Novel TRAF6-Protein Interactions and the Molecular Mechanisms by Which They Regulate TRAF6 Epd Endent Signaling An-Jey Andrew Su

Duquesne University Duquesne Scholarship Collection

Electronic Theses and Dissertations

Summer 1-1-2016 Novel TRAF6-Protein Interactions and the Molecular Mechanisms by Which They Regulate TRAF6 epD endent Signaling An-Jey Andrew Su

Follow this and additional works at: https://dsc.duq.edu/etd

Recommended Citation Su, A. (2016). Novel TRAF6-Protein Interactions and the Molecular Mechanisms by Which They Regulate TRAF6 Dependent Signaling (Doctoral dissertation, Duquesne University). Retrieved from https://dsc.duq.edu/etd/107

This One-year Embargo is brought to you for free and open access by Duquesne Scholarship Collection. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Duquesne Scholarship Collection. For more information, please contact [email protected].

NOVEL TRAF6-PROTEIN INTERACTIONS AND THE MOLECULAR

MECHANISMS BY WHICH THEY REGULATE TRAF6 DEPENDENT SIGNALING

A Dissertation

Submitted to the Bayer School of Natural and Environmental Sciences

Duquesne University

In partial fulfillment of the requirements for

the degree of Doctor of Philosophy

An-Jey Andrew Su

August 2016

An-Jey Andrew Su

2016

NOVEL TRAF6-PROTEIN INTERACTIONS AND THE MOLECULAR

MECHANISMS BY WHICH THEY REGULATE TRAF6 DEPENDENT SIGNALING

An-Jey Andrew Su

Approved March 11, 2016

______Philip E. Auron, Ph.D. Kyle W. Selcer, Ph.D. Professor of Biological Sciences Associate Professor of Biological (Committee Chair) Sciences (Committee Member)

______Michael I. Seaman, Ph.D. Charles J. Sfeir, DDS, Ph.D. Associate Professor of Biological Associate Professor of Oral Biology Sciences University of Pittsburgh (Committee Member) (External Committee Member)

______Deborah L. Galson, Ph.D. Associate Professor of Medicine University of Pittsburgh (External Committee Member)

______Philip P. Reeder, Ph.D. Joseph R. McCormick, Ph.D. Dean, Bayer School of Natural and Associate Professor & Chair, Department Environmental Sciences of Biological Sciences

iii

ABSTRACT

NOVEL TRAF6-PROTEIN INTERACTIONS AND THE MOLECULAR

MECHANISMS BY WHICH THEY REGULATE TRAF6 DEPENDENT SIGNALING

An-Jey Andrew Su

August 2016

Dissertation supervised by Philip E. Auron, Ph.D.

TRAF6 is an E3 ubiquitin ligase that is unique among TRAF family proteins in both its structure and protein-protein interaction specificity. It is further distinguished by its ability to transduce a multiplicity of receptors in varied biological systems. Although

TRAF6 activity is induced by these receptors, the mechanisms by which TRAF6 is activated under these stimulating conditions remain largely unclear. To address this, standard molecular biological techniques were used to gain insight into the interplay of three proteins with TRAF6: 1) Syntenin-1 (Syn); 2) SRY (sex determining region Y)-box

4 (Sox4); and 3) IL-1 receptor associated kinase 1 (IRAK1). These three proteins physically interact with TRAF6 and affect its signaling activity by modulating subcellular localization, conformation or activation of the NF-κB/Rel family of transcription factors under stimulating conditions in cell lines of various tissue types. While many previous

studies focused on cytoplasmic TRAF6 and its activation, there are a several reports on the nuclear localization of TRAF6 as well as TRAF3 and TRAF4 in response to either extracellular stimulation or disease. Ectopic Syn or Sox4 was found to not only attenuate

TRAF6 signaling, translocates it into the nucleus of hematopoietic and monocytic cells.

Syn attenuates TRAF6 activity in an ubiquitin and Sox4 dependent manner. This, and the observation that Syn is impaired in its ability to attenuate a non-ubiquitinated TRAF6 mutein (TRAF6ΔK), led to a hypothesis that Syn associates with TRAF6 in the cytoplasm following activation by IRAK1. Notably, knockdown of Sox4 was found to potentiate TRAF6 activation and abrogates Syn inhibition of TRAF6. Contrary to prior reports, use of domain deletions in both TRAF6 and Syn demonstrate that the full-length molecules are not necessary for their interaction. Instead, mutagenesis or deletion of a newly identified TRAF Interaction motif (TIM) in Syn affects TRAF6 signaling and localization. Interestingly, Syn also localizes to the nucleus when overexpressed with either wild type (WT) or a constitutively active TRAF6 (RZcc). This study demonstrates that Sox4 also attenuates TRAF6 signaling and identifies a unique Sox4 TIM that is necessary for binding TRAF6. TRAF6 and Sox4 colocalize under stimulatory conditions, thus providing a novel mechanism for TRAF6 entry into the nucleus. In sum,

TIR and TNF receptor signaling through TRAF6 dependent NF-κB activity is modulated by novel interactions with the Sox4 transcription factor in cooperation with Syn The pair act on TRAF6 nucleocytoplasmic partitioning, conformation and modification state, modulating TRAF6c-dependent ell morphogenesis and intracellular signaling.

DEDICATION

It is not the mountain we conquer, but ourselves. Sir Edmund Hilary1

This work is dedicated in loving memory to my father, Cheng-Hong Su

(November 22, 1939 – December 17, 2014). In the autumn of 2014, 爸爸 devoted his final effort in life towards ensuring the completion of my doctoral studies. This act affirmed his approval and love for me, for which I needed arguably more than anyone else. I will miss the vibrant, dynamic man who taught and demonstrated a commitment toward undertaking tasks independently. My father never considered any task beyond self-undertaking. Success was dependent on two axioms: “you’ve got to think” and

“you’ve got to use the right tool for the right job”. I will forever take inspiration from

爸爸’s unabashed desire to learn new things and seek new challenges. Ab imo pectore.

1 As quoted in That's Life: Wild Wit & Wisdom (2003) by Bonnie Louise Kocher, p. 20

ACKNOWLEDGEMENT

L'essentiel est invisible pour les yeux. Antoine de Saint Exupéry (1943)

Anyone who has accomplished anything worthwhile has a long list of assisting personalities that were instrumental in the achievement. First, I would like to acknowledge my advisor, Professor Philp E. Auron, who always believed in me and taught me how to think critically as a scientist, especially with regard to my own work and how it fits and expands our understanding of nature. Even when I lost 90% of my visual field midway through my graduate research (2011), Dr. Auron continued to support me directly and by example through his passionate dedication to the work despite any adversity. There have been many other teachers (too many to list) at all levels of my education that encouraged my desire to understand our invisible world and the complex mechanisms by which stimuli are transduced into response. I would also like to thank my parents, particularly my mother, Professor Wei-Fang Su, as a role model, and for her efforts put toward cultivating my pursuit of excellence in all my undertakings. Finally, I would like to thank my wife, Deena and children, Brandon and Benjamin for their unconditional love, support and patience. An unexpected lesson I’ve learned from my graduate studies and journey to becoming an independent scientist and scholar is the introspective realization that people are finite; that, you cannot do things alone and the realization that the best things often arise when you recognize and seek help and advice from others in cooperative effort.

vii

ATTRIBUTIONS

Experiments on the effect of Src family kinase inhibition by PP2 on Syn attenuation of

TRAF6 signaling to NF-κB were executed by Sherlock Liu (Figure 4.29).

Experiments confirming that a TRAF6C70A-YFP mutein created in our lab is deficient in poly-ubiquitination were executed by K.ZQ. Wang. (Figure 4.34)

Experiments finding that TLR4 dominant positive is inhibited by Syn & Sox4 were executed by Bhushan Kode (Figure 4.37).

Experiments regarding the mRNA expression of TRAF6, Syn & Sox4 in various cell types were executed by Sree Puligulia (Figure 4.44).

viii

TABLE OF CONTENTS

Page

ABSTRACT ...... iv

DEDICATION ...... vi

ACKNOWLEDGEMENT ...... vii

ATTRIBUTIONS ...... viii

LIST OF TABLES ...... xiv

LIST OF FIGURES ...... xv

LIST OF ABBREVIATIONS ...... xxi

CHAPTER 1 Introduction ...... 1

1.1 Cell Signaling, Signal Integration And Signal Transduction ...... 1

1.2 Biophysiological systems share recurrent organization and components ...... 2

1.3 Conserved Organizational Principles And Components Among Various Biological

Synapses ...... 4

1.4 TRAF6 is Unique Among TRAF Family Proteins ...... 7

1.5 TRAF6: Molecular Domain Structure And Function ...... 14

1.6 IRAK1 Initiates TRAF6 Ubiquitination Of Downstream Targets ...... 21

1.7 Shared Signaling Mechanisms and Components Utilized in Osteoimmunology ...... 24

1.8 TLR4, IL-1R and TNF-R signaling to NF-κB: variations on a common theme ...... 27

1.9 TRAF6 transduces both Canonical and Non-canonical Signaling to NF-κB ...... 28

1.10 Mechanisms of NF-κB Regulation by phosphorylation of I-κB ...... 30

Page

1.11 Dual targeting of proteins is a means for controlling cell signaling and

transcription ...... 31

1.12 Sox4 Molecular Domain Structure and Function transcription ...... 35

1.13 Sox4 localization depends on Syntenin ...... 38

1.14 Syntenin is a dual PDZ domain containing scaffolding protein ...... 40

CHAPTER 2 Hypothesis and Specific Aims ...... 46

2.1 Overall Goal ...... 47

2.2 Hypothesis ...... 48

2.3 Specific Aims ...... 48

CHAPTER 3 Materials And Methods ...... 49

3.1 Cell Culture ...... 49

3.2 Transfections ...... 51

3.3 Luciferase bulk-cell assay for NF-κB activity ...... 52

3.4 Reporters and Expression Plasmids ...... 53

3.5 Statistical Analysis ...... 59

3.6 Immunoprecipitation and Western Blotting ...... 59

3.7 Reagents and Antibodies ...... 61

3.8 Immunoflourescent staining ...... 62

3.9 ELM Analysis ...... 62

Page

3.10 Neuronal Differentiation and quantitative morphology ...... 65

3.11 RNA Expression analyses ...... 66

CHAPTER 4 Results ...... 68

4.1 IRAK1 modulation of TRAF6 auto-regulation and localization ...... 68

4.1.1 Rationale ...... 68

4.1.2 Subcellular Distribution of IRAK1 co-expressed with “open” and

“closed” TRAF6 ...... 71

4.1.3 TRAF6 RZ and MATH domain interact via the MATH TIM ...... 80

4.2 Super-stimulatory effects of ligands demonstrate bimodal inhibition of TRAF6 ..... 86

4.3 Molecular Dynamics of TRAF6-Syntenin Interaction ...... 97

4.3.1 Syntenin inhibition of NF-κB activators ...... 97

4.3.2 Molecular Domains involved Syntenin-TRAF6 interactions ...... 103

4.3.3 Syntenin inhibits TRAF6 in an Ubiquitin-dependent manner ...... 106

4.3.4 Inhibition of Src Family Kinase increases Syn attenuation of TRAF6 induced

NF-κB activity ...... 108

4.3.5 Syntenin can relocalize TRAF6 to the nucleus ...... 113

4.3.6 Domains of Syntenin involved in relocalizing TRAF6 to Nucleus ...... 116

4.4 Characterization of Sox4-TRAF6 Interaction ...... 122

4.4.1 Sox4 is a novel T6IM bearing protein that inhibits TRAF6 ...... 122

Page

4.4.2 Quantification of relative Sox4, TRAF6 and Syn mRNA levels in various

cell types ...... 130

4.5 Syntenin and TRAF6 involvement in Neurite Formation ...... 135

4.6 The Osteological Synapse ...... 144

4.6.1 Rationale ...... 144

4.6.2 BTK but not Tec Kinase is recruited to the plasma membrane upon RANKL

stimulation ...... 146

4.6.3 BTK is a component of Osteoclast Transcytotic Machinery and FSD ...... 146

CHAPTER 5 Discussion ...... 150

5.1 Summary ...... 150

5.2 Activity of keystone molecules like TRAF6 involves multiple regulatory

mechanisms ...... 152

5.3 IRAK1 disrupts TRAF6 autoinhibition ...... 154

5.4 IRAK1 and TRAF6 sequestosomes ...... 157

5.5 TRAF6 MATH domain recruits inhibitory molecules via its TIM groove ...... 157

5.6 Molecular Dynamics of Syntenin TRAF6 Interaction ...... 161

5.7 Syntenin associates with TRAF6 in an Ubiquitin-dependent manner ...... 165

5.8 Syntenin and Sox4 interact with TRAF6 cooperatively Protein interactions with

TRAF6 ...... 167

xii

Page

5.9 TRAF6 Interaction Motif Directs Subcellular localization ...... 170

5.10 Syntenin and TRAF6 involvement in Neurite Formation ...... 174

5.11 Tec Kinases Osteosynapse and Transcytotic Machinery ...... 176

5.12 Conclusions ...... 180

PERMISSIONS ...... 183

REFERENCES ...... 184

xiii

LIST OF TABLES

Page

Table 1. TRAF Family Member Functions and Primary Subcellular Localization...... 9

Table 2. Examples of Receptors and Intracellular Binding Partners that Bind to TRAF

Domain Proteins...... 20

Table 3. Cell Density Seeding Formula for Various Tissue Culture Plates...... 52

Table 4. Expression and Reporter Plasmids Used in this Study...... 56

Table 5. Molecular Weights of TRAF6 and Syntenin Muteins...... 64

Table 6. mRNA Analysis and qPCR Primer Sequences...... 67

Table 7. Summary of TRAF6 Dominant Positive Activity in Various Cell Lines...... 93

Table 8. Summary of SynDomains Effects upon TRAF6 Activity and localization. ....117

Table 9. Diseases Associated with TRAF6 Gene...... 153

xiv

LIST OF FIGURES

Page

Figure 1.1 Comparative Schematics of Immunological and Neural Synapses...... 5

Figure 1.2 Structural Organization of The Known TRAF Family Proteins...... 8

Figure 1.3 Canonical and Noncanonical Activation of NF-κB By RANK Receptor ...... 11

Figure 1.4 Exon-Intron Structure of Human TRAF Genes...... 13

Figure 1.5 TRAF Structural Models and Sequence Analysis For MATH Domain-Protein

Interactions...... 18

Figure 1.6 The Unique TRAF6 Interaction Motif (T6IM) Allows Receptor Interaction

Specificities For Signaling To C-Src And Subsequent PI3K Activation...... 19

Figure 1.7 Structural Domain Architecture and Associated Functions of IRAK1...... 22

Figure 1.8 TIR and TNFR signaling pathways converge during the activation of IKKs. 26

Figure 1.9 Mechanisms for Dual Targeting of a Single Translation Product...... 34

Figure 1.10 Comparison Of Murine And Human Domain Structure Of The SoxC

GroupFamily of Proteins...... 36

Figure 1.11 Sox4 Protein Domain Organization and Amino Acid Sequence...... 39

Figure 1.12 Molecular Domains and Interaction Motifs of Syntenin...... 42

Figure 1.13 Structural Basis for select Syntenin protein-protein Interactions...... 45

Figure 3.1 Schematic of PGL2- IL-1β-XN Luciferase Reporter design and map...... 55

Figure 3.2 Schematic Maps of the TRAF6 constructs Used in This Study...... 57

Figure 3.3 Schematic Maps of the Syn Constructs Used in This Study...... 58

Page

Figure 4.1 Model for TRAF6 Activation and Inhibition by Intra and Extra Molecular

Interactions...... 69

Figure 4.2 Signaling Map of TRAF6 mediated LPS and IL-1 Signaling to nucleus...... 70

Figure 4.3 IRAK1 reduces the number of large TRAF6 sequestosomes...... 72

Figure 4.4 SQSTM1/p62 and TRAF6 colocalize in cytoplasmic sequestosomes...... 73

Figure 4.5 Eukaryotic Linear Motif (ELM Analysis) for Protein Interaction Sites of

Human p62/SQSTM1 (UniProt q13501)...... 74

Figure 4.6 IRAK1 Opens TRAF6, Inducing Localization to Large Sequestosomes...... 76

Figure 4.7 IRAK1 Synergizes with TRAF6 Dominant Positive while Coexpression of

a RZ mutein with TRAF6 inhibits NF-κB activity...... 78

Figure 4.8 IRAK1 and MATH Domains Colocalize...... 79

Figure 4.9 Model of IRAK1 Disruption of TRAF6 RING-MATH Interaction as Revealed

by Immunoprecipitation...... 80

Figure 4.10 IRAK1 Disrupts RZ-MATH Interaction...... 81

Figure 4.11 ELM Analysis Shows TRAF6 Primary Amino Acid Sequence Contains a

TRAF6 Interaction Motif Sequence in Its RING Domain...... 84

Figure 4.12 Molecular Modeling of TRAF6 RING Structure with aa63-69 Putative TIM

Sequence Annotated...... 85

Figure 4.13 Ectopic Expression of TRAF6, IRAK1, or MyD88 is capable of

Activating NF-κB...... 86

Figure 4.14 Ectopic TRAF6 and RZcc Act as Dominant Positives for NF-κB Activity. 88

xvi

Page

Figure 4.15 Co-stimulation of 293R cells expressing TRAF6 and RZcc with IL-1β and

“Super-stimulates” NF-κB Activity...... 89

Figure 4.16 TRAF6 Does Not Act as a Dominant Positive for NF-κB Activity in

Pre-osteoclast Cells 4B12 and RAW264.7...... 90

Figure 4.17 LPS induces IL-1β Activity in Pre-osteoclast cell line RAW264.7...... 92

Figure 4.18 Transfecting either Murine or Human TRAF6 into RAW264.7 cells Does Not

Induce NF-κB Activity...... 94

Figure 4.19 RZcc Acts as a Dominant Positive in RAW264.7 and 4B12 Cells...... 95

Figure 4.20 Syn Inhibits NF-κB Activity Induced by Dominant Positive Ectopic

Expression of TLR4 in 293T Cells...... 98

Figure 4.21 Syntenin Inhibits IL-1β Activation of NF-κB Activity in 293R Cells...... 99

Figure 4.22 Syn inhibits LPS, IL-1β or RANKL Stimulated RAW264.7 Cells But Not

NF-κB Activity Induce by Dominant Positive RZcc...... 100

Figure 4.23 Syntenin Attenuates NF-κB Activity Induced By Ectopic Expression of

MyD88 and IRAK1 Which Signal Upstream of TRAF6...... 101

Figure 4.24 Syntenin Attenuates NF-κB Activity Induced By Ectopic Expression of

TRAF6...... 102

Figure 4.25 Syn Attenuates NF-κB Activity Induced By Ectopic Rzcc in 293 Cells. .. 104

Figure 4.26 CTD And NTD Of Syntenin Can Attenuate TRAF6 Induced NF-κB Signal 105

Figure 4.27 Co-Immunopreciptation Demonstrates that Only Full Length Syn Binds

TRAF6...... 107

xvii

Page

Figure 4.28 Syntenin Inhibits TRAF6ΔK Less Than TRAF6...... 109

Figure 4.29 Pharmacological Inhibition of Src Family Kinases Increases the

Attenuation of TRAF6 Induced NF-κB Activity By Ectopic Syntenin. .... 111

Figure 4.30 Expression of ectopic Syntenin translocates TRAF6 into the nucleus...... 114

Figure 4.31 Subcellular localization of endogenous TRAF6and Syn in RANKL

Stimulated RAW264.7 Cells...... 115

Figure 4.32 Syntenin Is Enriched In The Nucleus Of 293 Cells Activated By Ectopic

TRAF6 or RZcc...... 116

Figure 4.33 Intranuclear Translocation of TRAF6 Depends on NTD and PDZ2 and CTD

Domains of Syn...... 118

Figure 4.34 Western Blot. TRAF6C70A is Deficient in Poly-Ubiquitination...... 119

Figure 4.35 Intranuclear Translocation of Syntenin and TRAF6 Depends on an Active

Ubiquitylated, TRAF6 and the NTD of Syntenin...... 120

Figure 4.36 Sox4 T6IM: Schematic of Sox4 Domains And Important Binding Motifs. 123

Figure 4.37 Sox4 Inhibits TIR Receptor Dependent NF-κB Activation...... 125

Figure 4.38 Sox4 Inhibits NF-κB Activation Induced By Dominant Positive Ectopic

Expression of MyD88...... 126

Figure 4.39 Sox4 Inhibition Of TRAF6 Activated NF-κB Activity Depends on the

MATH Domain and Ubiquitinated TRAF6...... 127

Figure 4.40 Endogenous Sox4 and TRAF6 Co-Localize In Cytoplasm Of Stimulated

4B12 cells upon RANKL stimulation...... 128

xviii

Page

Figure 4.41 Co-IP Shows Sox4 Interaction with TRAF6 Depends on the

MATH Domain...... 129

Figure 4.42 Syntenin Disrupts IRAK1 and TRAF6 Colocalization in 4B12 Cells...... 132

Figure 4.43 Luciferase Assay: Syntenin Inhibition of TRAF6 is Dependent on Sox4

Interaction With TRAF6...... 133

Figure 4.44 Kinetic Profile Of Mrna Expression of TRAF6, Syn and Sox4 in 293 vs.

LPS Stimulated THP-1 or RAW264.7 cells...... 134

Figure 4.45 Visualization of Ectopic TRAF6 or NGF-Induced Neurite Extensions In

PC12 Cells...... 136

Figure 4.46 Ectopic Expression of TRAF6 Acts as a Surrogate for NGF Induced

Neurite Formation in PC12 Cells...... 139

Figure 4.47 Ectopic Expression of TRAF6 Can Act As A Surrogate For NGF Induced

Neurite Formation in 293 Cells...... 140

Figure 4.48 Ectopic expression of TRAF6 is Sufficient to Induce Neurite Formation, But

Inhibits Neurite Formation When Coexpressed with Syn...... 141

Figure 4.49 Ectopic Expression Of TRAF6 Or Syntenin in 293 Cells Induces a Neuronal

Differentiation State...... 142

Figure 4.50 PH-AKT-GFP Localizes to Membrane Extensions Induced by Ectopic

Expression of TRAF6 or Syntenin or NGF Stimulation in 293 Cells...... 143

xix

Page

Figure 4.51 Cartoon of Extracellular and Intracellular Signaling Molecules Involved in

Osteoclastogenesis that Might Comprise the Osteosynapse...... 145

Figure 4.52 BTK is recruited to Plasma Membrane but not Tec or GFP upon RANKL

Simulation...... 147

Figure 4.53 PH-BTK-GFP Localizes to Functional Secretory Domain-Like Structures. 148

Figure 4.54 Visualizations of BTK-GFP Expression And Localization In Osteoclasts

Generated By 44-68h Rankl Stimulation Of Raw 246.7 Cells...... 149

Figure 5.1 Schematic cartoon summary of TRAF6-Syntenin-Sox4 interactions...... 151

Figure 5.2 Model of TRAF6 RZ-MATH interacting to form closed TRAF6 via a

Syn-Sox4 Bridge...... 155

LIST OF ABBREVIATIONS

Akt Protein Kinase B (PKB)

ALIX ALG-2-interacting protein X

AP-1 Activator protein-1

APCs Antigen-presenting cells

BPs Bisphosphonates

C/EBPβ CCAAT/enhancer binding protein beta

CNS Central nervous system

CTD Carboxy Terminal Domain

CYLD Cylindromatosis

DAMP Danger-associated molecular patterns

EIF4A Eukaryotic translation initiation factor 4A

EGF Endothelial growth factor

FAK Focal Adhesion Kinase

FDS farnesyl diphosphate synthase

FSD functional secretory domain

GFP Green fluorescent protein

HIF-1α Hypoxia-inducible factor 1α

IGFBP-2 Insulin growth factor-binding protein-2

IKKγ IκB kinase γ

IL-1 Interleukin-1

IL-1 Interleukin-1 beta

IL1RI IL-1 type I receptor

xxi

IL1RAcp IL1R interacting accessory protein

IP3 Inositol triphosphate

IP buffer Cell lysis buffer for immuno-precipitation

IRAK1 IL-1 receptor associated kinase 1

IL5R Interleukin-5 Receptor

IRF Interferon regulatory factor

LPS Lipopolysacharide

LT-βR Receptor for lymphotoxin-β

MAPK Mitogen-activated protein kinase

MHC Class I major histocompatibility complex

MATH Meprin and TRAF-C homology domain mROS Mitochondrial reactive oxygen species

NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells

NIK NF-κB inducing kinase

NGF Nerve growth factor

NK cells Natural killer cells

NLS Nuclear Localization Signal

NMR Nuclear magnetic resonance

NOD Nucleotide-binding oligomerization domain receptors

NSCLC Non-small cell lung cancer

NTD Amino Terminal Domain

xxii

OPG Osteoprotegerin

OS Osteological synapse

PAMPs Pathogen associated molecular patterns

PH-Akt-GFP GFP conjugated Plekstrin homology domain of Akt

PI3K Phosphoinositol 3-kinase

PI(4,5)P2P Phosphatidylinositol 4, 5-bisphosphate

PI(3,4,5)P3 Phosphatidylinositol 3, 4, 5-trisphosphate

PKB/Akt Protein kinase B

PKC Protein kinase C theta

PLC γ1 Phospholipase C γ1

PRRs Pattern recognition receptors

RANK Receptor activator for NF-κB

RANKL Receptor activator for NF-κB ligand

Rel Relish: The founding member/name of the NF-κB factor family

RING Really interesting gene domain

RIP Receptor-interacting protein 1

RIP2 Receptor-interacting protein 2 rPTP Receptor type protein tyrosine phosphatase

RZ TRAF6 RING Zinc Finger Domain

SMAC Supramolecular activation cluster

Sox4 SRY (sex determining region Y)-box 4

xxiii

SUMO-1 Small ubiquitin-related modifier-1

Syn Syntenin 1

T6IM TRAF6 Interaction Motif

T6DP TRAF6 Decoy Peptide

TAK1 Transforming growth factor beta (TGFβ) activated kinase 1

TAB1 TAK1 binding protein 1

TAB2 TAK1 binding protein 2

TD TRAF domain

TGβRI Transforming growth factor beta (TGFβ) receptor type I

TGFβ Transforming growth factor beta

TIM TRAF Interaction Motif

TIR Toll-interleukin IL-1/18 receptor

TLR Toll like receptor

TNFα Tumor necrosis factor alpha

TNFR Tumor necrosis factor receptor

TRAF6 Tumor necrosis factor receptor associated factor 6

TRAP Tartrate resistant acidic phosphatase

VEGF-A Vascular Endothelial Growth Factor A

WCL Whole cell lysates

WT Wild type

ZAP70 Zeta-chain (of T cell receptor associated kinase)-associated protein

xxiv

Chapter 1

INTRODUCTION

1.1 Cell signaling, Signal Integration and Signal Transduction

The ability for biological systems to respond in an appropriate manner to various stimuli is critical for the maintenance of normal organismal physiology. Multicellular organisms must deal with both external and internal signal inputs that may be mechanical, electrical and/or chemical. Such systems typically display receptors on the cell surface to receive these multimodal inputs and then initiate specific responses.

Additionally, cells must do this with a limited number of gene products at their disposal for use in their signaling networks. Complexity and emergent properties in biology have evolved to deal with variable inputs that stimulate multiple pathways using multiple outputs that are integrated network responses to the inputs. This behavior is conducted with a backdrop of interactions between multiple cell types and multiple contexts and environments for each cell type or combination of cell types (Butcher, Berg et al. 2004).

While characterization of specific signaling pathways and their associated end responses have received intensive research, less studied is the integration of multiple receptor signal inputs that are differentially recognized by the network to trigger a specific cellular response (Gutierrez, O'Keeffe et al. 2008). The result is reflected in the literature as incongruent reports often reflecting either contradictory or divergent signaling functions for single molecules.

Extracellular signals need to be interpreted, integrated and amplified. This process elicits cellular responses such as proliferation, differentiation, secretion,

contraction, metabolism and membrane excitation. Receptors act as catalysts and amplifiers for this process. In a signaling cascade, intracellular adapter proteins are used to effect downstream signal convergence and the final determination of cellular response.

Two general regulatory mechanisms become apparent when considering the control of cellular signal transduction: 1) protein-protein interactions and 2) spatio-temporal control of signaling machinery. Specificity of multifunctional signaling machinery is achieved through protein–protein interactions involving specific structural domains or binding motifs and adapter/scaffold proteins. Additionally, the subcellular spatial and temporal expression of each molecular component is clearly important in the context of signal transduction (Meier and Somers 2011). Spatiotemporal control provides a regulatory mechanism for controlling the players involved in protein-protein interactions. An example of this bi-modal control of intracellular signaling can be seen with inducible transcription factors that mediate rapid, but transient changes in gene expression in response to cellular demand. In this study, signal convergence for multimodal receptor activation of members of the Rel/NF-κB transcription factor family, through the signaling adapter TRAF6 (Tumor necrosis factor receptor associated factor 6) is examined.

TRAF6 is a very busy molecule, mediating signaling for many receptor systems critical for normal cellular and organismal physiology. As such, the regulation and activation of

TRAF6 must be exquisitely regulated. Specifically, I am interested in how TRAF6 signaling is modulated by both protein-protein interactions and subcellular localization.

1.2 Biophysiological systems share recurrent organization and components

An allegory to the pitfalls modern molecular biologist must avoid is found in

Saxe’s six blind men of Indostan and their elephant, who were “each in isolation

potentially correct, but all were ultimately wrong!” Armed with a reductionist strategy, investigators studying their favorite protein(s) in the alphabet soup of intracellular signal transduction networks can lose perspective of the integrative nature of biological systems.

The central nervous system (CNS) along with the immune and endocrine systems together form a regulatory network in higher animals and man termed the Neuroimmune

Super System (NISS) (Berczi, Quintanar-Stephano et al. 2009). The healthy brain and spinal cord are under continual immune surveillance to guard against potential mediators of infection and damage. Uncontrolled response in the brain can be particularly deleterious, as in the case of meningitis. Loss of immunity is just as bad, often resulting in cerebral infections. While it is established that cells from the immune system interact with the CNS within the meningeal compartment of the central nervous system (CNS)

(Ousman and Kubes 2012, Ransohoff and Engelhardt 2012), it was believed that the CNS lacked a classic lymphatic drainage system. Most recently, it has been discovered that T- cells gain entry into the CNS via functional lymphatic vessels that line the dural sinuses of mice (Louveau, Smirnov et al. 2015). The vessels express all of the molecular hallmarks of lymphatic endothelial cells, are able to carry both fluid and immune cells from the cerebrospinal fluid, and are connected to the deep cervical lymph nodes. While this finding is very exciting, many previously held assumptions of NISS processes would now need reconsideration. One such topic might be the comparative similarities between the synaptic structures found in the immune system and those between neurons (Dustin and Colman 2002). Such similarities harken to the of conserved organizational principles across biological systems.

