A Missense Cystic Fibrosis Transmembrane Conductance Regulator Mutation with Variable Phenotype

A Missense Cystic Fibrosis Transmembrane Conductance Regulator Mutation With Variable Phenotype

Eitan Kerem, MD*; Malka Nissim-Rafinia‡; Zvi Argaman, MD*; Arie Augarten, MD§; Lea Bentur, MDʈ; Aharon Klar, MD¶; Yaacov Yahav, MD§; Amir Szeinberg, MD§; Ornit Hiba‡; David Branski, MD*; Mary Corey, PhD#; and Batsheva Kerem, PhD‡

ABSTRACT. Objective. Cystic fibrosis (CF) has vari- classified either as a severe or as a mild mutation. able clinical presentation. Disease severity is partially Pediatrics 1997;100(3). URL: http://www.pediatrics.org/ associated with the type of mutation. The aim of this cgi/content/full/100/3/e5; cystic fibrosis, genotype-pheno- study was to report genotype-phenotype analysis of the type correlation, genetics, pancreatic function, pulmonary G85E mutation. function, CFTR mutation. Patients. The phenotype of 12 patients (8 were from the same extended family, and 5 of them were siblings from 2 families) carrying at least one copy of the G85E ABBREVIATIONS. CF, cystic fibrosis; CFTR, cystic fibrosis trans- mutation was evaluated and compared with the pheno- membrane conductance regulator; PI, pancreatic insufficiency; PS, type of 40 patients carrying the two severe mutations, pancreatic sufficiency; PCR, polymerase chain reaction; RT, reverse transcriptase; FEV , forced expiratory volume in 1 second. W1282X and/or ⌬F508 (group 1), and with 20 patients 1 carrying the splicing mutation, 3849؉10kb C->T, which was found to be associated with milder disease (group 2). ystic fibrosis (CF), the most common lethal Results. A high phenotypic variability was found autosomal recessive disease among whites, is among the patients carrying the G85E mutation. This caused by defects in the CF transmembrane high variability was found among patients carrying the C same genotype and among siblings. All the studied chro- conductance regulator (CFTR) gene, which encodes a mosomes carrying the G85E mutation had the 7T variant chloride channel regulated by cyclic adenosine in the polythymidine tract at the branch/acceptor site in monophosphate protein. Defects in the CFTR cause intron 8. Of the G85E patients, 25% had pancreatic suf- abnormal chloride concentration across the apical ficiency and none had meconium ileus, compared with membrane of epithelial cells in the airways, pan- 0% and 32%, respectively, of patients from group 1, and creas, intestine, sweat gland and duct, and in the 80% and 0%, respectively, from group 2. Two patients male genital system. It therefore results in progres- carrying the G85E mutation had sweat chloride levels sive lung disease, pancreatic and intestinal dysfunc- <60 mmol/L whereas all the others had typically elevated levels >80 mmol/L. Compared with group 2, patients tion, elevated sweat electrolytes, and male infer- 1 carrying the G85E mutation were diagnosed at an earlier tility. CF is characterized by a wide variability of age and had higher sweat chloride levels, with mean clinical expression. The cloning of the CFTR gene values similar to group 1 but significantly more variable. and the identification of mutations in the gene, has Forced expiratory volume in 1 second (FEV1) was similar promoted extensive research into the association be- in the three groups, with no differences in the slope or in tween genotype and phenotype, which has contrib- age-adjusted mean values of FEV1. The levels of tran- uted to our understanding the mechanisms of the scripts lacking exon 9 transcribed from the G85E allele remarkable clinical heterogeneity of CF. Previous measured in 3 patients were 55%, 49%, and 35% and their studies analyzed the genotype-phenotype correla- FEV1 values were 82%, 83%, and 50% predicated, respectively. tion in several mutations for which a large enough 2–16 Conclusions. The G85E mutation shows variable clin- number of patients was available. These studies ical presentation in all clinical parameters. This variabil- have shown that genetic factors influence the severity could be seen among patients carrying on the other ity of the disease, and that there are two groups of chromosome the same CFTR mutation, and also among mutations. One group is associated with pancreatic siblings. This variability is not associated with the level insufficiency (PI) (Ͼ95% of cases) and a young age at of exon 9 skipping. Thus, the G85E mutation cannot be diagnosis (usually Ͻ1 year of age), high sweat chloride levels (Ͼ80 meq/L), and