DOCSLIB.ORG

Genome-Wide Analysis of DNA Methylation in Tongue Squamous Cell Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Analysis of DNA Methylation in Tongue Squamous Cell Carcinoma ONCOLOGY REPORTS 29: 1819-1826, 2013 Genome-wide analysis of DNA methylation in tongue squamous cell carcinoma SHENG ZHANG1, XIANG-LING FENG2, LEI SHI3, CHAO-JIAN GONG1, ZHI-JING HE1, HAN-JIANG WU1 and TIAN-YOU LING1 1Department of Oral and Maxillofacial Surgery, the Second Xiangya Hospital, Central South University, Changsha, Hunan 410011; 2Cancer Research Institute, Xiangya School of Medicine, Central South University, Changsha, Hunan 410008; 3Department of Pathology, the Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, P.R. China Received December 29, 2012; Accepted January 23, 2013 DOI: 10.3892/or.2013.2309 Abstract. Tongue squamous cell carcinoma (TSCC) is one of Introduction the most common types of oral cancer; however, its molecular mechanisms remain unclear. In this study, methylated DNA Oral cancer accounts for 2-4% of all cancer cases world- immunoprecipitation (MeDIP) coupled with methylation wide (1). An estimated 263,900 new cases and 128,000 deaths microarray analysis was performed to screen for aberrantly from oral cancer occurred globally in 2008 (2). More than methylated genes in adjacent normal control and TSCC tissues 90% of all oral cancer cases are oral squamous cell carci- from 9 patients. Roche NimbleGen Human DNA Methylation nomas (OSCCs), which are a result of multistep processes that 385K Promoter Plus CpG Island Arrays were used to detect develop from the combined effects of a patient's genetic predis- 28,226 CpG sites. A total of 1,269 hypermethylated CpG position and exposure to environmental influences, including sites covering 330 genes and 1,385 hypomethylated CpG sites tobacco, alcohol, betel quid, chronic inflammation and viral covering 321 genes were found in TSCC tissue, compared to the infection (3). Tongue squamous cell carcinoma (TSCC) is a adjacent normal tissue. Furthermore, we chose three candidate common OSCC. Imaging systems and treatment strategies in genes (FBLN1, ITIH5 and RUNX3) and validated the DNA TSCC are improving substantially, however, 5-year survival methylation status by methylation-specific PCR (MS-PCR) statistics remain low. The molecular mechanisms underlying and the mRNA expression levels by reverse transcription PCR its clinical characteristics including carcinogenesis, develop- (RT-PCR). In TSCC tissue, FBLN1 and ITIH5 were shown ment, progression, invasion, and metastasis have yet to be fully to be hypermethylated and their expression was found to be elucidated. Epigenetics studies recently showed that aberrant decreased, and RUNX3 was shown to be hypomethylated, DNA methylation is involved in the progress of TSCC (4). however, its mRNA expression was found to be increased. DNA methylation is an important regulator of gene transcrip- In addition, another three genes (BCL2L14, CDCP1 and tion and its role in carcinogenesis and development has been DIRAS3) were tested by RT-PCR. In TSCC tissue, BCL2L14 a topic of considerable interest in recent years. DNA methyla- and CDCP1 expressions were markedly upregulated, and tion, which represses transcription of the promoter region of DIRAS3 expression was significantly downregulated. Our data tumor suppressor genes leading to gene silencing, has been demonstrated that aberrant DNA methylation is observed in studied extensively (5). TSCC tissue and plays an important role in the tumorigenesis, DNA methylation is a very stable epigenetic mark and next development and progression of TSCC. generation sequencing studies have shown that several genes are aberrantly methylated in various types of cancer (6,7). Tissue specific DNA methylation patterns are stabilized during embryonic development, and are maintained through cell