1.3 Conserved Organizational Principles and Components Among Various Biological

Synapses

A synapse is a stable adhesive junction between two cells across which information is relayed by direct secretion. Synapses are used by both the nervous system and immune system to directly convey and transduce highly controlled secretory signals between cell populations. Each of these synapse types is built around a microdomain structure composed of central active domains of exocytosis and endocytosis that are encircled by outer adhesion domains (Figure 1.1). Surface molecules that are incorporated into and around the active domains may modulate the functional state of the synapse (Dustin and Colman 2002). In 2002, Dustin and Coleman proposed four criteria for defining synaptic junctions: (1) cells remain individual; (2) the apposed membranes are held together by adhesion molecules; (3) the junction is stable either through adhesion clamp or cytoskeleton polarity; and (4) directed secretion in response to signals from microdomains. Analysis of the origins of the IS pattern formation over the past 15 years has seen an emergent modularity to synapse design that has provided solutions to lymphocyte biology and phagocytic processes (Dustin and Colman 2002, Dustin 2009,

Goodridge, Reyes et al. 2011). As the components most critical for lymphocyte signaling became known, efforts were made to uncover the subcellular localization of those components, both under resting and stimulated conditions (Paul 2003). Seminal studies by Monks et al. provided images that showed a variety of molecules accumulating at the

Interface between T cells and antigen-presenting cells (APCs). These molecules’ membrane surface, were spatially segregated over time into distinct structures termed

Figure 1.1 Comparative schematics of immunological and neural synapses A) CNS synapse B) Effector immunological synapses with T-Cell as presynaptic and target cell as postsynaptic C) Inductive immunological synapse with DC as presynaptic and T-Helper cell as postsynaptic D) Diagram of IS formation. Green, TCR-MHCp interactions and MHCp in exocytic vesicles; red, LFA-1:ICAM-1 interaction; blue, soluble contents of exocytic vesicles and diffusing contents after release; yellow, CD43 at boundaries; orange, microtubules; cross-hatch, material in synaptic cleft (From Dustin, M. L. and D. R. Colman [2002]. "Neural and immunological synaptic relations." Science 298[5594]: 785-789. Reprinted with permission from AAAS.)

supramolecular activation complexes (SMACs) (Monks, Freiberg et al. 1998, Wetzel,

McKeithan et al. 2002). The immunological synapse (IS) is formed on the plane of adhesion between T cell and APCs where the molecules involved in antigen recognition and adhesive molecules rearrange and cluster into a characteristic ring like pattern of adhesion molecules surrounding a central supramolecular activation cluster (cSMAC)

(Dustin and Shaw 1999, Davis 2002).

The area of cell membrane where the IS forms is populated by lipid microdomains, where various signaling molecules collect to transmit the antigen recognition signal into the cell. This activates the T cell defense programs and the lipid microdomains are utilized in spatiotemporal control of the signaling components. Lipid microdomains have also been demonstrated as an important mechanism for the

RANK/TRAF6/NF-κB signaling axis found in osteoimmunological systems (Ha, Kwak et al. 2003). Metazoan physiological systems are rife with this type of shared mechanistic organization. Given the integrated nature of organismal systems that arise from undifferentiated totipotent cells, it is not surprising that biological systems share mechanistic modalities that include the overlap of critical keystone molecules that are able to bridge the many cell surface receptor signaling systems. TRAF6 is one such keystone molecule. TRAF6 is uniquely poised to bridge a diverse array of physiological processes, including adaptive and innate immunity, bone metabolism and the development of several tissues including lymph nodes, mammary glands, skin and the central nervous system (Wu and Arron 2003).

1.4 TRAF6 is unique among TRAF family proteins

TRAF6 is an intracellular signal transducer that functions as an E3 ubiquitin ligase. TRAF6 belongs to a family of proteins that were initially identified by the capability to interact with and regulate signaling through different members of the TNFR superfamily (Takeuchi, Rothe et al. 1996, Locksley, Killeen et al. 2001). The TNFR superfamily consists of at least 26 members, including: Fas antigen; CD27; CD30; CD40;

TNFR1; and TNFR2, which mediate immune regulation and inflammatory responses. In mammals, six different TRAF proteins (TRAF1-TRAF6) have been described with

TRAF1 clearly distinct from the others with respect to the architecture of the N-Terminal domain (Figure 1.2). Among the members of the TRAF protein family, only TRAF6 has been demonstrated to transduce both TNFR family signaling and that for the unrelated interleukin-1/18 receptor/Toll-like receptor (IL-1R/TLR) superfamily that possess a conserved cytoplasmic TIR (Toll I-1 Receptor (TIR) domain (Table 1). Upon TLR1/2/4, but not TLR3/9, signaling, TRAF6 translocates to mitochondria where it binds to ECSIT to induce mitochondrial reactive oxygen species (mROS) and enhance bacterial killing

(West, Brodsky et al. 2011). TRAF6 also mediates signaling for some growth factor receptors including: transforming growth factor beta (TGFβ), nerve growth factor (NGF), and endothelial growth factor (EGF). TRAF6 signaling activates many transcription factors including: NF-κB, Jun-Fos dimers (Activator protein-1 or AP-1), Interferon regulatory factors (IRFs) and CCAAT/enhancer binding protein beta (C/EBPβ). Such activity stimulates the production of cytokines or the differentiation of cells into several distinct phenotypes (Wu and Arron 2003). TRAF6 has been demonstrated, using knockout mice and RNAi technology, to be critical for CD40 signaling and receptor

activator of nuclear factor κB (RANK) signaling (Lomaga, Yeh et al. 1999, Davies, Mak et al. 2005). RANK is known to mediate both canonical (TAK1/IKKα, β, γ) and non- canonical (NIK/IKKα) NF-κB pathways (Mizukami, Takaesu et al. 2002, Novack, Yin et al. 2003, Xiao, Balasubramanian et al. 2012) (Figure 1.3).

Figure 1.2 Structural Organization of The Known TRAF Family Proteins. Shown is the number of amino acids (right) of murine TRAF proteins* and human TRAF proteins. Boxes represent the relative positions of described protein domains and modules as indicated. TRAF6 features shown reflect positions as reported for human TRAF6. The “module” containing both the TRAF-N (Coiled-coil) and TRAF-C (MATH) domains has historically been referred collectively as the “TRAF” domain, even though it contains two distinct, structurally independent, domains. Similarly, the “RING-Zinc Finger” module contains multiple Zinc Finger domains.

Table 1 TRAF Family Member Functions And Primary Subcellular Localization. Functions and localization was derived from online databases (Gene Cards, UniProt, The Human Protein Atlas), this research study and the literature cited herein.

In the mammalian immune system, when CD40 ligand on T cells engage CD40 on B cells, numerous signals within B cells initiate, including the activation of Mitogen- activated protein kinase (MAPK) and both classical and non-canonical NF-κB (Karin

2008, Hostager and Bishop 2013). The herpes viral oncoprotein, Tio, depends on TRAF6 and Inhibitor of κB kinase (IKKγ or NEMO), and enhances the expression of the noncanonical NF-κB proteins, p100 and RelB (de Jong, Albrecht et al. 2010). Further,

OX40 activated the ubiquitin ligase TRAF6, which triggered induction of the kinase

NIK in CD4+ T cells and the noncanonical transcription factor NF-κB pathway (Xiao,

Balasubramanian et al. 2012). Thus, TRAF6 differentially affects both the canonical and non-canonical NF-κB activation pathways by recruiting both TAK1 and NIK, respectively. However, the mechanistic details of this phenomenon remain incompletely understood or may be confounded by the cell lineage, type or developmental state. As such, greater detail is an important direction for future research.

The current understanding partially derives from research in the field of neurotrophic signaling, suggesting that the underpinnings are dependent upon both direct and indirect protein-protein interactions; namely, TRAF6 interacts with specific domains of variably expressed scaffolding proteins and isoforms of those proteins

(Geetha and Wooten 2002, Wooten, Geetha et al. 2005) and/or polyubiquitination by

TRAF6 of those extramolecular proteins. In Schwann cells, TRAF6 and an adapter protein RIP2 bind directly to the p75NTR receptor in a ligand dependent manner to activate NF-κB. In the neuronal cell line PC12, IRAK1 and atypical PKC (aPKC) complex with TRAF6 and recruit p62/SQSTM1 to promote nerve growth factor

(NGF) activation of NF-κB. The various domains of the protein p62, also known as

Figure 1.3 RANKL Binding To RANK Activates Canonical And Non-Canonical Signaling To The Transcription Factor NF-κB. Signaling from RANKL and other receptors converge on a two different IκB kinase complexes that phosphorylate the NF-κB inhibitory proteins I-κB.

sequestosome 1 (SQSTM1) can bind to RIP, aPKCs, TRAF6 and polyubiquitin chains in order to regulate proteosomal degradation of ubiquitinated proteins (Seibenhener, Babu et al. 2004, Babu, Geetha et al. 2005, Moscat, Diaz-Meco et al. 2007). Moreover, SQTM1 modulates RANK signaling to NF-κB and mutations in SQSTM1 are associated with both sporadic and hereditary Paget's disease of Bone (PDB) in different populations.

PDB is a hereditary disorder characterized by excessive localized bone resorption by osteoclasts (Layfield and Hocking 2004). Recent work in immunobiology has implicated the herpes viral oncoprotein Tio, which promotes growth and transformation of human T cells in a recombinant herpes virus Saimiri background and to potently induce canonical

NF-κB signaling through membrane recruitment of TRAF6. In addition to triggering canonical NF-κB signaling in NEMO/IKKγ-dependent activation of the p52 and RelB isoforms of NF-κB, Tio also induces NEMO/IKKγ-independent generation of active NF-

κB p52 from its inactive p100 precursor (de Jong, Albrecht et al. 2010, de Jong, Albrecht et al. 2013). Taken together the Tio and p62 studies underscore TRAF6’s role as a keystone adaptor molecule utilizing protein-protein interactions with other adaptor molecules to regulate both the canonical and noncanonical NF-κB activation pathways.

Figure 1.4 Exon–intron Structure of Human TRAF Genes. The exon–intron structures of the human genes encoding TRAF2 to TRAF6 according to the NCBI entries NT_025667 (TRAF2), NT_010019 (TRAF3), NT_030828 (TRAF4), NT_021877 (TRAF5) and NT_024229 (TRAF6) were matched with the cDNA sequences encoding TRAF2 to TRAF6 [accession numbers U12597 (TRAF2), U19260 (TRAF3), X80200 (TRAF4), AB000509 (TRAF5) and U78798 (TRAF6) Only exons encoding parts of the cDNA translated into protein were considered in this illustration. Thus, exons numbered in this scheme with as 1 do not necessarily correspond to exon 1 of the respective gene in the database. Exons encoding parts of the TRAF domain were summarized and labeled TD. The number of nucleotides encoded by each exon is indicated in the box representing the respective exon. Gray boxes indicate exons containing multiples of three nucleotides. Modified from (Glauner, Siegmund et al. 2002).

1.5 TRAF6 molecular domain structure and function

TRAF6 is a 61-kDa protein consisting of several distinct modules with specific functions. The architecture of the TRAF family proteins is largely homologous, with the seven mammalian TRAFs hallmarked by distinct amino and carboxyl structures (Figure

1.2) that consists of two distinct modules: an amino Ring-Zinc (RZ) module and a carboxyl TRAF module. TRAF7 The human TRAF6 gene is located at chromosome

11p12. The exon–intron structures of human TRAF genes are diagrammed in (Figure

1.4). Remarkably, analyses of the human TRAF2, 3, 4, 5 and 6 genes revealed that they all share a stretch of three to six consecutive exons with a multiple of three nucleotides encoding the zinc finger domains of these molecules (Figure 1.4). Thus, any combination of these exons results potentially in an in-frame splice-form of the respective TRAF isotype (Glauner, Siegmund et al. 2002). The implication of such similarities in splice forms could account for differential subcellular localization and/or functionality amongst the TRAF family isoforms and isotypes. (For a through review and characterization of evolutionary consequences upon TRAF family genomic structure and functional implications please see (Grech, Quinn et al. 2000)).

Proceeding from the amino termini in TRAF2 through 7, the RZ module contains a RING zinc finger (Really Interesting New Gene) domain, which is common to E3 ligases, followed by four to seven non-RING zinc fingers. The RZ module is followed by the TRAF module, which is separated into TRAF-N and TRAF-C domains. The

TRAF-N is a coiled-coil (cc) domain is comprised of a single alpha helix, which is required for TRAF coiled-coil oligomerization, as implied by correlation with the X-ray crystal structures of TRAF2 and TRAF3. TRAF modules potentially oligomerize as both

homotypic and heterotypic dimers and trimers. The structure of the TRAF module of

TRAF2 reveals a trimer where the coiled-coil (TRAF-N) domain forms a single stalk-like structure and the Ig-like anti-parallel -stranded MATH (Meprin and TRAF homology domain)/TRAF-C domain forms three interacting globulin structures beyond the stalk that terminate the oligomer (Ye, Park et al. 1999, Glauner, Siegmund et al. 2002). The trimeric form of the TRAF2 C-terminal TRAF module is shown in Figure 1.5A. With the exception of TRAF7, the remaining six members of the TRAF family possess a carboxyl- terminal MATH domain that folds into a beta-sandwich structure that contains a groove that specifically interacts with receptors or intracellular proteins bearing a TRAF interaction motif (TIM). For a thorough review of TRAF7 please see (Zotti, Vito et al.

2012). Importantly, TRAF1 through 5 all have similar TIM specificities, whereas

TRAF6 binds distinct TIM sequences. This is reflected in the distinct amino acid composition of the MATH domain groove that binds the TIM (Figure 1.5C). Peptides with the sequence P-X-E-X-X-(acidic or aromatic residue) bind TRAF6 while, a

PXQX(T/S) motif specifies binding to the other TRAFs, such as TRAF2 and TRAF3.

Synthetic transduction TIM peptides (Figure 1.5D) have been shown to inhibit TRAF activity (Poblenz, Jacoby et al. 2007). Interestingly, the reported crystal structures of the

TRAF6 MATH domain (residues 346-504) only contained a monomeric TRAF6 MATH domain (Figure 1.5B) and not a coiled-coil multimerization domain (Ye, Arron et al.

2002). The TRAF6 MATH domain is structurally similar to both the TRAF2 and TRAF3

MATH domains, which both crystallized as trimers (McWhirter, Pullen et al. 1999, Park,

Burkitt et al. 1999), possibly because the crystallized fragments of TRAF2 and TRAF3 included both coiled-coil and MATH domains. Furthermore, it is known that the TRAF6

MATH contains a polyproline loop that is unique to the TRAF6 MATH and facilitates

Src binding (Wong, Besser et al. 1999) and PI3K activity (Wang, Wara-Aswapati et al.

2006) (Figure 1.6). This would support the functionality of the coiled-coil domain in oligomerization of TRAF molecules. Moreover, the divergent peptide-binding groove in the MATH domain of TRAF6, as compared to other TRAFs (Figure 1.5C), confers unique biological functions to TRAF6; it does not interact with peptide motifs that are recognized by TRAF1, -2, -3 or -5 (TIMs). Comparing the peptide bound crystal structures of TRAF6 and TRAF2 reveals that bound TRAF6-binding peptides display a

40o rotation in chain vector from that of the TRAF2-binding peptides. As a result, side- chains of TRAF6-binding peptides interact with surface pockets on TRAF6 that are vastly different from those on TRAF2 (Ye, Arron et al. 2002), as well as other TRAFs.

TRAF Domain proteins are intracellular proteins that can act as adapters, binding either the cytoplasmic tails of receptors, upstream regulators, or downstream effectors

(Table 2). Both CD40 and RANK can recruit TRAF1, 2, 3, 5 and 6 to their cytoplasmic tails. TRAF6 binds to more distinct TIM sites (T6IM) than the other TRAFs. There are two distinct types of TIM: PXEXX(Ar/Ac) motif with the last residue either aromatic or acidic for TRAF6 (Figure 1.5D), and a conserved PXQX(T/S) motif with the last residue either a threonine or serine for TRAFs 1, 2, 3 and 5 (Wu and Arron 2003, Yoshida,

Takaesu et al. 2008). Similar to TRAF6, TRAF4 also bears a non-conserved substitution in the MATH binding site, helping to explain differences in receptor specificity (Ye, Park et al. 1999, Grech, Quinn et al. 2000, Rousseau, Rio et al. 2011). By aligning various crystallized TRAF-receptor complexes it is possible to derive the TIM sequence. The core of four conserved residues of the TIM are labeled P-2 to P3, centered about the zero

position (P0) that is invariably a Glu (Wu and Arron 2003). Although, proteins bearing a

TIM peptide are highly variable in their primary sequences, the conserved motif serves to converge this diverse set upon the MATH domain of TRAF proteins. Regardless, TRAF6 specificity is the most distinct, resulting in greater selectivity for specific TIM interaction.

In summary, there are three ways that TRAF proteins can be recruited to and actuated by ligand-engaged receptors: (1) Members of the TNF receptor superfamily that do not contain intracellular death domains, such as NFR2 and CD40, recruit TRAFs directly by

TIM sequences in their intracellular tails; (2) Those that contain an intracellular death domain, such as TNFR1, utilize the adapter protein TRADD via a death domain-death domain (DD) interaction that results in TRADD assembling a complex of TRAF2 and

RIP for survival signaling that competes with a DD interaction with FADD that activates caspase 8 for the induction of apoptosis; (3) Members of the TIR superfamily, containing a protein interaction module known as the TIR domain, recruit Myeloid differentiation primary response gene 88 (MyD88), a TIR domain and DD containing protein, and various IRAKs. IRAK1 then recruits TRAF6 by their T6IM (Gravallese, Galson et al.

2001).

Figure 1.5 TRAF Structural Models and Sequence Analysis for MATH Domain- Protein Interactions. A) Structural model of TRAF2 coiled-coil (CC) domain/MATH domain trimerization, shown by the symmetrical interaction of trimerized MATH/TRAF-C domains (cyan, blue and green) and yellow for the three coiled-coil domains (from (Ye, Park et al. 1999). B) Accessible solvent surface contour representation of a single TRAF6 and TRAF2 MATH domain in an orientation similar to that shown in A. The superimposed worm representations of receptor peptide backbones are shown in magenta, emphasizing distinct orientations and specific MATH domain contacts (arrows). C) Conservation of exposed contact residues within the MATH domain of TRAF family proteins representing key features of the TIM grooves that interact with TIM peptides (from (Ye, Park et al. 1999). D) The three conserved key amino acids of proteins bearing TRAF6 TIM peptides identified from the structural analysis of peptide interactions with distinct sites on the MATH domain surface.

Figure 1.6 The Unique TRAF6 Interaction Motif (T6IM) Allows Receptor Interaction Specificity for Signaling to C-Src and Subsequent PI3K Activation. Differences in the MATH domain and TRAF6 Interaction Motif (T6IM) between that of TRAF6 and other TRAFs, such as TRAF2 and TRAF5, provide unique receptor interaction specificities for signaling to c-Src and subsequent PI3K activation. Key: Red arrows indicate tyrosine phosphorylation targets; Dotted double-ended arrows indicate protein-protein interactions; and solid single-ended arrow indicates a likely IRAK relocalization form IL-1 receptor at the plasma membrane to cytoplasmic TRAF6. The multiple, promiscuous, TIM targets for TRAF2 and TRAF5 on the cytoplasmic region of RANK, and the unique membrane-proximal binding of TRAF6 to a TIM of distinct specificity, reflects the differences emphasized in the text for TRAF6 vs. other TRAFs.

TRAF Domain Proteins Binding Partners

TRAF 1,2,3,5 CD40

TRAF 1,2 TRADD

TRAF6 IRAK1, Sox4

TRAF2 TNFR1

TRAF6 IL-1, CD40, RANK, TLR4

Table 2 Examples of Receptors and Intracellular binding Partners that bind to TRAF Domain Proteins. TRAF Domain proteins are intracellular proteins that can act as adapters, binding either the cytoplasmic tails of receptors, upstream regulators, or downstream effectors.

1.6 IRAK1 Initiates TRAF6 Ubiquitination Of Downstream Targets

TLR4 is the principal signal-transducing receptor for lipopolysaccharide (LPS), a component of the outer membrane of Gram-negative bacteria, (Poltorak, He et al. 1998,

Chow, Young et al. 1999). Activated TLR/IL1R (TIR) recruit the adapter protein

Myeloid differentiation primary response gene 88 (MyD88) to their cytoplasmic TIR domains, initiating assembly of the Myddosome, a multi-protein complex composed of

MyD88, and the serine/threonine kinases: IL-1R-associated kinases (IRAK), IRAK4,

IRAK1 and IRAK2. This complex initiates the MyD88-dependent signaling pathway that has been implicated in LPS-induced tyrosine phosphorylation (Zeisel, Druet et al.

2005). IRAK2 activates IRAK1 through IRAK4-dependent phosphorylation. IRAK1 phosphorylation by IRAK4 results in a conformational change, dissociating IRAK1 from the TLR4 complex. IRAK1 then either binds to then activates TRAF6 in the cytoplasm,

(Akira and Takeda 2004) or TRAF6 dynamically interacts with receptor-bound IRAK1, resulting in rapid release and transfer to TRAF6 (Jiang, Johnson et al. 2003, Muroi and

Tanamoto 2008). Structurally, IRAK1 consists of an amino terminal domain (NTD) that contains a death domain (DD) that interacts with the DD of MyD88, and a proline-serine- threonine rich region (ProST Domain) followed by a central kinase domain that has been shown to be dispensable for NF-κB activation (Li, Commane et al. 2001) (Figure 1.7).

This might be due to the redundant functions of IRAK2 (Rhyasen and Starczynowski

2015). The carboxyl terminal domain (CTD) of IRAK1 contains three potential TRAF6- binding sites (Glu544, Glu587, Glu706). Mutating these Glu to Ala was found to significantly reduce NF-κB activation (Ye, Arron et al. 2002).

Figure 1.7 Structural Domain Architecture and Associated Functions of IRAK1. Amino Acid numbering is indicated for human IRAK1 and is annotated according to ELM Analysis (http://elm.eu.org/). The ProST Domain is a proline-serine- threonine rich region that is heavily phosphorylated upon IRAK1 activation (Kollewe, Mackensen et al. 2004).

The NTD (death domain and ProST Region) plus the first half of the CTD were demonstrated to be sufficient for IL-1-induced activation of NF-κB (Li, Commane et al.

2001). The ephemeral nature of the IRAK1-TRAF6 interaction might account for the dearth of reports in the literature of TRAF6 being recruited by TIR to the membrane, as is the case with TRAF6 and RANK (Wong, Besser et al. 1999) or TRAF2/3 by CD40

(Hostager, Catlett et al. 2000). In particular, there is an absence of micrographic evidence for this interaction, although biochemical evidence has been reported to support a TRAF6-TIR interaction (Cao, Xiong et al. 1996, Qian, Commane et al. 2001, Jiang,

Mak et al. 2004, Kollewe, Mackensen et al. 2004).

Covalent attachment of ubiquitin to proteins is a reversible, post-translational modification (similar to phosphorylation or acetylation) that distinguishes select proteins

for regulation and signal propagation. Ubiquitylated proteins interact with other proteins bearing ubiquitin-binding modules (Rahighi and Dikic 2012). To act an E3 ubiquitin ligase, TRAF6 forms a complex with the E2 ubiquitin conjugating enzyme Ubc13 and

Ubc-like protein Uev1A. This enables TRAF6 auto-ubiquitination, trans-ubiquitination, activation and downstream ubiquitination of targets such as TAK1 through a non- degradative Lys63-linked polyubiquitination (Wang, Deng et al. 2001, Seibenhener, Babu et al. 2004, Rong, Cheng et al. 2007, Balkhi, Fitzgerald et al. 2008). TRAF6 can also mediate Lys48-linked polyubiquitination, which induces proteosomal degradation of proteins such as RIP1 and IRAK1 (Newton, Matsumoto et al. 2008). Since IRAK1 activates TRAF6, this is a feed-forward mechanism for attenuation of TRAF6 signaling.

Here, TRAF6 binds to Lys48-linked polyubiquitinated proteins like IRAK1 and they translocate together into the proteasome where IRAK1 undergoes proteosomal degradation while TRAF6 is recycled through de-ubiquitination, rather than by degradation. The enzyme, Cylindromatosis (CYLD) is responsible for deubiquitinating

Lys63-linked-TRAF6, -TRAF2 and - NEMO/IKKγ (Jensen and Whitehead 2003,

Kovalenko, Chable-Bessia et al. 2003, Trompouki, Hatzivassiliou et al. 2003, Yoshida,

Jono et al. 2005, Wooten, Geetha et al. 2008). In addition to de-ubiquitinating enzymes

(DUBs), proteins such as A20 act as ubiquitin-editing enzymes; substituting Lys63 linked poly-ubiquitin with Lys48 linked poly-ubiquitin on its target proteins (Sun 2008,

Coornaert, Carpentier et al. 2009).

1.7 Shared signaling systems utilized in Osteoimmunology

In bone remodeling, osteoclasts resorb old and damaged bone, which is then replaced by new bone deposited by osteoblasts. Imbalances in either resorption or deposition of bone leads to a pathological decrease or increase in bone mass, the former often being caused by inflammatory diseases of the immune system. For example, the autoimmune disease rheumatoid arthritis is an abnormal or prolonged activation of the immune system that causes bone loss by excessive osteoclast activity (Guo, Yamashita et al. 2008). The first reports that cells of the immune system could influence the functions of bone cells were made over 40 years ago. Then, in the 1980’s, antigen stimulated immune cells were shown to produce soluble factors that stimulate osteoclast bone resorption, and interleukin 1 (IL-1) was identified as one of these factors (Stashenko,

Dewhirst et al. 1987, Blair, Zheng et al. 2007). Accumulating evidence suggests that bone destruction associated with rheumatoid arthritis is caused by the enhanced activity of osteoclasts, resulting from the activation of the Th17 subset of helper T cells (Miossec

2003). Such work promoted the now decade old research field of osteoimmunology, which investigates the interplay between the skeletal and immune systems at the molecular level (Arron and Choi 2000, Lorenzo, Horowitz et al. 2008). Numerous studies have shown that the two systems share a number of regulatory molecules including cytokines, receptors, signaling molecules and transcription factors. This is particularly true when comparing B cell with osteoclast biology (Takayanagi 2007).

Together, Tumor necrosis factor alpha (TNFα) synergizes with Receptor Activator of

Nuclear Factor Kappa B Ligand (RANKL) for enhanced osteoclast activation and activity

(Jimi, Aoki et al. 2004). TNFα is considered one of the key inflammatory mediators

during bacterial infections. Blood leukocytes, such as monocytes/macrophages, secrete

TNFα as a host defense against bacterial infections (Chen, Pan et al. 2009, Funakoshi-

Tago, Kamada et al. 2009). Trimeric RANKL (a member of the TNF family) in stromal cells is the essential osteoclastogenic ligand. Each RANKL trimer recognizes either a single trimeric RANK (a member of the TNF receptor family) or the trimeric osteoprotegerin (OPG) decoy receptor, which inhibits osteoclastogenesis (Boyle, Simonet et al. 2003, Warren, Nelson et al. 2014). Trimerization of RANK is a good example of a strategy for increasing and concentrating the signaling of an extracellular ligand in order to activate the downstream, intracellular signaling cascades. It is common for a single ligand to engage multiple rather than an individual receptor (Korpelainen, Karkkainen et al. 1999). Multimeric receptor complexes may be homotypic or heterogeneous in subunit composition. Oligomerization of active receptors allows the formation of receptor complexes composed of distinct, but similar subunits, which can have different signaling potentials (Pawson and Nash 2000). Signaling by RANK in response to its ligand,

RANKL, stimulates osteoclast formation and bone resorption. Cells may also utilize receptor modularity of the extracellular (ligand-binding) and intracellular (signaling) regions. This allows a wide variety of signals to use limited regulatory componentry

(Katritch, Cherezov et al. 2012). Additionally, cells may also express different receptors for the same ligand. This ligand may have different effects depending on the effector domain of the receptor. For example, TLR4 and MD-2 form a heterodimer that

recognizes LPS (lipopolysaccharide) from Gram-negative bacteria (Kim, Park et al.

2007). Intracellularly, the receptors: TLR4, IL-1R and TNF-R signal to NF-κB through a common IKK-dependent pathway that allows us to view them as variations on a common theme (Figure 1.8).

Figure 1.8 TIR and TNFR Signaling Pathways Converge During the Activation of IKKs. Phosphorylation activates IKK, resulting in IkBα phosphorylation, ubiquitination and degradation. Signal transduction through TNFR recruits RIPK, when poly-ubiquitinated, binds TAB adaptor proteins, inducing TAK1 activation. Activated IKKβ phosphorylates IkBα, which is modified with Lys48-linked chains. This form of IkBα is subsequently transported to the proteasome, where it is degraded, enabling NF-kB nuclear translocation.

1.8 TLR4, IL-1R and TNF-R signaling to NF-κB: variations on a common theme

In mammals, the TIR family members are important mediators of inflammation, innate and adaptive immune responses. The specificity of distinct TLRs is achieved through alternate and combinatorial adaptor usage (Yin, Lin et al. 2009). MyD88 can recruit IRAK molecules to the plasma membrane. Notably though, TRAF6 has not been visually demonstrated to be stably recruited by TIR to the membrane. Thus, after TIR activation, IRAK is bound to the receptor and either interacts with TRAF6 after release or

TRAF6 interacts in a “kiss and run” fashion with receptor bound IRAK. Toll-like receptors (TLRs), as well as the receptors for tumor necrosis factor (TNF-R) and interleukin-1 (IL-1R), are important for initiating osteoimmunity function by the non- canonical NF-B pathway via developmental signals activating NIK and IKK kinases.

