• Abstract and Figures
• Public Full-text

A Missense Cystic Fibrosis Transmembrane Conductance Regulator Mutation With Variable Phenotype Eitan Kerem, MD*; Malka Nissim-Rafinia‡; Zvi Argaman, MD*; Arie Augarten, MD§; Lea Bentur, MDi; Aharon Klar, MD¶; Yaacov Yahav, MD§; Amir Szeinberg, MD§; Ornit Hiba‡; David Branski, MD*; Mary Corey, PhD#; and Batsheva Kerem, PhD‡ ABSTRACT. Objective. Cystic fibrosis (CF) has vari- classified either as a severe or as a mild mutation. able clinical presentation. Disease severity is partially Pediatrics 1997;100(3). URL: http://www.pediatrics.org/ associated with the type of mutation. The aim of this cgi/content/full/100/3/e5; cystic fibrosis, genotype-pheno- study was to report genotype-phenotype analysis of the type correlation, genetics, pancreatic function, pulmonary G85E mutation. function, CFTR mutation. Patients. The phenotype of 12 patients (8 were from the same extended family, and 5 of them were siblings from 2 families) carrying at least one copy of the G85E ABBREVIATIONS. CF, cystic fibrosis; CFTR, cystic fibrosis trans- mutation was evaluated and compared with the pheno- membrane conductance regulator; PI, pancreatic insufficiency; PS, type of 40 patients carrying the two severe mutations, pancreatic sufficiency; PCR, polymerase chain reaction; RT, re- verse transcriptase; FEV , forced expiratory volume in 1 second. W1282X and/or DF508 (group 1), and with 20 patients 1 carrying the splicing mutation, 3849110kb C->T, which was found to be associated with milder disease (group 2). ystic fibrosis (CF), the most common lethal Results. A high phenotypic variability was found autosomal recessive disease among whites, is among the patients carrying the G85E mutation. This caused by defects in the CF transmembrane high variability was found among patients carrying the C same genotype and among siblings. All the studied chro- conductance regulator (CFTR) gene, which encodes a mosomes carrying the G85E mutation had the 7T variant chloride channel regulated by cyclic adenosine in the polythymidine tract at the branch/acceptor site in monophosphate protein. Defects in the CFTR cause intron 8. Of the G85E patients, 25% had pancreatic suf- abnormal chloride concentration across the apical ficiency and none had meconium ileus, compared with membrane of epithelial cells in the airways, pan- 0% and 32%, respectively, of patients from group 1, and creas, intestine, sweat gland and duct, and in the 80% and 0%, respectively, from group 2. Two patients male genital system. It therefore results in progres- carrying the G85E mutation had sweat chloride levels sive lung disease, pancreatic and intestinal dysfunc- <60 mmol/L whereas all the others had typically elevated levels >80 mmol/L. Compared with group 2, patients tion, elevated sweat electrolytes, and male infer- 1 carrying the G85E mutation were diagnosed at an earlier tility. CF is characterized by a wide variability of age and had higher sweat chloride levels, with mean clinical expression. The cloning of the CFTR gene values similar to group 1 but significantly more variable. and the identification of mutations in the gene, has Forced expiratory volume in 1 second (FEV1) was similar promoted extensive research into the association be- in the three groups, with no differences in the slope or in tween genotype and phenotype, which has contrib- age-adjusted mean values of FEV1. The levels of tran- uted to our understanding the mechanisms of the scripts lacking exon 9 transcribed from the G85E allele remarkable clinical heterogeneity of CF. Previous measured in 3 patients were 55%, 49%, and 35% and their studies analyzed the genotype-phenotype correla- FEV1 values were 82%, 83%, and 50% predicated, respec- tively. tion in several mutations for which a large enough 2–16 Conclusions. The G85E mutation shows variable clin- number of patients was available. These studies ical presentation in all clinical parameters. This variabil- have shown that genetic factors influence the sever- ity could be seen among patients carrying on the other ity of the disease, and that there are two groups of chromosome the same CFTR mutation, and also among mutations. One group is associated with pancreatic siblings. This variability is not associated with the level insufficiency (PI) (.95% of cases) and a young age at of exon 9 skipping. Thus, the G85E mutation cannot be diagnosis (usually ,1 year of age), high sweat chlo- ride levels (.80 meq/L), and meconium ileus (20% From the *Department of Pediatrics, Cystic Fibrosis (CF) Clinic, Shaare to 30% of the cases). The other group of mutations is Zedek Medical Center, Jerusalem, Israel; and the ‡Department of Genetics, associated with a high rate of pancreatic sufficiency Hebrew University, Jerusalem; the §Department of Paediatrics, CF Clinic, (PS) (70% to 80%), and a later age at diagnosis (usu- Chaim Sheba Medical Center, Tel Hashomer, Israel; the iDepartment of . Paediatrics, CF Clinic, Rambam Medical Center, Haifa; the ¶Department of ally 10 years of