divisions. Aberrant DNA methylation patterns have been associated with a large number of human malignancies and are Correspondence to: Dr Sheng Zhang, Department of Oral and found in two distinct forms: hypermethylation and hypometh- Maxillofacial Surgery, the Second Xiangya Hospital, Central South ylation (8). The majority of DNA methylation studies focus University, 139 Middle Renmin Road, Changsha, Hunan 410011, on the analysis of CpG islands located in the promoter areas P. R. Ch i na E-mail: [email protected] of candidate genes. However, differentially methylated areas may be located within genes and at large distances from the Key words: tongue squamous cell carcinoma, DNA methylation, nearest neighboring genes (9). In the past decade, researchers CpG island, microarray, biomarker focused only on a few candidate genes of DNA methylation in TSCC-related genes (4,5,10). Nevertheless, systematic studies on the genome-wide distribution of methylated loci in TSCC 1820 ZHANG et al: GENOME-WIDE METHYLATION ANALYSIS IN TSCC Table I. List of primers of methylated (M) and unmethylated (U) sequences for MS-PCR analysis. Gene Primer Sequence FBLN1 M primer F: 5'-ATTAGGAGATTCGCGGTTTC-3' R: 5'-GCTCCATAAACGACGAACG-3' U primer F: 5'-GATTAGGAGATTTGTGGTTTTG-3' R: 5'-CACACTCCATAAACAACAAACA-3' ITIH5 M primer F: 5'-TTGGCGATAGAAATTAAGTAAGTTC-3' R: 5'-AACCACCTATATTAACCCACG-3' U primer F: 5'-TTGGTGATAGAAATTAAGTAAGTTTGT-3' R: 5'-AAAACCACCTATATTAACCCCACA-3' RUNX3 M primer F: 5'-TTACGAGGGGCGGTCGTACGCGGG-3' R: 5'-AAAACGACCGACGCGAACGCCTCC-3' U primer F: 5'-TTATGAGGGGTGGTTGTATGTGGG-3' R: 5'-AAAACAACCAACACAAACACCTCC-3' remain scarce. With the advent of next generation sequencing, methylated DNA was obtained by whole-genome amplifica- genome-wide screening has become an attractive and useful tion using the GenomePlex® Whole Genome Amplification kit tool for profiling TSCC. (Sigma-Aldrich, St. Louis, MO, USA). MeDIP DNA and input In this study, methylated DNA immunoprecipitation DNA were labeled with Cy5 and Cy3, respectively, and then (MeDIP) in combination with microarray-based hybridization analyzed using Human DNA Methylation 385K Promoter was performed in adjacent normal control and tumor tissues Plus CpG Island Arrays (Roche NimbleGen, Madison, WI, from 9 patients with TSCC (11). Extensive DNA methylation USA), which were used to detect 28,226 CpG sites. Gene distribution information from human TSCC and its adjacent chips were scanned by GenePix 4000B microarray scanner normal tissues provided a preliminary genomic DNA meth- and hybridization signals were analyzed using GenePix Pro ylation profile. Selected differentially expressed genes were 6.0 hybridization analysis software. Probe-rich value setting further validated using methylation-specific PCR (MS-PCR) was ≥2.0. and reverse transcription PCR (RT-PCR). MS-PCR analysis. To determine the methylation status of the Materials and methods three selected genes (FBLN1, ITIH5 and RUNX3), we used MS-PCR in 20 pairs of samples from adjacent normal control Patients and samples. Samples were obtained from 20 patients and TSCC tissues. Genomic DNA was isolated by using diagnosed with TSCC who underwent surgery at the Second Wizard® Genomic DNA Purification kit (Promega, Madison, Xiangya Hospital of Central South University and the Hunan WI, USA). Complete bisulfite conversion and purification of Provincial Tumor Hospital. The study protocol was approved DNA were performed according to the EpiTect® Bisulfite kit by the Ethics Committees of Central South University and (Qiagen). The fully methylated and fully unmethylated DNA written informed consent was obtained from all patients. None samples were used as controls, and a water blank reaction of the patients were given adjuvant chemotherapy or radiation was used as control for contamination. Following amplifi- prior to the operation. For each TSCC case, fresh