This activation causes proteolytic degradation of the inhibitory IκBδ domain of NF-

Bp100, generating active NF-B-p50, resulting in nuclear translocation of RelA:p50,

RelB:p50 and RelB:p52 dimers, facilitating target gene expression. The canonical pathway is activated through pathogen and inflammatory signals activating NIK and

IKK kinases. This activation results in the degradation of IκBα/IκBβ/IκBε, allowing for the nuclear translocation of RelA:p50, RelA:RelA and cRel:p50 dimers, which then activate a different set of genes from the noncanonical pathway. (Modified from (Shih,

Tsui et al. 2011)). Nevertheless, the principles of signaling are similar, involving the recruitment of specific adaptor proteins and the activation of kinase cascades in which protein-protein interactions are controlled by poly-ubiquitination (Verstrepen, Bekaert et al. 2008). MyD88 and IRAK1 play crucial roles as adaptor molecules in signal

transduction of the TLR/IL-1R superfamily, and it is known that expression of these proteins leads to the activation of NF-κB in a TRAF6 dependent manner.

1.9 TRAF6 transduces both Canonical and Non-canonical Signaling to NF-κB

The transcription factor NF-κB is a member of the widely expressed family of

Rel-related transcription factors that are required for the induction of many genes. In particular, these genes have been associated with the osteoimmunological and neurobiological systems (Kuner, Schubenel et al. 1998, Arron and Choi 2000, Lorenzo,

Horowitz et al. 2008). Furthermore, NF-κB has been demonstrated to critically regulate cancer, adaptive and innate immune response, apoptosis, inflammation, and cellular differentiation (Li and Stark 2002). In mammals, the family has five members: p50, p52,

RelA (p65), c-Rel and RelB. NF-κB consists of a 50-kDa protein (p50) and a 65-kDa protein (p65), as well as larger p100 and p105 heterodimers with smaller Rel family isoforms of NF-κB. Family members can homo and hetero dimerize through a shared

300 amino acid N-terminal DNA binding/dimerization domain, called the Rel homology domain, of which there are two different classes that possess a distinct intra-domain and

DNA binding specificity (Chen, Ghosh et al. 1998, Wang, Huang et al. 2012). Such modularity provides a platform for differential binding to gene expression enhancers, promoters and the control over gene expression. The extensive range of stimuli that activates Rel family members underscores their importance in the integration of stimuli for transcriptional responses. The complete details by which such diverse stimuli converge to activate this family of transcription factors have not yet been totally resolved and remains a highly researched topic of scientific investigation (Mercurio and Manning

1999, Oeckinghaus, Hayden et al. 2011, Sun 2011).

NF-κB is activated through two signaling cascades: the classical (canonical) and non-canonical pathways. Regarding immunological systems, the canonical pathway has historically been associated with inflammatory responses, while the non-canonical pathway is described to mediate immune cell differentiation and maturation and secondary lymphoid organogenesis. Such differential effects arise from differences in the activation signals, regulatory mechanisms and involvement of specific NF-κB subunits.

The non-canonical pathway predominantly targets activation of the p100/RelB complex via p100 processing to p52 to release the covalent IκBδ inhibitor, while the canonical pathway activates RelA/p50 and other NF-κB dimer complexes inhibited by non-covalent association with IκB and IκB inhibitors (n.b., p50 may be derived from constitutive p105 processing to release the covalent IκB inhibitor). Despite the distinctions between the two pathways, recent studies have revealed numerous crosstalk mechanisms between pathways. This crosstalk involves control of NF-κB monomer expression, interdependent proteolytic processing events of precursors, and the recent identification of IκBδ activity that is induced by one pathway and subsequently degraded by another (Oeckinghaus,

Hayden et al. 2011, Shih, Tsui et al. 2011). Regardless of this revised model, a brief review of the signaling mechanisms both distinct and common to each pathway remains relevant for research (including this study) that involves activation by receptors of both pathways, where TRAF6 overexpression can act as a surrogate or dominant positive for

NF-κB activity (Wang, Wara-Aswapati et al. 2006, Wang, Galson et al. 2010). The ability of p62 (Sequestosome 1/SQSTM1) to complex with TRAF6 and other signaling adapter proteins may explain how TRAF6 activates both canonical and non-canonical

NF-κB signaling pathways (de Jong, Albrecht et al. 2010, Zotti, Scudiero et al. 2014).

Recently, OX40 (CD134) has been implicated in TRAF6 mediated non-canonical NF-κB activity. OX40 is a member of the TNFR superfamily that is expressed on primary CD4+

T cells when they are activated by CD28+ TCR ligation. In activated primary CD4+ T cells, OX40 co-stimulates the cells to sustain NF-κB activity in an antigen-independent manner (Hildebrand, Yi et al. 2011). Here, TRAF6 and cIAP2 were found to cooperatively activate the non-canonical NF-κB pathway. OX40 directly recruited

TRAF6 and TRAF2/TRAF3/cIAP2/NIK complexes in which TRAF6 acted as the E3 ligase to mediate Lys63-linked polyubiquitination of cIAP2 (Fan, Xiao et al. 2015).

Taken together, TRAF6 can be considered another example of cells using adaptor molecules to integrate the multi-variant receptor activation signals by converging on limited, keystone effector molecules.

1.10 Mechanisms of NF-κB Regulation by phosphorylation of I-κB

Activation and nuclear translocation of NF-κB requires signal dependent phosphorylation, ubiquitination and proteosomal degradation of I-κB (Beg, Finco et al.

1993, Heck, Bender et al. 1997). The classical pathway for NF-κB activation requires

IKK and IKKβ, as well as NEMO/IKK, whereas non-canonical signaling involves an

IKK complex composed of two IKKα subunits and are NEMO independent (Figure 1.3).

The canonical pathway is induced by pro-inflammatory signals such as cytokines, pathogen-associated molecular patterns (PAMPs), and some danger-associated molecular patterns (DAMPs). Receptor activation ultimately triggers IKK activity, where IκBα is phosphorylated in an IKKβ and NEMO/IKKγ dependent manner. This results in the nuclear translocation of mostly p65-containing heterodimers. The non-canonical pathway is induced by certain TNF family cytokines, such as CD40L, BAFF and

lymphotoxin-β (LT-β) (Oeckinghaus, Hayden et al. 2011). Here, a stimulus such as

CD40L activates CD40 and NF-κB inducing kinase (NIK). Activation of NIK is classically regulated by TRAF3, TRAF2 and additional ubiquitin ligases. Receptor for lymphotoxin-β (LT-βR) and leads to homodimerization and IKKα phosphorylation of p100 associated with RelB, thereby resulting in the partial processing of p100 and the generation of transcriptionally active p52-RelB heterodimers. There is speculation and some evidence for an unidentified TRAF6 dependent pathway X (see above), stimulated by CD40 that activates the IKK holoenzyme composed of all three subunits. In most cases, the activity of this complex depends on IKKβ (Karin 2008). One strategy for treating CD40-driven inflammatory disorders is to block the downstream effectors of

CD40. Blocking TRAF6 in MHC II (+) cells diminishes inflammation, but is complicated by CD40-TRAF6 blockade induced immunosuppression.

1.11 Dual targeting of proteins is a means for controlling cell signaling and transcription

Corralling genetic material and transcriptional machinery to the nucleus segregates it from the translational and metabolic machinery in the cytoplasm. This provides a regulatory opportunity for cell signaling and gene regulation using nucleocytoplasmic shuttling. Among the numerous examples of nucleo-cytoplasmic shuttling proteins are the transcription factor 4 (Sox4) and its binding partner, the adapter protein,

Syntenin (Syn) (Zimmermann, Tomatis et al. 2001, Beekman, Vervoort et al. 2012).

Syntenin affects cancer cell motility and invasion through distinct biochemical and signaling pathways, including focal adhesion kinase and p38 mitogen-activated protein kinase (MAPK), resulting in activation of the NF-κB pathway (Boukerche, Aissaoui et al.

2010). Activation of NF-κB is a classical example of eukaryotic cell signaling regulation

by subcellular sequestration via protein-protein interactions. Cells assemble proteins in the cytosol, but use selective bi-directional transport between the cytoplasm and the nucleus to regulate gene expression, signal transduction and cell cycle. Latent NF-κB resides in the cytoplasm in an inhibited complex, bound by one of the IκB family members, as previously discussed. IκB masks the nuclear localization signal (NLS) of both the NF-κB р65 and p50 subunits from interacting with the karyopherin-α/importin-

β1 complex, whereas IκB masks only one NLS, resulting in dynamic nucleocytoplasmic shuttling (Malek, Chen et al. 2001). NLSs are short peptide motifs that mediate the nuclear import of proteins by binding to karyopherins/importins. There are at least two nuclear import pathways: 1) the classical nuclear localization sequences (cNLSs) which involve the receptors importin-α/karyopherin-α and importin-β/karyopherin-β1; and 2) the karyopherin-β2 pathway, involving the proline-tyrosine (PY)-NLSs and the receptor transportin-1/karyopherin-β2 (Marfori, Mynott et al. 2011). β-karyopherins are a family of soluble transport receptors that transport macromolecules through the nuclear pore complex (NPC) by an energy-dependent process. Unmasking of the NLS on NF-κB p65 and subsequent nuclear import as the cargo of the ternary karyopherin-α/importin-

β1/cargo complex requires proteosomal degradation of I-κB. Untethered to the cytoplasm, NF-κB enters the nucleus, where it binds to B binding sites affecting the transcriptional profile of target genes (Baeuerle and Baltimore 1988, Baeuerle and

Baltimore 1989, Ghosh and Baltimore 1990).

The phenomenon of dual targeting or dual distribution of proteins is abundant in eukaryotic cells. Echoforms is the term that for, identical or nearly identical proteins that are dually/differentially localized/targeted within a cell. This contrasts with isoforms,

which are related, but distinct, proteins that may be similarly localized. The targeting of echoforms can be determined prior to synthesis of the protein by generating multiple, different mRNAs derived from a single gene, or dual targeting of a single translation product (Figure 1.9). Regardless, the differential subcellular positioning of echoforms strategically increases the complexity of eukaryotic signaling effectors from a finite pool of gene products. Kisslov et al reported that dual targeted proteins are more evolutionarily conserved than proteins that are exclusively targeted. They argue that maintenance of dual targeting is evolutionarily driven by a dual or discrete functionality of a single protein in different cellular compartments, without regard to the dual targeting mechanism (Kisslov, Naamati et al. 2014).

Figure 1.9 Mechanisms for Dual Targeting of a Single Translation Product. (A) Two signals compete for different organelles on the same polypeptide. (B) Ambiguous targeting signal is recognized by two organelles. (C) Changes in the targeting signal accessibility caused by protein (i) folding (ii) binding to cellular factors (iii) modification or (iv) cleavage by a protease that exposes a targeting signal. (D) Reverse translocation, polypeptides move back to the cytosol during translocation into an organelle. (E) Trapping of proteins in an organelle by folding. (F) Export of proteins out of an organelle. (G) Release of proteins from organelles due to membrane permeabilization or breakage. (H) Vesicular release of proteins from organelles. (I) Release of proteins from organelles through tethering of membranes. Used with permission from the author (Kalderon and Pines 2014).

1.12 Sox4 Molecular Domain Structure and Function

All Sox-family proteins share a conserved SRY‐ box or HMG‐ box (high mobility group‐ box) AT-rich DNA binding domain. Sox transcription factors were initially identified with the discovery of the sex determining factor, sex determining region on Y Chromosome (SRY) (Gubbay, Collignon et al. 1990). SRY and Sox proteins are highly conserved in the HMG domain and belong to the same subgroup within the superfamily of HMG-box proteins. In this superfamily, Sox proteins are characterized by having a single HMG domain that binds DNA in a sequence specific manner. Sox proteins bind to the minor groove of DNA via the consensus sequence 5’‐ A/T A/T CAA

A/T G‐ 3’ (Laudet, Stehelin et al. 1993, Harley, Lovell-Badge et al. 1994). When Sox proteins bind to the DNA minor groove, the DNA bends at an angle of 70-85° providing an additional structural component to the gene regulatory mechanism (Werner, Bianchi et al. 1995, Jauch, Ng et al. 2012). The Sox family can be subdivided into groups A through H based upon a consensus within the HMG box sequence. Sox4 is a member of the C subgroup of Sox proteins, which also includes Sox11 and Sox12 (Bowles, Schepers et al. 2000). Group C members are distinguished from other Sox family subgroups by a conserved C-terminal transactivation domain (Figure 1.10). The HMG box of Sox4 binds to and bends DNA with high affinity to the minor groove of DNA with the sequence

AACAAT with the optimal 10bp sequence containing 5’ AG and 3’ G nucleotides directly adjacent to the core sequence (Vervoort, van Boxtel et al. 2013). The SoxC proteins Sox4/11/12 are expressed widely in embryonic tissues, with the highest expression levels found in neural

Figure 1.10 Comparison of Murine and Human Domain Structure of the SoxC Group Family of Proteins. Sox4, Sox11 and Sox12 (formerly known as Sox 22) constitute the group C of Sry-related HMG box proteins. Members feature two functional domains: an Sry-related HMG box (Sox) DNA-binding domain and TAD comprised of the last 33 amino acids of the C terminus. The TAD is 66% identical across all vertebrate SoxC proteins, 97% identical amongst Sox4 and Sox11 orthologues and 79% identical amongst Sox12 orthologues. SoxC protein domain architecture critically control cell fate and differentiation in major developmental processes, and that their up regulation may be a critical determinant of cancer progression. Human molecular domain positions are derived from those reported by (Penzo-Mendez, Dy et al. 2007) and denoted in UniProt, * Denotes Murine amino acid positions as described by (Dy, Penzo-Mendez et al. 2008).

and mesenchymal progenitor cells. Sox4 was first identified as a transcription factor required for B- and T-lymphocyte differentiation. The expression pattern of Sox4 during mouse embryogenesis has been analyzed by both whole mount and section in situ hybridization studies, which show that Sox4 is expressed in the mesenchyme of the branchial arches, trachea, esophagus and nervous system (Maschhoff, Anziano et al.

2003). Later in embryonic development, Sox4 is expressed in the embryonic growth plate where its expression is regulated via parathyroid hormone and parathyroid hormone-related protein receptor. Sox4 and Sox11 knockout mice develop multiple organ defects (Schilham et al., 1996; Sock et al., 2004), whereas Sox12 knockout mice are grossly normal (Hoser et al., 2008). However, various combinations of homo- and heterozygous SoxC mutations indicate that continued and cumulative activities of these three genes are required for widespread organ development; increasingly severe organ hypoplasia phenotypes were found with decreasing wild-type SoxC alleles (Bhattaram et al., 2010). Partially SoxC-deficient embryos (Sox11-/-, Sox4+/- Sox11+/-, etc.) also display malformation of various organs. For example, Sox4-/-Sox11-/- embryos are minute at E9.5 and show highly severe organ defects and extensive cell death. Nevertheless, these embryos appropriately express genes involved in cell lineages and embryo patterning, such as Pax1/7, Otx2 (orthodenticle homolog 2), Shh and Bmp4 (bone morphogenetic protein 4) (Bhattaram et al., 2010). This suggests that SoxC proteins play important roles during early embryogenesis in sustaining neural and mesenchymal progenitor cells, rather than in cell lineage specification. In support of this, a reported target of SoxC is Tead2 (TEA domain family member 2), which is a transcriptional mediator of the

Hippo signaling pathway that is crucial for organ size regulation (Bhattaram et al., 2010).

Additionally, Sox4-deficient mice exhibit arrest of B-cell development at the pro-B-cell stage. Thus, Sox4 appears to be critical for normal development and maturation of endocardial cushions and for normal B-cell maturation. However, its function(s) in these processes is not yet clear (Maschhoff, Anziano et al. 2003). Interestingly, Sox4 and

Sox11 have been shown to have redundant functions in multiple systems, including an importance in the establishment of pan-neuronal protein expression and retinal ganglion cell development (Bergsland, Werme et al. 2006, Jiang, Ding et al. 2013).

1.13 Sox4 localization depends on Syntenin

Transcription factors like NF-κB and Sox proteins need to be translocated to the nucleus after translation in order to bind DNA and directly regulate gene expression.

Control of the import and export of transcription factors is important for cell development and defense scenarios. Improper nucleo-cytoplasmic shuttling of Sox transcription factors is associated with cancer and developmental disorders. Mutations or problems that disrupt the proper timing, location or expression levels of Sox factors can lead to defects in organogenesis or other developmental disorders such as human sex reversal syndrome (HSR). The etiology of HSR is defective nuclear import of SRY and Sox9

(Preiss, Argentaro et al. 2001, Smith and Koopman 2004). Sox4 has a bipartite nuclear localization signal (BP-NLS or -NLS) at positions 60-77 and 129-136, as identified by the Nuclear Protein Database (NPD, http://npd.hgu.mrc.ac.uk/user/index.php). Half of

Sox4’s BP-NLS is located within the N-terminus of the HMG box and just distal to it within the C-terminus, and allows Sox4 to be dually localized to both the nucleus and the cytoplasm (Figures 1.11). Sox4 has been reported to accumulate with Syntenin in the nucleus (Farr, Easty et al. 1993, Beekman, Vervoort et al. 2012). Syntenin interacts with

both the NTD and CTD of Sox4, but binds to 33 C-terminal residues of Sox4 to prevent poly-ubiquitin independent proteosomal degradation of Sox4 and co-relocalization with

Syntenin to the nucleus.

Figure 1.11 Sox4 Protein Domain Organization and Amino Acid Sequence. A) Molecular Architecture of Human Sox4 Domains B) primary amino acid sequence annotated to show a Bi-Partite Nuclear Localization Signal (Underlined) (Kaur, Delluc-Clavieres et al. 2010), and a potential TRAF6 Interaction Motif (Red). GRR and SRR represent glycine- and serine- rich regions respectively that are subject to posttranslational modification and either supports (GRR) or abrogates (SRR) apoptosis (Hur, Hur et al. 2004).

1.14 Syntenin is a dual PDZ domain containing scaffolding protein

The SDCBP gene encodes the 298aa, 33kDa protein, Syntenin-1 (Syn). Syn was initially identified as a binding partner of syndecan-1 (Grootjans, Zimmermann et al.

1997). Concurrently, Syn was also identified as a melanoma differentiation-associated gene 9 (mda9) in a melanoma cell line treated with IFN-γ (Lin, Jiang et al. 1998). Syn is an adapter protein that couples transmembrane proteoglycans with cytoskeletal components and is involved in intracellular vesicle transport. Structurally, Syn is composed of an N-terminal domain comprised of the first 113 amino acids followed by two adjacent PDZ domains (PDZ1 and PDZ2) and a short 24 amino acid CTD (Figure

10). The NTD can recruit the transcription factor Sox4 and eukaryotic translation initiation factor 4A (EIF4A) into signaling complexes and is important for homodimerization and heterodimerization with Syntenin 2 (Geijsen, Uings et al. 2001).

Within the NTD of Syn are tyrosine residues that can be targeted by Src kinase for phosphorylation and act as docking sites for zeta-chain-associated protein 70 (ZAP70) and Src kinases (Beekman and Coffer 2008, Read and Gorman 2009). Importantly, the

NTD has been demonstrated to be involved in binding both free ubiquitin and ubiquitinated proteins. Specifically, the L4YPXL motif (amino acids 3 to 7 in Figure 10) was demonstrated to be a novel ubiquitin-binding motif for Syn binding ubiquitin as an obligate dimer. The three LYPXL motifs in the NTD at positions 5, 47 and 51, are necessary for the interaction with ALIX/Aip1 during syndecan-lead cargo recruitment to exosomal compartments (Rajesh, Bago et al. 2011). ALIX/Aip1 is a Lys 63-specific polyubiquitin binding adaptor protein that may regulate retroviral budding, endosome and

receptor trafficking and cytoskeleton-associated tyrosine kinases (Trioulier, Torch et al.

2004, Dowlatshahi, Sandrin et al. 2012).

The CTD of Syn has been shown to be necessary, but insufficient, for interaction with CD63, and along with the NTD stabilizes the full length protein (Cierpicki,

Bushweller et al. 2005). Both the NTD and CTD have been shown to regulate interactions between the PDZ domains of Syn and its binding partners, as mentioned above. Additionally, phosphorylation of the NTD disrupts Syn interaction with the receptor protein tyrosine phosphatase (rPTP) CD148, demonstrating that posttranslational modifications of the NTD affect interactions between the dual PDZ domains and binding targets (Harrod and Justement 2002). Recently it has been shown that the N- and CTD of Syn modulates targeting to the plasma membrane. Phosphorylation of Tyr56 in the NTD decreases Syn localization of to the plasma membrane, while the basic residues K280/R281 at the CTD increased localization to the membrane (Wawrzyniak,

Vermeiren et al. 2012). It remains unclear however, the exact mechanism by which the

N- and CTD of Syn contribute to Syn function.

Postsynaptic density protein, Disc large, Zona occludens (PDZ) domains are protein-protein interaction modules that predominate in submembranous scaffolding proteins. The PDZ domains of Syn serve as scaffolds for binding multiple peptide motifs with low to medium affinity (Beekman and Coffer 2008). However, these PDZ domains bind to multiple peptide motifs (class I, class II and other sequences) with low to medium affinity, rather than by a unique sequence. Such degenerate specificity is not unique to the Syn PDZ domains, but accounts for Syn localization, tissue expression and

Figure 1.12 Molecular Domains and Interaction Motifs of Syntenin. Human Syntenin is a 33Kda protein encoded by 298 amino acids. Above the diagram of the linear sequence is a ribbon model of the tandem PDZ domains showing the unstructured linker (194-204) that may contain an imperfect T6IM. Below the cartoon is the amino acid sequence for human Syn, annotated with specific domains and binding motifs for TRAF6 and Ubiquitin (Underlined).

scaffolding protein function. Syntenin is widely expressed in all adult tissues (Grootjans,

Zimmermann et al. 1997, Zimmermann, Tomatis et al. 2001).

Most protein ligands show preference for the PDZ2 domain of Syn, but peptides derived from IL-5Rα, merlin and neurexin interact with the PDZ1 domain with high affinity (Beekman and Coffer 2008). Additionally, the Syntenin PDZ domains have been found to interact with membrane lipids using surface plasmon resonance experiments with liposomes modeled after the inner leaflet of the cell membrane. Syn directly and strongly interacts with membrane phosphoinositol lipids and especially phophatidydylinsositol (4,5) bisphosphonate (PI(4,5)P2) (Zimmermann, Tomatis et al.

2001, Zimmermann, Meerschaert et al. 2002, Zimmermann, Zhang et al. 2005). Later studies showed that Syntenin-2 also interacts with PI(4,5)P2 and organizes nuclear

PI(4,5)P2 pools, which are crucial for cell survival and proliferation (Mortier, Wuytens et al. 2005). However, PDZ domain affinity for PI(4,5)P2 is insufficient for directing

PDZ-containing proteins to subcellular PI(4,5)P2 pools or to compartments rich in other phosphoinositides). This is akin to what is known for most PH domains, which also weakly bind PI(4,5)P2 and cannot solely target their host proteins to phosphoinositide‐ rich domains (Lemmon 2003). Since PI(4,5)P2 is not present in certain cellular compartments, this could represent a way to direct Syn to interact with a subset of protein targets enriched within specific subcellular compartments. While the dual PDZ domains of Syn are independent, and can independently integrate with C-terminal peptides, binding studies suggest that an intact full tandem PDZ works cooperatively (Grootjans,

Zimmermann et al. 1997). Crystal studies reveal extensive contact sites between the domains which are tethered by a short, unstructured five residue linker (Cierpicki,

Bushweller et al. 2005). Such intramolecular interactions fix the PDZ domain orientation. This orientation coupled with moderate affinities for the C-terminus of various peptides may be the structural underpinnings for the assembly of multimeric protein complexes (Figure 1.13).

Syn activation of the PI3K-Akt pathway in human melanoma cells has been linked to increased angiogenesis. Fibronectin activation of Focal Adhesion Kinase (FAK) and c-Src kinases is modulated by Syn and initiates the PI3K-Akt pathway. Activated Akt causes Hypoxia-inducible factor 1α (HIF-1α) translocation to the nucleus, which induces insulin growth factor-binding protein-2 (IGFBP-2) expression. After secretion, IGFBP-2 interacts with αVβ3 integrin on endothelial cells, supporting pro-angiogenic factor

Vascular Endothelial Growth Factor A (VEGF-A) expression (Das, Bhutia et al. 2012).

Finally, Syn was shown to directly interact with TRAF6, resulting in IL-1R and TLR-4- induced NF-κB activation (Chen, Du et al. 2008).

Figure 1.13 Structural Basis for select Syntenin protein-protein Interactions.

Chapter 2

HYPOTHESIS AND SPECIFIC AIMS

Proper cellular response to both internal and external signals requires exact spatio-temporal positioning of intracellular components to facilitate their interaction and organize a coordinated response from a limited number of cellular effector molecules.

Adaptor molecules are used to assemble protein complexes to converge diverse signaling pathways under variant conditions. TRAF6 is a keystone adapter protein that transduces signaling from a wide array of upstream receptors. TRAF6 is able to uniquely interact with proteins via its structural architecture and biological activities Specifically, its ability to auto-ubiquitinate, which sustains downstream E3 ligase activity and signaling as well as its unique MATH domain, which bears a TIM groove. The TIM groove allows

TRAF6 to uniquely interact with TRAF6 interaction motif (T6IM) peptides and T6IM bearing proteins. Further, it has been shown that TRAF6 can also make intra and intermolecular interactions head to head (RZ-RZ) and head to tail (RZ-MATH) to autoinhibit downstream signaling (Yin, Lin et al. 2009, Wang, Galson et al. 2010).

Overexpression of just the coiled-coil plus MATH domain sequence (ccMATH) has a dominant-negative effect on IL-1β/LPS signaling, as well as an antagonistic effect for

TRAF6 recruitment by upstream activators (Darnay and Aggarwal 1999). Similarly, ectopic expression of TRAF6WT or RZcc can act as a dominant positive and GFP fused

TRAF6 constructs localize to the cytoplasm (Baud, Liu et al. 1999, Wang, Wara-

Aswapati et al. 2006, Wang, Galson et al. 2010). Since ectopic dominant-positive expression is independent of upstream activators, I hypothesized the existence of

additional potential inhibitory intra- and inter-molecular interactions between the MATH domain and TIM bearing proteins and sought to continue investigating TRAF6 regulation and dynamics. In a timely study by Chen et al., overexpression of Syn was found to inhibit TIR signaling to NF-κB, but not TNFα induced NF-κB activation in a dose dependent manner. Furthermore, Syn associates with TRAF6 under physiological conditions, and dissociates from TRAF6 upon TIR stimulation (Chen, Du et al. 2008).

Therefore, there may exist competition for TRAF6 between IRAK1 and Syn, as overexpression of IRAK1 disrupted the interaction of Syn with TRAF6 or Syn might otherwise sustain the auto inhibitory effect of closed RZ-MATH associated TRAF6.

Initially I hypothesized that Syn associated with TRAF6 via a putative T6IM, but surprisingly, Syn was also able to inhibit the RZcc dominant positive activity for NF-κB.

This observation coupled with the discovery that Syn overexpression caused the intranuclear relocalization of TRAF6 into the nucleus made me consider the possibility that Syn was acting as an adapter protein for another T6IM bearing protein that directly associated with TRAF6. Another timely paper was published characterizing the stabilizing effect of Syn binding to the CTD of Sox4 (Beekman, Vervoort et al. 2012) and

I quickly discovered a novel T6IM within Sox4, perhaps providing a mechanism for

Syn’s effect upon TRAF6 activation and subcellular localization.

2.1 Overall Goal

The overall goal of this study is to identify novel TRAF6 Interaction Motif

(T6IM)-bearing proteins that interact with TRAF6 and characterize their regulatory functions mechanisms upon downstream signaling. Such insights will help to explain the

phenomenon in which over-expressed ectopic TRAF6 in 293 cells acts as a dominant positive for NF-κB activity.

2.2 Hypothesis

1. TRAF6 Interaction Motif (T6IM) controls TRAF6 signaling-bearing proteins such

as IRAK1, disrupting TRAF6 RZ-MATH domain auto-regulation and competes

with another inhibitory TIM-based TRAF6 binding protein.

2. Syn uses the T6IM bearing transcription factor, Sox4 as an adapter molecule to

coordinately both inhibit TRAF6-dependent NF-κB activity and to also

translocate cytoplasmic TRAF6 into the nucleus.

2.3 Specific Aims

Aim 1. Characterize IRAK1 modulation of TRAF6 auto-regulation and localization

Aim 2. Identify the molecular determinants of Syntenin-1/TRAF6 interaction

Aim 3. Understand the nature of Syntenin-mediated nuclear localization of TRAF6

Chapter 3

MATERIALS AND METHODS

3.1 Cell Culture

All cell lines were maintained at 37°C under 5% CO2 in sterile 100x20mm tissue culture dishes treated by Vacuum Gas Plasma (BD Biosciences). Human 293 (CRL-

1573) and 293T (CRL-11268) cells were obtained from American Type Cell Collection

(Manassas, VA) and were cultured in EMEM medium supplemented with 10% heat inactivated fetal bovine serum (Tissue Culture Biologicals Lot #103283), 2 mg/mL L-

Glutamine and 1% penicillin/streptomycin solution (Sigma). 293R cells are stably transfected 293 cells (American Type Culture Collection CTRL-1573) that ectopically express the IL-1R receptor (Wang et al., 2006). 293R cells were maintained and cultured in the same culture media as the 293 and 293T cells. 293R cells were cultured from cryopreserved aliquots of cells previously derived as described (Asea, Rehli et al. 2002,

Yoshida, Kumar et al. 2004).

THP-1 cells were cultured in RPMI media (10-040-CV, Cellgro) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 1% Penicillin/Streptomycin

Solution (30-002-CI, Cellgro) and 500 µl of 2ME (21985-023, Invitrogen). Murine RAW

264.7 (#TIB-71, American Type Culture Collection, Manassas, VA) were cultured in

DMEM (10-013-CV, Cellgro) supplemented with 10% heat-inactivated fetal bovine serum (HyClone SH30070 Lot#AYC60564, AWC10533) and 1%

Penicillin/Streptomycin Solution (Sigma) at 37°C under 5% CO2.

Rat PC12 pheochromocytoma cells were provided by Dr. Yong-Jian Liu

(University of Pittsburgh) and maintained in Dulbecco’s modified Eagle’s medium

(DMEM) supplemented with 10% horse serum and 5% fetal calf serum (Invitrogen,

USA). For experiments, PC12 cells were seeded onto matrigel (Corning) treated multiwell Lab-Tek Chambered Coverglass (Nunc) for at least 24 hours prior to treatment.

NGF (100 ng/mL) was then added. Neurite outgrowth was measured using a modified protocol as previously described, at 24-hour timepoints up to 120h as indicated in the legend to each figure (Park, Lee et al. 2002, Hong, Noh et al. 2003)

Murine 4B12 cells and calvaria-derived stromal (CDS) cells were a gift from Dr.

