DOCSLIB.ORG

Mouse Ei24 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Ei24 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Ei24 Knockout Project (CRISPR/Cas9) Objective: To create a Ei24 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ei24 gene (NCBI Reference Sequence: NM_001199494 ; Ensembl: ENSMUSG00000062762 ) is located on Mouse chromosome 9. 11 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000115086). Exon 2~7 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a targeted allele do not survive to the neonatal stage. Exon 2 starts from the coding region. Exon 2~7 covers 57.26% of the coding region. The size of effective KO region: ~7817 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 11 Legends Exon of mouse Ei24 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 953 bp section downstream of Exon 7 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(26.45% 529) | C(19.1% 382) | T(34.15% 683) | G(20.3% 406) Note: The 2000 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(953bp) | A(28.75% 274) | C(17.21% 164) | T(30.43% 290) | G(23.61% 225) Note: The 953 bp section downstream of Exon 7 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr9 - 36793336 36795335 2000 browser details YourSeq 114 12 268 2000 90.9% chr11 - 95920990 95921479 490 browser details YourSeq 106 17 296 2000 90.8% chr12 + 53980126 53980488 363 browser details YourSeq 99 15 294 2000 90.0% chr12 - 86820098 86820376 279 browser details YourSeq 95 12 294 2000 93.6% chr14 + 60970469 61187786 217318 browser details YourSeq 94 15 296 2000 89.9% chr11 + 100507772 100508211 440 browser details YourSeq 88 14 296 2000 94.9% chr18 + 60829439 60829783 345 browser details YourSeq 88 21 294 2000 93.2% chr14 + 49014562 49015081 520 browser details YourSeq 86 13 294 2000 88.4% chr9 - 70674625 70675089 465 browser details YourSeq 79 188 281 2000 97.7% chr6 - 136569584 136569984 401 browser details YourSeq 78 199 294 2000 90.7% chr1 + 51995881 51995976 96 browser details YourSeq 77 14 281 2000 88.9% chr12 - 69138570 69543192 404623 browser details YourSeq 75 218 296 2000 97.5% chr17 + 47393841 47393919 79 browser details YourSeq 73 218 296 2000 97.5% chr16 - 94643023 94643115 93 browser details YourSeq 73 206 292 2000 92.0% chr1 + 132784450 132784536 87 browser details YourSeq 72 224 297 2000 98.7% chrX - 56419117 56419190 74 browser details YourSeq 72 214 296 2000 94.0% chr5 - 35326561 35326644 84 browser details YourSeq 71 218 296 2000 95.0% chr2 - 30308140 30308218 79 browser details YourSeq 71 218 294 2000 96.2% chr16 - 96265410 96265486 77 browser details YourSeq 71 218 296 2000 95.0% chr19 + 26843429 26843507 79 Note: The 2000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 953 1 953 953 100.0% chr9 - 36784580 36785532 953 browser details YourSeq 69 503 623 953 82.5% chr1 - 51723972 51724090 119 browser details YourSeq 68 512 626 953 90.5% chr3 + 89852861 89881822 28962 browser details YourSeq 63 512 649 953 86.3% chr1 + 119785646 119786194 549 browser details YourSeq 60 478 569 953 82.7% chrX - 111567762 111567853 92 browser details YourSeq 58 525 634 953 77.8% chrX - 153727146 153727573 428 browser details YourSeq 57 512 664 953 86.9% chrX - 60332910 60333063 154 browser details YourSeq 57 502 623 953 84.4% chr8 - 106943586 106943708 123 browser details YourSeq 55 541 623 953 88.6% chr10 + 59050574 59050656 83 browser details YourSeq 54 539 664 953 83.6% chr12 + 84960080 84960202 123 browser details YourSeq 53 539 626 953 93.5% chr12 - 59136310 59187996 51687 browser details YourSeq 53 497 569 953 87.7% chr4 + 99270697 99270768 72 browser details YourSeq 52 543 632 953 83.9% chr4 + 83531999 83532086 88 browser details YourSeq 52 492 571 953 82.5% chr4 + 44266404 44266483 80 browser details YourSeq 52 550 663 953 90.7% chr17 + 84162292 84162408 117 