist any halophilic archaea (vector side's primer). The sequences of strains with stronger solvent tolerance, we isolated some OHF-1 and OHF-2 had very high similarities with extreme halophiles from a commercially available that of Haloarcula argentinensis,99.1z and 99.3z, French solar salt (Sel Marin DE NOIRMOUTIER). respectively, suggesting that the two strains belonged The salt sample was dissolved in 50 ml of a sterile to Har. argentinensis. DDBJ accession numbers of medium (consisting of Casamino acids, yeast extract, OHF-1 and OHF-2 are AB098536 and AB098337, 0.2z KCl, and 2z magnesiumsulfate,pH7.4)ata respectively. concentration of 25z, and incubated at 379Cfor3 Unexpectedly, the type strain of Har. argentinen- weeks without shaking. The culture was then spread sis, JCM 9737T, showed tolerance only up to 5.1, as on an agar plate of the same medium containing 25z do most other type strains of other genera. It was Organic Solvent Tolerant Halophiles 1811 Fig. 1. Growth Curves of Halophilic Archaea. Growth curves of Natronorubrum bangense (A) and Natronobacterium gregoryi (B). Cultures were done in 100-ml ‰asks containing 20 ml of medium, with () or without ()10mlofn-decane, shaken at 110 rpm at 309C. Samples were taken periodically to measure OD660nm. also noted that OHF-1 showed pattern B while OHF-2 showed pattern A, thus there was little corre- References lation between growth patterns and the genera. Strains OHF-1 and 2 maintained their tolerance to 1) Inoue, A., and Horikoshi, K., A Pseudomonas organic solvent even after repeated sub-culturing in thrives in high concentrations of toluene. Nature, solvent-free medium, suggesting that chromosomes 338, 264–266 (1989). contain genes for organic solvent tolerance. Further 2) Inoue, A., and Horikoshi, K., Estimation of solvent- tolerance of bacteria by the solvent parameter log P. studies of the genomes of type strains may reveal any J. Ferment. Bioeng., 71, 194–196 (1991). relationships. 3) Kobayashi, H., Takami, H., Hirayama, H., Kobata, In bacteria, genes relevant to solvent tolerance K., Usami, R., and Horikoshi, K., Outer membrance 8) have been identiˆed, such as ostAofE. coli K-12, changes in a toluene-sensitive mutant of toluene- and ttgRofP.
Load more

Recommended publications
  • Metagenomic Insights Into the Uncultured Diversity and Physiology of Microbes in Four Hypersaline Soda Lake Brines
    Lawrence Berkeley National Laboratory Recent Work Title Metagenomic Insights into the Uncultured Diversity and Physiology of Microbes in Four Hypersaline Soda Lake Brines. Permalink https://escholarship.org/uc/item/9xc5s0v5 Journal Frontiers in microbiology, 7(FEB) ISSN 1664-302X Authors Vavourakis, Charlotte D Ghai, Rohit Rodriguez-Valera, Francisco et al. Publication Date 2016 DOI 10.3389/fmicb.2016.00211 Peer reviewed eScholarship.org Powered by the California Digital Library University of California ORIGINAL RESEARCH published: 25 February 2016 doi: 10.3389/fmicb.2016.00211 Metagenomic Insights into the Uncultured Diversity and Physiology of Microbes in Four Hypersaline Soda Lake Brines Charlotte D. Vavourakis 1, Rohit Ghai 2, 3, Francisco Rodriguez-Valera 2, Dimitry Y. Sorokin 4, 5, Susannah G. Tringe 6, Philip Hugenholtz 7 and Gerard Muyzer 1* 1 Microbial Systems Ecology, Department of Aquatic Microbiology, Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, Netherlands, 2 Evolutionary Genomics Group, Departamento de Producción Vegetal y Microbiología, Universidad Miguel Hernández, San Juan de Alicante, Spain, 3 Department of Aquatic Microbial Ecology, Biology Centre of the Czech Academy of Sciences, Institute of Hydrobiology, Ceskéˇ Budejovice,ˇ Czech Republic, 4 Research Centre of Biotechnology, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, 5 Department of Biotechnology, Delft University of Technology, Delft, Netherlands, 6 The Department of Energy Joint Genome Institute, Walnut Creek, CA, USA, 7 Australian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences and Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD, Australia Soda lakes are salt lakes with a naturally alkaline pH due to evaporative concentration Edited by: of sodium carbonates in the absence of major divalent cations.