Lynda F. Bonewald (University of Missouri at Kansas City, MO). 4B12 and CDS cells were cultured separately in α-MEM (SIGMA#M4526), containing L-glutamine

(2.92mg/mL) (GIBCO#12561) supplemented with 10% Fetal Bovine Serum (Hyclone), penicillin/streptomycin at 100 U/mL; or α-MEM supplemented with 10% Fetal Bovine

Serum, penicillin/streptomycin, L-glutamine (GIBCO#10378-016). The 4B12 cells are maintained in α-MEM supplemented with 10% FBS and 30% calvarial-derived stromal cell conditioned media (CSCM). To prepare CSCM, calvaria-derived stromal cells were cluttered until confluent in α-MEM supplemented with10% FBS. Media was changed, and cultured for an additional 4 days. Conditioned media was then collected and centrifuged to remove cell debris (10000 Å~ g, 30 min), and filter through a 0.45 /um pore-size filter. CSCM was then added at ~10mL media/55cm2 or 30mL/150cm2 dish.

Murine ST2T cells were established by infecting the mouse stromal line ST2 with the retroviral vector expressing RANKL and provided by Dr. Deborah L. Galson

(University of Pittsburgh) (Lean, Matsuo et al. 2000). For co-culture, bone marrow cells

or RAW264.7 were seeded at 6x105 cells/cm2 with 6x104 /cm2 ST2-T cells and cultured in the presence of 108 M 1,25-dihydroxyvitamin D3 and 107 M dexamethasone.

For osteoblast-free culture, 4B12 and RAW264.7 cells were cultured in the presence of 10 ng/mL recombinant human M-CSF (Genzyme) and 50 ng/mL recombinant mice RANKL (R&D Systems) to generate osteoclast-like cells. Cells were plated overnight at a density of 2 × 104 cells/well in a 6-well plate in DMEM (Life

Technologies, Inc. Rockville, MD) and heat inactivated 10% FBS (HyClone). The next day the medium was changed to DMEM supplemented with 10% FBS and 50 ng/mL

RANKL (R&D Systems). After 24h, the medium was replaced by DMEM, pH 7.2

[13.53 g DMEM (Sigma), 0.78 g sodium bicarbonate (Sigma), 10% FBS, and 50 ng/mL

RANKL (R&D Systems). For each sample, cells were fixed and stained for tartrate- resistant acid phosphatase (TRAP) or lysed for RNA extraction.

3.2 Transfections

Reporters or expression plasmids were transfected into cells with FuGENE HD transfection reagents (Roche Applied Science, Indianapolis, IN) or X-tremeGENE HP transfection reagent (Roche Applied Science, Indianapolis, IN). At least one day before transfection, cells were seeded into tissue culture plates (Bioscience) or Lab-Tek

Chambered Coverglass (Nunc) at a density = Relative Area * 2x104 according to the table below with normal culture media and allowed to settle overnight.

PLATE SIZE GROWTH AREA (cm2) Relative Area 96 well 0.32 1x 24 well 1.88 5x 12 well 3.83 10x 6 well 9.4 30x

Table 3 Cell Density Seeding Formula for Various Tissue Culture Plates. Relative Growth Area (cm2) for tissue culture plates used in determining seeding density of cells prior to transfection

Prior to transfection, cells were allowed to reach 60-70% confluency. A 3:1 reagent (μl) : DNA (μg) ratio was used in all transfections. This mixture was prepared as a 1:1 (volume : volume) of transfection reagent (TR):DNA. Plasmids were added into a microfuge tube with proper volume of serum-free Opti-MEM medium (Gibco). Room temperature FuGENE HD or X-trememGENE HP was diluted in another microfuge tube with an equal volume of serum-free Opti-MEM medium as that used for plasmids, The

TR solution was then added directly to the plasmid solution, mixed gently and incubated at room temperature for 15-20 min. The plasmid-TR mixtures were then added (drop wise) into indicated wells containing the pre-seeded cells and incubated at 37oC under

5% CO2 for at least 24 hours prior to subsequent treatment or analysis.

3.3 Luciferase bulk-cell assay for NF-κB activity

The NF-κB luciferase reporter, NF-κB/pGL2, contains a c-fos core promoter and four tandem repeats of NF-κB p65/p50 heterodimer binding sequences (Yoshida, Kumar et al. 2004). The XT-Luc IL1B vector was generated previously as described in (Unlu,

Kumar et al. 2007). Briefly, BDC454 clone (Clark et al., 1986;Shirakawa et al., 1993) was partial digested with XbaI and TaqI to remove the appropriate length of human genomic IL1B DNA from −3757 downstream to +12. This 3.76 kbp sequence was

inserted into the SmaI site of the pGL3Basic vector. The IL-1β XN Luciferase reporter was generated according to the Figure 3.1 in collaboration with Dr. Luke O’Neill (Trinity

College, Dublin, Ireland). In most cases 20ng of luciferase reporter was co-transfected with indicated expression plasmids into cells for at least 24 hours prior to assay, with the transfection procedure described in the previous section. Luciferase Assay System

(Promega, #E-1501) was used to quantify NF-κB activity. 1x cell lysis buffer (Promega,

Madison, WI) was freshly prepared and allowed to equilibrate to room temperature. The transfected cells were then lysed with 50μL of 1X cell lysis buffer in each well and shaken for 20 min. 20 μl of supernatant from each well was used for luciferase activity analysis using a VERITAS luminometer (Turnaer BioSystems, Sunnyvale, CA) according to the manufacturer’s instructions.

3.4 Reporters and Expression Plasmids

The human wild-type TRAF6 and mutant coding sequences were engineered in both untagged pcDNA3.1 (ﬂ) and dual-tagged pFLAG CMV 5a-YFP expression vectors in the EcoRI and EcoRV sites by PCR subcloning strategies. The sequences coding for

TRAF6 (1-273) is designated as RZ; TRAF6 (1-358) as RZcc; TRAF6 (346) were subcloned into pFLAG CMV 5a plasmid (Sigma-Aldrich) as previously described

(Wang, Galson et al. 2010). A mutant version of full-length TRAF6 containing lysine

(K) to arginine (R) mutations at all lysine residues (referred to as TRAF6Δ K32-518R or

TRAF6ΔK) and murine TRAF6 (mTRAF6) were provided as a gift by Dr. Yongwon

Choi (University of Pennsylvania School of Medicine) (Walsh, Kim et al. 2008).

The tagged human wild-type Syn and mutant Syn expression plasmids were a gift from Dr. Paul J. Coffer (Utrecht, Netherlands). Murine Syntenin-1 in pCMV-Sport6

expression vector was purchased from Open BioSystems (Thermo Scientific Catalog

#MMM1013-77128). Human Sox4 and SDCBP (Syn) in pLX304 expression vectors were purchased from DNASU plasmid repository (Arizona State University, Tempe,

AZ). Tec kinase, BTK and variant expression vectors were provided by Dr. Lawrence P.

Kane (University of Pittsburgh). Both full-length murine Tec and BTK and their PH domains (first 152 aa Tec & first 174 aa for BTK) were inserted into vector pEGFP-N1

(Clontech) between Xho1 and BamH1 in the multi-cloning site (MCS) of the vector.

These engineered Tec kinase family reporters are CMV-driven and have Kan/Neo resistance. The HcRed tagged human Sequestosome-1/P62 expression plasmid (P62-

HcRed) was previously created in our lab (Wang, Galson et al. 2010) using human p62- pcDNA3.1 (courtesy of Dr. Deborah Galson, University of Pittsburgh) and a pFLAG

CMV5a-HcRed1 expression plasmid. Briefly, using PCR, the NLS was deleted from the

HcRed1/Nuc vector (Clontech) and HcRed1 was then inserted into the Eco RV and Bam

HI sites of pFLAG-CMV5a. P62 was then cloned from p62-pcDNA3.1 by PCR and newly generated EcoRI and BglII sites were used to insert the sequence into the pFLAG-

CMV5a-HcRed1 plasmid. The human MyD88 and HA-tagged human TLR4 plasmid was provided by Felix Randow and prepared as previously described (Randow and Seed

2001, Asea, Rehli et al. 2002). pEYFP-C1 vector was obtained from Clontech (Mountain view, CA Catalog #6005-1).

Figure 3.1 Schematic Map and Design of PGL2- IL-1β-XN Luciferase Reporter.

Expression PLASMIDS VECTOR species source label/tag clone ID HsCD00 LV Syntenin pLX304 human DNASU - 436572 pLenti6.2/ HsCD00 LV Sox4 V5-DEST human DNASU - 329922 mTRAF6 pFLAG murine Choi FLAG

Section 1.01 o pCMV- penBiosyste Section 1.02 4 mSyn SPORT6 murine ms - 017442 F-Syn pFLAG human Coffer FLAG ΔN Syn pMT2 human Coffer HA ΔPDZ1+2 Syn pMT2 human Coffer HA ΔPDZ1 pcDNA3 human Coffer HA ΔPDZ2 pMT2 human Coffer HA mKATE Syn pcDNA3 human Coffer mKATE Myc Syn pcDNA3 human Coffer Myc XN pGL2 human O'Neill Luciferase XT pGL2 human Auron Luciferase IRAK1 pcDNA human Auron MyD88 pcDNA human Auron TRAF6ΔK pFLAG murine Choi FLAG TRAF6C70A- FLAG/Y YFP pFLAG Human Auron FP TRAF6-YFP pFLAG Auron Auron EYFP EYFP pEYFPC1 Clontech EFYP 6005-1 TRAF6-EYFP pcDNA human Auron EYFP TRAF6 pcDNA3.1 human Auron TRAF6 pFLAG human Auron FLAG IRAKHcRed pcDNA human Auron HcRed Akt-GFP human Kane GFP BTK-GFP human Galson GFP Tec-GFP human Galson GFP PH-ATK-GFP human Kane GFP PH-BTK-GFP human Galson GFP PH-Tec-GFP human Galson GFP TLR4 pcDNA human Randow HA

Table 4 Expression and Reporter Plasmids Used in this Study.

Figure 3.2 Schematic Maps of the TRAF6 constructs Used in this Study. All constructs were FLAG tagged or dually tagged with FLAG and YFP in subcellular localization studies. Construct design and preparation was as previously described (Wang, Galson et al. 2010). The C70A mutein was prepared by site-directed mutagenesis and subcloned into the TRAF6-YFP construct. TRAF6ΔK and the corresponding murine wtTRAF6 plasmid were provided by Dr. Y.W. Choi (University of Pennsylvania) (Walsh, Kim et al. 2008).

Figure 3.3 Schematic Maps of the Syn Constructs Used in this Study. All human sequence constructs were HA tagged and verified by sequencing.

3.5 Statistical Analysis

In all bulk cell luciferase assays, RLU values are reported as the mean of three experimental replicates along with the associated standard deviation (s.d.) for this calculated mean to quantify the scatter or variability between experimental replicates.

Each experiment was then repeated at least three times to verify the overall trend and pattern of the experimental results. Graphs then are a single experiment containing three experimental replicates, representative of results from at least three biological replicates.

The reported error for each mean provides an estimate of the s.d. of the overall population from a small sample size rather than the precision of the experimental mean to the actual population mean. SEM can be misleading because by definition it produces a smaller value than the s.d. SEM was not reported because SEM quantifies how precisely you know the true mean of the population, which is more appropriate in cases with large sample sizes. Recently, concern over the wide misuse of P values has been addressed

(Baker 2016). In this study, the nature of the TRAF6 dominant positive signal is robust enough (orders of magnitude) that, it not only serves as an internal positive control but also obviates the need to calculate statistical significance in observed differences.

3.6 Immunoprecipitation and Western Blotting

Western blotting. After indicated treatments, 293 or 293T cells were detached by pipetting and transferred to microcentrifuge tubes. Cells were spun down with a bench- top microcentrifuge at 5000 rpm for 3 min. aspirated culture medium and washed remaining cell pellets once with 1xPBS. Pellets were re-suspended in 50μL of ice-cold lysis buffer per 106 cells. Cell lysate was then incubated on ice for 30 minutes with

vortexing every 10 minutes, and then centrifuged at 14,000 rpm (10,000-15,500x g) at

4°C for 10 minutes. Supernatant was harvested and mixed with an equal volume of

2xSDS-PAGE sample buffer supplemented with fresh 2-mercapto ethanol (Bio-Rad) and incubated at 98°C for 15-30 min. Heat denatured samples were then loaded into a precast

4-12% gradient SDS-polyacylamide gel (Lonza) and run with 1x Laemmli buffer (25mM

Tris, 192mM Glycine, 0.1% SDS; pH 8.3) at 100V for about 2 hours. Resolved proteins were transferred from the SDS-polyacrylamide gel onto a PVDF membrane in 1X Tobin buffer (3.03g TRIS, 14.4g glycine, 150mL methanol per liter of solution, pH 8.3).

Membranes were incubated in 5% non-fat milk with 1xTPBS (10 mM phosphate,

140mM NaCl, 3 mM KCl, 0.05% Tween 20; pH 7.4) with slight shaking for 1 hour, and then incubated with indicated primary antibody for another 1-2 hours at RT with shaking or O.N. at 4°C. Membranes were then washed in 1xTTBS with slight shaking for 3-5 minutes to remove primary antibody. The membrane was then incubated in a 1:10,000 dilution of secondary antibody in 5% non-fat milk with 1xTTBS with slight shaking for 1 hour. The secondary antibody was removed and the membrane washed in 1xTTBS with slight shaking for 3-5 minutes. Finally, the membrane was incubated with chemiluminescent substrate (Thermo Scientific, Waltham, MA) at RT for 5 minutes to prepare for signal visualization by X-ray film exposure.

Immunoprecipitation. Cell lysate supernatant was diluted using the same type of lysis buffer as described above into 200μL per 106 cells. A specific antibody was added and the sample and then rocked at 4°C for 2-5 hours. Then, 30μL of 50% protein A/G conjugated agarose slurry (Protein A/G PLUS-Agarose IP Reagent sc-2003) pre-absorbed by non-specific IgG (Normal rabbit IgG sc-2027, Santa Cruz Biotechnology) was added

to each sample tube and rocked at 4°C overnight. The next day, agarose beads were centrifuged at 10,000rpm for 1 min. Supernatant was then aspirated and beads rinsed with 500μL lysis buffer three times. 100μL 1xSDS-PAGE sample buffer was added to each sample tube containing the agarose beads. Re-suspended agarose beads by vortexing and then incubated at 98°C for 10 minutes. SDS-PAGE and immuno-blotting procedures followed as described above for sample analysis.

3.7 Reagents and Antibodies

Depending on the experiment, RAW264.7 or 4B12 cells were stimulated with either 1μg/mL of E. coli 055:B5 Lipopolysaccharide (LPS) (Sigma) or 50ng/mL recombinant murine RANKL (R&D Systems) for indicated time periods. RAW264.7 or

293R cells were stimulated with 100ng/mL IL-1β (Millipore) for 6-8 hours prior to assay.

In neurite growth assays, 293 and PC12 cells were stimulated with 50ng/mL recombinant human NGF (Millipore) for indicated time periods. The primary antibodies for immunoprecipitation experiments include: Rabbit anti HA-probe (Y-11) (Santa Cruz

Biotechnology, sc-805), Rabbit anti TRAF6 (H-274) (Santa Cruz Biotechnology, sc-

7221), Goat anti Sox4 PAb (c-20) (Santa Cruz Biotechnology, sc-17326), Mouse anti

HA-Tag (6E2) ( Cell Signaling Technology, 2367S), Mouse anti GFP mAb (4B10) Cell

Signaling Technology, 2955S), and mouse IgG1 anti FLAG M2 Monoclonal Ab F1804

(Roche). For western blotting, the secondary HRP conjugated antibodies were purchased from Santa Cruz Biotechnology, including: Donkey anti-Goat HRP (sc-2020), Goat anti-

Rabbit IgG-HRP (sc-2004), Donkey anti Goat HRP (sc-2020), Goat anti-mouse IgG-HRP

(sc-2031). In imaging studies, the Syntenin primary antibody was used to visualize

subcellular localization was purchased from Abnova (SDCBP MaxPab rabbit polyclonal antibody (D01)). Cells interrogated for endogenous TRAF6 were probed with TRAF6

(H-274) sc-7221 Rabbit (Santa Cruz Biotechnology), Anti rabbit Alexa 488-conjugated secondary antibody were from Molecular Probes (Eugene, OR).

3.8 Immunoflourescent staining

To visualize the subcellular localization of endogenous proteins, cells were seeded onto Lab-Tec glass chambered cover slides (Nunc) the day prior to treatment.

Chambered slides were pretreated with either gelatin or matrigel (BD Biosciences). After relevant stimulatory conditions (6h-5 days), the culture media was removed by aspiration and cells were fixed using a 3.7 % formaldehyde solution made by diluting a 37% formaldehyde stock with 1x PBS that has been freshly diluted from 10x PBS and warmed to 37°C pre-warmed to 37°C for 10 minutes. 37% Formaldehyde solution (Sigma-

Aldrich catalog no. F-1268 or F-1635). In most cases, slides of fixed cells were treated with ProLong™ Gold antifade mounting solution (ThermoFisher Scientific) to suppress photobleaching and encourage signal preservation in case of long-term storage and analysis. ProLong™ Gold with DAPI (ThermoFisher Scientific Cat# P36935) was used to visualize the nuclei in experiments where necessary.

3.9 ELM Analysis

Many protein-protein interactions occur between large globular domains but an estimated 15-40% are mediated by functional microdomains of 3-10 amino acids in size called Short Linear Motifs (SLiMs) (Neduva and Russell 2006). These often occur in intrinsically disordered regions and are involved in a number of functions such as

binding, cleavage, subcellular targeting and posttranslational modifications. The ELM web server (http://elm.eu.org/) uses an algorithm that facilitates the exploration and identification of SLiM-mediated interactions within PPI networks. The website enables enquiries at the single protein level as well as within large-scale proteomic studies.

Therefore, ELM analysis is useful in guiding experimental studies and facilitating the analysis of pathways within PPI networks. The web server is freely available at http://i.elm.eu.org (Dinkel, Van Roey et al. 2014).

Un- FLAG- Dual- HA-tagged tagged tagged tagged Peptides Proteins Residues Proteins Proteins Proteins (KDa) (KDa) (KDa) (KDa) YFP 27 29 x 29 TRAF6 61 63 x 90 1-507 TRAF6ΔR 47 49 x 76 125-522 TRAF6C70 61 63 x 90 1-522 RZcc 42 44 x 71 1-358 Syn 33 35 36 63 1-298 SynΔN 20 x 21 48 110-298 SynΔP1 12 x 13 40 187-298 SynΔP2 18 x 19 46 1-193 SynΔP1+2 11 x 12 39 1-105 Sox4 47 x x x 1-474

Table 5 Calculated molecular sizes of un-tagged and dual-tagged TRAF6 and Syntenin proteins used in Co-IP and western blot analysis. The formula used for the calculation: M.W. = Numbers of residues X 0.117 kDa.

3.10 Neuronal Differentiation and quantitative morphology

A modified procedure adapted from Das et al. was used to assess differentiation and neurite outgrowth (Das, Freudenrich et al. 2004, Pool, Thiemann et al. 2008). 293 or

PC12 cells were plated onto 12-well tissue culture plates coated with 40 μg/mL of rat tail collagen Type I (Sigma, St. Louis, MO) according to the manufacturer-recommended procedure. Cells were plated at a relatively low density (2x103 cells/cm2) in DMEM/F12 medium containing 10%FBS, 2 mM HEPES, and 44 mM Na-bicarbonate. The next day after plating, the medium was replaced with serum free DMEM/F12 medium supplemented with 50 ng/mL NGF (human recombinant NGF, Sigma) and 0.25% bovine serum albumin (BSA; tissue culture grade from Sigma) with or without the pharmacologic inhibitors U0126, bisindolylmaleimide I (Bis I), or edelfosine (ET-18; all from Calbiochem, La Jolla, CA). Exposure to vehicle alone (culture medium) was used as the control. The cells were fed on Days 2, 4, and 6 by the addition of a concentrated stock of NGF for a final concentration of 50 ng/m. Neurite growth was determined by manually tracing the length of the longest neurite per cell (using NIH Image software) for all cells in a field that had an identifiable neurite and for which the entire neurite arbor could be visualized. Data from the two fields in each well were pooled, and each well was designated as a ‘‘n’’ of one. Experiments were repeated at least three times using cultures prepared on separate days.

3.11 RNA Expression analyses

1x106 cells were plated into 6-well plates (353846, FALCON). Following treatments, cells pellets were resuspended in 500µl of TRIzol reagent (15596-026,

Invitrogen). After addition of 170µl of Chloroform (C606-1, Fisher) samples were vortexed, incubated at room temperature for 15min, and centrifuged at 13000 RPM in

4°C for 15min. The aqueous layer was removed, combined with an equal volume of

Isopropanol (BP2632-4, Fisher), 1µl of Glycogen (9510, Ambion) and centrifuged at

13000RPM in 4°C for 10 min. Sample pellets were then washed with 500µl of 75%

Ethanol (111ACS200, Pharmaco-AAPER) and centrifuged for 10min in room temperature at 14000 RPM. Air-dried pellets were resuspended in 30µl of RNAse free water and subjected to DNAse treatments using Turbo DNA-free reagents (AM1907,

Ambion) according to the manufacturer instructions in order to eliminate genomic DNA contamination. RNA was converted to cDNA using GoScript Reverse Transcription

System (A5001, Promega). Relative expression levels were calculated using Ct method using B2M and 18srRNA as an endogenous controls. In certain experiments

RNA was directly subjected to an RT-PCR utilizing the Access RT-PCR system (A1250,

Promega). cDNA was analyzed using quantitative PCR (qPCR) carried out in a

StepOnePlus Applied Biosystems Real Time Instrument (40 cycles). Relative expression levels were calculated using Ct method.

Gene Forward Reverse hTRAF6 GTTGCTGAAATCGAAGCACA CGGGTTTGCCAGTGTAGAAT hSox4 ACCGGGACCTGGATTTTAAC AAACCAGGTTGGAGATGCTG hSDCBP GATAAAGCGCACAAGGTGCT CATTTCTGGCTGCAGAGCTA mTRAF6 TCCACACAATGCAAGGAGAA CCATGACCTCTTCGTGGTTT mSox4 CTCGTCCTCTTCCTCCTCCT GCCGGGTTCGAAGTTAAAAT mSDCBP CAACGGACAGAACGTCATTG GGTGTGATCCATCAGGCTTT

Table 6 mRNA analysis and qPCR primer sequences.

Chapter 4

RESULTS

4.1 IRAK1 modulation of TRAF6 auto-regulation and localization

4.1.1 Rationale

In 2010 our research group reported on the trans and cis intramolecular interactions between the TRAF6 RZ and MATH domains (Wang, Galson et al. 2010) and confirmed the homotypic RZ-RZ domain interaction demonstrated by others (Wooff,

Pastushok et al. 2004). The results of our study produced a model arguing that TRAF6 activity depends on interconversion between a “closed” inactive and an “open” active structure. Open TRAF6 can be “auto”-ubiquitinated, thus sustaining action upon other downstream proteins (Figure 4.1). While it is known that MyD88, TRAF6 and IRAK1 are all involved in TIR signaling to activate NF-κB, the full details of this process remain unresolved (Figure 4.2). Although the overexpression of MyD88, IRAK1 or TRAF6 can each individually as a dominant positive for NF-κB activity in 293 cells, it is has been demonstrated that IRAK1 and not MyD88 induces oligomerization of TRAF6, which is sufficient for signaling to JNK and IKK (Baud, Liu et al. 1999). Further, the X-ray crystal structures of TRAF2 and TRAF3, containing the coiled-coil and MATH

(ccMATH) domains, reveal that both proteins can form trimers associated via the coiled- coil domain (Park, Burkitt et al. 1999, Ni, Welsh et al. 2000). Strikingly, the published structure of TRAF6 contained only a MATH domain monomer, without a coiled-coil domain (Ye, Cirilli et al. 2002). It is unclear whether the omission in the crystallized

protein of the coiled-coil multimerization region during crystallization was intentional or necessary in order to produce a diffracting crystal. Glutaraldehyde crosslinking studies of purified TRAF proteins revealed both dimer and trimer forms for TRAF1, 2, and 3.

However, TRAF6 appeared to generate a complex and less-clear pattern of multimerization (Pullen, Labadia et al. 1999). The group that reported the TRAF6 monomeric structure generated a trimeric model of TRAF6 by graphical superimposition of the TRAF6 MATH domain backbone onto the 3-fold symmetry observed in the

TRAF2 structure (Ye, Cirilli et al. 2002, Ferrao, Li et al. 2012).

Figure 4.1 A Model for TRAF6 Activation and Inhibition by Intra and Extra Molecular Interactions. TRAF6 activity depends on interconversion between a “closed” inactive and an “open” active structure.

Figure 4.2 Map of TRAF6 Mediated LPS and IL-1 Signaling. TRAF6 plays central roles in response of LPS and IL-1 Signaling to nucleus. TIR sigaling involves recruitment of the adapter proteins myd88 and IRAK1 with recruit TRAF6 and promotes activation of transcription factors such as NF-κB, via IKK or by activating PI3 kinase, which can then activate the transcription factors AP-1 or C/EBPβ. These transcription factors acivate genes that lead to the production of pro-inflammatory cytokines.

One factor contributing to the challenges of crystallizing TRAF6 could be that the RZ-

MATH interaction is highly dynamic and the associated free energy is not favorable for crystal formation. In an effort to gain insight into the TRAF6 intramolecular interactions and also to understand why ectopic expression of TRAF6 acts as a dominant positive for

NF-κB, I hypothesized that IRAK1 activates TRAF6 by disrupting the intra/intermolecular RZ-MATH domain interaction, opening the “closed” TRAF6 structure. To investigate this, plasmids for full length TRAF6, the RZ domain of TRAF6 and IRAK1 were co-expressed in 293 cells. Since wtTRAF6 and the RZ are known to associate , it seemed likely that co-expression of IRAK1 would disrupt this interaction and permit visualization of the results by performing both co-Immunopreciptation experiments well as microscopic examination of the subcellular distribution for ectopically expressed chimeric fluorescently-labeled molecules (e.g., TRAF6-YFP, RZ-YFP, MATH-YFP, ccMATH-YFP and IRAK1-HcRed).

4.1.2 Subcellular Distribution of IRAK1 co-expressed with “open” and “closed” TRAF6

In agreement with previous reports, ectopic TRAF6-YFP was found to distribute to cytosolic speckles and several larger 1-2μm punctate in 293 cells while YFP was distributed diffusely throughout the cell (Figure 4.3A-B). Interestingly, in RAW264.7 cells, endogenous TRAF6 also displayed a pattern similar to that of ectopic TRAF6 in

293 with some additional aggregation in what appears to be the nucleus (Figure 4.3C).

Figure 4.3 IRAK1 Reduces the Number of Large TRAF6 Sequestosomes. A-B) confocal images show ectopic TRAF6 localized to sequestosome like cytoplasmic speckles or punctae. 40ng of either pFLAG-YFP or pFLAG-TRAF6-YFP was transfected into 293 cells seeded into a 24 well culture dish the prior day. C) Epiflourescent image of RAW264.7 cells stained for endogenous TRAF6. In pre- osteoclasts, TRAF6 appears to reside in cytoplasmic speckles, punctae or a nucleus- like structure (yellow wedges). In all conditions 3 independent biological replicates were conducted and several fields were taken at 200x. A representative subfield is displayed and scale bar: 20μm.

Our group previously demonstrated that the size of ectopic TRAF6 punctae correlates with TRAF6 induced NF-κB activity in a non-linear inverted U response (Wang, Galson et al. 2010). One hypothesis on the nature of these large punctae is that they are autophagic sequestosomes, targeting TRAF6 for recycling by the ubiquitin binding protein p62/SQSTM1 and various DUBs. To investigate this, p62-HcRed and TRAF6-

YFP were ectopically expressed in 293 cells and then examined by confocal microscopy as to their subcellular distribution. In agreement with our previous findings (Wang,

Galson et al. 2010), TRAF6-YFP colocalizes with p62-HcRed when co-expressed in 293 cells (Figure 4.4). ELM analysis reveals a canonical TRAF6 interaction motif in p62 at

AA positions 322-328, indicating the potential for p62 to interact with TRAF6 in a

MATH-dependent manner (Figure 4.5).

Figure 4.4 SQSTM1/p62 and TRAF6 Colocalize in Cytoplasmic Sequestosomes. 40ng of each expression plasmid was co-transfected into 293 cells. After 24h, confocal images of ectopic p62-HcRed1 (red) and TRAF6-YFP (green) were taken. At right, display of both red and green channels produces a merged image where yellow color represents co-localization of the two fluorescent-tagged proteins. Displayed image individual channels from a subfield from a collection of fields acquired from multiple fields taken from three independent experiments. Scale bar: 20μm.

Figure 4.5 Eukaryotic Linear Motif (ELM Analysis) for Protein Interaction Sites of Human p62/SQSTM1 (UniProt q13501). A) Interactive Summary and Graphic representation shows the canonical T6IM with favorable context toward the carboxy end of p62 B) Linear Sequence of T6IM within SQSTM1 and its positioning in at residues 320-328.

This comports with Sanz et al. who demonstrated that p62 interacts specifically with the ccMATH (TD) of TRAF6 and not TRAF2 (Sanz, Diaz-Meco et al. 2000); although, they identify the region 228-254 as necessary for p62 binding TRAF6. Additionally, in their study, TRAF6 and p62 only co-localized upon IL-1 stimulation in HepG2 cells. They suggested that adding IL-1 was necessary to increase the endogenous concentrations of

TRAF6 and IRAK1, but another possibility could be the need for an “open” TRAF6 structure, where IL-1 recruits IRAK1 to activate TRAF6 and expose its TIM binding

groove to interact with p62/SQSTM1. To address this, TRAF6-YFP, ccMATH-YFP or

MATH-YFP was ectopically expressed in in 293 cells. As expected, punctae were only visible with the addition of TRAF6-YFP, while ectopic ccMATH-YFP or MATH-YFP do not localize to punctae because they presumably inactivate TRAF6 ubiquination events and block NF-κB activity (Figure 4.6). Co-expression of ectopic RZ or IRAK1 with TRAF6-YFP was found to reduce the number of cells that display large TRAF6 punctae or the number of punctae per cell respectively (Figure 4.6). This modulation of sequestosome size or number can be correlated with the NF-κB activity, in luciferase reporter assays where transfecting mTRAF6 + IRAK1 into 293 cells synergize, super- activating NF-κB, while transfecting RZ + mTRAF6 decreased NF-κB, activity by ~10% as compared to mTRAF6 alone (Figure 4.7). Interestingly, the addition of both RZ and

IRAK1 with TRAF6-YFP completely abolished the formation of sequestosomes (Figure

4.6, left column). On the other hand, neither RZ nor IRAK1 was able to induce TRAF6 punctae when co-expressed with either ccMATH- or MATH-YFP (Figure 4.6). While deletion of the RZ domain seemed to be sufficient to disrupt punctae formation, in some cases punctae were still formed when either ccMATH-YFP or MATH-YFP coexpressed with IRAK1-HcRed (Figure 4.8). Here, coexpression of ectopic IRAK1-HcRed along with either the ccMATH-YFP or MATH-YFP in 293 cells revealed colocalization of

IRAK1-TRAF6 mutein pairs into cytosolic sequestosomes (Figure 4.8). When IRAK1-

HcRed was coexpressed with only RZ-YFP, devoid of the MATH domain, there was no colocalization (Figure 4.8).