browser details YourSeq 51 512 578 953 88.6% chr3 - 95912005 95912070 66 browser details YourSeq 51 513 578 953 89.9% chr19 - 44568941 44569005 65 browser details YourSeq 50 520 586 953 87.9% chr10 + 44784408 44784479 72 browser details YourSeq 49 512 578 953 86.6% chr2 - 121723615 121723681 67 browser details YourSeq 49 541 646 953 69.4% chr11 - 9221742 9221843 102 Note: The 953 bp section downstream of Exon 7 is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Ei24 etoposide induced 2.4 mRNA [ Mus musculus (house mouse) ] Gene ID: 13663, updated on 24-Oct-2019 Gene summary Official Symbol Ei24 provided by MGI Official Full Name etoposide induced 2.4 mRNA provided by MGI Primary source MGI:MGI:108090 See related Ensembl:ENSMUSG00000062762 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as PIG8; AA536736; AI115355 Expression Ubiquitous expression in liver adult (RPKM 47.4), bladder adult (RPKM 40.3) and 28 other tissues See more Orthologs human all Genomic context Location: 9 A4; 9 20.68 cM See Ei24 in Genome Data Viewer Exon count: 11 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 9 NC_000075.6 (36779153..36797334, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 9 NC_000075.5 (36586740..36604653, complement) Chromosome 9 - NC_000075.6 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 11 transcripts Gene: Ei24 ENSMUSG00000062762 Description etoposide induced 2.4 mRNA [Source:MGI Symbol;Acc:MGI:108090] Gene Synonyms PIG8 Location Chromosome 9: 36,779,159-36,797,393 reverse strand. GRCm38:CM001002.2 About this gene This gene has 11 transcripts (splice variants), 223 orthologues, is a member of 1 Ensembl protein family and is associated with 1 phenotype. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Ei24- ENSMUST00000115086.12 2220 358aa ENSMUSP00000110738.4 Protein CCDS22973 A0A0R4J250 TSL:1 201 coding GENCODE basic Ei24- ENSMUST00000239021.1 2104 358aa ENSMUSP00000159069.1 Protein CCDS22973 - GENCODE basic 211 coding Ei24- ENSMUST00000163192.10 2309 340aa ENSMUSP00000132270.3 Protein - A0A0R4J250 TSL:1 202 coding Q61070 GENCODE basic APPRIS P1 Ei24- ENSMUST00000238932.1 2220 340aa ENSMUSP00000159090.1 Protein - Q61070 GENCODE basic 210 coding APPRIS P1 Ei24- ENSMUST00000184395.8 619 163aa ENSMUSP00000139150.2 Protein - V9GXH2 CDS 3' incomplete 207 coding TSL:3 Ei24- ENSMUST00000184235.1 511 171aa ENSMUSP00000139319.1 Protein - V9GXU0 CDS 5' and 3' 206 coding incomplete TSL:3 Ei24- ENSMUST00000217339.1 1596 No - Retained - - TSL:NA 209 protein intron Ei24- ENSMUST00000185124.1 936 No - Retained - - TSL:2 208 protein intron Ei24- ENSMUST00000183430.1 655 No - Retained - - TSL:3 205 protein intron Ei24- ENSMUST00000183422.1 472 No - Retained - - TSL:2 204 protein intron Ei24- ENSMUST00000183360.1 347 No - lncRNA - - TSL:5 203 protein Page 7 of 9 https://www.alphaknockout.com 38.23 kb Forward strand 36.77Mb 36.78Mb 36.79Mb 36.80Mb Genes Gm26787-201 >lncRNA (Comprehensive set... Contigs < AC155921.2 Genes (Comprehensive set... < Ei24-211protein coding < Ei24-201protein coding < Ei24-210protein coding < Ei24-202protein coding < Ei24-208retained intron < Ei24-207protein coding < Ei24-204retained intron < Ei24-206protein coding < Ei24-205retained intron < Ei24-209retained intron < Ei24-203lncRNA Regulatory Build 36.77Mb 36.78Mb 36.79Mb 36.80Mb Reverse strand 38.23 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding Ensembl protein coding Non-Protein Coding RNA gene processed transcript Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000115086 < Ei24-201protein coding Reverse strand 18.23 kb ENSMUSP00000110... Transmembrane heli... Low complexity (Seg) Pfam PF07264 PANTHER Etoposide-induced 2.4 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 40 80 120 160 200 240 280 358 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC.