    [Show full text]
  • Carbon Monoxide As a Metabolic Energy Source for Extremely Halophilic Microbes: Implications for Microbial Activity in Mars Regolith
    Carbon monoxide as a metabolic energy source for extremely halophilic microbes: Implications for microbial activity in Mars regolith Gary M. King1 Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803 Edited by David M. Karl, University of Hawaii, Honolulu, HI, and approved March 5, 2015 (received for review December 31, 2014) Carbon monoxide occurs at relatively high concentrations (≥800 that low organic matter levels might indeed occur in some deposits parts per million) in Mars’ atmosphere, where it represents a poten- (e.g., 12). Even so, it is uncertain whether this material exists in a tially significant energy source that could fuel metabolism by a local- form or concentrations suitable for microbial use. ized putative surface or near-surface microbiota. However, the The Martian atmosphere has largely been ignored as a potential plausibility of CO oxidation under conditions relevant for Mars in energy source, because it is dominated by CO2 (24, 25). Ironically, its past or at present has not been evaluated. Results from diverse UV photolysis of CO2 forms carbon monoxide (CO), a potential terrestrial brines and saline soils provide the first documentation, to bacterial substrate that occurs at relatively high concentrations: our knowledge, of active CO uptake at water potentials (−41 MPa to about 800 ppm on average, with significantly higher levels for −117 MPa) that might occur in putative brines at recurrent slope some sites and times (26, 27). In addition, molecular oxygen lineae (RSL) on Mars. Results from two extremely halophilic iso- (O2), which can serve as a biological CO oxidant, occurs at lates complement the field observations.
    [Show full text]
  • Emended Descriptions of Genera of the Family Halobacteriaceae
    International Journal of Systematic and Evolutionary Microbiology (2009), 59, 637–642 DOI 10.1099/ijs.0.008904-0 Taxonomic Emended descriptions of genera of the family Note Halobacteriaceae Aharon Oren,1 David R. Arahal2 and Antonio Ventosa3 Correspondence 1Institute of Life Sciences, and the Moshe Shilo Minerva Center for Marine Biogeochemistry, Aharon Oren The Hebrew University of Jerusalem, Jerusalem 91904, Israel [email protected] 2Departamento de Microbiologı´a y Ecologı´a and Coleccio´n Espan˜ola de Cultivos Tipo (CECT), Universidad de Valencia, 46100 Burjassot, Valencia, Spain 3Department of Microbiology and Parasitology, Faculty of Pharmacy, University of Sevilla, 41012 Sevilla, Spain The family Halobacteriaceae currently contains 96 species whose names have been validly published, classified in 27 genera (as of September 2008). In recent years, many novel species have been added to the established genera but, in many cases, one or more properties of the novel species do not agree with the published descriptions of the genera. Authors have often failed to provide emended genus descriptions when necessary. Following discussions of the International Committee on Systematics of Prokaryotes Subcommittee on the Taxonomy of Halobacteriaceae, we here propose emended descriptions of the genera Halobacterium, Haloarcula, Halococcus, Haloferax, Halorubrum, Haloterrigena, Natrialba, Halobiforma and Natronorubrum. The family Halobacteriaceae was established by Gibbons rRNA gene sequence-based phylogenetic trees rather than (1974) to accommodate the genera Halobacterium and on true polyphasic taxonomy such as recommended for the Halococcus. At the time of writing (September 2008), the family (Oren et al., 1997). As a result, there are often few, if family contained 96 species whose names have been validly any, phenotypic properties that enable the discrimination published, classified in 27 genera.