Figure 4.6 IRAK1 Opens TRAF6, Inducing Localization to Large Sequestosomes. 24 hours prior to transfection, 293 cells were seeded into 24 well tissue culture plates and then transfected the next day with 40ng of each indicated plasmid with each condition receiving 120ng of total plasmid DNA. Adding an appropriate amount of pFLAG-CMV5 empty vector equalized differences in total DNA. Epiflourescent images demonstrate that ectopic TRAF6 localizes to cytosolic speckles or punctae. Co-expression of either the RZ domain or IRAK1 with wtTRAF6 reduces the number of large punctae, but addition of both RZ + IRAK1 completely abrogated sequestosome formation.

Since, sequestosomes correlate with excessively ubiquitinated TRAF6 and/or other interacting proteins which inhibit TRAF6 (Wang, Galson et al. 2010), a decrease in sequestosomes can be understood to result from co-expression of a TRAF6: RZ or

IRAK1 activation pair. The co-localization of the punctae with the protein p62/SQSTM1 and the finding that IRAK1 plus the RZ domain together disrupt the punctae, suggests that the punctae are sequestosomes, p62-rich proteasome-like structures, which are induced by an open-active TRAF6. Overexpression of inactive mutants displayed little or no sequestosome formation. Collectively, these results demonstrate that IRAK1 colocalization with TRAF6 in the cytoplasm depends on the presence of the TRAF6 MATH domain and TRAF6 punctae are sequestosomes that can be induced by TRAF6 activation.

) )

6 6 2.5 -

2.0

1.5

1.0 κB activity (RLU x 10 10 x (RLU activity κB

- 0.5 NF

Figure 4.7 IRAK1 Synergizes with TRAF6 Dominant Positive while Coexpression of a RZ Mutein with TRAF6 inhibits NF-κB Activity. 25ng of each plasmid was cotransfected with 25ng of NF-κB, Luciferase reporter into 293 cells seeded into 96 well tissue culture plates the previous day. 24 hours after transfection cells were harvested and assayed for luciferase signal. A representative experiment is shown for the results of least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.).

Figure 4.8 IRAK1 and MATH Domains Colocalize. Expression plasmids (40 ng/each) coding for IRAK1-HcRed and TRAF6-YFP muteins were co-transfected into 293 cells according to procedures described in Materials and Methods. Left panels display merged two color confocal mages which are representative subfields taken from three independent experiments. Correlating highlighted insets are magnified at right and channels split into green (YFP), red (HcRed), and merged where yellow represents colocalization.

4.1.3 TRAF6 RZ and MATH domain interact via the MATH TIM

In order to correlate our microscopic observations with direct evidence for a physical interaction between IRAK1 and the MATH domain of TRAF6, immununoprecipitation experiments were designed according to the rationale diagramed in Figure 4.9. Reasoning that TRAF6 may form homotypic interactions between its RZ- and either the RZ or MATH domain, I anticipated that an untagged-tagged RZ mutein

(RZ) would exhibit increased binding to FLAG-tagged TRAF6-YFP (F-TRAF6-YFP) with two acceptor sites vs. a FLAG-ΔR-YFP mutein (F-ΔR-YFP) or C70A-YFP mutein which has been previously demonstrated to exhibit an impaired RZ-RZ interaction

(Wooff, Pastushok et al. 2004).

Figure 4.9 Model of IRAK1 Disruption of TRAF6 RING-MATH Interaction as Revealed by Immunoprecipitation.

Predictably, ectopic IRAK1 was found to disrupt the wtTRAF6 interaction with a RZ mutein (Figure 4.10, Table 5). In the left panel, two RZ western signals are detected following IP with a FLAG antibody and immunoblotting with an antibody (Santa Cruz

Figure 4.10 IRAK1 Disrupts RZ-MATH interaction (Western blot of IP). A) Left panel indicates increased RZ western signal with the addition of IRAK B) Right panel is a separate control IP/IB that confirms identity of TRAF6 species in top band. HC*: Heavy Chain IgG LC*: Light chain IgG. In both western blots, whole cell lysates (WCL) extracted from 293 cells transfected with 1μg of each indicated plasmid were harvested 24h after transfection, incubated with FLAG antibody and prepared for western blot analysis. PVDF membranes containing 50μg of WCL protein were then probed with TRAF6 (directed at the RZ) or FLAG antibody. A representative blot of two independent experiments is shown.

sc-H274) that recognizes an epitope corresponding to amino acids 1-274 of TRAF6 or the

RZ domain. These two bands represent the RZ mutein (lower) and dual tagged F-ΔR, -

C70A or -TRAF6-YFP (upper). There is an obvious increase in ectopic RZ mutein signal between lanes 1&4, which is greater than that seen between lanes 2&5 or 3&6. In the right panel (a different membrane in which samples from the same WCL were immunoprecipitated with FLAG antibody, then immunoblotted with FLAG antibody before transfer to the PVDF membrane) no RZ western signal e.g. a lower band is detected and serves as a control. The untagged RZ mutein cannot be precipitated with

FLAG antibody and thus the dual tagged TRAF6 muteins are visualized as higher bands that correspond to their molecular weights (Table 5). Insomuch, adding IRAK1 increased the RZ mutein western blot signal, demonstrating that wtTRAF6 but not ΔR autoinhibition was overcome, increasing mutein RZ binding to both the RZ or MATH domains of FLAG tagged TRAF6 (Figure 4.10). This result supports the hypothesis that

IRAK1 activates TRAF6 by disrupting the RZ and MATH domain association via the

MATH domain TIM recognition groove. Moreover, there exists a putative T6IM in the

RING domain of TRAF6, as revealed by ELM analysis and scrutiny of the primary sequence (Figure 4.11). This previously unreported RING domain T6IM is modeled in

Figure 4.12 and could be the basis for a direct TRAF6 RZ-MATH interaction. Such an interaction would support a structurally “closed” inactive TRAF6 molecule.

Interestingly, this T6IM is adjacent to the cysteine at position 70 (C70) that has been identified as the critical residue for recruiting the E2 ubiquitin conjugase, Ubc13 (Yin,

Lamothe et al. 2009). The integrity of the Zn2+ finger motif within the RING domain has been shown as necessary to function and mutation of C70 (TRAF6-C70S) abolishes

interaction of TRAF6 with Ubc13 (Wooff, Pastushok et al. 2004). Relatedly, the

TRAF6-C70A mutant inhibited TRAF6 autoubiquitination (Lamothe, Besse et al. 2007).

In our Co-IP experiment, substituting a ΔR (125-522) deletion mutein for wtTRAF6 produced an overall decrease in RZ mutein signal on Western blot (Figure 4.10), both with and without IRAK1 coexpression. However, adding IRAK1 clearly increased the free RZ signal in a manner similar to that of wtTRAF6. Using the C70A mutein in place of wtTRAF6 did not show any differences in IRAK1 modulation of RZ binding to the

MATH domain of TRAF6. Given that addition of a TIM peptide is insufficient to activate TRAF6 (Poblenz, Jacoby et al. 2007), along with the results in this section, it seems that IRAK1 activation of TRAF6 depends on factors beyond simple TIM groove occupation and RZ-MATH dissociation.

Figure 4.11 ELM Analysis Shows TRAF6 Primary Amino Acid Sequence Contains a TRAF6 Interaction Motif Sequence in Its RING Domain. A) Analysis for Q9Y4K3 (human TRAF6) shows global protein domain structure and various motifs within linear sequence B) sequence for RING domain of human TRAF6 underlined peptide represents internal T6IM peptide.

Figure 4.12 Molecular Modeling of TRAF6 RING Structure Featuring aa63-69 Putative TIM Sequence. A) Peptide backbone and B) van der Waals space fill structures indicating the putative TIM amino acids. C) Peptide backbone structure (Red) with TIM amino acid side chains presented as van der Waals space fill. RING finger cysteine side chains are presented as yellow tubes with coordinated Zn (Green spheres). Space fill amino acid side chains are colored according to the Shapely standard: http://life.nthu.edu.tw/~fmhsu/rasframe/COLORS.HTM.

4.2 Super-stimulatory effects of ligands demonstrate bimodal inhibition of TRAF6

While some details have emerged, the molecular mechanism by which endogenous TRAF6 is activated by upstream factors has not yet been fully determined.

In agreement with others, I found that ectopic expression of MyD88, IRAK1 or wtTRAF6 acts as a dominant positive for Upstream activators potentiate TRAF6 dominant positive when co-expressed. NF-κB activity resulting from co-transfection in

293 cells with indicated expression vectors, and the luciferase reporter previously described (Wang, Wara-Aswapati et al. 2006). In agreement with others, I found that ectopic expression of any of these three molecules acts as a dominant positive for NF-κB activity in 293 cells (Figure 4.13) (Walsh, Kim et al. 2008, Wang, Galson et al. 2010).

Figure 4.13 Ectopic Expression of TRAF6, IRAK1, or MyD88 is capable of Activating NF-κB. 293 cells were co-transfected with 25ng of indicated expression vectors and 25ng NF-κB-Luciferase reporter.

Predictably, titrating increasing amounts of TRAF6 (Figure 4.14A) or RZcc (Figure

(4.14B) acted as a dominant positive with maximal stimulation occurring abruptly in both cases at high concentration of plasmid, while transfecting a control empty vector had no affect on NF-κB activity. Overexpression allows TRAF6 to act as a surrogate for receptor-dependent upstream stimulation in various NF-κB signaling pathways. To test the hypothesis that overexpression of TRAF6 was effectually titrating out an inhibitory molecule(s), I reasoned that NF-κB activity in either RAW264.7 or 293R cells induced by a minimal amount of ectopic TRAF6, could be increased by addition extracellular stimulatory ligands IL-1β (Figures 14.15) or LPS (Figure 14.16B) to levels greater than the saturation point achieved by ectopic TRAF6 alone. Interestingly, “super-stimulation” by IL-1β in 293R averaged unimpressive 1.5x increases over saturated dominant positive activity induced by transfecting saturating amounts of TRAF6 (100ng) alone but costimulation with minimal dose of activating TRAF6 (20ng) or RZcc (10ng) produced a

5-7x “super-stimulation” (Figure 4.15). This supports the model that ectopic TRAF6 or

RZcc acts as a dominant positive by overcoming the stoichiometry of putative inhibitory proteins interacting that attenuate TRAF6. Unexpectedly, ectopic expression of TRAF6 alone in the pre-osteoclast cell lines, 4B12 (Figure 4.16A) or RAW264.7 (Figure 4.16B) did not have a dominant effect for NF-κB activity. Despite the unresponsiveness of both pre-osteoclast lines to ectopic TRAF6, NF-κB activity was still inducible by LPS stimulation or transfection of the NF-κB-p65 subunit itself (Figure 4.16B). Furthermore,

IL-1β activity in RAW264.7 cells was normal, increasing in response to LPS stimulation

A ) )

7 293T - 4.0

3.0

2.0 κB activity (RLU x 10 10 x (RLU activity κB

- 1.0 NF

EV 10 20 50 100 200 TRAF6 (ng)

293T 7 ) ) 7 - 5.0

4.0

3.0

2.0 κB activity (RLU x 10 10 x (RLU activity κB

- 1.0 NF

EV 10 20 50 100 200 RZcc (ng)

Figure 4.14 Ectopic expression of either A) TRAF6 or B) RZcc (1-358) acts as a dominant positive for NF-κB activity in a dose dependent manner in 293T epithelial cells co-transfected with a NF-κB–Luciferase reporter. A representative experiment is shown for the results of at least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.). EV: Empty expression vector control.

Figure 4.15 Co-stimulation of 293R cells expressing TRAF6 and RZcc with IL-1β and “super-stimulates” NF-κB Activity. Stably transfected 293 cells expressing the IL-1 receptor (293R) were stimulated with IL-1β (10ng/mL) for 6-8 hours 24h after transfection of A) TRAF6 or B) RZcc as indicated and 25ng NF-κB luciferase rporter prior to preparation for luciferase assay. A representative experiment is shown for the results of at least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.) and fold increase with co-stimulation. EV: Empty expression vector control.

Figure 4.16 TRAF6 Does Not Act as a Dominant Positive for NF-κB Activity in Pre- osteoclast Cells A) 4B12 and B) RAW264.7. 4B12 or RAW264.7 cells were co- transfected with 25ng NF-κB–Luciferase reporter and TRAF6 or p65 (25ng) as indicated and then in the case of RAW264.7 cells stimulated with LPS (100ng/mL) for 6-8 hours 24h after transfection prior to harvesting for luciferase analysis. A representative experiment is shown for the results of at least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.). EV: Empty expression vector control.

as monitored by transfecting either a XN- or XT- IL-1β Luciferase reporters (Figure

4.17). Of these two constructs, the XN IL-1β -Luc, which is driven by an IL-1β promoter that contains elements that run downstream to the site of the IL-1β promoter, has nearly three fold greater activity than that of the XT IL-1β promoter when induced by LPS in

RAW264.7 cells (Figure 4.17). Thus, a model emerges where over-expression of TRAF6 has two modalities for increasing NF-κB activity: (1) It can shift the equilibrium of

TRAF6 toward the open active conformation previously reported by our laboratory

(Wang, Galson et al. 2010) and (2) titrate out the inhibitory effects of inhibitory molecules that depend upon TIM interaction. To address the possibility that murine

RAW264.7 cells were unresponsive to ectopic wtTRAF6 (human) due to species-specific differences between RAW264.7 and 293 (human) cell lines, both murine (Figure 14.18A) and human (Figure 14.18B) wtTRAF6 were separately transfected into RAW264.7 cells.

Here, ectopic expression of neither species of TRAF6 sequence activated NF-κB. Any

“super-stimulatory” effect when co-stimulated with LPS was also absent (10ng/mL)

(Figure 4.18A, 4.18B). Additionally, in a manner similar to results when transfecting 293 cells, NF-κB was activated in RAW264.7 cells transfected with IRAK1 (Figure 4.19A).

This suggests a difference in IRAK1 signaling downstream to TRAF6 between the epithelial/neuronal (293) and macrophage-monocyte/pre-osteoclast (4B12 and

RAW264.7) cell lines used in this study. Interestingly, while ectopic expression of wtTRAF6 was not effective at inducing NF-κB in RAW264.7 and 4B12, transient transfection of RZcc was able to activate NF-κB in both cell lines (Figure 4.19B, 4.19D).

As expected, stimulating RAW264.7 with either IL-1β (Figure 4.19B) or RANKL

(Figure 4.19C) was found to actuate NF-κB.

Figure 4.17 LPS induces IL-1β activity in pre-osteoclast RAW264.7 cells. RAW 264.7 were transfected with 25 ng/well of either XN- or XT- IL-1β Luciferase reporters or PGL3 luciferase empty vector (EV) and then stimulated for 6hrs with LPS (10ng/mL) 24h post transfection before harvested for bulk luciferase assay. A representative experiment is shown for the results of least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.). EV: Empty expression vector control.

However, co-stimulation with RZcc + IL-1β/RANKL had a greater effect than costimulation with TRAF6 + IL-1β/RANKL supporting previous reports that the MATH domain is inhibitory (Figure 14.19B, 14.19C) (Ye, Arron et al. 2002, Poblenz, Jacoby et al. 2007, Wang, Galson et al. 2010, Trudeau, Nassar et al. 2013). Collectively, these results suggest that the MATH domain of TRAF6 possesses some inhibitory character, which may be attributed to either auto-regulation and/or an exogenous inhibitor that could depend on a T6IM interaction (Table 7). Deleting the MATH domain abrogated

TIM-based inhibitory protein interaction with TRAF6 and increased NF-κB activation

(Figure 4.15, 4.19).

293 RAW264.7 4B12

pre-neuronal pre-osteoclast pre-osteoclast

TRAF6 YES NO NO

RZcc YES YES YES

Table 7 Summary of TRAF6 dominant positive activity in various cell lines. Full TRAF6 acts as a dominant positive for NF-κB activity in 293 epithelial but not pre- osteoclast cell lines 4b12cand Raw264.7.

Figure 4.18 LPS or ectopic p65 but not ectopic TRAF6 induces NF-κB activity in murine RAW264.7 cells regardless of any species differences in human and murine TRAF6 sequences transfected. 25ng of p65 or indicated amounts of TRAF6 were transfected with 25ng of NF-κB luciferase reporter and appropriate amounts of pFLAG empty vector so that total DNA transfected totaled 150ng/well. Cells were stimulated with LPS the next day for 8 hours then assayed for luciferase activity. A- B) A representative experiment is shown for the results of least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.).

Figure 4.19 RZcc acts as a dominant poistive in AW264.7 and 4B12 cells. NF-κB is activated by ectopic IRAK1 or stimulation by IL-1β/RANKL in RAW264.7 cells; additinally, ectopic RZcc expression can activate NF-κB in 4B12 and RAW264.7 cells. A) RAW264.7 cells were co-transfected with 25ng of each indicated plasmid and 25ng of NF-κB–Luciferase reporter B) RZcc or wtTRAF6 was transfected as indicated along with and 25ng of NF-κB–Luciferase reporter and then co-stimulated with 100ng/mL IL-1β 24 hours post transfection for 8 hours prior to harvesting fro luciferase assay. C) RAW 264.7 cells were transfected with 25ng of indicated plasmids and 25ng of NF-κB–Luciferase reporter 24h prior to stimulation with 50ng/mL RANKL the following day for 6 hours before preparation for luciferase assay. D) 4B12 cells were transfected with indicated amounts of RZcc and 25ng of NF-κB–Luciferase reporter before harvesting for luciferase assay the following day. A-D) A representative experiment is shown for the results of least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.). EV: Empty expression vector control.

4.3 Molecular Dynamics of TRAF6-Syntenin Interaction

4.3.1 Syntenin inhibition of NF-κB activators

Seminal work characterizing the ability for a human homologue of the Drosophila Toll protein to activate NF-κB utilized ectopic expression of a constitutively active CD4/human Toll receptor construct (Medzhitov, Preston-Hurlburt et al. 1997, Medzhitov, Preston-Hurlburt et al. 1998). Later, overexpression of CD14,

TLR4, and MD-2 was reported to confer LPS sensitivity to otherwise LPS-unresponsive

293T cells, without disrupting the induction of LPS tolerance (Medvedev and Vogel

2003). In contrast to these studies, I found that ectopic expression of TLR4 alone acts as a dominant positive for NF-κB activity in 293T cells (Figure 4.20A). As such this system allowed me to dispense with the need to initially transfect TLR4 into 293 cells so that

LPS could be used to induce NF-κB activity. Instead attenuation of TLR4 signaling by

Syn was assessed by mere coexpression of Syn and TLR4 in 293 cells. Coexpression of

Syn was found to inhibit ectopic TLR4 induced NF-κB activity (Figure 4.20B). Further,

Syn was found to inhibit NF-κB activity in IL-1β stimulated 293R cells (Figure 4.21A) in a dose dependent manner (Figure 4.21B). As with TLR4, ectopic Syn also inhibited the

NF-κB activity in LPS, IL-1β or RANKL stimulated RAW264.7 cells (Figure 4.22).

Beyond inhibition of NF-κB signaling initiated by the cell surface receptors, NF-κB activity induced in 293T cells transfected with the intracellular activator MyD88 was also inhibited by Syn in a dose-dependent manner (Figure 4.23A). Interestingly, although ectopic TRAF6 fails to act as a dominant positive in RAW264.7 cells, transecting IRAK1 instead was found to induce NF-κB activity. Such NF-κB activity induced by dominant

positive amounts of IRAK1 In 293T cells was attenuated by coexpression of Syn (Figure

14.23B). Finally, in agreement with Chen et al., ectopic expression of Syn attenuated dominant positive TRAF6 activation of NF-κB in 293 cells (Figure 4.24A). TRAF6 dominant positive activity in 293T cells was not affected by the addition of EYFP to the carboxy terminus of the molecule. Moreover, the fluorescent chimera could be inhibited by ectopic GFP-Syntenin (Figure 4.24B).

Figure 4.20 Syntenin can block NF-κB activity induced by dominant positive ectopic expression of TLR4 in 293T cells. A) 293T cells were transfected 25ng NF-κB luciferase reporter and indicated amounts of HA-TLR4 and then prepared for uciferase assay 24 hours post transfection. B) 293T cells were transfected with 150ng of TLR4 and 50ng of Syn or pHA empty vector (EV) 24 hours prior to luciferase assay. A representative experiment is shown for the results of least three biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.).

Figure 4.21 Syntenin inhibits IL-1β activation of NF-κB in 293R cells. A) Optimization for IL-1β stimulation of 293R cells transfected with 25ng NF-κB luciferase reporter and stimualtd the next day for 8 hours prior to luciferase assay. B) 293R cells expressing the IL-1 receptor were co-transfected with indicated amounts of Syn and 25ng of with 25ng NF-κB luciferase reporter, then simulated with stimulated with IL-1β (10ng/mL) for 6-8 hours 24 h post-transfection. Bars are quantification of (average±s.d.) for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

Figure 4.22 Syn inhibits NF-κB activity induced by LPS, IL-1β or RANKL stimulated RAW264.7 cells but not NF-κB activity induce by dominant positive RZcc. RAW264.7 cells were co-transfected with either 100ng pFLAG-RZcc, 25ng of mSyn or pFLAG empty vector and 25ng of NF-κB–Luciferase reporter and then co- stimulated with 100ng/mL IL-1β. 50ng/mL RANKL or 100ng/mL LPS 24 hours post transfection for 8 hours prior to harvesting for luciferase assay. A representative experiment is shown for the results of at least three qualitatively similar biological replicate experiments and quantification as indicated for three experimental replicates (average±s.d.).

100

Figure 4.23 Syntenin attenuates NF-κB activity induced by ectopic expression of MyD88 and IRAK1 wchih signal upstream of TRAF6. A) 293T cells were seeded into 96 well plates 24 hours prior to transfection with 50ng of expression plasmid of MyD88 along with 25ng NF-κB Luciferase reporter and indicated amounts of murine Syntenin expression plasmid. Cells were harvested and processed for Luciferase Reporter Assay 24 hours following transfection. B) RAW264.7 were seeded in 96 well plates 24 hours prior to transfection. 50ng of each Indicated plasmid was transfected along with 25ng of NF-κB Luciferase reporter and pcDNA3.1 was used to equalize total transfected DNA to 200ng. Bars are quantification of (average±s.d.) for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

101

Figure 4.24 Syntenin attenuates NF-κB activity induced by ectopic expression of TRAF6. A) 293 cells were seeded into 96 well plates 24 hours prior to transfection with 50ng of expression plasmid of TRAF6 along with 25ng NF-κB Luciferase reporter and indicated amounts of murine Syntenin expression plasmid. Cells were harvested and processed for Luciferase Reporter Assay 24 hours following transfection. B) 293T cells were seeded into 96 well plates 24 hours prior to transfection with 50ng of expression plasmid of TRAF6-EYFP along with 25ng NF- κB Luciferase reporter and 50ng of GFP-human Syntenin expression plasmid. Cells were harvested and processed for Luciferase Reporter Assay 24 hours following transfection. and pEYFP was used to equalize total transfected DNA to 200ng. Bars are quantification of (average±s.d.) for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

102

4.3.2 Molecular Domains involved Syntenin-TRAF6 interactions

I hypothesized that Syn associated with TRAF6 via a putative T6IM at amino acids (194-200) in the unstructured linker region between the tandem dual PDZ domains of Syn to inhibit TIR signaling (Figure 10). The C-terminal TRAF6 MATH domain, which is often defined as a structure involved in the integration of upstream receptor- proximal signals, has also been reported to be involved in downstream signal transduction. Examples include RANK ligand signaling through its receptor in osteoclasts ((Wong, Besser et al. 1999)) and the super-activation of NF-κB p65 homodimers by IL-1 (Yoshida, Kumar et al. 2004). To test this, NF-κB Luciferase reporter assays were carried out on 293T cells co-expressing ectopic RZcc and Syn.

Surprisingly, ectopic Syn was also able to inhibit NF-κB activity induced by dominant positive ectopic RZcc (Figure 4.25A), which lacks the MATH domain and does not possess a T6IM interaction site. This phenomenon was independent of the species sequence of transfected Syn (Figure 4.25B). Next, TRAF6 was coexpressed with a series of Syn deletion muteins systematically testing which functional domains of Syn were necessary for inhibiting TIR signaling. Deletion of amino acids 194- 298 of Syn

(ΔPDZ2) minimally abrogated Syn inhibition of dominant positive TRAF6-activated NF-

κB signaling (Figure 4.26). In contrast, deleting both PDZ domains and the CTD

(ΔPDZ1+2) of Syn did not inhibit the NF-κB signal, but in some cases increased the signal to suprathreshold levels beyond ectopic TRAF6 alone (Figure 4.26A). Deletion of

1-109 (ΔN) retained WT-like activity, whereas deletion of 1-192 (ΔPDZ1) was super-

103

Figure 4.25 Syntenin attenuates NF-κB activity induced by ectopic expression of RZcc. A) 293T cells were seeded into 96 well plates 24 hours prior to transfection with 50ng of expression plasmid of RZcc along with 25ng NF-κB Luciferase reporter and indicated amounts of murine Syntenin expression plasmid. Cells were harvested and processed for Luciferase Reporter Assay 24 hours following transfection. B) 293 cells were seeded into 96 well plates 24 hours prior to transfection with 50ng of expression plasmid of either TRAF6 or RZcc along with 25ng NF-κB Luciferase reporter and 50ng of either murine or human Syntenin expression plasmids as indicated. Cells were harvested and processed for Luciferase Reporter Assay 24 hours following transfection. and pEYFP was used to equalize total transfected DNA to 200ng. Bars are quantification of (average±s.d.) for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

104

Figure 4.26 The CTD Is The Dominant Factor In Syn Attenuation Of TRAF6 Signaling. CTD And NTD Of Syntenin Can Attenuate TRAF6 Induced NF-Κb Signal. A) 293T cells were transfected with 25ng indicated plasmids and 25ng NF- κB reporter 24 before preparation for luciferase assay. Bars are quantification of (average±s.d.) for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates. B) schematic of TRAF6 and Syn plasmids used. Human plasmids were tagged with either a 9aa HA tag or an 8aa FLAG tag as indicated.

105

inhibitory, similar to the mSyn effect. Collectively, these data suggest that the sequence between 193 and 298 is responsible for TRAF6 inhibition, with 1-192 possibly providing some intra-molecular regulation of ΔPDZ1. To support the results from the activity assays for the Syn deletion muteins Co-IP experiments were preformed with HA-tagged versions of Syn in order to determine whether the putative T6IM of Syn was sufficient for TRAF6 binding. Strikingly, only full length Syn was found to physically interact with TRAF6 (Figure 4.27). This could suggest that only full-length Syn binds to TRAF6, but that the inhibitory activity is associated with some other signaling component.

4.3.3 Syntenin inhibits TRAF6 in an Ubiquitin-dependent manner

The NTD of Syn was recently shown to contain 3 novel Ub binding motifs, which interact with the carboxy-terminal region of ubiquitin via a non-covalent interaction

(Okumura, Yoshida et al. 2011, Rajesh, Bago et al. 2011). To understand how the ubiquitination state of TRAF6 might affect interaction with Syn regulation of TRAF6, ectopic lysine-deficient TRAF6ΔK (Walsh, Kim et al. 2008) was transfected in 293 cells and NF-κB activity measured by the NF-κB Luciferase reporter assay (Figure 4.28A).

Ectopic Syn was less effective at inhibiting dominant positive NF-κB activity by

TRAF6ΔK, as compared to inhibition of wtTRAF6. Further, over-expression of Syn deletion muteins with TRAF6ΔK revealed a nearly opposite effect as compared to wtTRAF6. While, the PDZ2 (+CTD) of Syn seemed to be sufficient for inhibition of wtTRAF6, the Syn CTD (deletion muteins that lacked the NTD and (ΔN and ΔPDZ1) were unable to attenuate TRAF6ΔK induced NF-κB activity. Meanwhile, ΔPDZ2 and

106

Figure 4.27 Only full length Syn was found to interact with TRAF6. A) 293 cells were seeded into 6 well plates and transfected with 1μg FLAG-TRAF6 and 1μg indicated HA-tagged Syntenin construct. Western blots containing 50 μg protein of whole cell lysates (WCL) of 293 cells harvested 24h after transfection of indicated plasmids. Lysates supernatants were incubated with anti-FLAG agarose beads for 6 hours at 4°C. Absorbed proteins were eluted and denatured by 1x SDS-PAGE buffer and β-mercapto ethanol at 95°C and then prepared for western blot. Proteins were resolved on a 4-12% gradient gel and transferred onto a PVDF membrane. Membranes were blotted with LEFT) anti-FLAG antibody or RIGHT) anti-HA antibody. A representative blot of two independent experiments is shown. Left panel indicates sucessful FLAG-TRAF6 precipitation, right panel indicates that only full length HA-Syn co-immunoprecipitated with FLAG-tagged TRAF6.

107

ΔPDZ1+2 were yet able to inhibit TRAF6ΔK induced NF-κB activity (Figure 4.28B).

This result, taken together with previous reports, supports that the NTD of Syntenin interacts with ubiquitinated TRAF6 i.e. an active “open” TRAF6 (Wang, Galson et al.

2010) rather than “closed” un-ubiquitinated TRAF6.