Load more

Recommended publications
  • DNA Damage Triggers Tubular Endoplasmic Reticulum Extension to Promote Apoptosis by Facilitating ER-Mitochondria Signaling
    www.nature.com/cr www.cell-research.com ARTICLE OPEN DNA damage triggers tubular endoplasmic reticulum extension to promote apoptosis by facilitating ER-mitochondria signaling Pengli Zheng1,2, Qingzhou Chen1, Xiaoyu Tian1, Nannan Qian1,3, Peiyuan Chai1, Bing Liu1,4, Junjie Hu 5,6, Craig Blackstone2, Desheng Zhu7, Junlin Teng 1 and Jianguo Chen1,4 The endoplasmic reticulum (ER) is composed of the nuclear envelope, perinuclear sheets and a peripheral tubular network. The peripheral ER and mitochondria form tight contacts at specific subdomains, which coordinate the functions of the two organelles and are required for multiple cellular processes such as Ca2+ transfer and apoptosis. However, it is largely unknown how ER morphology and ER-mitochondria signaling are dynamically regulated under different physiological or pathological conditions such as DNA damage. Here we show that the peripheral, tubular ER undergoes significant extension in response to DNA damage, and that this process is dependent on p53-mediated transcriptional activation of the ER-shaping proteins REEP1, REEP2 and EI24 (alias PIG8). This promotes the formation of ER-mitochondria contacts through EI24 and the mitochondrial outer membrane protein VDAC2, facilitates Ca2+ transfer from ER to mitochondria and promotes DNA damage-induced apoptosis. Thus, we identify a unique DNA damage response pathway involving alterations in ER morphology, ER-mitochondria signaling, and apoptosis. Cell Research (2018) 28:833–854; https://doi.org/10.1038/s41422-018-0065-z INTRODUCTION transfer with high efficiency from the ER to mitochondria, which The endoplasmic reticulum (ER) is the largest membranous is necessary for mitochondrial metabolism.16 However, dramati- organelle and performs essential roles in protein synthesis and cally increased ER-mitochondria Ca2+ flux triggers apoptosis by secretion, Ca2+ homeostasis, and lipid metabolism.
    [Show full text]
  • Ei24) Reduced Cell Proliferation and Aggregate-Size in Dictyostelium Discoideum NEHA GUPTA and SHWETA SARAN*
    Int. J. Dev. Biol. 62: 273-283 (2018) https://doi.org/10.1387/ijdb.170327ss www.intjdevbiol.com Deletion of etoposide-induced 2.4 kb transcript (ei24) reduced cell proliferation and aggregate-size in Dictyostelium discoideum NEHA GUPTA and SHWETA SARAN* School of Life Sciences, Jawaharlal Nehru University, New Delhi, India ABSTRACT The etoposide-induced 2.4 kb transcript (ei24) gene is induced both by p53 and etoposide, an anti-cancer tumour drug. There is no p53 gene present in Dictyostelium discoideum. Thus, the functions of ei24 in the absence of p53 were analysed. Both overexpressor (ei24OE) and knockout (ei24-) mutants were made to study its role during growth, development and differentiation. Addi- tionally, cell cycle and its response to DNA-damage were also analysed. We identified, characterized and elucidated the functions of the ei24 gene in Dictyostelium. In silico analyses demonstrated the conservation across eukaryotes and in situ hybridization showed it to be prestalk-specific.ei24 - cells showed reduced cell proliferation and cell-cohesive properties, ultimately forming small-sized ag- gregates that developed into miniature and stalky fruiting bodies. The ei24OE cells formed fruiting bodies with engorged or double-decker type sori with short stalks. The ei24- cells showed reduced cAMP signalling with lower intracellular cAMP levels resulting in diminished migration of cells along cAMP gradients. Deletion of ei24 resulted in mis-expression of prestalk-specific markers. Cell cycle analysis revealed an increased bias towards the stalk-pathway by ei24- cells and vice-versa for ei24OE cells. EI24 in Dictyostelium functions even in the absence of p53 and is induced in response to both UV-radiation and etoposide treatments.