    [Show full text]
  • The Role of Stress Proteins in Haloarchaea and Their Adaptive Response to Environmental Shifts
    biomolecules Review The Role of Stress Proteins in Haloarchaea and Their Adaptive Response to Environmental Shifts Laura Matarredona ,Mónica Camacho, Basilio Zafrilla , María-José Bonete and Julia Esclapez * Agrochemistry and Biochemistry Department, Biochemistry and Molecular Biology Area, Faculty of Science, University of Alicante, Ap 99, 03080 Alicante, Spain; [email protected] (L.M.); [email protected] (M.C.); [email protected] (B.Z.); [email protected] (M.-J.B.) * Correspondence: [email protected]; Tel.: +34-965-903-880 Received: 31 July 2020; Accepted: 24 September 2020; Published: 29 September 2020 Abstract: Over the years, in order to survive in their natural environment, microbial communities have acquired adaptations to nonoptimal growth conditions. These shifts are usually related to stress conditions such as low/high solar radiation, extreme temperatures, oxidative stress, pH variations, changes in salinity, or a high concentration of heavy metals. In addition, climate change is resulting in these stress conditions becoming more significant due to the frequency and intensity of extreme weather events. The most relevant damaging effect of these stressors is protein denaturation. To cope with this effect, organisms have developed different mechanisms, wherein the stress genes play an important role in deciding which of them survive. Each organism has different responses that involve the activation of many genes and molecules as well as downregulation of other genes and pathways. Focused on salinity stress, the archaeal domain encompasses the most significant extremophiles living in high-salinity environments. To have the capacity to withstand this high salinity without losing protein structure and function, the microorganisms have distinct adaptations.
    [Show full text]
  • Salinity Drives Archaeal Distribution Patterns in High Altitude Lake Sediments on the Tibetan Plateau Yongqin Liu 1,2,∗, John C
    FEMS Microbiology Ecology, 92, 2016, fiw033 doi: 10.1093/femsec/fiw033 Advance Access Publication Date: 16 February 2016 Research Article RESEARCH ARTICLE Salinity drives archaeal distribution patterns in high altitude lake sediments on the Tibetan Plateau Yongqin Liu 1,2,∗, John C. Priscu3, Jinbo Xiong4, Ralf Conrad5, Trista Vick-Majors3, Haiyan Chu6 and Juzhi Hou1 Downloaded from 1Key Laboratory of Tibetan Environment Changes and Land Surface Processes, Institute of Tibetan Plateau Research, Beijing 100101, China, 2CAS Center for Excellence in Tibetan Plateau Earth Sciences, Chinese Academy of Sciences, Beijing 100101, China, 3Department of Land Resources and Environmental Sciences, Montana State University, Bozeman, MT 59717, USA, 4Faculty of Marine Sciences, Ningbo University, Ningbo http://femsec.oxfordjournals.org/ 315211, China, 5Max Planck Institute for Terrestrial Microbiology, Marburg 35043, Germany and 6State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, China ∗Corresponding author: Institute of Tibetan Plateau, Chinese Academy of Science, No. 16, Lincuo Rd., Beijing 100101, China. Tel: 86-10-84097122; E-mail: [email protected] One sentence summary: We represent a comprehensive investigation of archaeal diversity in the pristine lake sediments across the Tibetan Plateau, and found salinity is the key factor controlling archaeal community diversity and composition. Editor: Dirk Wagner by guest on April 5, 2016 ABSTRACT Archaeal communities and the factors regulating their diversity in high altitude lakes are poorly understood. Here, we provide the first high-throughput sequencing study of Archaea from Tibetan Plateau lake sediments. We analyzed twenty lake sediments from the world’s highest and largest plateau and found diverse archaeal assemblages that clustered into groups dominated by methanogenic Euryarchaeota, Crenarchaeota and Halobacteria/mixed euryarchaeal phylotypes.