4.3.4 Inhibition of Src Family Kinase increases Syn attenuation of TRAF6 induced NF-κB activity

Syn has been reported to activate NF-κB by binding to c-Src, inducing downstream target genes leading to cell migration and invasion (Boukerche, Aissaoui et al. 2010). Classically Src has been found to be neither necessary nor sufficient for NF- kB activity, only increasing the activity of NF-B over that derived by IKK-dependent release of IB by activation of PI-3K and Akt/PKB (Madrid, Mayo et al. 2001, Storz,

Doppler et al. 2004, Wang, Wara-Aswapati et al. 2006). Presumably, TRAF6 can further activate NF-B via c-Src in this manner. Additionally, TRAF6 and c-Src induce synergistic AP-1 activation via a PI3-kinase-AKT-JNK pathway (Funakoshi-Tago, Tago et al. 2003). However, at least one report implicates c-Src directly activating NF-B during hypoxic conditions via mROS (Funakoshi-Tago, Tago et al. 2003, Lluis, Buricchi et al. 2007). In some of our NF-B luciferase assays, Syn appeared to inhibit TRAF6 with a nonlinear dose response (Figure 4.29A). When Syn was overexpressed in 293 cells, it appears to activate NF-κB in an inverted U dose response with a peak centered in low concentrations (Figure 4.29A). It is possible that ectopic Syn inhibits TRAF6 only

108

Figure 4.28 Syntenin inhibits TRAF6 in an Ubiquitin-dependent manner. A) Values represent NF-κB activity resulting from co-transfection in 293 cells with indicated amounts of mTRAF6 or mTRAF6ΔK, 50ng mSyn and 25ng NF-κB luciferase reporter. A) A lysine deficient TRAF6 is inhibited less as compared to wtTRAF6 by Syntenin. B) Syn ΔN is less effective at inhbiting TRAF6ΔK vs wtTRAF6. Suggesting that the N terminus may bind to Ubiquinated, activated TRAF6. 293 cells were transfected with 25ng mTRAF6 or mTRAF6ΔK, 50ng of indicated Syntenin mutein and 25ng NF-κB luciferase reporter. Bars are quantification of (average±s.d.) for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

109

when the amount corresponds to activated “open” TRAF6 with proper stoichiometry, due to it’s own ability to activate NF-κB. To investigate this further, I sought to remove the downstream activation of Src. First, I determined the effect of PP2, a selective inhibitor of Src family kinase (SFK) members (Hanke, Gardner et al. 1996), on activation of the

NF-B pathway (Figure 4.29B-D). Indeed, ectopic Syn was found to activate NF-κB as a dominant positive in 293T cells and this activity was inhibited by addition of PP2 (Figure

4.29B). Notably, this Src-dependent activity did not have a comparable dose response.

When PP2 was added to 293 cells transfected with a dominant positive amount of

TRAF6, there was an order of magnitude less NF-κB activity, and Syntenin was found to inhibit TRAF6 induced NF-κB activity, regardless of the presence of the PP2 inhibitor

(Figure 4.29C, 4.29D). Interestingly, inhibition of Src Family Kinases by PP2 was found to exaggerate the ectopic Syntenin-dependent attenuation of TRAF6-activated NF-κB activity by six fold in a more linear manner, supporting the hypothesis that Syn inhibition of TRAF6 has a stoichiometric mechanism, possibly due to the mutual activation of Src by both TRAF6 and Syn.

110

111

Figure 4.29 Pharmacological inhibition of Src Family Kinases increases the attenuation of TRAF6 induced NF-κB activity by ectopic Syntenin. A) Ectopic exprsssion of Syntenin activates NF-κB in a Src dependent but Syn inhibits distinct dose response. A) 293 cells transfected with indicated amounts of HA-Syntenin and 25ng NF-κB luciferase report activates NF-κB at low dosage B) 293T cells were plated 24 hours prior to trasnfected with indicated amounts of HA-Syn or EV: pHA empty vecotor and 25ng NF-κB uciferase reporter, 6 hours after transfection cells were treated with Src inhibitor PP2 (10μM) and allowed to rest O.N. before luciferase assay C) PP2 inhibits TRAF6, attenuation of TRAF6 dominant positive is by Syntenin is not affected by PP2 treatment. 25 ng of Syn and or TRAF6 were transfected into 293T cells and treated with PP2 to a final concntration of 10μM as indicated 6 hours after transfection. D) Normalized values indicating effect of PP2 upon Syn attenuation of TRAF6 induced NF-κB acttivty in 293 cells transfetd with 25ng TRAF6 and indicated amounts of mSyn. Cells were treated with PP2 as indicated to a final concentraion of 10μM. Values are quantified as average±s.d. for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

112

4.3.5 Syntenin can relocalize TRAF6 to the nucleus

Although TRAF6 is typically located in the cytosol in order to act as a signal transducer in the TIR signaling pathway, there have been reports of intranuclear TRAF6

(Bai, Kitaura et al. 2005, Bai, Zha et al. 2008, Pham, Zhou et al. 2008). Additionally, our group has reported that truncated inactive TRAF6 muteins (RZ-, ccMATH- and MATH domains), in contrast to WT, localize to both the nucleus and cytoplasm (Wang, Galson et al. 2010). To visually contextualize the inhibitory effects of Syntenin upon TRAF6, the subcellular distribution of both molecules as ectopically expressed fluorescent chimeras was examined using confocal microscopy (Figure 30). Surprisingly, overexpression of Syn not only attenuates TRAF6 signaling, but also causes nuclear localization of ectopic WT TRAF6-YFP in 293 cells, as evidenced by colocalization with the co-expressed HcRed-Nuc nuclear marker. Similarly, ectopic co-expression of unlabeled TRAF6 resulted in translocation of GFP-Syn into the nucleus (Figure 4.30).

This nuclear localization correlates with the endogenous subcellular distribution in

RANKL stimulated RAW264.7 cells (Figure 4.31). This result discounts the possibility that nuclear localization of TRAF6 by Syn is merely an artifact of over-expression.

Immunoflourescent staining of endogenous Syn and TRAF6 reveals both proteins as largely cytoplasmic, but then simultaneously enter the nucleus (as seen by similar temporal kinetic) approximately 15min following stimulation of cell surface receptors that initiate TRAF6 mediated signal cascades.

113

Figure 4.30 Expression of ectopic Syntenin translocates TRAF6 into the nucleus. Expression plasmids (30 ng) coding for TRAF6ccMATH-YFP or YFP control vector (green) were co-transfected with pHcRed1-Nuc vector (30 ng) into one well of pre- inoculated 293 cells in a 96-well tissue culture plate. Confocal images were taken after 24 hours of transfection. The fluorescent signal of HcRed1-nuc, a nuclear localization marker, is pseudo-colored red. Confocal mages represent a subset of fields taken from three independent, qualitatively similar experiments.

Traditionally, PDZ domain-bearing proteins are associated with membranes, suggesting that these domains are involved in either organizing transmembrane protein complexes at the plasma membranes or recruiting proteins to membranes from the cytosol. Here, a Syn-TRAF6 complex promotes sequestration of TRAF6 into the nuclear compartment. Sequestration may promote transcriptional activity or attenuate signaling to the nucleus by removing TRAF6 from its cytosolic signal transduction location.

114

Figure 4.31 Subcellular localization of endogenous Traf6 and Syn in RANKL simulated RAW264.7 cells. RAW264.7 cells were seeded into 96 well plates, the next day they were stimulated with RANKL (50ng/mL) for 6-8 hours prior to fixing with 4% PFA and subsequently processed for immunolabelling and confocal imaging. Syntenin and TRAF6 were immuno-labeled in separate wells and then counterstained with Alexa488 (green) conjugated antibody. Confocal mages represent a subset of fields taken from three independent, qualitatively similar experiments.

115

4.3.6 Domains of Syntenin involved in relocalizing TRAF6 to Nucleus

With both the Syn and TRAF6 deletion muteins available, the next set of experiments aimed to interrogate which domains were either necessary or sufficient for

Syntenin mediated TRAF6 nuclear relocalization. When expressed by itself, GFP-Syn was found throughout the cell. However, when co-expressed with either RZcc (1-358) or wtTRAF6, ectopic GFP-Syntenin localizes primarily to the nucleus (visualized by ectopic expression of HcRED Nuc) and generates filipodia-like structures in 293 cells (Figure

4.32). Expression of inactive vectors coding for either the RZ or MATH domains co- transfected with GFP-Syn did not display differences from control, with Syn expressed throughout the cell (Figure 4.32).

Figure 4.32 Syntenin is enriched in the nucleus of 293 cells activated by ectopic TRAF6 or RZcc. 293 cells were seeded into 96 well plates and transfected with 25 ng GFP-Syn, 25 ng of the nuclear marker HcRED Nuc and 25ng of control empty vector or TRAF6 muteins as indicated.

116

These results correlate with NF-κB activity data, demonstrating that the MATH domain of TRAF6 is not necessary for Syntenin nuclear enrichment or attenuation of TRAF6 signaling. These findings contradict reports that the nuclear localization of Syn is inversely correlated with podosome/plasma membrane formation in epithelial cells

(Zimmermann, Tomatis et al. 2001) since an increase in podosome/filipodia is observed when Syn is enriched in the nucleus. A possible mechanism here could be that activated

TRAF6 must interact with other molecules such as Ubiquitin, before binding and co- translocating with Syn. Or, perhaps the effects on activity and subcellular localization have distinct mechanisms. To determine Syn domains critical for TRAF6 nuclear translocation, Syn deletion mutants were coexpressed with TRAF6-YFP in 293 cells

(Results summarized in Table 8).

Table 8 Summary of Syn Domains Effects upon TRAF6 Activity and Localization.

The addition of wtSyn results in translocation of TRAF6 to the nucleus in nearly all transfected cells expressing the TRAF6-YFP mutein as demonstrated by colocalization with ectopically expressed HcRed-Nuc mutein (Figure 4.30, 4.33). Coexpression of

SynΔN with TRAF6-YFP in 293 cells produced a mixed population of TRAF6 in both

117

the cytoplasm and nucleus (Figure 4.33). When co-expressed with SynΔPDZ1+2 or

SynΔPDZ2 muteins, TRAF6-YFP remained largely cytoplasmic, which is similar to normal TRAF6 subcellular expression (Figure 4.33). Collectively these results suggest that the NTD domain of Syn is necessary but insufficient for TRAF6 re-localization to the nucleus. Mechanistically this may be due to the ability of the Syn NTD to bind

Ubiquitin ergo “open” TRAF6. On the other hand, coexpression of SynΔPDZ1 (retaining the PDZ2 and CTD of Syntenin) with TRAF6-YFP was able to relocalize TRAF6-YFP to the nucleus, suggesting that the dominant factor in Syn mediated relocalization of TRAF6 may be either the CTD or PDZ2 (Figure 4.33).

Figure 4.33 Intranuclear translocation of TRAF6 depends on NTD and PDZ2 and CTD of Syn. Removal of the C-terminus precludes TRAF6-YFP enter into the nucleus. Images are merged signals from confocal subfields that represent three independently conducted experiments the nucleus is visualized by transient transfection of HcRED-Nuc reporter.

118

Unlike wtTRAF6, TRAF6C70A is inactive as an E3 ligase and deficient in polyubiquitination (Walsh, Kim et al. 2008). We confirmed this result and importantly detected monoubiquitinated. TRAF6c70AYFP and TRAF6ΔRYFP, which in the case of

C70AYFP revealed as a faint but distinct band when FLAG-C70AYFP was transfected into 293 cells, then immunoprecipitated by FLAG and resolved by SDS page and revealed by immunoblotted using anti-Ubiquitin antibody (Figure 4.34).

Figure 4.34 TRAF6C70A is deficient in poly-ubiquitination. 293 cells were transfected with indicated plasmids and then prepared for immunoprecipitation using FLAG antibody and resolution by SDS page and detection by Immunoblot on PVDF membrane. At left FLAG-C70AYFP and the ΔR muteins are deficient in poly ubiquitination while smear above full length TRAF6 represents ply-Ub modification. At right is control blot confirming FLAG IP occurred and ΔR mutein is unstable (smear beneath are degradation). *Lowest two bands in each lane of both micrographs are antibody heavy (HC) and light (LC) chains respectively (Wang 2010, unpublished).

119

Ectopic expression of TRAF6C70AYFP in 293 cells reveals a subcellular localization, primarily in the cytoplasm, similar to that of wtTRAF6 (Figure 4.35). When Syn was co-expressed with TRAF6C70A-YFP, TRAF6C70A-YFP failed to translocate to the nucleus. Additionally, when TRAF6C70A-YFP was co-expressed with the Syn deletion muteins, none of them were able to translocate TRAF6C70A-YFP to the nucleus.

Interestingly the large TRAF6C70A-YFP punctae decreased with coexpression of all Syn muteins except SynΔN and TRAF6C70A-YFP seemed more diffuse or in speckles in the cytosol (Figure 4.35). This might indicate that Syn may not bind TRAF6 that is not poly-

Ub, but might use it’s others domains to block TRAF6 sequestosome formation, perhaps by association with another molecule that interacts with the Syn PDZ2 or CTD and in turn recognizes TRAF6 via a T6IM (i.e. Sox4).

Figure 4.35 Intranuclear translocation of Syntenin and TRAF6 depends on an active ubiquitylated, TRAF6 and the NTD of Syntenin. Images are merged signals from confocal subfields that represent three independently conducted experiments the nucleus is visualized by transient transfection of HcRED-Nuc reporter. TRAF6C70A displays subcellular localization opposite to that of wtTRAF6. Scale bar= 20μm.

120

Collectively, these results suggest that the PDZ2 and CTD of Syn requires TRAF6 + Ub to bind TRAF6 and bring it to the nucleus which interferes with TRAF6 signaling in the cytoplasm. Further, TRAF6 - Ub blocks the Syn NTD from interacting and translocating

TRAF6 to the nucleus. These results are corroborated by reports that Syn binds ubiquitin directly through a novel Ub binding pocket, using a mechanism where the recognition involves both N- and C-termini of Syn rather than its PDZ domains, which instead mediate prerequisite dimerization (Rajesh, Bago et al. 2011). Furthermore, Syntenin interacts equally well with K48- or K63-linked polyubiquitin chains in a NTD- CTD Syn homo-dimer dependent manner (Rajesh, Bago et al. 2011). Since the NTD of Syn is involved in binding to Ub and likely, ubiquitinated TRAF6, the inability of Syn to interact and relocalize the C70A muteins support this model of interaction. The CTD

(194-298) of Syn, comprised of the linker (T6IM), PDZ2 and CTD, alone are also critical components of Syn involved in TRAF6 nuclear localization.

121

4.4 Characterization of Sox4-TRAF6 Interaction

4.4.1 Sox4 is a novel T6IM bearing protein that inhibits TRAF6

Although TRAF6 and Syntenin co-localize in the nucleus, neither molecule bears a NLS. Furthermore, Syntenin attenuates RZcc dominant positive signaling to NF-κB.

These two results led to our hypothesis that Syn was acting as an adapter protein for another T6IM-bearing protein. Presumably, this novel T6IM-bearing protein would associate with TRAF6 in a trimeric complex with Syn, mediating the attenuation of NF-

κB signaling and intranuclear localization of TRAF6. Sox4 has been reported to accumulate with Syntenin in the nucleus (Beekman, Vervoort et al. 2012). Sox4 has a bipartite nuclear localization signal (BP-NLS) at positions 60-77 and 129-136, as identified by the Nuclear Protein Database(NPD, http://npd.hgu.mrc.ac.uk/user/index.php). Furthermore, analysis of the Sox4 primary amino acid sequence revealed a perfect TRAF6 TIM immediately adjacent to the HMG-

Box DNA binding domain at AA 147-154 (Figure 4.36).

To investigate the possibility that Sox4 cooperates with Syn to modulate TRAF6 signaling and subcellular localization, a similar strategy to that employed for interrogating the nature of Syn-TRAF6 interactions was utilized, with Sox4 substituting for Syntenin in the experiments. Subsequent experiments were designed to assess changes in activity, subcellular localization, physical interactions and morphological/developmental effects. NF-κB-Luciferase reporter assays from bulk cellular extracts revealed that ectopic Sox4 attenuates NF-κB activity in a dose dependent

122

Figure 4.36 Sox4 and Syntenin share many motifs for binding proteins that have been either previously implicated with TRAF6 signaling or direct TRAF6 binding. Putative TIMs were discovered in both Syn-1 & Sox4 primary sequences. The Sox4 TIM is a consensus sequence also predicted by ELM Analysis. A) Schematic of Sox4 domains and important binding motifs. B) ELM Analysis confirms canonical TRAF6 TIM next to DNA binding domain of Sox4.

GRR: glycine rich region of Sox4 (151-155; 333 - 397)

SRR: serine-rich region

TAD/DD: Transactivation/degradation domain

123

manner when either 293R cells were stimulated with IL-1β or 293T cells transiently transfected with TLR4 (Figure 4.37).

In the case of the ectopic TLR4 dominant positive, Sox4 is more effective than

Syn at attenuating the NF-κB signal when equivalent amounts of plasmid was transfected. This suggests that Sox4 is the dominant factor in Syn inhibition of TRAF6 dependent receptor signaling to NF-κB (Figure 41B). Similarly, Sox4 was also able to inhibit the upstream

TIR adapter, MyD88, in a dose dependent manner (Figure 4.38).

The next step was to use TRAF6 as a surrogate for upstream signaling events in

TIR signaling and determine whether Sox4 inhibited the TRAF6 dominant positive in a manner that depends upon the MATH TIM groove. In accordance with my hypothesis, ectopic Sox4 was able to attenuate wtTRAF6-induced NF-κB activity in 293R cells, but was unable to attenuate the RZcc dominant positive (Figure 4.39A). Similar to Syn, attenuation of TRAF6 signaling by Sox4 was affected by the Ub state of TRAF6. Both

Sx4 and Syn were reduced in their ability to inhibit NF-κB activity induced by

TRAF6ΔK (Figure 4.39B). This suggests that Syn and Sox4 cooperatively inhibit

TRAF6 possibly through Syn interaction with Ubiquitinated TRAF6 and Sox4.

Encouraged by these results, I sought to correlate the activity assays with information on the physical interaction of Sox4 with TRAF6. First, confocal microscopy revealed that endogenous Sox4 and TRAF6 colocalize within cytoplasmic punctae pre-osteoclast 4B12 cells upon RANKL stimulation (Figure 4.40). Co-immunoprecipitation of WCL from 293 cells revealed that Sox4 precipitated with TRAF6-YFP but not RZcc-YFP (Figure 4.41).

Thus, TRAF6- Sox4 interactions depend on the MATH domain.

124

Figure 4.37 Sox4 inhibits TIR receptor dependent NF-κB activation. A) 293R cells were transfected with 25ng NF-κB luciferase reporter and indicated Sox4. 24 hours later the cells were stimulated with IL-1β (10ng/mL) for 6-8 h and assayed for NF- κB activity. B) 293 cells were transfected with 200ng TLR4 or EV and 50ng of LV- Syn or LV-Sox4 as indicated along with 25ng NF-κB luciferase reporter to examine the effect of Sox4 on TLR4 signaling. EV= pcDNA3.1 empty vector. Values are quantified as average±s.d. for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

125

Figure 4.38 Sox4 inhibits NF-κB activation induced by dominant positive ectopic expression of MyD88. 293T cells were transiently transfected with 50ng MyD88, indicated amounts of LV-Sox4 expression plasmid or EV (pcDNA 3.1 empty vector), and 25ng NF-κB luciferase reporter. The next day cells were prepared for luciferase assay. Values are quantified as average±s.d. for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

126

Figure 4.39 Sox4 inhibition of TRAF6 activated NF-κB depends on the MATH domain and Ubiquitinated TRAF6. A) 293 cells were transiently transfected with 25ng NF-κB luciferase reporter along with 25ng (EV) pFLAG, TRAF6 or RZcc and indicated amounts of LV-Sox4 24 hours prior to lysis and harvesting for luciferase assay. B) Normalized luciferase activity of 293T cells transfected with 25ng of indicated plasmids and 25ng NF-κB luciferase reporter 24 hours prior to preparation for luciferase assay. Values are quantified as average±s.d. for a representative experiment done in triplicate and qualitatively similar to at least three independent experimental replicates.

127

Figure 4.40 Endogenous Sox4 and TRAF6 co-localize in cytoplasm of stimulated 4B12 cells upon RANKL stimulation. 4B12 cells were fixed and immunostained following 5min stimulation with 50ng/mL RANKL or a control stimulation (optimum only). Confocal mages are a subfield of at least three fields taken from three experimental and two biologically independent experiments that are qualitatively similar.

128

Figure 4.41 Sox4 interaction with TRAF6 depends on the MATH domain. Western blots containing 50 μg protein of whole cell lysates (WCL) of 293 cells plated into 6 well tissue culture plates and harvested 24h after transfection of 1μg TRAF6-YFP, RZcc-YFP and LV-Sox4 plasmid as indicated. Lysates were incubated with anti- YFP antibody and subsequently blotted with anti-Sox4 (left) or anti-YFP (right) antibody following SDS-PAGE and transfer to PVDF membrane. A representative blot of three independent experiments is shown. Left panel indicates interaction with full length TRAF6-YFP but not RZcc-YFP, Left panel indicates that YFP IP occurred.

129

To expand on this data, the comparative subcellular localization of IRAK1, Sox4,

Syntenin and TRAF6 was visualized by confocal microscopy. Consistent with our observations thus far, in 4B12 cells, ectopic Syn disrupts IRAK1 and TRAF6 colocalization and neither Syn nor Sox4 colocalizes with IRAK1 in 4B12 cells (Figure

4.42). To underscore the visual data, Sox4 was knocked-down by co-transfecting siRNA against Sox4 in 293 cells concurrently with transient transfection of TRAF6

±Syntenin/Sox4 and an NF-κB Luciferase reporter. Without Sox4, TRAF6 activity increased, arguing that Syntenin was unable to attenuate TRAF6 dependent NF-κB activity (Figure 4.43). Taken together, these data suggest that TRAF6 and Sox4 bind in a

MATH domain-dependent manner with Syntenin, serving cooperatively to stabilize the cargo carrying capacity of Sox4 for TRAF6 nuclear translocation and the attenuation of

NF-κB activity.

4.4.2 Quantification of relative Sox4, TRAF6 and Syn mRNA levels in various cell types

The differential ability of ectopic TRAF6 to act as a dominant positive for NF-κB activity in cell lines of different lineages is a novel finding that prompted further examination. One possibility for the observed difference could be that the molecules regulating TRAF6 (Sox4 and Syn) are differently expressed in the pre-osteoclast

RAW246.7 and 4B12 lines vs. the commonly used 293 epithelial cells. To test this hypothesis, the appropriate primers were designed to quantify relative amounts of endogenous mRNA expression of TRAF6, Sox4 and Syn by qPCR was conducted in LPS stimulated THP-1 and RAW264.7 cells and compared against steady-state mRNA levels in 293 cells (Figure 4.44). Interestingly, 293 cells were found to have relatively low amounts TRAF6 and virtually no Syn mRNA expression as compared to Sox4. At

130

steady state, THP-1 has equally low amounts of TRAF6, Sox4 and Syn, with Sox4 levels nearly 30 fold lower than that found in 293 cells. Upon LPS stimulation Syn levels tripled before falling to tice that of steady state by 5 hours and persisting at two fold steady state for 24 hours. Sox4 mRNA rose progressively to 20% the steady state levels found in 293, but 10 fold higher than base line levels in unstimulated THP-1 cells. In

RAW 264.7, TRAF6 mRNA expression was 3 fold higher than that found in 293 cells at steady state, increasing two fold by 3 hours post LPS stimulation and persisting for 24 hours. This represents a 6-fold increase over 293 steady state levels of TRAF6 mRNA expression. Syn mRNA expression in RAW264.7 was the highest in RAW264.7 of the three cell lines compared, at least 5 fold higher than that of THP-1 or 293 expression levels. Upon LPS stimulation, Syn mRNA expression increased to 10x then 15x at 3h and 6h respectively over 293 steady state levels, or 2x and 2.5x the baseline Syn levels in

RAW264.7 itself. Elevated Syn mRNA was sustained in response to LPS stimulation in

RAW264.7 for upon to 24 hours, although by 24 hours the levels were reduced to 2x, similar to levels at 3hours. Surprisingly, RAW264.7 seemed to be devoid of Sox4 mRNA expression in both steady state and LPS stimulated conditions. In summary, 293 cells have low TRAF6 and Syn mRNA expression but high Sox4 expression that are consistent with the embryonic origin of the epithelial cell line. On the other hand,

RAW264,7 cells express higher levels of Syn and TRAF6 but virtually no Sox4. Upon stimulation, TRAF6 mRNA levels increase in RAW264.7 but, Syn levels elevate dramatically in response to LPS stimulation. THP-1 cells on the other hand, show similar starting points for TRAF6, Syn and Sox4 mRNA expression and LPS increases Syn and

Sox4 expression but the increase in Sox4 is later and more robust. Collectively, these

131

data suggest that mRNA expression of Syn critically regulates NF-κB activation in TIR signaling. Further, ectopic TRAF6 may act as a dominant positive in 293 cells and not

RAW264.7 cells because the inhibitory effect of Syn is more readily overcome in 293 vs

RAW264.7.

Figure 4.42 Syntenin disrupts IRAK1 and TRAF6 colocalization. 4B12 cells were transiently co-transfected with the indicated plasmids 24h prior to fixation with 4% PFA and DAPI staining to visualize the nuclei. Confocal mages represent a subset of fields taken from three biological replicates.

132

Figure 4.43 Syntenin inhibition of TRAF6 is dependent on Sox4 interaction with TRAF6. Sox4 was knocked down in 293 cells by transfection of siRNA to Sox4 and the 25ng indicated plasmids and 25ng NF-κB luciferase reporter. 24h later cell cultures were lysed and harvested for luciferase assay. Values are quantified as average±s.d. for a representative experiment done in triplicate and qualitatively similar to at least two independent experimental replicates.

133

Figure 4.44 Kinetic profile of mRNA expression of TRAF6, Syn and Sox4 in 293 vs. LPS (1μg/mL) stimulated THP-1 or RAW264.7 cells. mRNA was extracted from cells at indicated timepoints following stimulation by LPS and processed for qPCR. Values represent relative expression levels were calculated using Ct method and are average±s.d. for an experiment done in duplicate and qualitatively similar to at least two independent experimental replicates.

134

4.5 Syntenin and TRAF6 involvement in Neurite Formation

Amongst the inputs following injury to the nervous system, TRAF6 can transduce many of the signals intended for cell survival, death or proliferation. For example,

TRAF6 mediates p75 neurotrophic signaling, which is essential for activating either apoptosis or survival of the cell dependent cellular context and p75 stimulation

(Khursigara, Orlinick et al. 1999, Wu and Arron 2003). Syntenin has been shown to both couple transmembrane proteoglycans to cytoskeletal components and play a role in targeting receptors to the synaptic cleft (Zimmermann, Tomatis et al. 2001, Beekman and

Coffer 2008, Chen, Du et al. 2008). Previously, our group demonstrated that overexpression of c-Src, MyD88 or TRAF6 in 293 cells, or addition of IL-1β to 293R cells, created long filipodia like cellular structures, reminiscent of axons or neurites (Wang,

Wara-Aswapati et al. 2006). These results, and our examination of TRAF6 and Syntenin interaction, prompted us to ask whether 293 cells could be differentiated into a neuronal- like cell merely by ectopic expression of TRAF6. Consequently, I sought to characterize the roles of Syntenin and TRAF6 in a neuronal PC12 cells. PC12 cells are an established neuronal cell line derived from rat pheochromocytoma cells. PC12 are widely used to study neurobiology and neurotoxicology as a model of neuronal differentiation.

Importantly, PC12 cells respond to NGF with morphological changes phenotypically resembling sympathetic neurons. In PC12 cells, NGF stimulation causes proliferation, extension of neurites and membrane excitability (Drubin, Feinstein et al. 1985,

Schimmelpfeng, Weibezahn et al. 2004, Garcia, Castillo et al. 2013). To test this, neurite growth was compared in PC12 cells either transfected with TRAF6 or stimulated with

NGF (Figure 4.45). Transient transfection of PC12 cells with TRAF6 was found to

135

Figure 4.45 Ectopic TRAF6 or NGF-induced neurite extension in PC12 cells. 24 hours prior to transfection with 50ng of pF-TRAF6 or pFLAG empty vector (control), cells were plated on matrigel at a low density of (2x103 cells/cm2). The next day, selected cells were treated with 50 ng/mL of human recombinant NGF (Millipore). Top: Phase contrast images of cells on Day 0 prior to treatment with NGF. Bottom: Phase contrast image of cells after 96h of NGF treatment.

136

induce neurite formation over 96 hours with qualitatively similar lengths. Next, an expression vector for PKB/Akt Plekstrin-homology domain joined to GFP (PH-Akt-GFP) was used to detect phosphoinositol 3-kinase produced in response to either transfection of

TRAF6 or NGF stimulation in both PC12 and 293 cells for comparison. Phospho-Akt

(and also its PH domain when expressed ectopically) is localized at the tips of growth cones, which supports a role for Akt in the regulation of neurite elongation (Higuchi,

Onishi et al. 2003, Read and Gorman 2009). 293 cells have been previously characterized as pre-neuronal despite the widely held belief that they are kidney cells

(Shaw G 2002). Indeed, microarray data show that 293 are positive for the NGFR receptor and they might be responsive to NGF stimulation. In both 293 and PC12 cells,

TRAF6 was able to induce neurite/filipodia like structures of qualitatively similar morphologies (Figure 4.46, Figure 4.47). This suggests that TRAF6 can drive the differentiation events by over-expression, expanding on demonstrations that it is critical by elimination (Geetha, Jiang et al. 2005, Wooten, Geetha et al. 2005).

Having confirmed and clarified the mechanisms by which Syntenin negatively regulates TRAF6 signaling, I sought to evaluate whether Syntenin can inhibit the ability of TRAF6 or NGF to differentiate 293 cells. Using ectopically expressed PH-Akt-GFP reporter to monitor recruitment to growth cones and newly formed neurites, wtTRAF6 and/or mSyn was co-transfected into cells that were either stimulated with 50ng/mL NGF

(+NGF) for 96 hours or a control vehicle (-NGF) 24 hours after transfection. Confocal images were then taken at 24h, 48h, and 96h post transfection for analysis (Figures 4.48-

4.50). At 24hours, cells that were transfected with either mSyn or wtTRAF6 alone displayed filipodia/neurites. However, transfection of both mSyn and TRAF6 seemed

137

to have a cancelling effect, and neurite outgrowth was not observed. Cells that were stimulated with NGF all displayed neuronal growth with the exception of the condition where mSyn and TRAF6 were transfected in addition to NGF stimulation. Furthermore, stimulation of the cells with NGF produced a more robust overall length in neurite growth. In particular, cells stimulated with NGF+mSyn or NGF+TRAF6 had dramatically longer neurite formation vs. NGF alone (Figure 49). Neurite extension are marked with blue wedges, but only extensions that were at least 1x the diameter of the cell. By 48 hours post-transfection, 293 cells co-transfected with wtTRAF6 and mSyn seemingly overcome the inhibitory effect of ectopic expression of both plasmids.