    [Show full text]
  • Experimental Glaucoma and Optic Nerve Transection Induce Simultaneous Upregulation of Proapoptotic and Prosurvival Genes
    Experimental Glaucoma and Optic Nerve Transection Induce Simultaneous Upregulation of Proapoptotic and Prosurvival Genes Hani Levkovitch-Verbin, Rima Dardik, Shelly Vander, Yael Nisgav, Maya Kalev-Landoy, and Shlomo Melamed PURPOSE. To investigate changes in gene expression induced by imental glaucoma allow identification of genes and proteins elevated intraocular pressure (IOP) and complete optic nerve that are involved in different stages of the disease.3–7 Extensive transsection (ONT) over time. data have been collected to understand how RGCs degenerate METHODS. A gene array of 18 signal transduction pathways was in glaucoma. Gene array analysis recently revealed up- and downregulation of many genes in response to elevated intraoc- used to examine the changes in RNA profiles of retinas post- 8–10 10 ONT in rats. Among the seven genes that were determined to ular pressure (IOP). Ahmed et al. analyzed early (8 days) be upregulated, four were confirmed to have higher expres- and late (35 days) changes in gene expression of retinas from sion by semiquantitative RT-PCR analysis: Ei24 and Gadd45a glaucomatous eyes of rats, by using the episcleral vein injection (both associated with apoptosis induced via the p53 pathway), of hypertonic saline. They found altered expression of 81 genes, approximately half of which were associated with ei- IAP-1 (inhibitor of apoptosis protein 1), and Cdk2 (cell cycle 8 regulation and apoptosis). Their mRNA levels were then stud- ther apoptosis or neuroinflammatory responses. Farkas et al. ied by quantitative RT-PCR in experimental glaucoma and ONT found increased mRNA levels of iron-regulating proteins, sug- over time. Levels of the corresponding proteins were evaluated gesting the involvement of iron and copper metabolism and by Western blot analysis and immunohistochemistry.
    [Show full text]
  • Retinoic Acid Receptor-Independent Mechanism of Apoptosis of Melanoma Cells by the Retinoid CD437 (AHPN)
    Cell Death and Differentiation (2001) 8, 878 ± 886 ã 2001 Nature Publishing Group All rights reserved 1350-9047/01 $15.00 www.nature.com/cdd Retinoic acid receptor-independent mechanism of apoptosis of melanoma cells by the retinoid CD437 (AHPN) 1 1 1 2 3 X Zhao , K Demary , L Wong , C Vaziri , AB McKenzie , Introduction TJ Eberlein4 and RA Spanjaard*,1 Retinoic acid (RA)3 and other retinoids are small molecules 1 Department of Otolaryngology, Cancer Research Center, Boston University derived from retinol (Vitamin A) which guide proper School of Medicine, Boston, MA, USA mammalian embryonic development by activating RARs, a 2 Department of Medicine, Cancer Research Center, Boston University School of class of ligand-dependent transcription factors which regulate Medicine, Boston, MA, USA gene expression through binding to RA response elements 3 Department of Surgery, Brigham and Women's Hospital, Harvard Medical (RAREs).1,2 RA can also induce growth-arrest and differentia- School, Boston, MA, USA 3 4 Department of Surgery, Washington University School of Medicine, St. Louis, tion of a large variety of tumor cells in vitro and mediate 4 MO, USA similar effects in some neoplastic tissues, which is the * Corresponding author: Boston University School of Medicine, Cancer rationale behind the use of retinoids as pharmacological Research Center, 715 Albany Street R903, Boston, MA 02118. agents for differentiation and chemoprevention therapies in Tel: (617) 638-4811; Fax: (617) 638-5837; E-mail: [email protected] certain cancers.5,6 In order to understand the molecular basis of the effects Received 18.1.01; revised 20.3.01; accepted 9.4.01 of retinoids on the genetic program of tumor cells, we have Edited by D Green utilized the S91 murine melanoma cell line as a model system for the etiology of this disease.