samples cation by PCR, products were resolved on 1% agarose gels were obtained from the primary tumor tissue and the adjacent containing 0.5 µg/ml ethidium bromide and visualized under normal tongue mucosa with a clear surgical margin to tumor. UV transillumination. Primers for MS-PCR analysis are Surgical margins were considered as tumor-free or negative shown in Table I. at least 5 mm of histologically normal tissue according to the pathological examination. The samples were snap frozen in RT-PCR analysis. To determine the mRNA expression level liquid nitrogen and stored at -80˚C until subsequent analyses. of the six selected genes (FBLN1, ITIH5, RUNX3, BCL2L14, CDCP1 and DIRAS3), we used RT-PCR in 20 pairs of samples MeDIP and methylation microarray hybridization. Genomic from adjacent normal control and TSCC tissues. Total RNA DNA from TSCC and adjacent normal control tissue (n=9) was isolated from the sample tissues using TRIzol® reagent were extracted and purified according to the DNeasy Blood (Invitrogen, Grand Island, NY, USA) according to the manu- and Tissue kit (Qiagen, Germantown, MD, USA). Then, DNA facturer's protocol. RNA was efficiently reverse transcribed samples were pooled to one pair and sheared by sonication to into cDNA using the Reverse Transcription System (Promega). obtain fragments between 400 and 500 bp and were immuno- Primers for RT-PCR analysis and the PCR conditions of the precipitated by anti-5-methylcytidine antibody according six selected genes are shown in Table II. The expression level to the MagMeDIP kit (Diagenode, Liège, Belgium). Fully of each gene was confirmed by comparison to the expres- ONCOLOGY REPORTS 29: 1819-1826, 2013 1821 Table II. List of primers for RT-PCR analysis and the condition of PCR. Gene Primer Size of Annealing Cycles product (bp) temperature (˚C) FBLN1 F: 5'-TCAATACAGTTGCCTAGAGCA-3' 409 60 28 R: 5'-GAGGAACAAGAGGACCCAT-3' ITIH5 F: 5'-CACAGTTCTCCAGCGACA-3' 386 60 32 R: 5'-CAGGACCGTTTCAGTATCAT-3'
Load more

Recommended publications
  • Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers
    Published OnlineFirst May 9, 2012; DOI: 10.1158/1055-9965.EPI-12-0352-T Cancer Epidemiology, Research Article Biomarkers & Prevention Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers Margaret R. Spitz1, Ivan P. Gorlov2, Qiong Dong3, Xifeng Wu3, Wei Chen4, David W. Chang3, Carol J. Etzel3, Neil E. Caporaso5, Yang Zhao8, David C. Christiani8, Paul Brennan9, Demetrius Albanes7, Jianxin Shi6, Michael Thun10, Maria Teresa Landi5, and Christopher I. Amos4 Abstract Background: Tobacco-induced lung cancer is characterized by a deregulated inflammatory microenviron- ment. Variants in multiple genes in inflammation pathways may contribute to risk of lung cancer. Methods: We therefore conducted a three-stage comprehensive pathway analysis (discovery, replication, and meta-analysis) of inflammation gene variants in ever-smoking lung cancer cases and controls. A discovery set (1,096 cases and 727 controls) and an independent and nonoverlapping internal replication set (1,154 cases and 1,137 controls) were derived from an ongoing case–control study. For discovery, we used an iSelect BeadChip to interrogate a comprehensive panel of 11,737 inflammation pathway single-nucleotide poly- morphisms (SNP) and selected nominally significant (P < 0.05) SNPs for internal replication. Results: There were six SNPs that achieved statistical significance (P < 0.05) in the internal replication data set with concordant risk estimates for former smokers and five concordant and replicated SNPs in current smokers. Replicated hits were further tested in a subsequent meta-analysis using external data derived from two published genome-wide association studies (GWAS) and a case–control study. Two of these variants (a BCL2L14 SNP in former smokers and an SNP in IL2RB in current smokers) were further validated.