However, the overall length lagged behind the other conditions where neurites began to appear at 24hours post transfection. Notably, the PH-Akt-GFP displayed a neuronal buton like appearance, decorating the lengths of the membrane extensions, suggesting the development of a neuronal phenotype (Figure 4.49). The phenomena observed at 48hours post-transfection continued for up to 96 hours post-transfection (Figure 51). By 96 hours, though the “buton -like” structures seems to have largely disappeared, but the presence of multipolar-, bipolar-r and unipolar-like “neurons” persisted (Figure 4.50).

138

Figure 4.46 Ectopic expression of TRAF6 can act as a surrogate for NGF induced neurite formation. PC12 cells were seeded onto covered chamber slides (Nunc) pre- treated with matrigel. 24 hours later, Cells were then transfected with 25ng of indicated plasmids or mock transfected with vehicle (optimum). The following day, select cells were stimulated with 50ng/mL NGF. NGF stimulated cells were subsequently stimulated at 72hours with 50ng/mL NGF (Millipore).

139

Figure 4.47 Ectopic expression of TRAF6 can act as a surrogate for NGF induced neurite formation. 293cells were seeded onto covered chamber slides pre-treated with matrigel. 24 hours later, Cells were then transfected with 25ng of indicated plasmids or mock transfected with vehicle (optimum). The following day, select cells were stimulated with 50ng/mL NGF. NGF stimulated cells were subsequently stimulated at 72hours with 50ng/mL NGF (Millipore).

140

Figure 4.48 Ectopic expression of TRAF6 is sufficient to induce neurite formation, but inhibits neurite formation when coexpressed with Syn. 293 cells were seeded onto chambered cover slides pre treated with matrigel and transfect with 25ng of indicated plasmids and stimulated with NGF as previously described. Total amount of DNA transfected was normalized across all conditions with pcDNA3.1.

141

Figure 4.49 Ectopic expression of TRAF6 or Syntenin in 293 cells induces a neuronal differentiation state. Inhibition of neurite extension by co-expression of ectopic Syntenin and TRAF6 is overcome 48 hours post transfection. 293 cells were seeded onto chambered cover slides pre treated with matrigel and transfect with 25ng of indicated plasmids and stimulated with NGF as previously described. Total amount of DNA transfected was normalized across all conditions with pcDNA3.1. Wedges indicate extensions that are at least twice the diameter of the cell.

142

Figure 4.50 PH-AKT-GFP localizes to membrane extensions induced by ectopic expression of TRAF6 or Syntenin or NGF stimulation in 293 cells and persists 96 hours post transfection. Inhibition of neurite extension by co-expression of ectopic Syntenin and TRAF6 is overcome 48 hours post transfection. 293 cells were seeded onto chambered cover slides pre treated with matrigel and transfect with 25ng of indicated plasmids and stimulated with NGF as previously described. Total amount of DNA transfected was normalized across all conditions with pcDNA3.1. Wedges indicate extensions that are at least twice the diameter of the cell.

143

4.6 The Osteological Synapse

4.6.1 Rationale

It has been reported that RANK accumulates in membrane rafts, and these specialized domains may play an important role in the RANK signal transduction (Ha,

Kwak et al. 2003, Ha, Kwak et al. 2003). Further, DAP12, BTK, BLNK, and PLC, as well as RANK, were recruited to caveolin-rich membrane domains, which are the crucial signaling domains contained in lipid rafts, after RANKL stimulation (Shinohara, Koga et al. 2008). Thus, I hypothesized that a synaptic complex between RANK bearing stromal cells and osteoclast precursors similar to the immunological synapse exists. This

“osteosynapse” (OS) would contain (on the osteoclast-side) both the RANK and ITAM signaling pathways is generated by RANKL stimulation and contribute to the facilitation of the osteoclastogenic signal transduction (Figure 4.5). Synapses are stable adhesive junctions between two cells across which information is relayed by directed secretion. The nervous system and immune system utilize these specialized cell surface contacts to directly convey and transduce highly controlled secretory signals between the constituent cell populations. The phagocytic synapse has also been described to form when dectin 1-expressing phagocytes are exposed to particulate β-glucans, initiating phagocytosis (Goodridge, Reyes et al. 2011). Such examples suggest a conserved organizational scheme that might be utilized by other biosystems, such as in the bone.

144

Figure 4.51 Extracellular and Intracellular signaling molecules involved in osteoclastogenesis that might comprise the osteosynapse.

145

4.6.2 BTK but not Tec Kinase is recruited to the plasma membrane upon RANKL stimulation

Based on the general structure of synapses, and the fact that osteoclast already form an adhesive junctions with bone, I looked at the subcellular localization of the Tec kinases BTK and Tec in the osteoclast precursor cell line RAW264.7. Plasmids containing Tec- or BTK-GFP were transfected into RAW264.7 cells and then stimulated with RANKL. Confocal microscopy revealed that BTK and Tec are normally expressed through the cytoplasm. Upon RANKL stimulation, within 5 minutes, BTK was recruited to the plasma membrane as compared to control (GFP) or Tec Kinase-GFP. The relocalization of BTK was sustained for nearly an hour (Figure 4.52).

4.6.3 BTK is a component of Osteoclast Transcytotic Machinery and FSD

Osteoclasts are the primary cells responsible for bone resorption. Waste products created by this process are transcytosed through the osteoclast and released through the functional secretory domain (FSD). The mechanisms of this process are not fully understood. To understand to the temporal stability of the OS, I stimulated RAW264.7 cells transfected with PH-BTK-GFP with RANKL for up to 96 hours. Interestingly, with extended differentiation by RANKL, visualization of PH-BTK-GFP reveals a structure that resembels the osteoclast FSD. Further, the appearance of negatively stained tunnels from apical to basolateral membrane in RANKL differentiated RAW264.7 cells expressing PH-BTK-GFP, possibly representing a means for resorbed bone to be transcytosed through the cell and released by exocytosis at the FSD (Figure 4.52-4.54).

Of note, finger like projections did not appear to be localized to a single FSD but rather in

146

multiplicity of FSDs. This suggests a scenario where the FSD is built at the sRANKL- signaling site. Such a scenario would help to explain why pre-osteoclasts differentiated by membrane bound RANKL are more robust, functional osteoclasts (Galson, personal communication). Here, in a co-culture cell-cell signaling system the RANKL signaling complex is amplified and focal, producing single FSD structure.

Figure 4.52 Subcellular Distribution of Full length BTK-GFP and Tec-GFP. BTK is recruited to Plasma Membrane but not Tec or GFP upon RANKL simulation. 50ng of A) GFP B) BTK-GFP C) Tec-GFP was transfected in RAW 264.7 and seeded onto a 96 well plate. 24h after transfection, cells were stimulated with RANKL [50ng/mL] and imaged by confocal microscopy. Images are representative confocal images extracted from z-stacks. Each pattern was observed consistently over the course of 1-3 experiments in dozens of cells imaged. D) 3D Perspective view E) Max projection of the same field of view.

147

Figure 4.53 Left: 3D Max projection of PH-BTKGFP localization. Middle: z-stack demonstrates the localization of BTK to ‘finger like’ villi of FSD in basolateral membrane Right: 3D reconstruction from stack (Max projection) show FSD is not only localized to one spot of basolateral membrane. Media was changed and fresh RANKL was introduced every 48 hours during differentiation. 24h after transfection, cells were stimulated with RANKL [50ng/mL] and imaged by confocal microscopy. Images representative confocal images of consistently observed pattern for 2 experiments in dozens of cells imaged.

148

Figure 4.54 Visualizations of BTK-GFP expression and localization in osteoclasts generated by 44-68h RANKL stimulation of RAW 246.7 cells. Images are representative 3D Max projection of z stacks. Red arrows point out FSD; Blue arrows denote transcytotic passageways.

149

Chapter 5

DISCUSSION

5.1 Summary

Among the members of the TRAF protein family, TRAF6 has been uniquely demonstrated to transduce both TNFR family signaling and the unrelated Interleukin-1/18 receptor/Toll-like receptor (IL-1R/TLR). The goal of my research was to elucidate novel mechanistic details by which TRAF6 is activated under stimulating conditions and characterize how TIM (TRAF Interaction Motif) bearing molecules regulate TRAF6 signaling across various cell types and receptor systems. Due to the intramolecular association of its amino-terminus RING and carboxy-terminus MATH domains, TRAF6 exists in either an active-open or inactive-closed (autoinhibited) conformation (Wang,

Galson et al. 2010). Interaction of TIM bearing molecules with the TRAF6 MATH domain modulates this state and downstream signaling. The experimental data suggests that an open TRAF6 state facilitates both the activity and subcellular localization of the molecule. Furthermore, besides auto-inhibition, the adapter protein Syntenin coordinately attenuates TRAF6 signaling to NF-κB in cooperation with the transcription factor Sox4. While the interaction of TRAF6 and Syntenin has been previously reported, as well as that between Sox4 and Syntenin, there has been no previous report of the interaction between Sox4 and TRAF6. Interestingly, the TRAF6 interactions with Sox4-

Syntenin appear to relocalize normally cytoplasmic TRAF6 to the nucleus, providing a novel mechanism for this largely unexplored, but previously reported, phenomenon

(Nakamura, Kadono et al. 2002). The results obtained by this study support the model of

150

TRAF6 activation from a closed autoinhibited state by IRAK1 and attenuation by association with a Syntenin/Sox4 complex, with possible sequestration of TRAF6 within the nucleus (Figure 4.57), concomitant with the termination of cytoplasmic signaling.

Furthermore, in the nucleus TRAF6 can regulate transcription in a manner reported by others (Bai, Zha et al. 2008, Pham, Zhou et al. 2008).

Figure 5.1 Summary of TRAF6-Syntenin-Sox4 interactions. Syntenin stabilizes Sox4, which binds to TRAF6 after it has been opened and activated. TRAF6 autoubiquitination supports Syntenin binding possibly stabilizing the Sox4 TRAF6 interaction. Attenuation of TRAF6 signaling is either via the relocalization of TRAF6 to the nucleus, away from cytoplasmic substrates for downstream signaling or by direct inhibition of the RZcc by interfering with E2 binding or E3 ligase activity.

151

5.2 Activity of keystone molecules like TRAF6 involves multiple regulatory mechanisms

TRAF6 is associated with several distinct receptor signaling pathways, including: p75 NTR neurotropic receptor, IL1R/TLR (TIR) and nucleotide-binding oligomerization domain (NOD)-like receptor inflammatory responses, and RANK differentiation of osteoclasts. Therefore, TRAF6 mediated signals are not only important for normal bone homeostasis, but also host defense and development. Accordingly, TRAF6 has been implicated in several disorders and disease (Table 9). Overexpression of immune-related genes chronically stimulates the immune system and increases the risk for development of disorders such as myelodysplastic syndrome (MDS) and rheumatoid arthritis. Somatic mutations and copy number alterations (resulting from deletion or amplification of large portions of a chromosome) are implicit in human lung cancer development. Detailed analysis of lung cancer-associated chromosomal amplifications could identify novel oncogenes. Reportedly, TRAF6 was highly expressed in non-small cell lung cancer

(NSCLC), small-cell lung cancer (SCLC) cell lines and tumors. Inhibiting TRAF6 in these, two human lung cancer cell lines suppressed NF-κB activation, anchorage- independent growth, and tumor formation and were found to be necessary for oncogenesis. Furthermore, TRAF6 overexpression in NIH3T3 cells resulted in NF-κB activation, anchorage-independent growth, and tumor formation. TRAF6 is an oncogene that is important for constitutive of NF-κB activation in RAS-driven lung cancers

(Starczynowski, Lockwood et al. 2011). Additionally, TRAF6 has been identified as a target for cancer therapeutics due to its ability to amplify the expression of hypoxia- inducible factor-1α (HIF-1α) and tumor angiogenesis (Luong le, Fragiadaki et al. 2013,

Sun, Li et al. 2013, Sun, Li et al. 2014).

152

Disease PubMed IDs 9432981(2) 9625770(2) 9915784(1) 9990007(1) necrosis See all 63 » 9432981(2) 9625770(2) 9915784(1) 9990007(1) tumors See all 60 » 14579250(1) 16143987(2) 17925880(1) inflammation 18093978(1) ectodermal dysplasia 16527194(1) bone diseases 18778854(1) rheumatoid arthritis 18759964(1) 19479062(1) virus infection 20097753(1) 12716453(1) bone loss 15320903(1) pathological processes 16697380(1) osteoporosis 14579250(1) osteopenia 12975380(1) lymphoma 18036806(1) 17270016(1) cancer 19439102(1)

Table 9 Diseases associated with TRAF6 Gene. This table was generated from the literature and the Gene Cards database.

http://www.genecards.org/cgi-bin/carddisp.pl?gene=TRAF6

153

As such, it is necessary for cells to tightly regulate TRAF6 activity to preserve normal physiological function and prevent pathogenesis. Understanding the mechanisms of TRAF6 inhibition and activation can assist in rational drug design, targeting either

TRAF6 directly or its immediate interacting partners to avoid poor efficacy and off target effects of current therapeutics. In particular, there is mounting evidence that warrants a concerted focus on IRAK1 and its interaction with TRAF6 as a therapeutic target (Jain,

Kaczanowska et al. 2014, Rhyasen and Starczynowski 2015). Clarification of the nature of these interactions is necessary because the details remain unclear and at times contrary to expectations. For example, among the intracellular TLR signaling molecules MyD88,

IRAK4, IRAK1 and IKKβ, only IRAK1 expression down-regulates TRAF6 in 293 cells

(Hayden and Ghosh 2004, Muroi and Tanamoto 2008, Muroi and Tanamoto 2012).

5.3 IRAK1 disrupts TRAF6 autoinhibition

Previously our group reported data (Wang, Wara-Aswapati et al. 2006) supporting a model for TRAF6 activation where, prior to stimulation, an intra-molecular interaction between the RING-Zinc and MATH domains of TRAF6 generated an inactive “closed” state reminiscent of protein kinase autoinhibitory mechanisms (Huse and Kuriyan 2002).

Others have reported autoinhibition in E3-ligases; for example, with SCF (Skp1 x CUL1 x F-box protein x ROC1) E3 ubiquitin ligase, where Nedd8 conjugation acts as a molecular switch to drive the E3 into an active state by diminishing the inhibitory ECTD x ROC1 interaction (Yamoah, Oashi et al. 2008). This study demonstrates that ectopic expression of IRAK1 is able to disrupt the intramolecular RZ-MATH interaction, as seen by an intermolecular interaction between RZ-only mutein with wtTRAF6 when co- precipitated in 293 cells co-expressing IRAK1 (Figure 4.10). Overexpression of IRAK1

154

acts as a surrogate for receptor-dependent recruitment of TIM-bearing proteins and the activation of TRAF6. Interactions with the TIM-recognition groove contained within the

MATH domain (Ye, Arron et al. 2002) disrupts the “closed” autoinhibited TRAF6, opening the molecule, thereby enabling the RING-Zinc and coiled-coil domains to interact with E2 conjugating enzyme (Yin, Lin et al. 2009) resulting in trans- ubiquitination events. It is possible that the intramolecular RZ-MATH interaction is between an internal TIM within the RZ (Figure 4.12) and the MATH TIM groove.

Mutation of the identified residues in a future study would easily resolve this question, possibly producing a constitutively open TRAF6. Another possibility raised by this study is that the inhibitory pair: Syn-Sox4 bind to open TRAF6, with Syn associating with ubiquitinated TRAF6 via its NTD (as a dimer) while associated with the C-Terminus of

Sox4. In this model, Sox4 associates with TRAF6 in a T6IM dependent manner.

Effectively then Sox4 and Syntenin bridge TRAF6 to associate the RZ and MATH domains and conferring a “closed” conformation to TRAF6 (Figure 5.2). Importantly,

Figure 5.2 Model of TRAF6 RZ-MATH interacting to form closed TRAF6 via a Syn-Sox4 bridge.

155

this model does not preclude direct RZ-MATH interaction; as with all molecular associations, there is an on-off rate and when the closed TRAF6 molecule breathes or is opened by activators such as IRAK1, the opportunity for Syn/Sox4 to associate with

TRAF6 emerges. It would be interesting to see how IRAK1 affects the ubiquitination state of TRAF6 or whether IRAK1 could rescue NF-κB activity in cells co-expressing wtTRAF6+RZ dominant negative. One reason why ectopic expression of TRAF6 acts as a dominant positive in 293 cells is that overexpression increases the concentration of a low abundance equilibrium open TRAF6 state, permitting intermolecular RZ-RZ or RZ-

MATH interactions (Figure 4.9). However, when poly-ubiquitination of TRAF6 exceeds the recycling capability of the sequestosome, recycling ceases and activity is lost due to the sequestration of inactive TRAF6 (Wang, Galson et al. 2010). This can be visualized by the co-localization of p62 and TRAF6 (Figure 4.4) as well as the large cytoplasmic

TRAF6 punctate aggregates (Figure 4.6). IRAK1 was found colocalizes with the MATH domain of TRAF6 (Figure 4.8) and that coexpression of IRAK1 with TRAF6-YFP reduced the number and size of sequestosomes. One explanation might be that bound

IRAK1 prevents excessive ubiquitination by sterically shielding Lysines on the TRAF6 molecule or mono Ub from Ubiquitylating events. Ubiquitination of TRAF6 may also have steric bulk effects, thus sustaining the active conformation, by preventing intramolecular re-association. Another mechanism of TRAF6 dominant positive induction of NF-κB activity besides driving inter-molecular TRAF6 activation interactions could be the that an excess of TRAF6 saturates the antagonistic effect of an inhibitory molecule that associates with TRAF6 either constitutively (like a safety/modulator), or in response to stimulatory or activating conditions (like a brake).

156

5.4 IRAK1 and TRAF6 sequestosomes

From the literature and findings in this study, it seems clear that IRAK1 associates with TRAF6 in a MATH and thus, T6IM dependent manner, However, the effect and role that IRAK1 has on TRAF6 subcellular localization is less clear. The only published mutations done in this area seem to affect SQSTM1 binding to autophagy effector proteins LC3-A and -B. Disrupting this event compromises the degradation of ubiquitinated protein aggregates by autophagy (Pankiv, Clausen et al. 2007). Here,

IRAK1 was found to induce TRAF6 localization from cytoplasmic speckles into to large sequestosomes (Figure 4.6), and activating TRAF6 by disrupting the RZ-MATH interaction, possibly by disrupting the Sox4-Syn pair. This model comports with reports that IRAK disrupts Syn interaction with TRAF6 and increases TRAF6 polyubiquitination (Chen, Du et al. 2008). Further, since the T6DP is insufficient to inhibit

TRAF6 signaling, a new peptide could be synthesized that more closely resembles either the Syn T6IM or Sox4 T6IM. Such rational drug design of a peptide that resembles physiological, endogenous inhibitors of TRAF6 might assist in attenuating TRAF6 signaling that is the basis for the various inflammatory and bone related diseases listed in

Table 9.

5.5 TRAF6 MATH domain recruits inhibitory molecules via its TIM groove

The TIM groove of the TRAF6 MATH domain (amino acid residues 346-522) is involved in receptor binding upon different signaling events. Ectopic expression of the

MATH domain itself acts as a dominant negative for downstream events such as NF-κB activity. Others have suggested that the MATH domain competes with endogenous

157

TRAF in binding with upstream activators (Darnay and Aggarwal 1999, Yoshida, Kumar et al. 2004). Our group has suggested that the MATH domain is necessary for autoinhibition of TRAF6 signaling (Wang, Galson et al. 2010). Here, the results of this study suggest that the MATH domain is involved in recruiting inhibitory molecules to regulate TRAF6 conformation and activity. Dominant positive signaling to NF-κB by ectopic TRAF6 is independent of upstream activators. I hypothesized that ectopic expression of TRAF6 was providing a substrate for TRAF6 inhibitory binding.

Therefore, I reasoned that induction of TRAF6 dominant positive activity by a minimal amount of ectopic TRAF6 should provide a reserve capacity for increased NF-κB activity by increasing the stimulatory input using either LPS or IL-1β, Surprisingly, the super- stimulatory effects of IL-1β were modest in 293R cells transfected with wtTRAF6

(Figure 4.14, 4.15), but much greater when the MATH domain was removed and the

RZcc dominant positive was additionally stimulated by exogenous ligand (Figure 4.15).

Unexpectedly, I was not able to induce a dominant positive effect using wtTRAF6 in monocytic cell lines RAW264.7 and 4B12, but those same cells could be stimulated by the RZcc dominant positive (Figure 4.16). These phenomena could be due to the fact that different cell lines of various lineages express either different proteins or the same protein in differing amounts to enable differential cellular functions. Indeed, when mRNA levels were examined in monocytic-macrophage THP-1 or pre-osteoclast RAW264.7 vs pre- neuronal 293 epithelial kidney cells, the expression profile of our two putative inhibitory molecules Syn and Sox4 showed marked difference between 293 and RAW264.7 cells

(Figure 4.44). Since TRAF6 acts as a dominant positive in 293 cells, and Sox4 levels are high, the data suggest that ectopic TRAF6 is overcoming the inhibition of Sox4.

158

However, RAW264.7 cells are deficient in Sox4 mRNA expression (Figure 4.4), suggesting that Sox4 is not the dominant factor in the inability for TRAF6 to act as a dominant positive for NF-κB activity. Since the Sox4 protein is unstable without

Syntenin it would make sense to increase Syntenin expression and subsequently Sox4 protein levels in response to stimulatory events (LPS) to attenuate TRAF6 signaling.

This is exactly what the THP-1 data suggest, that Syn mRNA increases first, followed by a delayed more robust Sox4 mRNA expression. Of course, mRNA expression doesn’t always correlate to protein expression and so a logical follow up to this study would be to examine the steady state and stimulated protein levels for TRAF6 Syn and Sox4 in the various cell lines used in this study. Taken together, the data that describes differential activation of NF-κB activity by TRAF6 in different cell lines point to the inhibitory proteins identified in this study, that interact with the MATH domain. Additionally, these inhibitory proteins are expressed differentially in various cell lines or tissue types s seen at least at the RNA message level. This expands the capacity of the MATH domain to inhibit beyond competition for upstream activators in experimental situations or autoinhibition. It is estimated that 80% of proteins function within protein complexes

(von Mering, Krause et al. 2002), rather than as isolated species. For autoinhibited proteins, an inhibitory module regulates activity of a functional domain. TRAF6 is autoinhibited by the association of its MATH and RZ domain (Wang, Galson et al. 2010).

Although previously unreported, the RING domain of TRAF6 possesses a perfect

T6IM (Figure 4.12) that could be the basis for this interaction. Validation of this would affirm the existence of a structurally “closed” inactive TRAF6 molecule. Generally, autoinhibition can be either alleviated or reinforced by binding partners and post-

159

translational modifications. Since the TRAF6 MATH domain is necessary for both autoinhibition and extramolecular interactions with potential inhibitory molecules, our next goal was to identify novel proteins that might compete with upstream effectors possessing a T6IM peptide. Such inhibitory proteins could explain why either a putative

TRAF6 interaction peptide or a TRAF6 decoy peptide (T6DP) is insufficient for activation of TRAF6 while functioning as an inhibitor (Ye, Arron et al. 2002, Poblenz,

Jacoby et al. 2007, Trudeau, Nassar et al. 2013). However, an IRAK1 based T6DP can disrupt recruitment of TRAF6 to the cytoplasmic T6IM of RANK (Poblenz, Jacoby et al.

2007). A T6DP is available commercially for research purposes and inhibits RANKL mediated osteoclast differentiation. Small molecule inhibitors targeting the TRAF6

MATH domain have not been discovered and the T6DP is not currently in clinical use

(Morrow, Du-Cuny et al. 2011).

In general, the results of this study and those of others argue that a T6IM can inhibit TRAF6 recruitment to, and activation by, receptor-activated IRAK1, but requires full-length IRAK1 for downstream signaling. This suggests that domains of the IRAK1 molecule other than the T6IM are responsible for this activation. Our group reported that a majority of the IRAK1 kinase domain could support TRAF6 interaction (Boch,

Yoshida et al. 2003). Similarly, multiple T6IM have been located within the kinase domains of IRAK-1 and -3 (Ye, Arron et al. 2002). This suggests that the whole IRAK1 molecule, either directly or indirectly, provides an activation function beyond the T6IM.

Although our group has reported that LPS-activated TRAF6 can recruit c-Src kinase that, in turn, phosphorylates TRAF6 (Liu, Gong et al. 2012)this appears to occur downstream of IRAK-dependent activation. In addition, the above-described direct interaction of

160

TRAF6 with the IRAK kinase catalytic domain may suggest an inhibitory, rather than activating function. A possible mechanism may simply be steric clashing with the RZ-

MATH domain kinetic interaction that our group previously reported (Wang, Galson et al. 2010). Since the results obtained in this study describe that full-length IRAK1 can open/activate TRAF6, activation may simply be the result of the binding of a bulky molecule to the TRAF6 MATH domain. In particular, the amino terminal Death domain of IRAK1 that our group reported to not be critical for TRAF6 interaction (Boch,

Yoshida et al. 2003) but is associated with upstream receptor recruitment and may provide steric bulk for maintaining TRAF6 in an open and active state or disrupt a Sox4-

Syn bridge between the TRAF6 RZ- and -MATH domains.

5.6 Molecular Dynamics of Syntenin TRAF6 Interaction

De novo identification of protein-protein interactions can be accomplished by in vitro, in vivo, and in silico techniques. Often, several techniques are concomitantly used by researches to find novel protein-protein interactions. Initially, an in vitro approach was considered to identify T6IM bearing proteins that might regulate TRAF6 autoinhibition. In vitro methods for protein-protein interaction detection include tandem affinity purification, affinity chromatography, co-Immunopreciptation, protein arrays, protein fragment complementation, phage display, X-ray crystallography, and NMR spectroscopy (Rao, Srinivas et al. 2014). However, the discovery that ectopically expressed Syntenin inhibits TIR signaling to NF-κB, but not TNFα induced NF-κB activity, spared us this initial effort (Chen, Du et al. 2008). Therefore, I sought increased understanding of the molecular details of this Syn-TRAF6 interaction. To obtain novel details of the interaction in other receptor systems that signal to NF-κB required careful

161

investigation. Incorporating new findings would facilitate the refining of our model of

TRAF6 inhibition and activation. Syntenin seemed an attractive candidate for a TIM inactivation pathway due to its demonstrated ability to negatively regulate the TRAF6 dominant positive effect for NF-κB activity (Chen, Du et al. 2008), in addition to a putative TIM sequence identified between its two PDZ domains (Figure 1.12). Notably, the linker region of Syn is unstructured and disordered. Such disordered regions have an increased ability to conform and bind to other proteins in a specific, yet transient, manner that enable their central roles in signaling pathways and act as hubs of protein interaction networks (Meszaros, Dosztanyi et al. 2012). The results herein confirm that Syntenin can inhibit TIR signaling by ectopically expressing Syn in cells stimulated by TIR receptors

(whose signals are transduced by TRAF6) such IL-1R (Figure 4.21 4.22) and, TLR4

(Figure 4.22) and newly demonstrate inhibition of RANK signaling (4.22). Arguably, suing of a cell line (RAW264.7) that endogenously expresses these receptors provides more relevant, physiological evidence of inhibitory effects of Syntenin, especially when considering that 293 expresses a low level of Syntenin (Figure 4.44). Further, RANK signaling is unique to osteoclasts and so Syntenin can inhibit some TNFR family signaling but not other such as TNF-α (Chen, Du et al. 2008). Since ectopic expression of TLR4 in 293 acts as a dominant positive for NF-κB and Syn can attenuate this activity

(Figure 4.37), it would be interesting to see whether our 293R cells have mRNA expression of Syn, Sox4 and TRAF6 more similar to RAW 264.7 cells or stimulated

THP-1 cells. Notably, unmodified TLR4 has not previously been shown to act as a dominant positive for NF-κB activity, and others usually transient transfect 293 to express TLR4 prior to LPS stimulation. Relatedly, 293R cells used in this study did not

162

have a high background level of NF-κB activity when transfected with empty vector

(Figure 4.15). Results from this study newly demonstrate that NF-κB activity, induced by ectopic IRAK1 and MyD88, is also attenuated by Syn (Figure 4.23). I hypothesized that this was because Syn interacted with the TRAF6 MATH domain, although collectively the data seem to suggest that the Syn T6IM might be less important than the

Sox4 T6IM. When the putative TIM (194-198) spanning the PDZ tandem linker region was removed (ΔPDZ2) Syn was no longer able to attenuate ectopic TRAF6 induced NF-

κB activity (Figure 4.26, Table 8). While this could be interpreted as the importance of the T6IM, PDZ2 and/or CTD, it also suggests that the NTD of Syn is insufficient to attenuate TRAF6 signaling. Furthermore, I expected that Syn would not be able to inhibit RZcc if Syn associated with the MATH domain, using its putative TIM. Contrary to my expectation, Syn was equally able to inhibit RZcc induced NF-κB activity (Figure

4.25A). This finding contradicts other reports that that full length Syn is required to both interact with TRAF6 and inhibit TRAF6 signaling and (Chen, Du et al. 2008). As such, a more complex mechanism for attenuation of TRAF6 signaling by Syntenin must exist.

Furthermore, although the ΔPDZ1 or ΔN muteins could inhibit TRAF6 signaling the

ΔPDZ1 and ΔN was insufficient for physical interaction with TRAF6 (Figure 4.27).

Here, the underlying mechanism might be that the putative T6IM in Syn is not binding tightly to the MATH TI6M due to minor degeneracy in the sequence. When the sequence was initially identified, I reasoned that while the last position, which calls for an (Ar/Ac) residue, was substituted in Syntenin for other hydrophobic residues, the final two positions for the T6IM were hydrophobic as seen in (Figure 5.3) and would be adequate to mitigate TRAF6-Syn interaction, perhaps as a minor TRAF6-binding motif. Such

163

minor binding motifs have previously been reported (Schneider, Zimmermann et al.