    [Show full text]
  • MDGA2 Is a Novel Tumour Suppressor Cooperating with DMAP1 in Gastric
    Gut Online First, published on July 23, 2015 as 10.1136/gutjnl-2015-309276 GI cancer ORIGINAL ARTICLE MDGA2 is a novel tumour suppressor cooperating Gut: first published as 10.1136/gutjnl-2015-309276 on 23 July 2015. Downloaded from with DMAP1 in gastric cancer and is associated with disease outcome Kunning Wang,1 Qiaoyi Liang,1 Xiaoxing Li,1,2 Ho Tsoi,1 Jingwan Zhang,1 Hua Wang,3 Minnie Y Y Go,1 Philip W Y Chiu,4 Enders K W Ng,4 Joseph J Y Sung,1 Jun Yu1 ▸ Additional material is ABSTRACT published online only. To view Background Using the promoter methylation assay, Significance of this study please visit the journal online (http://dx.doi.org/10.1136/ we have shown that MDGA2 (MAM domain containing gutjnl-2015-309276). glycosylphosphatidylinositol anchor 2) is preferentially fi methylated in gastric cancer. We analysed its biological What is already known on this subject? For numbered af liations see fi ▸ end of article. effects and prognostic signi cance in gastric cancer. MDGA2 belongs to the brain-derived Methods MDGA2 methylation status was evaluated by immunoglobulin superfamily and has been Correspondence to combined bisulfite restriction analysis and bisulfite reported to regulate the growth of axons and Professor Jun Yu, Department genomic sequencing. The effects of MDGA2 the development of inhibitory synapse. of Medicine and Therapeutics, re-expression or knockdown on cell proliferation, ▸ State Key Laboratory of Expression of human MDGA2 is detected in Digestive Disease, Institute of apoptosis and the cell cycle were determined. MDGA2 normal human stomach. interacting protein was identified by mass spectrometry Digestive Disease, Prince of fi Wales Hospital, The Chinese and MDGA2-related cancer pathways by reporter activity What are the new ndings? ▸ MDGA2 University of Hong Kong, and PCR array analyses.
    [Show full text]
  • 42328 EI24 (D3F6Z) Rabbit Mab
    Revision 1 C 0 2 - t EI24 (D3F6Z) Rabbit mAb a e r o t S Orders: 877-616-CELL (2355) [email protected] 8 Support: 877-678-TECH (8324) 2 3 Web: [email protected] 2 www.cellsignal.com 4 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source/Isotype: UniProt ID: Entrez-Gene Id: WB, IP H M R Endogenous 30 Rabbit IgG O14681 9538 Product Usage Information 8. Zhao, Y.G. et al. (2012) J Biol Chem 287, 42053-63. 9. Devkota, S. et al. (2016) Autophagy 12, 2038-2053. Application Dilution 10. Choi, J.M. et al. (2013) Oncotarget 4, 2383-96. Western Blotting 1:1000 Immunoprecipitation 1:200 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA, 50% glycerol and less than 0.02% sodium azide. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity EI24 (D3F6Z) Rabbit mAb recognizes endogenous levels of total EI24 protein. Species Reactivity: Human, Mouse, Rat Source / Purification Monoclonal antibody is produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Ala31 of human EI24 protein. Background Etoposide-induced 2.4 mRNA (EI24)/p53-induced gene 8 (PIG8) was identified as a DNA damage response gene induced by etoposide in a p53 dependent manner with roles in growth suppression and apoptosis (1-3). As a pro-apoptotic gene, some evidence suggests that EI24 functions as a tumor suppressor gene in cases such as breast and cervical cancer (4-6).