meconium ileus (20% From the *Department of Pediatrics, Cystic Fibrosis (CF) Clinic, Shaare to 30% of the cases). The other group of mutations is Zedek Medical Center, Jerusalem, Israel; and the ‡Department of Genetics, associated with a high rate of pancreatic sufficiency Hebrew University, Jerusalem; the §Department of Paediatrics, CF Clinic, (PS) (70% to 80%), and a later age at diagnosis (usu- Chaim Sheba Medical Center, Tel Hashomer, Israel; the ʈDepartment of Ͼ Paediatrics, CF Clinic, Rambam Medical Center, Haifa; the ¶Department of ally 10 years of age), lower sweat chloride levels, Paediatrics, Bikur Cholim Hospital, Jerusalem, Israel; and the #Research and no meconium ileus. Severity of lung disease Institute, Hospital for Sick Children, Toronto, Canada. varies considerably among both groups of pheno- Received for publication Jan 10, 1997; accepted Mar 13, 1997. types. Pancreatic status was suggested to be the best Reprint requests to (E.K.) Department of Pediatrics, Pulmonary and Cystic Fibrosis Clinic, Shaare Zedek Medical Center, Jerusalem, Israel 91031. parameter in differentiating between the two 17 PEDIATRICS (ISSN 0031 4005). Copyright © 1997 by the American Acad- groups. emy of Pediatrics. The G85E mutation is a missense mutation result- http://www.pediatrics.org/cgi/content/full/100/3/Downloaded from www.aappublications.org/newse5 by PEDIATRICS guest on September Vol. 28, 100 2021 No. 3 September 1997 1of6 ing from a substitution of glutamic acid for glycine at The cDNA samples were heated at 94°C for 3 minutes and then amino acid 85. The result is a relatively major change subjected to 35 cycles of denaturation at 94°C for 60 seconds, primer annealing for 30 seconds at 55°C for the RT-PCR 1 and 4, replacing a polar amino acid with a negatively- 60°C for the RT-PCR 2, and 51°C for the RT-PCR 3. In RT-PCR 1, charged one within the first membrane spanning 3, and 4 the extension was performed at 65°C for 60 seconds, in domain of CFTR. It might be expected to have a RT-PCR 2 at 60°C for 120 seconds, followed by a final extension of significant effect on the protein. Two patients, 1 with 7 minutes at 65°C. RNA-less samples were used as controls. Semi- PI and the other with PS and exceptionally mild lung quantitative PCR conditions, which reflect the initial relative 18,19 amounts of the normal and aberrantly spliced transcripts, were disease, were previously reported. Thus, for fur- established by serial dilutions (1:3) of the cDNA products before ther determination of the correlation between the the nondifferential PCR. Only RT-PCR products in the linear G85E mutation and disease phenotype a larger co- phase were analyzed. hort of patients was required. We undertook this study to analyze the genotype-phenotype correlation Hybridization to RT-PCR Products of this mutation among our CF patient population. 50 ␮L of each differential RT-PCR reaction were subjected to electrophoresis and were subsequently blotted and hybridized to MATERIALS AND METHODS the exon 3 oligonucleotide G85E-N 5ЈGTTCTATGGAATCTTT 3Ј that identified the normal sequence, washed at 42°C, and to DNA Sequence Determination and Mutation Analysis G85E-M 5ЈGTTCTATGAAATCTTT 3Ј that identified the G85E DNA sequences spanning individual exons of the CF gene were mutation, washed at 40°C. The intensity of the RT-PCR products amplified by polymerase chain reaction (PCR)20,21 with oligonu- was measured by phosphorimager. cleotide primers located in the respective flanking introns of the CF gene.22 The amplified genomic DNA fragments eluted from 5% Assessment of Disease Severity polyacrylamide gels were extracted with phenol/chloroform and The clinical phenotype was assessed by the following parame- were subjected to the dideoxy-chain termination sequencing 23 ters: age at diagnosis and at assessment, sex, mode of presentation, method essentially as described, using the US Biochemicals Se- history of meconium ileus, diagnostic sweat chloride levels, most quenase (Indianapolis, IN) kit with either one of the PCR primers recent sputum cultures, and pancreatic function as determined by or internal oligonucleotides as sequencing primers. After the iden- a 3-day fecal fat collection. Patients in whom fecal fat loss ex- tification of a specific mutation in an individual, the entire studied ceeded 7% of dietary intake were considered to have PI. The CF population was detected for this mutation using previously 24 patients who died before the study did not have stool fat analysis described