    [Show full text]
  • DIRAS3 Antibody Catalog # ASC11908
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 DIRAS3 Antibody Catalog # ASC11908 Specification DIRAS3 Antibody - Product Information Application WB Primary Accession O95661 Other Accession NP_004666, 4757772 Reactivity Human Host Rabbit Clonality Polyclonal Isotype IgG Calculated MW Predicted: 25 kDa Observed: 24 kDa KDa Application Notes DIRAS3 antibody can be used for detection of DIRAS3 by Western blot at 1 Western blot analysis of DIRAS3 in human - 2 µg/ml. testis tissue lysate with DIRAS3 antibody at 1 µg/ml. DIRAS3 Antibody - Additional Information DIRAS3 Antibody - Background Gene ID 9077 Target/Specificity DIRAS3 is a member of the ras superfamily, DIRAS3; DIRAS3 antibody is human specific. and is expressed in normal ovarian and breast epithelial cells, but not in ovarian and breast Reconstitution & Storage cancers. It is an imprinted gene, with DIRAS3 antibody can be stored at 4℃ for mono-allelic expression of the paternal allele, three months and -20℃, stable for up to which is associated with growth suppression one year. and down-regulation of cyclin D1 promoter Precautions activity and induction of p21 (WAF/CIP1). Thus, DIRAS3 Antibody is for research use only this gene appears to be a putative tumor and not for use in diagnostic or therapeutic suppressor gene whose function is abrogated procedures. in ovarian and breast cancers (1). DIRAS3 has been shown to induce autophagy in human ovarian cancer cells by blocking PI3K signaling, inhibiting the mammalian target of rapamycin DIRAS3 Antibody - Protein Information (TOR), upregulating ATG4, and colocalizing with LC3 in autophagosomes (2). DIRAS also Name DIRAS3 interacts with C-RAF and downregulates mitogen-activated protein kinase kinases Synonyms ARHI, NOEY2, RHOI (MEK) to restrict cell migration (3).
    [Show full text]
  • DIRAS3 Antibody Cat
    DIRAS3 Antibody Cat. No.: 8139 DIRAS3 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human DIRAS3 antibody was raised against an 18 amino acid peptide near the carboxy terminus of human DIRAS3. IMMUNOGEN: The immunogen is located within the last 50 amino acids of DIRAS3. TESTED APPLICATIONS: ELISA, WB DIRAS3 antibody can be used for detection of DIRAS3 by Western blot at 1 - 2 μg/ml. APPLICATIONS: Antibody validated: Western Blot in human samples. All other applications and species not yet tested. SPECIFICITY: DIRAS3 antibody is human specific. POSITIVE CONTROL: 1) Cat. No. 1313 - Human Testis Tissue Lysate Predicted: 25 kDa PREDICTED MOLECULAR WEIGHT: Observed: 24 kDa Properties September 26, 2021 1 https://www.prosci-inc.com/diras3-antibody-8139.html PURIFICATION: DIRAS3 antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: DIRAS3 antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL DIRAS3 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. Additional Info OFFICIAL SYMBOL: DIRAS3 ALTERNATE NAMES: DIRAS family GTP-binding RAS-like 3, ARHI, NOEY2 ACCESSION NO.: NP_004666 PROTEIN GI NO.: 4757772 GENE ID: 9077 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References DIRAS3 is a member of the ras superfamily, and is expressed in normal ovarian and breast epithelial cells, but not in ovarian and breast cancers. It is an imprinted gene, with mono-allelic expression of the paternal allele, which is associated with growth suppression and down-regulation of cyclin D1 promoter activity and induction of p21 (WAF/CIP1).