    [Show full text]
  • Potential Whole-Cell Biosensors for Detection of Metal Using Merr Family Proteins from Enterobacter Sp
    micromachines Article Potential Whole-Cell Biosensors for Detection of Metal Using MerR Family Proteins from Enterobacter sp. YSU and Stenotrophomonas maltophilia OR02 Georgina Baya 1, Stephen Muhindi 2, Valentine Ngendahimana 3 and Jonathan Caguiat 1,* 1 Department of Biological and Chemical Sciences, Youngstown State University, Youngstown, OH 44555, USA; [email protected] 2 Department of Biological Sciences, University of Toledo, Toledo, OH 43606, USA; [email protected] 3 Biology Department, Lone Star College-CyFair, 9191 Barker Cypress Rd, Cypress, TX 77433, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-330-941-2063 Abstract: Cell-based biosensors harness a cell’s ability to respond to the environment by repurposing its sensing mechanisms. MerR family proteins are activator/repressor switches that regulate the expression of bacterial metal resistance genes and have been used in metal biosensors. Upon metal binding, a conformational change switches gene expression from off to on. The genomes of the multi- metal resistant bacterial strains, Stenotrophomonas maltophilia Oak Ridge strain 02 (S. maltophilia 02) and Enterobacter sp. YSU, were recently sequenced. Sequence analysis and gene cloning identified three mercury resistance operons and three MerR switches in these strains. Transposon mutagenesis and sequence analysis identified Enterobacter sp. YSU zinc and copper resistance operons, which ap- pear to be regulated by the protein switches, ZntR and CueR, respectively. Sequence analysis and Citation: Baya, G.; Muhindi, S.; reverse transcriptase polymerase chain reaction (RT-PCR) showed that a CueR switch appears to Ngendahimana, V.; Caguiat, J. activate a S. maltophilia 02 copper transport gene in the presence of CuSO4 and HAuCl4·3H2O.
    [Show full text]
  • Mdr1b Facilitates P53-Mediated Cell Death and P53 Is Required for Mdr1b Upregulation in Vivo
    Oncogene (2001) 20, 303 ± 313 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Mdr1b facilitates p53-mediated cell death and p53 is required for Mdr1b upregulation in vivo Valerie Lecureur1, Jaideep V Thottassery1, Daxi Sun1, Erin G Schuetz1, Jill Lahti2, Gerard P Zambetti3 and John D Schuetz*,1 1Department of Pharmaceutical Sciences, St Jude Children's Research Hospital, 332 North Lauderdale Avenue, Memphis, Tennessee, TN 38105, USA; 2Department of Tumor Cell Biology, St Jude Children's Research Hospital, 332 North Lauderdale Avenue, Memphis, Tennessee, TN 38105, USA; 3Department of Biochemistry, St Jude Children's Research Hospital, 332 North Lauderdale Avenue, Memphis, Tennessee, TN 38105, USA The mdr1b gene is thought to be a ``stress-responsive'' share greater than 88% identity, are often expressed in gene, however it is unknown if this gene is regulated by the same tissues and can be selectively overproduced p53 in the whole animal. Moreover, it is unknown if during selection for resistance to cytotoxic agents (e.g., overexpression of mdr1b aects cell survival. The taxol, vinblastine, adriamycin (Lothstein et al., 1989)). dependence of mdr1b upon p53 for upregulation was Further, selection for drug resistance with ectopically evaluated in p53 knockout mice. Wild-type (wt) or introduced mdr1a or mdr1b expression vectors yields p537/7 mice were treated singly or in combination similar drug resistance pro®les for many drugs with gamma irradiation (IR) and/or the potent DNA (Devault and Gros, 1990). In contrast, the application damaging agent, diethylnitrosoamine (DEN). Both IR of cytotoxic drug selective pressure to murine macro- and DEN induced mdr1b in wild-type animals, but not in phage cells caused a switch in endogenous mdr the p537/7 mice.