    [Show full text]
  • Natronorubrum Sulfidifaciens Sp
    This article is downloaded from http://researchoutput.csu.edu.au It is the paper published as: Authors: Yun-Zhuang Mou, Xing-Xing Qiu, Mei-Lin Zhao, Heng-Lin Cui, Dickson Oh, and Mike L. Dyall-Smith Title: Halohasta litorea gen. nov. sp. nov., and Halohasta litchfieldiae sp. nov., isolated from the Daliang aquaculture farm, China and from Deep Lake, Antarctica, respectively Journal Title: Extremophiles ISSN: 1433-4909 Year: 2012 Volume: 16 Issue: 6 Pages: 895-901 Abstract: Two halophilic archaeal strains, R30T and tADLT, were isolated from an aquaculture farm in Dailing, China, and from Deep Lake, Antarctica, respectively. Both have rod-shaped cells that lyse in distilled water, stain Gram-negative and form red-pigmented colonies. They are neutrophilic, require >120 g/l NaCl and 48–67 g/l MgCl2 for growth but differ in their optimum growth temperatures (30 °C, tADLT vs. 40 °C, R30T). The major polar lipids were typical for members of the Archaea but also included a major glycolipid chromatographically identical to sulfated mannosyl glucosyl diether (S-DGD-1). The 16S rRNA gene sequences of the two strains are 97.4 % identical, show most similarity to genes of the family Halobacteriaceae, and cluster together as a distinct clade in phylogenetic tree reconstructions. The rpoB′ gene similarity between strains R30T and tADLT is 92.9 % and less to other halobacteria. Their DNA G + C contents are 62.4–62.9 mol % but DNA–DNA hybridization gives a relatedness of only 44 %. Based on phenotypic, chemotaxonomic and phylogenetic properties, we describe two new species of a novel genus, represented by strain R30T (= CGMCC 1.10593T = JCM 17270T) and strain tADLT (= JCM 15066T = DSMZ 22187T) for which we propose the names Halohasta litorea gen.
    [Show full text]
  • Isolation and Identification of Haloalkaliphilic Archaeal Isolates from a Soda Lake in India
    ISSN(Online) : 2319-8753 ISSN (Print) : 2347-6710 International Journal of Innovative Research in Science, Engineering and Technology (An ISO 3297: 2007 Certified Organization) Website: www.ijirset.com Vol. 6, Issue 6, June 2017 Isolation and Identification of Haloalkaliphilic Archaeal Isolates from a Soda Lake in India Gopal N. Kalambe 1, Vivek N. Upasani 2 Research Student, Department of Microbiology, JJTU, Vidyanagari, Jhunjhunu, Rajasthan, India Associate Professor, Department of Microbiology, M. G. Science Institute, Ahmedabad, Gujarat, India2 ABSTRACT: Although an extreme environment, the hypersaline ecosystems are rich in microbial diversity for biotechnological applications. The aerobic, gram-negative, pleomorphic rods and cocci, chemoorganotrophic archaea belonging to the family Halobacteriaceae within the Phylum Euryarchaeota have been extensively studied in the last few decades. They have provided new insights for survival under high salinity and/or alkalinity. They occur in both marine as well as inland saline regions mainly in solar salterns. The soda lakes are intermittent saline lakes that contain sodium carbonate / bicarbonate (soda) alongwith sodium chloride that are found in desert regions of the world for example, Lake Magadii (Kenya), Wadi Natrun lakes (Egypt), Sambhar Salt Lake (India), etc. Several halobacterial strains were isolated from the hypersaline brines collected from Sambhar Lake, Rajasthan. Three of the isolates were selected based on differences in colony/cultural characteristics and identified phylogenetically based on 16S rRNA sequence homology studies. Two isolates were identified as strains identical to Natronobacterium sp. and one as Natrialba sp. KEYWORDS: Natronobacterium, Natrialba, Haloarchaea, Sambhar Lake. I. INTRODUCTION The extremely halophilic archaea belonging to the family Halobacteriaceae (Phylum Euryarchaeota) are commonly found in the hypersaline environments such as salt lakes, salt ponds, marine salterns and soda lakes.