methods. but presented with severe malabsorption responding to enzyme supplementation. Pulmonary function was assessed in all CF pa- Detection of the Polypyrimidine Tract Length Variants tients Ͼ6 years of age. Forced expiratory volume in 1 second at the Acceptor/Branch Site of Exon 9 (FEV1) was measured and expressed as a percentage of predicted The genomic region flanking the polythymidine tract was am- values for height and sex, using previously described standard- ized pulmonary equations.27 Current height and weight percen- plified by PCR using the primers 9i-5 and 9i-3 using previously 28 described methodology.25 Nested PCR was subsequently per- tiles were computed using the tables of Tanner. Data was col- formed with primers TT-i5 (5ЈGTGTGTGTGTGTGTGTTTTT 3Ј) lected throughout 10 years and the most recent values were and TT-i3 (5Ј CTGTCCTCTTTTCTATCTTG 3Ј). The PCR condi- considered. tions were: 94°C 6Ј followed by 35 cycles of 94°C 30“, 54°C 30”, To assess the severity of disease presentation of the patients 74°C 40“, and 74°C 6Ј. The PCR products were visualized on 12% carrying the G85E mutation, we compared their clinical parame- nondenaturing polyacrylamide gel (sequencing format) that were ters with those of two groups of patients. The first was comprised electrophoresed at room temperature, at 600 V, for 18 hours and of 40 patients homozygous or compound heterozygous for the W1282X and ⌬F508 mutations, both associated with severe disease subsequently silver-stained. Assignment of the splice variant al- 2,3 leles was performed by analysis of available family members. presentation. In the second group were 20 patients carrying the 3849ϩ10kb C-ϾT mutation, which is associated with higher frequency of PS and a milder phenotype.7,8 RNA Extraction and Single-strand cDNA Synthesis Nasal epithelial cells were scraped from 3 individuals. The Statistical Analysis scraped cells were suspended in 300 ␮L RNAzol B buffer (BIOTEC Laboratories, Inc, Houston, TX). Total RNA was extracted from Mean values of continuous variables were compared using the scraped nasal cells using the acid-phenol-chloroform method analysis of variance and Student’s t test. The F statistic was used according to the manufacturer’s instructions. RNA was solubi- to asses the assumption of equal variances in comparison groups. 2 lized in 10 ␮L diethylpyrocarbonate-treated RNase-free double- ␹ analysis was used to compare proportions and frequency dis- distilled water. RNA was extracted from the polyp biopsies of the tributions. In which expected values were small, Fisher’s exact test control individuals by the guanidinium thiocyanate method. The was used to compare proportions. RNA was purified by centrifugation through a CsCl cushion.26 cDNA was synthesized using 2.5 ␮M random hexamer mix RESULTS (Pharmacia Fine Chemicals, Piscataway, NJ), 5 mM MgCl,2 1mM dNTP mix (Pharmacia), 2.5 units of Moloney murine leukemia Twelve CF patients were found to carry the G85E virus reverse transcriptase (RT) (BRL, Gaithersburg, MD), and 4 mutation, 9 were Arab, 8 from the same extended units of RNase inhibitor (Boehringer, Indianapolis, IN). The tubes family (Table 1, patients 1 to 4 and 6 to 9), and 3 were were incubated at room temperature for 10 minutes, at 42°C for 20 Jews from Turkish origin (patients 10 to 12). Six minutes, at 99°C for 5 minutes, and at 4°C for 5 minutes. Each patients were homozygous for the G85E mutation cDNA synthesis experiment included a control sample in which all reagents except RNA were present. and 6 were compound heterozygote for the G85E and the ⌬F508, W1282X or the 3849ϩ10kb CϪϾT Nondifferential PCRs of cDNA Products mutations. All the studied chromosomes carrying the Nondifferential RT-PCR reactions in which the normally G85E mutation had the 7T variant in the polythymi- spliced transcripts, containing exon 9, and the aberrantly spliced dine tract at the branch/acceptor site in intron 8. transcripts, lacking exon 9, produce products of the same size The clinical parameters of the patients carrying the were designed. Amplification of the region between exon 3 and G85E mutation are presented in Table 1. It shows a the junction of either exons 8/9 or 8/10 using the oligonucleotide primers 3Ri5 5Ј GGATAGAGAGCTGGCTTCAAAGAAA 3Ј, high variability in the age at diagnosis among pa- 8/9Ri3 5ЈAAATAATTCCCCAAATCCCTCCTCC 3Ј, and 8/10Ri3 tients carrying the G85E. Although 7 patients were 5ЈCATCATTAGAAGTGAAGTCTCCTCC 3Ј, respectively. symptomatic and diagnosed before 1 year of age, 3