    [Show full text]
  • Genenames.Org: the HGNC Resources in 2011 Ruth L
    Nucleic Acids Research Advance Access published October 6, 2010 Nucleic Acids Research, 2010, 1–6 doi:10.1093/nar/gkq892 genenames.org: the HGNC resources in 2011 Ruth L. Seal*, Susan M. Gordon, Michael J. Lush, Mathew W. Wright and Elspeth A. Bruford European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Received September 15, 2010; Accepted September 21, 2010 ABSTRACT In order to achieve this, we endeavour to contact the The HUGO Gene Nomenclature Committee (HGNC) researchers that work on particular genes for their Downloaded from aims to assign a unique gene symbol and name to advice and input before approving symbols, and encour- every human gene. The HGNC database currently age researchers to submit proposed gene symbols directly contains almost 30 000 approved gene symbols, to us to determine their suitability prior to publication. over 19 000 of which represent protein-coding The HGNC team attends conferences regularly to ensure that we are meeting the requirements of the community genes. The public website, www.genenames.org, and to discuss the nomenclature of specific gene families nar.oxfordjournals.org displays all approved nomenclature within Symbol and locus types. We work closely with the nomenclature Reports that contain data curated by HGNC editors committees for several other species, especially the mouse and links to related genomic, phenotypic and prote- (2), rat (3), zebrafish (4) and Xenopus (5) to ensure that omic information. Here we describe improvements orthologous vertebrate genes are assigned equivalent to our resources, including a new Quick Gene symbols wherever possible. HGNC symbols are used by Search, a new List Search, an integrated HGNC most biomedical databases, including Ensembl (6), Vega BioMart and a new Statistics and Downloads facility.
    [Show full text]
  • EI24 (NM 004879) Human Untagged Clone – SC117074 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC117074 EI24 (NM_004879) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: EI24 (NM_004879) Human Untagged Clone Tag: Tag Free Symbol: EI24 Synonyms: EPG4; PIG8; TP53I8 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC117074 sequence for NM_004879 edited (data generated by NextGen Sequencing) ATGGCTGACAGTGTCAAAACCTTTCTCCAGGACCTTGCCAGAGGAATCAAAGACTCCATC TGGGGTATTTGTACCATCTCAAAGCTAGATGCTCGAATCCAGCAAAAGAGAGAGGAGCAG CGTCGAAGAAGGGCAAGTAGTGTCTTGGCACAGAGAAGAGCCCAGAGTATAGAGCGGAAG CAAGAGAGTGAGCCACGTATTGTTAGTAGAATTTTCCAGTGTTGTGCTTGGAATGGTGGA GTGTTCTGGTTCAGTCTCCTCTTGTTTTATCGAGTATTTATTCCTGTGCTTCAGTCGGTA ACAGCCCGAATTATCGGTGACCCATCACTACATGGAGATGTTTGGTCGTGGCTGGAATTC TTCCTCACGTCAATTTTCAGTGCTCTTTGGGTGCTCCCCTTGTTTGTGCTTAGCAAAGTG GTGAATGCCATTTGGTTTCAGGATATAGCTGACCTGGCATTTGAGGTATCAGGGAGGAAG CCTCACCCATTCCCTAGTGTCAGCAAAATAATTGCTGACATGCTCTTCAACCTTTTGCTG CAGGCTCTTTTCCTCATTCAGGGAATGTTTGTGAGTCTCTTTCCCATCCATCTTGTCGGT CAGCTGGTTAGTCTCCTGCATATGTCCCTTCTCTACTCACTGTACTGCTTTGAATATCGT TGGTTCAATAAAGGAATTGAAATGCACCAGCGGTTGTCTAACATAGAAAGGAATTGGCCT TACTACTTTGGGTTTGGTTTGCCCTTGGCTTTTCTCACAGCAATGCAGTCCTCATATATT ATCAGTGGCTGCCTTTTCTCTATCCTCTTTCCTTTATTCATTATCAGCGCCAATGAAGCA AAGACCCCTGGCAAAGCGTATCTCTTCCAGTTGCGCCTCTTCTCCTTGGTGGTCTTCTTA AGCAACAGACTCTTCCACAAGACAGTCTACCTGCAGTCGGCCCTGAGCAGCTCTACTTCT
    [Show full text]
  • New Approaches for Quantitative Reconstruction of Radiation Dose in Human Blood Cells Shanaz A