    [Show full text]
  • Taxonomic Study of Extreme Halophilic Archaea Isolated from the “Salar De Atacama”, Chile
    System. Appl. Microbiol. 24, 464–474 (2001) © Urban & Fischer Verlag http://www.urbanfischer.de/journals/sam Taxonomic Study of Extreme Halophilic Archaea Isolated from the “Salar de Atacama”, Chile CATHERINE LIZAMA1,2, MERCEDES MONTEOLIVA-SÁNCHEZ1, BERNARDO PRADO2, ALBERTO RAMOS-CORMENZANA1, JURGEN WECKESSER3 and VICTORIANO CAMPOS2 1Department of Microbiology, Faculty of Pharmacy, University of Granada, Campus Universitario de Cartuja Granada, Spain 2Laboratory of Microbiology, Institute of Biology, Faculty of Basic and Mathematics Sciences, Catholic University of Valparaíso, Val- paraíso, Chile 3Institute of Biology and Microbiology, Freiburg, Germany Received July 1, 2001 Summary A large number of halophilic bacteria were isolated in 1984–1992 from the Atacama Saltern (North of Chile). For this study 82 strains of extreme halophilic archaea were selected. The characterization was performed by using the phenotypic characters including morphological, physiological, biochemical, nu- tritional and antimicrobial susceptibility test. The results, together with those from reference strains, were subjected to numerical analysis, using the Simple Matching (SSM) coefficient and clustered by the unweighted pair group method of association (UPGMA). Fifteen phena were obtained at an 70% simi- larity level. The results obtained reveal a high diversity among the halophilic archaea isolated. Represen- tative strains from the phena were chosen to determine their DNA base composition and the percentage of DNA-DNA similarity compared to reference strains. The 16S rRNA studies showed that some of these strains constitutes a new taxa of extreme halophilic archaea. Key words: Atacama Saltern – Tebenquiche Lake – Extreme Halophilic Archaea – Numerical Taxonomy Introduction The extreme halophilic archaea require at least 1.5 M promise of providing valuable molecules for biotechno- NaCl.
    [Show full text]
  • Application for Approval to Import Into Containment Any New Organism That
    ER-AN-02N 10/02 Application for approval to import into FORM 2N containment any new organism that is not genetically modified, under Section 40 of the Page 1 Hazardous Substances and New Organisms Act 1996 FORM NO2N Application for approval to IMPORT INTO CONTAINMENT ANY NEW ORGANISM THAT IS NOT GENETICALLY MODIFIED under section 40 of the Hazardous Substances and New Organisms Act 1996 Application Title: Importation of extremophilic microorganisms from geothermal sites for research purposes Applicant Organisation: Institute of Geological & Nuclear Sciences ERMA Office use only Application Code: Formally received:____/____/____ ERMA NZ Contact: Initial Fee Paid: $ Application Status: ER-AN-02N 10/02 Application for approval to import into FORM 2N containment any new organism that is not genetically modified, under Section 40 of the Page 2 Hazardous Substances and New Organisms Act 1996 IMPORTANT 1. An associated User Guide is available for this form. You should read the User Guide before completing this form. If you need further guidance in completing this form please contact ERMA New Zealand. 2. This application form covers importation into containment of any new organism that is not genetically modified, under section 40 of the Act. 3. If you are making an application to import into containment a genetically modified organism you should complete Form NO2G, instead of this form (Form NO2N). 4. This form, together with form NO2G, replaces all previous versions of Form 2. Older versions should not now be used. You should periodically check with ERMA New Zealand or on the ERMA New Zealand web site for new versions of this form.