2of6 VARIABLE PHENOTYPEDownloaded from OF www.aappublications.org/news CFTR MUTATION by guest on September 28, 2021 TABLE 1. Clinical Data of CF Patients Carrying the G85E Mutation

Patient No. Genotype Sex Age at Sweat Mode of Current Pancreatic FEV1 % Weight Sputum Diagnosis Chloride Presentation Age Status Predicted Percentile Culture meq/l 1* G85E/G85E F 9 mo 143 Respir ϩ GI Died 13 y PI NA Ͻ3 Klebsiela 2* G85E/G85E M 2 mo 184 Respir Died 10 y PI NA Ͻ3 H influenzae 3* G85E/G85E M 12 y 54 Liver 13 y PS 82 Ͻ3 H influenzae 4 G85E/G85E F 6 mo 157 Respir ϩ GI Died 6 y PI 20 Ͻ3 P aeruginosa 5 G85E/G85E F 2 mo 90 Respir ϩ GI 4 mo PI NA Ͻ3 H influenzae 6 G85E/G85E F 3 mo 97 Respir ϩ GI 6 yr PS 86 35 H influenzae ϩ Staph 7† G85E/⌬F508 M 6 mo 158 GI Died 11 y PI NA 3 NA 8† G85E/⌬F508 M 10 y 108 Screening 12 y PS 83 80 Staph 9 G85E/⌬F508 M 5 mo NA Respir ϩ GI 18 y PI 50 Ͻ3 P aeruginosa ϩ Staph 10 G85E/W1282X F 7 mo 117 Respir 20 y PI 65 50 P aeruginosa 11 G85E/W1282X F 19 y 82 Pancreatitis 34 y PI 22 50 P aeruginosa ϩ Respir 12 G85E/3849 ϩ 10KB M 5 mo 54 Respir 10 y PI 65 97 P aeruginosa * and † Patients are siblings, respectively. Abbreviations: F, female; M, male; Respir, respiratory symptoms; GI, steatorrhea and/or failure to thrive; PI, pancreatic insufficiency; PS, pancreatic sufficiency; NA, not available. were diagnosed after 10 years of age with atypical Comparison of the patients carrying the G85E mu- presentation. One patient (No. 8) was diagnosed in a tation with patients carrying the ⌬F508 and/or carrier screening performed in his school. Likewise, W1282X mutations previously associated with PI sweat chloride levels varied among the patients; 2 and the more severe disease (group 1) or with pa- had sweat chloride levels Ͻ60 meq/L, and diagnosis tients carrying the 3849ϩ10kb C-ϾT previously as- of CF was confirmed only after genotype analysis. sociated with higher frequency of PS and a milder There were two families in our study. One had 3 disease (group 2), revealed that the mean age at children homozygous for the G85E mutation (Table diagnosis and age at assessment in the group of 1, patients 1 to 3). The first 2 presented before 1 year patients carrying the G85E mutation were not signif- of age with typical CF disease, had severe course, icantly different from those in group 1, but signifi- and died at a relatively early age. Their subsequent cantly lower than in group 2 (P ϭ .001 for age of brother presented with liver disease at age 12 with diagnosis, P ϭ .04 for age at assessment; Table 2). no signs of pancreatic or respiratory involvement, Likewise, mean sweat chloride levels in patients car- and with sweat chloride levels of Ͻ60 mmol/L. The rying the G85E mutation was similar to group 1, and diagnosis of CF was made by genotyping only. The significantly higher than group 2 (P ϭ .001; Table 2). second family had 2 children compound heterozy- Thus, it seems that patients carrying the G85E mu- gous for G85E and ⌬F508 mutations (Table 1, pa- tation have similarly severe disease as patients car- tients 7 and 8). The first child was diagnosed at an rying the ⌬F508 and/or W1282X mutations. How- early age with typical severe course and died at an ever, the F test of equal variance was significantly early age, whereas his subsequent brother was diag- different between these groups: the range of age at nosed at age 10 during CF screening. After the diag- diagnosis and sweat chloride levels were much nosis he was further assessed and was found to have broader for the G85E group than for group 1 (P Ͻ PS, elevated sweat chloride levels, minimal bronchi- .0001), and sweat chloride was more variable in the ectasis, and normal pulmonary function. G85E mutation than in group 2 (P ϭ .002).