    www.nature.com/scientificreports OPEN New Approaches for Quantitative Reconstruction of Radiation Dose in Human Blood Cells Shanaz A. Ghandhi 1,2*, Igor Shuryak1,2, Shad R. Morton1, Sally A. Amundson 1 & David J. Brenner1 In the event of a nuclear attack or large-scale radiation event, there would be an urgent need for assessing the dose to which hundreds or thousands of individuals were exposed. Biodosimetry approaches are being developed to address this need, including transcriptomics. Studies have identifed many genes with potential for biodosimetry, but, to date most have focused on classifcation of samples by exposure levels, rather than dose reconstruction. We report here a proof-of-principle study applying new methods to select radiation-responsive genes to generate quantitative, rather than categorical, radiation dose reconstructions based on a blood sample. We used a new normalization method to reduce efects of variability of signal intensity in unirradiated samples across studies; developed a quantitative dose-reconstruction method that is generally under-utilized compared to categorical methods; and combined these to determine a gene set as a reconstructor. Our dose-reconstruction biomarker was trained using two data sets and tested on two independent ones. It was able to reconstruct dose up to 4.5 Gy with root mean squared error (RMSE) of ± 0.35 Gy on a test dataset using the same platform, and up to 6.0 Gy with RMSE of ± 1.74 Gy on a test set using a diferent platform. In the event of a nuclear attack or large-scale radiation event, there would be an urgent need for assessing the dose to which hundreds or thousands of individuals were exposed1–4.
    [Show full text]
  • Gene-Expression and in Vitro Function of Mesenchymal Stromal Cells Are Affected in Juvenile Myelomonocytic Leukemia
    Myeloproliferative Disorders SUPPLEMENTARY APPENDIX Gene-expression and in vitro function of mesenchymal stromal cells are affected in juvenile myelomonocytic leukemia Friso G.J. Calkoen, 1 Carly Vervat, 1 Else Eising, 2 Lisanne S. Vijfhuizen, 2 Peter-Bram A.C. ‘t Hoen, 2 Marry M. van den Heuvel-Eibrink, 3,4 R. Maarten Egeler, 1,5 Maarten J.D. van Tol, 1 and Lynne M. Ball 1 1Department of Pediatrics, Immunology, Hematology/Oncology and Hematopoietic Stem Cell Transplantation, Leiden University Med - ical Center, the Netherlands; 2Department of Human Genetics, Leiden University Medical Center, Leiden, the Netherlands; 3Dutch Childhood Oncology Group (DCOG), The Hague, the Netherlands; 4Princess Maxima Center for Pediatric Oncology, Utrecht, the Nether - lands; and 5Department of Hematology/Oncology and Hematopoietic Stem Cell Transplantation, Hospital for Sick Children, University of Toronto, ON, Canada ©2015 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.126938 Manuscript received on March 5, 2015. Manuscript accepted on August 17, 2015. Correspondence: [email protected] Supplementary data: Methods for online publication Patients Children referred to our center for HSCT were included in this study according to a protocol approved by the institutional review board (P08.001). Bone-marrow of 9 children with JMML was collected prior to treatment initiation. In addition, bone-marrow after HSCT was collected from 5 of these 9 children. The patients were classified following the criteria described by Loh et al.(1) Bone-marrow samples were sent to the JMML-reference center in Freiburg, Germany for genetic analysis. Bone-marrow samples of healthy pediatric hematopoietic stem cell donors (n=10) were used as control group (HC).
    [Show full text]