    [Show full text]
  • Cellular and Molecular Biology
    Cellular and Molecular Biology E-ISSN : 1165-158X / P-ISSN : 0145-5680 www.cellmolbiol.org Original Research Isolation and identification of two extremely halophilic archaea from sebkhas in the Algerian Sahara Sakina Khallef1, Roxane Lestini2, Hannu Myllykallio2, Karim Houali3* 1 Laboratoire de Bio Ressources Sahariennes. Préservation et valorisation (BRS). Département des Sciences Biologiques, Faculté des Sciences de la Nature et de la Vie, Université Kasdi MERBAH de Ouargla, 30000, Algérie 2 Laboratoire d'Optique et Biosciences (LOB), Ecole Polytechnique, CNRS UMR7645 - INSERM U696.Université Paris-Saclay, 91 128, Palaiseau Cedex, France 3 Laboratoire de Biochimie Analytiques et Biotehnologies (LABAB), Faculté des Sciences Biologiques et des Sciences Agronomiques. Université Mouloud MAMMERI de Tizi-Ouzou. Algérie Correspondence to: [email protected] Received November 18, 2017; Accepted March 26, 2018; Published March 31, 2018 Doi: http://dx.doi.org/10.14715/cmb/2018.64.4.14 Copyright: © 2018 by the C.M.B. Association. All rights reserved. Abstract: In Algeria, many salt lakes are to be found spread from southern Tunisia up to the Atlas Mountains in northern Algeria. Oum Eraneb and Ain El beida sebkhas (salt lakes), are located in the Algerian Sahara. The aim of this study was to explore the diversity of the halobacteria in this type of habitats. The physico- chemical properties of these shallow saline environments were examined and compared with other hypersaline and marine ecosystems. Both sites were relatively alkaline with a pH around 8.57- 8.74 and rich in salt at 13% and 16% (w/v) salinity for Oum Eraneb and Ain El beida, respectively, with dominant ions of sodium and chloride.
    [Show full text]
  • Diversity and Activity of Aerobic Thermophilic Carbon Monoxide-Oxidizing Bacteria on Kilauea Volcano, Hawaii
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2013 Diversity and activity of aerobic thermophilic carbon monoxide-oxidizing bacteria on Kilauea Volcano, Hawaii Caitlin Elizabeth King Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Recommended Citation King, Caitlin Elizabeth, "Diversity and activity of aerobic thermophilic carbon monoxide-oxidizing bacteria on Kilauea Volcano, Hawaii" (2013). LSU Doctoral Dissertations. 690. https://digitalcommons.lsu.edu/gradschool_dissertations/690 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. DIVERSITY AND ACTIVITY OF AEROBIC THERMOPHILIC CARBON MONOXIDE- OXIDIZING BACTERIA ON KILAUEA VOLCANO, HAWAII A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Biological Sciences by Caitlin E. King B.S., Louisiana State University, 2008 December 2013 ACKNOWLEDGEMENTS First and foremost, I would like to thank my advisor Dr. Gary King for his guidance, flexibility, and emotional and financial support over the past 5 years. I am fortunate that I was able to accompany Dr. King on two field excursions to Hawaii. Dr. King also went on additional field trips on behalf of my project and initiated our metagenomic work. Dr. King made this project possible and taught me the important skills of troubleshooting and writing critically, which have prepared me for success in both my professional and personal life.
    [Show full text]
  • Haloarchaeal Species Genesis: Diversity, Recombination, and Evolution Nikhil Ram Mohan University of Connecticut - Storrs, R [email protected]
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 7-26-2016 Haloarchaeal Species Genesis: Diversity, Recombination, and Evolution Nikhil Ram Mohan University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Ram Mohan, Nikhil, "Haloarchaeal Species Genesis: Diversity, Recombination, and Evolution" (2016). Doctoral Dissertations. 1207. https://opencommons.uconn.edu/dissertations/1207 Haloarchaeal Species Genesis: Diversity, Recombination, and Evolution Nikhil Ram Mohan University of Connecticut, 2016 ABSTRACT The processes key to the generation of new species in eukaryotes is well understood but the same is not true for the prokaryotic world. Allopatric speciation is widely accepted as the driving force in eukaryotic species genesis. However, little is known about prokaryotic speciation primarily due to the abundance of prokaryotes in this world. They inhabit every fathomable niche, present high cell densities, complex community structures, and are easily dispersed between large distances. For example, a gram of soil or a milliliter of seawater house millions and millions of a vast variety of microorganisms. This complexity in the prokaryotic world makes inferring an overall evolutionary processes extremely difficult. To reduce the complexity, the system studied needs to be narrowed down. This thesis focusses on one environment that is so extreme that it is conducive for the growth of only certain groups of organisms. The system is characterized by high salinity, much greater than that of seawater, which is a prerequisite for the survival of an entire class of Archaea call the Halobacteria (Haloarchaea). Studying these environments reduces the microbial complexity in comparison to some of the more easily habitable areas like soil or water.
    [Show full text]