    [Show full text]
  • Accepted Version
    Article A catalog of genetic loci associated with kidney function from analyses of a million individuals WUTTKE, Matthias, et al. Abstract Chronic kidney disease (CKD) is responsible for a public health burden with multi-systemic complications. Through trans-ancestry meta-analysis of genome-wide association studies of estimated glomerular filtration rate (eGFR) and independent replication (n?=?1,046,070), we identified 264 associated loci (166 new). Of these, 147 were likely to be relevant for kidney function on the basis of associations with the alternative kidney function marker blood urea nitrogen (n?=?416,178). Pathway and enrichment analyses, including mouse models with renal phenotypes, support the kidney as the main target organ. A genetic risk score for lower eGFR was associated with clinically diagnosed CKD in 452,264 independent individuals. Colocalization analyses of associations with eGFR among 783,978 European-ancestry individuals and gene expression across 46 human tissues, including tubulo-interstitial and glomerular kidney compartments, identified 17 genes differentially expressed in kidney. Fine-mapping highlighted missense driver variants in 11 genes and kidney-specific regulatory variants. These results provide a comprehensive priority [...] Reference WUTTKE, Matthias, et al. A catalog of genetic loci associated with kidney function from analyses of a million individuals. Nature Genetics, 2019, vol. 51, no. 6, p. 957-972 DOI : 10.1038/s41588-019-0407-x PMID : 31152163 Available at: http://archive-ouverte.unige.ch/unige:147447 Disclaimer: layout of this document may differ from the published version. 1 / 1 HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Genet Manuscript Author . Author manuscript; Manuscript Author available in PMC 2019 August 19.
    [Show full text]
  • A 14.8 Mb 12P Deletion Disrupting ETV6 in a Patient with Myelodysplastic Syndrome
    tics: Cu ne rr e en G t y R r e a t s i e d a e r r c e h Valetto et al., Hereditary Genet 2017, 6:1 H Hereditary Genetics DOI: 10.4172/2161-1041.1000174 ISSN: 2161-1041 Research Article Open Access A 14.8 Mb 12p Deletion Disrupting ETV6 in a Patient with Myelodysplastic Syndrome Angelo Valetto 1*, Veronica Bertini1, Elena Ciabatti2,3, Maria Immacolata Ferreri1, Alice Guazzelli1, Antonio Azzarà2, Susanna Grassi2, Alessia Azzarà1, Francesca Guerrini2, Iacopo Petrini2,4 and Sara Galimberti2 1Laboratory of Medical Genetics, A.O.U.P., S. Chiara Hospital, Pisa, Italy 2Department of Clinical and Experimental Medicine, Section of Hematology, University of Pisa, Pisa, Italy 3GenOMeC, University of Siena 4Department of translational Research and New Technologies in Medicine, University of Pisa, Pisa, Italy *Corresponding author: Valetto A, Laboratory of Medical Genetics, A.O.U.P., S. Chiara Hospital, Pisa, Italy, Tel: +39050992777; E-mail: [email protected] Received Date: Oct 27, 2016; Accepted Date: Mar 16, 2017; Published Date: Mar 21, 2017 Copyright: © 2017 Valetto A, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract We present on a new case of myelodysplastic syndrome characterized by array Comparative Genomic Hybridization. This technique confirmed the monosomy 7, detected by conventional cytogenetics, and revealed also a deletion on the short arm of chromosome 12. This deletion extends for about 14.8 Mb and breaks ETV6 gene.
    [Show full text]
  • GNG12-AS1 Uncouples Its Transcriptional and Product-Related Functions
    ARTICLE Received 4 Sep 2015 | Accepted 8 Dec 2015 | Published 2 Feb 2016 DOI: 10.1038/ncomms10406 OPEN Transcriptional silencing of long noncoding RNA GNG12-AS1 uncouples its transcriptional and product-related functions Lovorka Stojic1, Malwina Niemczyk1, Arturo Orjalo2,w, Yoko Ito1, Anna Elisabeth Maria Ruijter1, Santiago Uribe-Lewis1, Nimesh Joseph1, Stephen Weston3, Suraj Menon1, Duncan T. Odom1, John Rinn4, Fanni Gergely1 & Adele Murrell1,3 Long noncoding RNAs (lncRNAs) regulate gene expression via their RNA product or through transcriptional interference, yet a strategy to differentiate these two processes is lacking. To address this, we used multiple small interfering RNAs (siRNAs) to silence GNG12-AS1,a nuclear lncRNA transcribed in an antisense orientation to the tumour-suppressor DIRAS3. Here we show that while most siRNAs silence GNG12-AS1 post-transcriptionally, siRNA complementary to exon 1 of GNG12-AS1 suppresses its transcription by recruiting Argonaute 2 and inhibiting RNA polymerase II binding. Transcriptional, but not post-transcriptional, silencing of GNG12-AS1 causes concomitant upregulation of DIRAS3, indicating a function in transcriptional interference. This change in DIRAS3 expression is sufficient to impair cell cycle progression. In addition, the reduction in GNG12-AS1 transcripts alters MET signalling and cell migration, but these are independent of DIRAS3. Thus, differential siRNA targeting of a lncRNA allows dissection of the functions related to the process and products of its transcription. 1 Cancer Research UK Cambridge Institute, University of Cambridge, Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE, UK. 2 Biosearch Technologies Inc., 2199S. McDowell Boulevard, Petaluma, California 94954, USA. 3 Centre for Regenerative Medicine, Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY, UK.