TABLE 2. Comparison of Clinical Data Between CF Patients Carrying the G85E Mutations and Patients Homozygous or Compound Heterozygous for Two Severe Mutations (W1282X and ⌬F508) and Those Carry a Milder Mutation (3849ϩ10kb CϪϾT) Variable G85E W1282X/W1282X 3849 ϩ 10kb CϪϾT ⌬F508/⌬F508 W1282X/⌬F508 n124021 Age at diagnosis* 3.7 Ϯ 6.3 0.7 Ϯ 1.8࿣ 13.2 Ϯ 7.8 Sweat chloride (mmol/L)* 119 Ϯ 38 111 Ϯ 12࿣ 71 Ϯ 18¶ Died, n 4 2 2 Pancreatic sufficiency, %§ 25 0 79 Meconium ileus, %§ 0 33 0 Current age, y† 12.8 Ϯ 8.5 10.8 Ϯ 7.0 19.8 Ϯ 8.8 Weight (percentile)‡ 28 Ϯ 34 24 Ϯ 24 50 Ϯ 34 Forced expiratory volume in 1 second 55 Ϯ 26 (n ϭ 7) 66 Ϯ 28 (n ϭ 24) 55 Ϯ 21 (n ϭ 19) (% predicted) * P Ͻ .0001, † P Ͻ .001, ‡ P Ͻ .01 analysis of variance for three means. § P Ͻ .002 ␹2 test of three populations. ࿣ P Ͻ .0001 F test of equal variance compared with G85E. ¶ P Ͻ .01 F test of equal variance compared with G85E.

Downloaded from www.aappublications.org/newshttp://www.pediatrics.org/cgi/content/full/100/3/ by guest on September 28, 2021 e5 3of6 Of the patients carrying the G85E mutation, 25% of a nonfunctional CFTR protein. The level of aber- had PS significantly higher than in group 1 (0%), and rantly spliced CFTR RNA transcribed in respiratory significantly lower than in group 2 (80%) (P Ͻ .001; epithelial cells from the G85E allele was analyzed Table 2). Furthermore, similar to the patients in using semiquantitative nondifferential RT-PCR. The group 2, none of the patients carrying the G85E RT-PCR was performed on respiratory epithelial mutation had meconium ileus, whereas a third of the cells from 3 patients who carried at least one G85E patients from group 1 had meconium ileus (P ϭ allele (patients 3, 8, and 9). The reaction was repeated .002). The nutritional status of patients carrying the three times for each patient. The results showed that G85E mutation was poor. As a group, they had sim- the level of transcripts lacking exon 9 transcribed ilar mean weight percentile to group 1. However, from the G85E allele was 55 Ϯ 3% for patient 3, 49 Ϯ 58% of the patients carrying the G85E mutation were 2% for patient 8, and 35 Ϯ 4% for patient 9. Their under the third percentile of weight, compared with FEV1 was 82, 83, and 50% predicated, respectively. 25% of the group 1 patients (P ϭ .02), and 20% of The patient with the lowest FEV1 had the lowest level group 2 (0.05). of RNA transcripts lacking exon 9. Thus, the level of As shown in Table 2, FEV1 was similar in the three aberrantly spliced transcripts could not explain the groups. Because pulmonary function is age-depen- variable pulmonary function among patients carry- dent, and ages in the three groups are different we ing the G85E mutation. performed analysis of covariance for FEV1. There were no differences in the slope or in age-adjusted DISCUSSION mean values of FEV1 in the three groups. However, This study demonstrates high variability of clinical the scatter of the values was very wide with typical presentation among patients carrying the G85E mu- spread of the points (Fig 1), similar to that seen in tation. Thus, the G85E mutation cannot be classified other studies,2,10,15 and very large numbers would either as a severe or as a mild mutation. This vari- therefore be necessary to reveal possible group dif- ability was found also among patients carrying the ferences. same CFTR mutations on the other chromosomes, and among siblings. Therefore, no other CFTR mu- Levels of Correctly Spliced CFTR RNA Transcribed tation is expected. Several genotype-phenotype stud- From the G85E Allele in Respiratory Epithelium ies including the CF genotype-phenotype consor- We next studied the possibility that the variability tium have shown that there are mutations like the in pulmonary function found among our patients ⌬F508,2,6,11 W1282X,3,6 G542X,6 N1303K,4,6 and carrying the G85E mutation is associated with the R533X5,6 in which Ͼ95% of the patients had PI2–10 level of exon 9 skipping that leads to the translation whereas others like the 3849ϩ10kb C-ϾT,7,8 A455E15

Fig 1. FEV1 versus age for the three groups showing similar distribution with wide scatter of the values in all groups. The superimposed lines are the reference values and 1 and 2 standard deviations around the reference line of patients from Toronto homozygous for ⌬F508,2 showing that the spread of the values are typical. Severe: ⌬F508/⌬F508, W1282X/W1282X, ⌬F508/W1282X. Mild: 3849ϩ10kb CϪϾT.