age), lower sweat chloride levels, Paediatrics, Bikur Cholim Hospital, Jerusalem, Israel; and the #Research and no meconium ileus. Severity of lung disease Institute, Hospital for Sick Children, Toronto, Canada. varies considerably among both groups of pheno- Received for publication Jan 10, 1997; accepted Mar 13, 1997. types. Pancreatic status was suggested to be the best Reprint requests to (E.K.) Department of Pediatrics, Pulmonary and Cystic Fibrosis Clinic, Shaare Zedek Medical Center, Jerusalem, Israel 91031. parameter in differentiating between the two 17 PEDIATRICS (ISSN 0031 4005). Copyright © 1997 by the American Acad- groups. emy of Pediatrics. The G85E mutation is a missense mutation result- http://www.pediatrics.org/cgi/content/full/100/3/Downloaded from www.aappublications.org/newse5 by PEDIATRICS guest on September Vol. 28, 100 2021 No. 3 September 1997 1of6 ing from a substitution of glutamic acid for glycine at The cDNA samples were heated at 94°C for 3 minutes and then amino acid 85. The result is a relatively major change subjected to 35 cycles of denaturation at 94°C for 60 seconds, primer annealing for 30 seconds at 55°C for the RT-PCR 1 and 4, replacing a polar amino acid with a negatively- 60°C for the RT-PCR 2, and 51°C for the RT-PCR 3. In RT-PCR 1, charged one within the first membrane spanning 3, and 4 the extension was performed at 65°C for 60 seconds, in domain of CFTR. It might be expected to have a RT-PCR 2 at 60°C for 120 seconds, followed by a final extension of significant effect on the protein. Two patients, 1 with 7 minutes at 65°C. RNA-less samples were used as controls. Semi- PI and the other with PS and exceptionally mild lung quantitative PCR conditions, which reflect the initial relative 18,19 amounts of the normal and aberrantly spliced transcripts, were disease, were previously reported. Thus, for fur- established by serial dilutions (1:3) of the cDNA products before ther determination of the correlation between the the nondifferential PCR. Only RT-PCR products in the linear G85E mutation and disease phenotype a larger co- phase were analyzed. hort of patients was required. We undertook this study to analyze the genotype-phenotype correlation Hybridization to RT-PCR Products of this mutation among our CF patient population. 50 mL of each differential RT-PCR reaction were subjected to electrophoresis and were subsequently blotted and hybridized to MATERIALS AND METHODS the exon 3 oligonucleotide G85E-N 59GTTCTATGGAATCTTT 39 that identified the normal sequence, washed at 42°C, and to DNA Sequence Determination and Mutation Analysis G85E-M 59GTTCTATGAAATCTTT 39 that identified the G85E DNA sequences spanning individual exons of the CF gene were mutation, washed at 40°C. The intensity of the RT-PCR products amplified by polymerase chain reaction (PCR)20,21 with oligonu- was measured by phosphorimager. cleotide primers located in the respective flanking introns of the CF gene.22 The amplified genomic DNA fragments eluted from 5% Assessment of Disease Severity polyacrylamide gels were extracted with phenol/chloroform and The clinical phenotype was assessed by the following parame- were subjected to the dideoxy-chain termination sequencing 23 ters: age at diagnosis and at assessment, sex, mode of presentation, method essentially as described, using the US Biochemicals Se- history of meconium ileus, diagnostic sweat chloride levels, most quenase (Indianapolis, IN) kit with either one of the PCR primers recent sputum cultures, and pancreatic function as determined by or internal oligonucleotides as sequencing primers. After the iden- a 3-day fecal fat collection. Patients in whom fecal fat loss ex- tification of a specific mutation in an individual, the entire studied ceeded 7% of dietary intake were considered to have PI. The CF population was detected for this mutation using previously 24 patients who died before the study did not have stool fat analysis described methods. but presented with severe malabsorption responding to enzyme supplementation. Pulmonary function was assessed in all CF pa- Detection of the Polypyrimidine Tract Length Variants tients .6 years of age. Forced expiratory volume in 1 second at the Acceptor/Branch Site of Exon 9 (FEV1) was measured and expressed as a percentage of predicted The genomic region flanking the polythymidine tract was am- values for height and sex, using previously described standard- ized pulmonary equations.27 Current height and weight percen- plified by PCR using the primers 9i-5 and 9i-3 using previously 28 described methodology.25 Nested PCR was subsequently per- tiles were computed using the tables of Tanner. Data was col- formed with primers TT-i5 (59GTGTGTGTGTGTGTGTTTTT 39) lected throughout 10 years and the most recent values were and TT-i3 (59 CTGTCCTCTTTTCTATCTTG 39). The PCR condi- considered. tions were: 94°C 69 followed by 35 cycles of 94°C 30“, 54°C 30”, To assess the severity of disease presentation of the patients 74°C 40“, and 74°C 69.

Load more

  8

Copy Link