    [Show full text]
  • ARHI (DIRAS3), an Imprinted Tumour Suppressor Gene, Binds to Importins and Blocks Nuclear Import of Cargo Proteins
    Biosci. Rep. (2010) / 30 / 159–168 (Printed in Great Britain) / doi 10.1042/BSR20090008 ARHI (DIRAS3), an imprinted tumour suppressor gene, binds to importins and blocks nuclear import of cargo proteins Shaoyi HUANG*, In Soon CHANG†, Wenbo LIN§, Wenduo YE§, Robert Z. LUO*, Zhen LU*, Yiling LU‡, Ke ZHANG†, Warren S.-L. LIAO*, Tao TAO§, Robert C. BAST, Jr*, Xiaomin CHEN† and Yinhua YU*1 *Department of Experimental Therapeutics, The University of Texas, M.D. Anderson Cancer Center, Houston, TX 77030, U.S.A., †Department of Biochemistry and Molecular Biology, The University of Texas, M.D. Anderson Cancer Center, Houston, TX 77030, U.S.A., ‡Department of Systems Biology, The University of Texas, M.D. Anderson Cancer Center, Houston, Texas 77030, U.S.A., §School of Life Sciences, Xiamen University, Xiamen, Fujian 361005, People’s Republic of China, and Obstetrics and Gynecology Hospital of Fudan University, Shanghai 200011, People’s Republic of China ' $ Synopsis ARHI (aplasia Ras homologue member I; also known as DIRAS3) is an imprinted tumour suppressor gene, the expression of which is lost in the majority of breast and ovarian cancers. Unlike its homologues Ras and Rap, ARHI functions as a tumour suppressor. Our previous study showed that ARHI can interact with the transcriptional activator STAT3 (signal transducer and activator of transcription 3) and inhibit its nuclear translocation in human breast- and ovarian-cancer cells. To identify proteins that interact with ARHI in nuclear translocation, in the present study, we performed proteomic analysis and identified several importins that can associate with ARHI. To further explore this novel finding, we purified 10 GST (glutathione transferase)–importin fusion proteins (importins 7, 8, 13, β1, α1, α3, α5, α6, α7 and mutant α1).