4of6 VARIABLE PHENOTYPEDownloaded from OF www.aappublications.org/news CFTR MUTATION by guest on September 28, 2021 R117H6 in which Ͼ65% of the patients were PS. The patients in our study is not a result of another mu- incidence of PS among the patients carrying the tation in the CFTR locus, or attributable to different G85E mutation (25%), suggests that it cannot be clas- levels of thymidine at the branch/acceptor site of sified either as a PI- or PS-associated mutation. intron 8, and not associated with exon 9 skipping. Slightly elevated, borderline, or even normal values Another cause for this variability might be different of sweat chloride were previously reported among levels of the CFTR protein regulated by genes asso- patients carrying at least one copy of the splicing ciated with the translation machinery. In addition, mutation 3849ϩ10kb C-ϾT.7,8,15 Two of the patients other genes coding for alternative ion channels or in our study, carrying the G85E mutation, had bor- channel regulators, might modify the CF disease se- derline sweat chloride levels, whereas the others had verity as was recently found in studies in knockout typically high levels. Furthermore, as shown in Table CF mice.34 Thus, other genetic and/or environmental 2, it seems that the G85E patients present to medical factors modulate the severity of the disease expres- attention at a later age than the patients in the severe sion. Further understanding the mechanisms group. However, again this is attributable to the underlying the disease variability found among pa- wide range of the age of diagnosis among the G85E tients carrying the G85E mutation will contribute to patients, and not attributable to a milder disease our understanding of the genotype-phenotype asso- course. As shown in Table 1, the patients were diag- ciation and disease variability in CF. nosed either typically under 1 year of age, or at a significantly later age. Thus, the results of our anal- REFERENCES ysis show that the G85E mutation is associated with variable disease presentation in all the studied pa- 1. Welsh MJ, Tsui L.-C, Boat TF, Beaudet AL. Cystic fibrosis. In: Scriver CL, Beaudet AL, Sly WS, Valle D, eds. The Metabolic Basis of Inherited rameters. Most of the patients have typically a severe Disease. 7th ed. New York, NY: McGraw-Hill; 1995:3799–3876 course, although approximately 25% of the patients 2. Kerem E, Corey M, Kerem B, et al. The relationship between genotype have an atypical course. Interestingly, pulmonary and phenotype in cystic fibrosis—analysis of the most common muta- disease is similar in all types of mutations, thus the tion (⌬F508). N Engl J Med. 1990;323:1517–1522 3. Shoshani T, Augarten A, Gazit E, et al. Association of a nonsense atypical course is related mainly to the gastrointesti- mutation (W1282X), the most common mutation in the Ashkenazi nal involvement. Jewish cystic fibrosis patients in Israel, with presentation of severe The mechanism causing the variability seen disease. Am J Hum Genet. 1992;50:222–228 among the patients carrying the G85E mutation is 4. Osborn L, Santis G, Schwartz M, et al. Incidence and expression of the unknown. So far, such high variability among pa- N1303K mutation of the cystic fibrosis (CFTR) gene. Hum Genet. 1992; 89:653–658 tients with the same genotype was found in lung 5. Liechti-Gallati S, Bonsall I, Malik N, et al. Genotype-phenotype associ- disease only. Sequence variations within the CFTR ation in cystic fibrosis: analysis of the ⌬F508, R553X and 3905insT gene that modulate the CF phenotype have been mutations. Pediatr Res. 1992;32:175–178 reported in 2 CF patients.29,30 However, in our study 6. The Cystic Fibrosis Genotype-Phenotype Consortium. Correlation between genotype and phenotype in patients with cystic fibrosis. N Engl 8 patients were from the same extended family, car- J Med. 1993;329:1308–1313 rying the same G85E allele, as evidenced by ex- 7. Augarten A, Kerem B, Yahav Y, et al. Mild cystic fibrosis and normal or tended haplotype analysis using polymorphic mark- borderline sweat test in patients with the 3849ϩ10kb C-ϾT mutation. ers in the CFTR locus (data not shown). These Lancet. 1993;342:25–26 patients show the high variability of disease expres- 8. Highsmith WE, Lauraneli H, Burch MS, et al. A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sion. Splicing variance of thymidine at the branch/ sweat chloride concentrations. N Engl J Med. 1994;331:974–980 acceptor site of intron 8, known as a polyT tract, 9. Angelicheva D, Boteva K, Jordanova A, et al. Cystic fibrosis patients contains five, seven, or nine thymidines (the 5T, 7T, from the Black Sea region: the 1677delTA mutation. Hum Mutat. 1994; and 9T alleles, respectively). Chu et al31 showed that 3:353–357 10. Moullier P, Jehanne M, Audrezet MP, et al. Association of 1078delT normal individuals and patients with other respira- cystic fibrosis mutation with severe disease. J Med Genet. 1994;31: tory abnormalities, have different levels of aberrantly 159–161 spliced mRNA lacking exon 9 in the bronchial epi- 11. Santis G, Osborne L, Knight RA, Hodson ME. Independent genetic thelial cells. This level depends on the length of the determinants of pancreatic and pulmonary status in cystic fibrosis. polyT tract. The 5T allele is associated with the low- Lancet. 1990;336:1081–1084 12. Hamosh A, King TM, Rosenstein BJ, et al. Cystic fibrosis patients est levels of normal splicing of exon 9, and high bearing both the common missense mutation Gly-ϾAsp at codon 551 levels of exon 9 skipping leading to a nonfunctional and ⌬F508 mutation are clinically indistinguishable from ⌬F508 ho- chloride channel.32 Furthermore, the 5T allele was mozygotes except for decreased risk of meconium ileus. Am J Hum shown to affect the disease severity of patients car- Genet. 1992;51:245–250 33 13. Chillon M, Dork T, Casals J, et al. A novel donor splice site in intron 11 rying the mutation R117H. In patients carrying the of the CFTR gene, created a mutation 1811ϩ1.6kbA3G, produces a R117H mutation when the allele also contained the new exon. High frequency in Spanish cystic fibrosis chromosomes and 5T variant the phenotype was mild CF, whereas in association with severe phenotype. Am J Hum Genet. 1995;56:623–629 patients carrying R117H together with the 7T variant 14. Estivill X, Ortigosa L, Perez-Frias J, et al. Clinical characteristics of 16 the phenotype was male infertility only. In our study cystic fibrosis patients with the missense mutation R334W, pancreatic insufficiency mutation with variable age of onset and interfamilial all the G85E chromosomes contained the 7T variant. clinical differences. Hum Genet. 1995;95:331–336 In addition, the level of RNA transcripts lacking exon 15. Gan KH, Veeze HJ, van den Ouweland AMW, et al. A cystic fibrosis 9, transcribed from the G85E allele, varied among mutation associated with mild lung disease. N Engl J Med. 1995;333: different individuals. However, the severity of the 95–99 16. Varon R, Sturmann M, Macek M, et al. Pancreatic insufficiency and pulmonary disease could not be explained by the pulmonary disease in German and Slavic cystic fibrosis patients with variable level of aberrantly spliced transcripts. Thus, the R347P mutation. Hum Mut. 1995;6:219–225 the high phenotypic variability found among the 17. Kristidis P, Bozon D, Corey M, et al. Genetic determinants of exocrine