    [Show full text]
  • (BCL2L14) (NM 138722) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC206404 Bcl G (BCL2L14) (NM_138722) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Bcl G (BCL2L14) (NM_138722) Human Tagged ORF Clone Tag: Myc-DDK Symbol: BCL2L14 Synonyms: BCLG Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC206404 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGTAGCACCAGTGGGTGTGACCTGGAAGAAATCCCCCTAGATGATGATGACCTAAACACCATAGAAT TCAAAATCCTCGCCTACTACACCAGACATCATGTCTTCAAGAGCACCCCTGCTCTCTTCTCACCAAAGCT GCTGAGAACAAGAAGTTTGTCCCAGAGGGGCCTGGGGAATTGTTCAGCAAATGAGTCATGGACAGAGGTG TCATGGCCTTGCAGAAATTCCCAATCCAGTGAGAAGGCCATAAACCTTGGCAAGAAAAAGTCTTCTTGGA AAGCATTCTTTGGAGTAGTGGAGAAGGAAGATTCGCAGAGCACGCCTGCCAAGGTCTCTGCTCAGGGTCA AAGGACGTTGGAATACCAAGATTCGCACAGCCAGCAGTGGTCCAGGTGTCTTTCTAACGTGGAGCAGTGC TTGGAGCATGAAGCTGTGGACCCCAAAGTCATTTCCATTGCCAACCGAGTAGCTGAAATTGTTTACTCCT GGCCACCACCACAAGCGACCCAGGCAGGAGGCTTCAAGTCCAAAGAGATTTTTGTAACTGAGGGTCTCTC CTTCCAGCTCCAAGGCCACGTGCCTGTAGCTTCAAGTTCTAAGAAAGATGAAGAAGAACAAATACTAGCC AAAATTGTTGAGCTGCTGAAATATTCAGGAGATCAGTTGGAAAGAAAGCTGAAGAAAGATAAGGCTTTGA TGGGCCACTTCCAGGATGGGCTGTCCTACTCTGTTTTCAAGACCATCACAGACCAGGTCCTAATGGGTGT GGACCCCAGGGGAGAATCAGAGGTCAAAGCTCAGGGCTTTAAGGCTGCCCTTGTAATAGACGTCACGGCC AAGCTCACAGCTATTGACAACCACCCGATGAACAGGGTCCTGGGCTTTGGCACCAAGTACCTGAAAGAGA
    [Show full text]
  • Human ARHI / DIRAS3 Protein (Fc Tag)
    Human ARHI / DIRAS3 Protein (Fc Tag) Catalog Number: 14239-H04H General Information SDS-PAGE: Gene Name Synonym: ARHI; DIRAS3; NOEY2; RHOI Protein Construction: A DNA sequence encoding the human DIRAS3 (O95661) (Met1-Lys225) was expressed with the Fc region of mouse IgG1 at the N-terminus. Source: Human Expression Host: HEK293 Cells QC Testing Purity: > 85 % as determined by SDS-PAGE Endotoxin: Protein Description < 1.0 EU per μg of the protein as determined by the LAL method ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Stability: Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected Samples are stable for up to twelve months from date of receipt at -70 ℃ in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, Predicted N terminal: Asp ARHI is not only an important factor in the pathogenesis of gastric cancer, Molecular Mass: but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease. The recombinant human DIRAS3/mFc comprises 461 amino acids and has a predicted molecular mass of 52.1 kDa. The apparent molecular References mass of the monomer is approximately 62 kDa in SDS-PAGE under 1.Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24. 2.Lin D. et al., 2011, reducing conditions due to glycosylation. J Int Med Res. 39 (5): 1870-5.
    [Show full text]
  • Transcriptional Silencing of Long Noncoding RNA GNG12-AS1 Uncouples Its Transcriptional and Product-Related Functions.” Nature Communications 7 (1): 10406
    Transcriptional silencing of long noncoding RNA GNG12- AS1 uncouples its transcriptional and product-related functions The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Stojic, L., M. Niemczyk, A. Orjalo, Y. Ito, A. E. M. Ruijter, S. Uribe- Lewis, N. Joseph, et al. 2016. “Transcriptional silencing of long noncoding RNA GNG12-AS1 uncouples its transcriptional and product-related functions.” Nature Communications 7 (1): 10406. doi:10.1038/ncomms10406. http://dx.doi.org/10.1038/ncomms10406. Published Version doi:10.1038/ncomms10406 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26318707 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA ARTICLE Received 4 Sep 2015 | Accepted 8 Dec 2015 | Published 2 Feb 2016 DOI: 10.1038/ncomms10406 OPEN Transcriptional silencing of long noncoding RNA GNG12-AS1 uncouples its transcriptional and product-related functions Lovorka Stojic1, Malwina Niemczyk1, Arturo Orjalo2,w, Yoko Ito1, Anna Elisabeth Maria Ruijter1, Santiago Uribe-Lewis1, Nimesh Joseph1, Stephen Weston3, Suraj Menon1, Duncan T. Odom1, John Rinn4, Fanni Gergely1 & Adele Murrell1,3 Long noncoding RNAs (lncRNAs) regulate gene expression via their RNA product or through transcriptional interference, yet a strategy to differentiate these two processes is lacking. To address this, we used multiple small interfering RNAs (siRNAs) to silence GNG12-AS1,a nuclear lncRNA transcribed in an antisense orientation to the tumour-suppressor DIRAS3.