Downloaded from www.aappublications.org/newshttp://www.pediatrics.org/cgi/content/full/100/3/ by guest on September 28, 2021 e5 5of6 pancreatic function. Am J Hum Genet. 1992;50:1178–1184 27. Polgar G, Promadhart V. Pulmonary Function Testing in Children: Tech- 18. Zielenski J, Bozon D, Kerem B, Markiewicz D, Rommens JM, Tsui LC. niques and Standards. Philadelphia, PA: WB Saunders; 1971 Identification of mutations in exons 1 through 8 of the cystic fibrosis 28. Tanner JM, Whitehouse RH, Takaishi M. Standards from birth to ma- transmembrane conductance regulator (CFTR) gene. Genomics. 1991;10: turity for height, weight, height velocity and weight velocity: British 229–235 children, 1965. Arch Dis Child. 1966;41:454–471 19. Chalkey G, Harris A. A cystic fibrosis patient who is homozygous for 29. Dork T, Wulbrand U, Richter T, et al. Cystic fibrosis with three muta- the G85E mutation has very mild disease. J Med Genet. 1991;28:875–877 tions in the cystic fibrosis transmembrane conductance regulator gene. 20. Saiki RK, Scharf S, Faloona F, et al. Enzymatic amplification of beta Hum Genet. 1991;87:441–446 globin genomic sequences and restriction site analysis for diagnosis of 30. Kalin N, Dork T, Tummler B. A cystic fibrosis allele encoding missense sickle cell anemia. Science. 1985;230:1350–1354 mutations in both nucleotide binding folds of the cystic fibrosis trans- 21. Saiki RK, Gelfand SH, Stoffel S, et al. Primer-directed enzymatic ampli- membrane conductance regulator. Hum Mut. 1993;1:204–210 fication of DNA with a thermostable DNA polymerase. Science. 1988; 31. Chu CS, Trapnell BC, Curristin SM, Cutting GR, Crystal RG. Extensive 239:487–491 posttranscriptional deletion of the coding sequences of part of nucleo- 22. Zielenski J, Rozmahel R, Bozon D, et al. Genomic DNA sequences of the tide-binding fold 1 in respiratory epithelial m RNA transcripts of the cystic fibrosis transmembrane conductance regulator. Genomics. 1991; cystic fibrosis transmembrane conductance regulator gene is not asso- 10:214–228 ciated with the clinical manifestations of cystic fibrosis. J Clin Invest. 23. Winship PR. An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acids Res. 1989;17: 1992;90:785–790 1266–1269 32. Chu CS, Trapnell BC, Curristin S, Cutting GR, Crystal RG. Genetic basis 24. Kerem E, Kalman YM, Yahav Y, et al. Highly variable incidence of cystic of variable exon 9 skipping in cystic fibrosis transmembrane conduc- fibrosis mutation distribution among different ethnic Jewish groups in tance regulator mRNA. Nature Genet. 1993;3:151–156 Israel. Hum Genet. 1995;96:193–197 33. Kiesewetter S, Macek M Jr, Davis C, et al. A mutation in CFTR produces 25. Kiesewetter S, Macek M, Davis C, et al. A mutation in CFTR produces different phenotypes depending on chromosomal background. Nature different phenotypes depending on chromosomal background. Nature Genet. 1993;5:274–278 Genet. 1993;5:274–278 34. Rozmahel R, Wilschanski M, Matin A, et al. Modulation of disease 26. Chirgwin JM, Przbyla AE, MacDonald RJ, Rutter W. Isolation of bio- severity in cystic fibrosis transmembrane conductance regulator de- logically active ribonucleic acid from sources enriched in ribonuclease. ficient mice by a secondary genetic factor. Nature Genet. 1996;12: Biochemistry. 1979;18:5294–5299 280–287

6of6 VARIABLE PHENOTYPEDownloaded from OF www.aappublications.org/news CFTR MUTATION by guest on September 28, 2021 A Missense Cystic Fibrosis Transmembrane Conductance Regulator Mutation With Variable Phenotype Eitan Kerem, Malka Nissim-Rafinia, Zvi Argaman, Arie Augarten, Lea Bentur, Aharon Klar, Yaacov Yahav, Amir Szeinberg, Ornit Hiba, David Branski, Mary Corey and Batsheva Kerem Pediatrics 1997;100;e5 DOI: 10.1542/peds.100.3.e5

Updated Information & including high resolution figures, can be found at: Services http://pediatrics.aappublications.org/content/100/3/e5 References This article cites 32 articles, 5 of which you can access for free at: http://pediatrics.aappublications.org/content/100/3/e5#BIBL Subspecialty Collections This article, along with others on similar topics, appears in the following collection(s): Genetics http://www.aappublications.org/cgi/collection/genetics_sub Permissions & Licensing Information about reproducing this article in parts (figures, tables) or in its entirety can be found online at: http://www.aappublications.org/site/misc/Permissions.xhtml Reprints Information about ordering reprints can be found online: http://www.aappublications.org/site/misc/reprints.xhtml

Downloaded from www.aappublications.org/news by guest on September 28, 2021 A Missense Cystic Fibrosis Transmembrane Conductance Regulator Mutation With Variable Phenotype Eitan Kerem, Malka Nissim-Rafinia, Zvi Argaman, Arie Augarten, Lea Bentur, Aharon Klar, Yaacov Yahav, Amir Szeinberg, Ornit Hiba, David Branski, Mary Corey and Batsheva Kerem Pediatrics 1997;100;e5 DOI: 10.1542/peds.100.3.e5

The online version of this article, along with updated information and services, is located on the World Wide Web at: http://pediatrics.aappublications.org/content/100/3/e5

Pediatrics is the official journal of the American Academy of Pediatrics. A monthly publication, it has been published continuously since 1948. Pediatrics is owned, published, and trademarked by the American Academy of Pediatrics, 345 Park Avenue, Itasca, Illinois, 60143. Copyright © 1997 by the American Academy of Pediatrics. All rights reserved. Print ISSN: 1073-0397.

Downloaded from www.aappublications.org/news by guest on September 28, 2021