    [Show full text]
  • Bcl-G Acquitted of Murder&Excl;
    Citation: Cell Death and Disease (2012) 3, e405; doi:10.1038/cddis.2012.147 & 2012 Macmillan Publishers Limited All rights reserved 2041-4889/12 www.nature.com/cddis Editorial Bcl-G acquitted of murder! D Tischner1 and A Villunger*,1 Cell Death and Disease (2012) 3, e405; doi:10.1038/cddis.2012.147; published online 11 October 2012 Proteins of the Bcl-2 family are characterized by the presence Philippe Bouillet and colleagues8 started a whole-hearted of structural motives, referred to as Bcl-2 homology (BH) effort to elucidate the protein expression pattern and domains that orchestrate protein–protein interactions within physiological function of Bcl-G by the generation of a set of the family. The prosurvival members, such as Bcl-2 or Bcl-xL, highly specific monoclonal antibodies and Bcl-G-deficient usually contain four such domains (BH1–4), while their pro- mice.9 Contrary to some commercially available antibodies apoptotic opponents, Bax/Bak-like proteins and the BH3-only that picked up a 22-kDa band by western blotting, the newly proteins, contain three or only one such domain, that is, the generated monoclonals detected only a single 38-kDa band BH1, 2 and 3 or the BH3 domain, respectively.1 In concert, that was not present in protein extracts from cells and tissues these proteins regulate cell death by the mitochondrial derived from Bcl-G-deficient mice. Using four different anti- apoptosis pathway. However, some members of the family bodies, they could confirm that in mice only one Bcl-G isoform cannot be fully integrated in one of the three described exists, reflecting human Bcl-GL.
    [Show full text]
  • Chromatin Accessibility Dynamics of Chlamydia-Infected Epithelial Cells
    Hayward et al. Epigenetics & Chromatin (2020) 13:45 https://doi.org/10.1186/s13072-020-00368-2 Epigenetics & Chromatin RESEARCH Open Access Chromatin accessibility dynamics of Chlamydia-infected epithelial cells Regan J. Hayward1, James W. Marsh2, Michael S. Humphrys3, Wilhelmina M. Huston4 and Garry S. A. Myers1,4* Abstract Chlamydia are Gram-negative, obligate intracellular bacterial pathogens responsible for a broad spectrum of human and animal diseases. In humans, Chlamydia trachomatis is the most prevalent bacterial sexually transmitted infec- tion worldwide and is the causative agent of trachoma (infectious blindness) in disadvantaged populations. Over the course of its developmental cycle, Chlamydia extensively remodels its intracellular niche and parasitises the host cell for nutrients, with substantial resulting changes to the host cell transcriptome and proteome. However, little infor- mation is available on the impact of chlamydial infection on the host cell epigenome and global gene regulation. Regions of open eukaryotic chromatin correspond to nucleosome-depleted regions, which in turn are associated with regulatory functions and transcription factor binding. We applied formaldehyde-assisted isolation of regulatory elements enrichment followed by sequencing (FAIRE-Seq) to generate temporal chromatin maps of C. trachomatis- infected human epithelial cells in vitro over the chlamydial developmental cycle. We detected both conserved and distinct temporal changes to genome-wide chromatin accessibility associated with C. trachomatis infection. The observed diferentially accessible chromatin regions include temporally-enriched sets of transcription factors, which may help shape the host cell response to infection. These regions and motifs were linked to genomic features and genes associated with immune responses, re-direction of host cell nutrients, intracellular signalling, cell–cell adhesion, extracellular matrix, metabolism and apoptosis.
    [Show full text]