2012). These data, coupled with the fact that the putative T6IM resides in an unstructured region, along with the robust activity data where the CTD was found to be inhibitory in wt. and RZ conditions (Figure 4.25) may yet allow this sequence to be confirmed as the binding motif for TRAF6 in Syn. To be sure that the putative T6IM is dispensable, point mutations of the site or a small deletion of the site should be generated and used for assays similar to those performed in this study.

Analysis of Syntenin TIM sequence

P X E X X ψ (acidic residue) Canonical TIM

P X E X Φ (aromatic residue)

194 P F E R T I 198 T PDZ2 Human

194 P F E R T V 198 T S M PDZ2 Mouse

I is very hydrophobic aliphatic V is very hydrophobic T is hydrophobic as well

Figure 5.3 Deviations of murine and human Syn T6IM from canonical T6IM. P-X-E-X-X-aromatic (F/W/Y)-acidic (D/E) is the TRAF6-binding motif (where 'X' indicates any amino acid and '/' indicates 'or').

164

5.7 Syntenin associates with TRAF6 in an Ubiquitin-dependent manner

Ubiquitination has been shown to be an important post-translational modification for protein function and cellular control. Ubiquitin is covalently bound to proteins via an isopeptide bond between the carboxy-terminal glycine (G76) of ubiquitin (Ub) and the ε amino group of a lysine in target proteins. Ubiquitin contains seven lysine residues (K6,

K11, K27, K29, K33, K48, and K63) which can attach to another Ub to form poly-Ub chains attached to a single lysine (Nath and Shadan 2009). Ubiquitinated TRAF6 recruits

TAB1/2 and TAK1 kinase leading to the activation of TAK1, which phosphorylates both

MAPK and IKK complexes to activate NF-κB (Figure 4.2). Although autoubiquitination is insufficient for NF-κB activity, our results and the literature suggest that

TRAF6 auto-ubiquitination serves to sustain TRAF6 signaling by keeping it in the

“open” state (Walsh, Kim et al. 2008, Wang, Galson et al. 2010). Deletion of all lysines, which are potential ubiquitination sites, in TRAF6 reduces, but does not abolish, its signaling capacity (Walsh, Kim et al. 2008).

Syn was found to inhibit the RZcc mutein in 293 cells (Figure 4.25), implying that it does not directly bind TRAF6 via a Syn-MATH interaction or that Syn binds to TRAF6 through multiple interactions (Figure 5.1, 5.2). When a lysine deficient TRAF6

(TRAF6ΔK) was ectopically expressed in 293 cells, Syn inhibition was reduced (Figure

4.28A). Additionally, Syn ΔN was less effective at inhbiting TRAF6ΔK vs wtTRAF6.

This suggests that the Syn NTD which has been shown to bind Ub in a novel manner

(Rajesh, Bago et al. 2011) may bind to Ubiquinated, activated TRAF6 (Figure 4.28B).

This conclusion is corroborated by differential colocalization of Syn and TRAF6 vs a poly-Ub deficient TRAF6c70A mutein (Figure 4.33, 4.34). While Syn colocalizes with

165

TRAF6 in the cytoplasm and translocates TRAF6 into the nucleus under stimulating conditions (dominant positive or ligand stimulation; Figures 4.30, 4.31) TRAF6C70A r3mained in the cytoplasm (Figure 4.32), Collectively, these results suggest that the

PDZ2 and CTD of Syn requires TRAF6 + Ub to bind TRAF6 and bring it to the nucleus which interferes with TRAF6 signaling in the cytoplasm. Further, TRAF6 (-) Ub blocks the Syn NTD from interacting and translocating TRAF6 to the nucleus. These results are corroborated by reports that Syn binds ubiquitin directly through a novel Ub binding pocket, using a mechanism where the recognition involves both N- and C-termini of Syn rather than its PDZ domains, which instead mediate prerequisite dimerization (Rajesh,

Bago et al. 2011). Furthermore, Syntenin interacts equally well with K48- or K63-linked polyubiquitin chains in a NTD- CTD Syn homo-dimer dependent manner (Rajesh, Bago et al. 2011). Since the NTD of Syn is involved in binding to Ub and likely, ubiquitinated

TRAF6, the inability of Syn to interact and relocalize the C70A muteins supports this model of interaction. The CTD (194-298) of Syn, comprised of the linker (T6IM), PDZ2 and CTD, alone are also critical components of Syn involved in TRAF6 nuclear localization.

A future study should include a co-IP of C70Aand Syn, which should not bind if

Ub-TRAF6 is critical for Syn interaction. Additionally, the study should test whether

Syn can inhibit RZcc dominant positive in RAW264.7 and 4B12 cells. The mechanism by which Syn binds to TRAF6 might be that ubiquitinated TRAF6 is necessary, but insufficient, for the Syn-TRAF6 interaction. Taken together, the results that both the

CTD and NTD of Syntenin are required for interaction with TRAF6, along with the demonstration that IRAK1 binds to the MATH domain of TRAF6 and disrupts RZ-

166

MATH interaction, lead to consider the temporal dynamics of a Syn-TRAF6 association and regulation. Specifically, IRAK1 opens the TRAF6 conformation allowing TRAF6 to be auto-ubiquitinated, optimizing the Syn interaction and attenuation of TRAF6 signaling. This model conflicts with reports that Syn and TRAF6 are pre-associated and that IRAK1 disrupts this interaction in concert with an increase in TRAF6 polyubiquitination (Chen, Du et al. 2008). Since Syn dimerization is required for Ub binding (Rajesh, Bago et al. 2011), this may reconcile the fact that TRAF6 was not crystallized as a trimer (McWhirter, Pullen et al. 1999, Park, Burkitt et al. 1999, Ely,

Kodandapani et al. 2007) like other TRAFs, but rather as a MATH domain monomer devoid of a coiled-coil (cc) multimerization domain (Ye, Arron et al. 2002, Ye, Cirilli et al. 2002).

5.8 Syntenin and Sox4 interact with TRAF6 cooperatively Protein interactions with

TRAF6

Examination of Syn and Sox4’s primary amino acid sequences yielded two novel

TIM-bearing TRAF6regulatory proteins: the adapter protein Syntenin-1 and the transcription factor Sox4 (Figures 9, 10, 21, 40). Syn is a dual PDZ domain-containing adaptor protein consisting of asymmetric N- and C-terminal domains joined by a linker peptide (Beekman and Coffer 2008, Pham, Zhou et al. 2008). Often PDZ containing proteins bind to the carboxy-terminal residues of other proteins, which is in keeping with the C terminus position of The MATH domain or the reported stabilization of Sox4’s last

33 C-terminus residues by Syntenin (Beekman, Vervoort et al. 2012). PDZ proteins can act as multi-functional adaptor proteins, playing a role in assembling multi-protein complexes in appropriate regions of the cell (Harris and Lim 2001). Proteins of the PSD-

167

95/Discs large/ZO-1 (PDZ) class can interact with Sox factors. All Sox-family proteins share a conserved High Mobility Group (HMG)-like DNA binding domain. Sox transcription factors can activate or repress many target genes associated with development using the conserved HMG domain. However, it is the non-HMG domains that have been proposed to influence partner protein selection and binding stability

(Wilson and Koopman 2002). There are three different classes of Sox protein–protein interaction: 1) DNA-binding proteins that partner with Sox proteins to regulate transcription 2) adaptor-proteins, that link Sox factors to other proteins; and 3) Importins, required for the nuclear import of all Sox proteins, all of which have relevance to this study. Poulat et al. demonstrated that the PDZ protein, SIP-1 interacts with the carboxy- terminal seven amino acids of SRY and proposed SIP1 connected SRY to other, unidentified proteins (Poulat, de Santa Barbara et al. 1997). By interacting with both

Sox4 and the interleukin 5-receptor α subunit (IL-5α), Syntenin acts adapter facilitating

IL-5R stimulated Sox4-dependent transcriptional activity. The results of my research support a new model where Syn works as an adapter protein possibly by both protecting

Sox4 from proteosomal degradation and TRAF6-Sox4 interaction to attenuate TRAF6 signaling and TRAF6 nuclear import. Ectopic Sox4 was found to inhibit TIR signaling at multiple levels in the TIR signaling pathway to NF-κB (Figure 4.37, 4.38) but perhaps most telling of its specificity for TRAF6 was the ability to inhibit the TRAF6 dominant positive for NF-κB, which is independent of upstream events (Figure 4.39). Sox4 associated with TRAF6 in a MATH dependent manner (Figure 4.39-4.41) since the RZcc was not able to co-precipitate with Sox4 and ectopic Sox4 was unable to attenuate the

RZcc dominant positive for NF-κB activity. Tellingly, Syntenin was unable to inhibit

168

TRAF6 when Sox4 was knocked down in cells treated with si-RNA directed against

Sox4 expression. One possible experiment for a future study would be to see if si-Sox4 could induce dominant positive NF-κB activity in RAW264.7 or $b12 cells, either alone or in conjunction with ectopic wtTRAF6. These results found in this study suggest that the inhibition of TRAF6 by Syntenin is dependent on Sox4 and that Syn acts as an adapter to facilitate Sox4 binding to TRAF6, possibly stabilizing the Sox4-TRAF6 interaction by associating with open Ubiquitinated TRAF6 or a transient association of its degenerate TRAF6 interaction motif. Sox4 was initially identified as a transcription factor required for B- and T-lymphocyte differentiation (Beekman, Vervoort et al. 2012,

Vervoort, van Boxtel et al. 2013). Among the genes targeted by Sox4, are the cmyb and

FHL2, which have been previously implicated as regulated by nuclear TRAF6 (Bai,

Kitaura et al. 2005, Bai, Zha et al. 2008). These studies do not provide a clear mechanism for the nuclear import of TRAF6 from the cytoplasm. I found that overexpression of Syn translocates TRAF6 to the nucleus. Importantly, neither TRAF6 nor

Syn possess a nuclear import signal (NLS). Therefore, my results provide the first description of a mechanism by which TRAF6 enters the nucleus using Syntenin- stabilized Sox4 as the cargo carrying protein for nuclear import and attenuation of

TRAF6 signaling.

169

5.9 TRAF6 Interaction Motif Directs Subcellular Localization

Many TRAF family members translocate from their normal cytoplasmic residence to various subcellular compartments including: the plasma membrane, sequestosome, and nucleus upon stimulating conditions in various receptor systems. TRAF2 and TRAF3 move from the cytoplasm to plasma membrane raft microdomains of anti-CD40 antibody treated B cells upon CD40 engagement (Hostager, Catlett et al. 2000). Moreover, CD40 engagement initiates formation of the immunological synapse has which contain TRAF2 and TRAF3 (Dustin, Chakraborty et al. 2010). RANKL induced recruitment of TRAF6 to detergent resistant lipid microdomains was demonstrated biochemically in RANKL stimulated RAW264.7 cells and osteoclasts (Ha, Kwak et al. 2003, Ha, Kwak et al.

2003). In cells that were pre-treated with a lipid raft disruption reagent, methyl-β- cyclodextrin (MBCD), there was a decrease in the presence of TRAF6 in the detergent insoluble fraction. Coupling the results with the observation that TRAF2/3 are recruited to the IS, points to the possibility that lipid rafts were as an osteoclastogenic signaling platform to support a RANK/TRAF6 complex resembling the immunological synapse.

While TRAF6 is normally associated with signal transduction in the cytoplasm, others have noted that TRAF6 is dual target to both the nucleus on the cytoplasm. This study demonstrates that ectopic TRAF6 resides in punctae (Figure 4.3) whose size has been shown to correlate with TRAF6 activity as measured by a NF-κB Luciferase reporter

(Wang, Galson et al. 2010). Cytoplasmic granules enriched in Sequestosome-1

(p62/SQSTM1), an ubiquitin-binding scaffold protein (Geetha and Wooten 2002,

Donaldson, Li et al. 2003) that activates p38 MAPK (Diradourian, Le May et al. 2008) and IKK (Sanz, Diaz-Meco et al. 2000). SQSTM/p62 is dual targeted to proteasomes

170

and autophagosomes (Wojcik 2013) and inhibition of the TRAF6-p62 interaction has been shown to blocks TRAF6 activity, reducing K63 linked ubiquitination of its target substrate, the tyrosine receptor kinase A (TrkA) (Geetha, Jiang et al. 2005) and neurotrophin receptor interacting factor (NRIF). Intranuclear TRAF6 has been reported in lymphoma B cells where it interacts with c-Myb and represses c-Myb-mediated transactivation (Pham, Zhou et al. 2008).

This study demonstrates that ectopic Syn can translocate normally cytosolic

TRAF6 to the nucleus (Figure 4.32, 4.33). Similarly, ectopic co-expression of unlabeled

TRAF6 resulted in translocation of GFP-Syn into the nucleus (Figure 38). To determine the important domains of Syn for TRAF6 translocation to the nucleus, deletion mutants of Syn were coexpressed with TRAF6-YFP in 293 cells. The results suggests that the C- terminus (194-298) of Syn comprised of the linker (TIM) PDZ2 & C-terminal Domain, along with the unstructured N-Terminus, are the critical components of Syn involved in

TRAF6 nuclear localization (Figure 4.33). TRAF6C70A is inactive and deficient in poly-ubiquitination (Figure 4.34) (Walsh, Kim et al. 2008). Ectopic expression of

TRAF6C70AYFP in 293 cells reveals a subcellular localization, primarily in the cytoplasm, similar to that of wtTRAF6 (Fig 17 Bottom). When Syn was co-expressed with TRAF6C70A-YFP, TRAF6C70A-YFP failed to translocate to the nucleus.

Additionally, when TRAF6C70A-YFP was co-expressed with the Syn deletion muteins, the opposite effect to that of co-expression with wtTRAF6-YFP was seen. SynΔPDZ2 was unable to translocate wtTRAF6 to the nucleus, but was able to support translocation when co-expressed with TRAF6C70A-YFP. I have already determined that the N-

171

terminus of Syn are involved in binding to Ubiquitinated TRAF6; thus, the effects observed here support this interaction.

Traditionally, PDZ domain-bearing proteins are associated with membranes, suggesting that these domains are involved in either organizing transmembrane protein complexes at plasma membranes or recruiting proteins to membranes from the cytosol. However, Syn was observed to have nuclear enrichment in an inverse correlation with plasma membrane localization. The authors imagine that syndecans sequester Syntenin to the plasma membrane and depleting it from a nuclear pool. This suggests that when syndecans are down regulated, Syn moves to the nucleus, where it could have transcriptional activities

(Zimmermann, Tomatis et al. 2001). By extension, I proposed a model where Syntenin interacts with activated TRAF6 at the membrane, and that this association then sequesters

TRAF6 into the nucleus in order to attenuate receptor signaling and propagate TRAF6 transcriptional activity, such as that reported by others (Bai, Kitaura et al. 2005, Bai, Zha et al. 2008, Pham, Zhou et al. 2008). In these reports, TRAF6 was previously found in the nuclei of both normal and malignant CD40 stimulated B-lymphocytes. TRAF6 does not possess a nuclear localization signal but enters the nucleus through the nuclear pore complex containing RanGap1 a Ran GTPase-activating enzyme. Nuclear TRAF6 is modified by SUMO-1 at lysines 124, 142 and 453, interacts with HDAC-1, repressing c-

Myb-mediated transactivation. Of the SUMO proteins, only SUMO-1 contains a nuclear localization signal that functions by transporting the cargo protein into the nucleus.

Interestingly, Syn also contains two Small Ubiquitin-related Modifier-1 (SUMO-

1) binding motifs (Vijayakumaran, Wong et al. 2015). Nuclear TRAF6 is reportedly

172

modified by (SUMO-1), interacts with histone deacetylase 1, and represses c-Myb- mediated transactivation (Pham, Zhou et al. 2008). This could indicate the potential for

Syn to recruit SUMO-1 for targeting TRAF6 within the nucleus.

To ensure that nuclear localization of TRAF6 by Syn was not an artifact of overexpression, I confirmed that endogenous Syn and TRAF6 enter the nucleus with similar kinetics upon RANKL stimulation of RAW246.7 cells (Figure 39). Immunoflourescent staining of endogenous Syn and TRAF6 revealed both proteins as largely cytoplasmic, but then simultaneously enter the nucleus upon stimulation of cell surface receptors that initiate TRAF6 mediated signaling cascades. This was also observed for LPS stimulation

(data not shown), which comports with data presented by others, although misrepresented or incorrectly interpreted as cell surface membrane aggregations (see Fig 6b of Yin et al.

(Yin, Lamothe et al. 2009)). Altogether, it can be concluded that attenuation of TRAF6 signaling may also result from sequestration of cytoplasmic TRAF6, providing a mechanism for previous reports of nuclear translocation of cytoplasmic TRAF6.

While ectopic Syn can translocate normally cytosolicTRAF6 to the nucleus, neither Syn nor TRAF6 has a Nuclear Localization Signal (NLS). Sox4 has been reported to accumulate with Syntenin in the nucleus (Beekman, Vervoort et al. 2012).

Sox4 has a bipartite nuclear localization signal (BP-NLS) at positions 60 -77 and 129-

136, as identified by the Nuclear Protein Database (NPD, http://npd.hgu.mrc.ac.uk/user/index.php) (Figure 1.11). Endogenous TRAF6 and Sox4 were found to colocalize in 4B12 cells (Figure 4.40) and that LPS stimulation resulted in intranuclear TRAF6 accumulation in a manner similar to that of Syntenin. Ectopic

IRAK1 and TRAF6 colocalize in cytoplasmic punctae but ectopic Syntenin disrupted this

173

and neither Sox4 nor Syn seemed to affect IRAK1 localization. These results underscore a model where the T6IM bearing molecules IRAK1, Sox4 or Syn can either activate or attenuate TRAF6 by affecting its subcellular distribution or conformation and presumably

Ubiquitination state. We have recently undertaken some pilot studies where, it seems that there may be a constitutively high amount of Syn mRNA that is followed by an increase in Sox4 mRNA in response to LPS stimulation in THP-1 and 293 cells. We are further examining whether there is any message difference in the monocytic cell line

RAW264.7 that would account for the inability for wt. TRAF6 to act as a dominant positive in those cells. Upon first examination, the data supports model where Syn is available to interact with activated TRAF6, perhaps stabilizes Sox4 and then the two cooperatively translocate TRAF6 into to the nucleus to attenuate signaling to NF-κB by sequestration and possibly allowing for TRAF6-Sox4 transcriptional events, including the repression of FHL2 and cMyb expression.

5.10 Syntenin and TRAF6 involvement in Neurite Formation

Nervous system disruption often results in irreversible loss of sensation and paralysis. This is in part because neurons in the central nervous system (CNS) are unable to overcome an unfavorable extracellular environment to regrow long cellular processes

(axons) after they have been damaged. Neurotrophic factors, proinflammatory cytokines, and transcription factors are often reported to have conflicting trophic and inhibitory roles in neurite extension. As such, the success of regeneration depends largely on the severity of the initial injury and resultant degenerative changes (Harrington, Kim et al. 2002).

The processes of injury-induced neuronal cell death and subsequent regeneration remain poorly understood. However, conditions within the local microenvironment of the injury

174

site, and the intercellular signaling cascades they trigger, are undoubtedly important. The regenerative capacity of the peripheral nerve microenvironment has been studied since the early 1900s when Cajal proposed that it was the peripheral nerve milieu, rather than intrinsic neuronal differences between peripheral and central nervous system neurons, that explained the failure of regeneration in the latter (Yiu and He 2006, Lobato 2008).

Since then, it has been demonstrated that CNS neurons can regenerate in a peripheral nervous system (PNS) environment and that peripheral neurons lose this ability when placed in a central environment (Harrington, Kim et al. 2002). The presence of growth- supportive Schwann cells in the PNS, and inhibition by oligodendrocytes and glial scar in the CNS, contribute to this difference in regenerative capability. Upon injury, CNS axonal growth cones undergo Wallerian degeneration, while the PNS axons assemble new actin-rich growth cones after injury (Knoll and Nordheim 2009). Clearly, the PNS environment facilitates a program of cytoskeletal rearrangement in response to neuronal injury in order to initiate the actin polymerization necessary for axonal growth and synapse formation (Revenu, Athman et al. 2004, Chia, Patel et al. 2012, Montani and

Petrinovic 2014). Yang et al reported that TRAF6 is a direct E3 ubiquitin ligase for Akt kinase K63 linked poly-ubiquitination. Such modification is critical for Akt recruitment to the plasma membrane and activation (Yang, Zhang et al. 2009). In this study, they found that two lysine residues (K8 and K14) located inside the PH (Plekstrin Homology) domain of Akt were targeted for: TRAF6 directed ubiquitination; ubiquitination of Akt, required for its phosphorylation and membrane recruitment; and contribution to both survival and oncogenic signaling pathways (Restuccia and Hemmings 2009). A construct containing the PH-domain of AKT fused to GFP was used P to see whether TRAF6 could induce

175

neurite extensions or neuronal like filipodia in either PC12 cells or 293 cells.

Interestingly, 293 cells were found to be responsive to NGF (Nerve Growth Factor) and produced extensions in response to the NGF stimulation (Figure 4.47), in a manner similar to a previous study published by our group where 293 cells produced extensions in response to either TRAF6 overexpression or IL-1β stimulation (Wang, Wara-Aswapati et al. 2006). Interestingly, when Syntenin was co-expressed with TRAF6, the two ectopic molecules seemed to have antagonistic morphological effects (Figure 4.48-4.50), analogous to Syn attenuation of TRAF6 signaling to NF-κB). Of note, either TRAF6 or

Syn alone seemed to induce either neurite formation or enhance neurite formation in cells additionally stimulated with NGF (Figures 4.48-4.50). It was not unexpected that Syn would generate extensions, since the overexpression of wild-type MDA-9/Syn has been shown to increase migration in non-metastatic cancer cells, and correlates with a more polarized distribution of F-actin and increased pseudopodia formation (Grootjans,

Zimmermann et al. 1997). Further, deleting the PDZ tandem inhibits the formation of filipodia, suggesting that Syn plays an important role via interaction with ubiquitin in the regulation of cancer metastasis and invasion (Okumura, Yoshida et al. 2011). These results underscore that different tissues may utilize the same adapter protein to accomplish different cellular outputs, dependent on the biophysiological system.

However, some of the molecular componentry and mechanisms remain constant across these systems.

5.11 Tec Kinases Osteosynapse and Transcytotic Machinery

Osteoclasts are multinucleated giant cells (MNC) responsible for bone resorption.

These syncytial cells are differentiated from hematopoietic myeloid precursors of the

176

monocyte/macrophage lineage. Mature osteoclasts are polarized cells with a ruffled border and a sealing zone at the apical membrane towards bone surface. To differentiate osteoclast precursors into mature osteoclasts, a cell-cell interaction between osteoclast precursors and osteoblasts/stromal cells is required (Udagawa, Takahashi et al. 1990). In the late 1980’s an in vitro culture system for osteoclast formation was established. This system revealed the importance of the cell-to-cell contact of osteoblast/stromal cells and hematopoietic cells for osteoclast differentiation (Takahashi, Yamana et al. 1988).

Specifically, the system enabled production of the TNF-related cytokine RANKL and the polypeptide growth factor colony-stimulating factor-1 (CSF-1) that were subsequently shown to induce, together, the expression of genes necessary for osteoclastogenesis

(Nakagawa, Kinosaki et al. 1998, Boyle, Simonet et al. 2003). The sealing zone between an osteoclast and the resorbed bone is a large F-actin rich structure that is important for the bone-resorbing activity of osteoclasts, anchoring it to the mineralized extracellular matrix. Additionally, in order to generate a bone resorption pit, osteoclasts may form other F-actin rich structures known as podosomes, which are used for migration in a manner similar to focal adhesions plaques, but independent of actin stress fibers (Jurdic,

Saltel et al. 2006). These two structures share molecular components and architecture with other integrin-mediated adhesive structures, and parallels exist between the regulatory mechanisms that contribute to the formation of these adhesive structures

(Wernimont, Cortesio et al. 2008). An osteopetrotic phenotype in Tec-/- BTK-/- mice revealed these two kinases to play a crucial role in the regulation of osteoclast differentiation. This study establishes their crucial role in the integration of the two essential osteoclastogenic signals, RANK and ITAM (Figure 4.51). Thus, although

177

immune and bone cells share components of signaling cascades, they play distinct roles in each cell type. Furthermore, our studies identified an osteoclastogenic signaling complex composed of Tec kinases and adaptor proteins that may provide a new paradigm for the signal transduction mechanism of osteoclast differentiation: ITAM phosphorylation results in the recruitment of Syk, which phosphorylates adaptor proteins such as BLNK and SLP-76, which in turn function as scaffolds to recruit the Tec kinases activated by RANK and PLCγ to the osteoclast signaling complex so as to induce maximal calcium influx. Such complexes are similar to those formed in the immunological synapse in T cells, which are associated with membrane rafts (Cherukuri,

Dykstra et al. 2001). Each of these synaptic types is built around a microdomains structure comprised of central active zones of exocytosis and endocytosis encircled by adhesion domain surface molecules that may be incorporated into and around the active zones, contributing to modulation of the function state of the synapse. Similarly, T cell activation and function requires a structured engagement of antigen-presenting cells. The cell contacts are characterized by two distinct dynamics in vivo: transient contacts resulting for promigratory junctions called immunological kinipsases or prolonged contacts from stable junctions called immunological synapses. Synapses are induced by T cell receptor (TCR) interactions with agonist self-peptides (MHC) under specific conditions and correlate with robust immune response that generate effector and memory

T-cells. Additionally, parallels exist between the regulatory mechanisms that contribute to the formation of these adhesive structures (Wernimont, Cortesio et al. 2008). This study demonstrated the rapid recruitment of BTK and Tec kinases to the plasma membrane of RAW264.7 cells stimulated with RANKL (Figure 4.52). This patterning

178

could indicate that the signaling complex activated by RANK includes these two bridge molecules (Figure 4.51). Attempts to visualize TRAF6 as part of this complex were unsuccessful and TRAF6 was not observed to be recruited to the membrane (data not shown). Instead, TRAF6 was observed to relocalize to the nucleus in a concomitant manner with Syntenin in stimulating conditions (Figure 4.31). However, when

RAW264.7 were stimulated with RANKL rapid recruitment of fluorescently labeled PH domains or full-length Tec kinases BTK and Tec kinases to the membrane was seen, in a manner similar to reports of CD40 induced recruitment of TRAF2/3 to the plasma membrane (Hostager, Catlett et al. 2000). Confocal microscopy revealed that BTK and

Tec are normally expressed through the cytoplasm. Upon RANKL stimulation, within 5 minutes, BTK was recruited to the plasma membrane as compared to control (GFP) or

Tec Kinase-GFP. The relocalization of BTK was sustained for nearly an hour (Figure

4.52).

Another important question is how the dissolved mineral within the sealed resorption pit is transported away from the bone surface. It has long been suggested that a transcytotic process accomplishes this. Using transfected fluorescent BTK, I observed a continuous collection of vesicles suggestive of the proposed transcytotic mechanism.

OS, I stimulated RAW264.7 cells transfected with PH-BTK-GFP with RANKL for up to

90 hours. Interestingly, what appeared to be a structure resembling the osteoclast FSD

179

was formed and the appearance of negatively stained tunnels from apical to basolateral membrane, possibly representing a means for resorbed bone to be transcytosed through the cell and released by exocytosis at the FSD (Figure 4.53, 4.54). Of note, finger like projections did not appear to be localized to a single FSD but rather in multiples, perhaps suggesting that the FSD is built at the sRANKL signaling site, whereas in a co-culture cell-cell signaling system the RANKL signaling complex might be concentrated into a single structure analogous to the Immunological Synapse.

5.12 Conclusions

TRAF6 is recruited by these receptors, the mechanisms by which TRAF6 is activated under these stimulating conditions remain largely unclear. To address this, I used standard molecular biological techniques to gain insight into the interplay of three proteins with TRAF6: 1) Syntenin-1 (Syn); 2) SRY (sex determining region Y)-box 4

(Sox4); and 3) IL-1 receptor associated kinase 1 (IRAK1). These three proteins physically interact with TRAF6 and affect its signaling activity by modulating subcellular localization and activation of the NF-κB/Rel family of transcription factors under stimulating conditions in cell lines of various tissue types. While many studies have focused on cytoplasmic TRAF6 and its activation, there are a several reports on the localization of TRAF6 (Geetha and Wooten 2002, Nakamura, Kadono et al. 2002, Bai,

Zha et al. 2008, Pham, Zhou et al. 2008) as well as TRAF3 (Gamper, van Eyndhoven et al. 2000) and TRAF4 (Regnier, Tomasetto et al. 1995) to the nucleus in response to either

180

extracellular stimulation or disease. Overexpression of either Syn or Sox4 was found to not only attenuates TRAF6 signaling, but results in its nuclear localization in hematopoietic and monocytic cells. This study demonstrates that IRAK1 can activate

TRAF6 by disrupting a constitutively closed, autoinhibited conformation. Syn attenuates

TRAF6 activity in an ubiquitin and Sox4 dependent manner. This study demonstrates that either mutagenesis or deletion of a newly identified TRAF Interaction motif (TIM) in

Syn and conjunction with the PDZ2 and CTD can affect TRAF6 signaling and localization. Moreover, in agreement with previous reports, Syn appears to interact with

TRAF6 directly when TRAF6 is in an ubiquitinated, open-active state. This, and our observation that Syn is impaired in its ability to attenuate a non-ubiquitinated TRAF6 mutein (TRAF6ΔK), led to a hypothesis that Syn associates with TRAF6 in the cytoplasm following activation by IRAK1. Furthermore, knockdown of Sox4 potentiates

TRAF6 activation and abrogates Syn inhibition of TRAF6. Contrary to prior reports, protein domain deletions in both TRAF6 and Syn show that the full-length molecules are not necessary for their interaction. Interestingly, Syn also localizes to the nucleus when overexpressed with either wild type (WT) or a constitutively active TRAF6 (RZcc).

Lastly, Syn binds to the transcription factor Sox4, resulting in Sox4-Syn relocalization to the nucleus. This study demonstrates that Sox4 also induces TRAF6 nuclear translocation that depends on a unique Sox4 TIM, providing a novel mechanism for

TRAF6 entry into the nucleus. Thus, intranuclear TRAF6 suppresses either morphogenesis or differentiation and that inactivation of TRAF6 dependent NF-κB activity involves a novel interaction with the Sox4 transcription factor that controls

TRAF6 nucleocytoplasmic partitioning, conformation and modification state.

181

PERMISSIONS FOR COPYRIGHTED MATERIAL

AAAS permits the use of content published in its journals Science, Science Technical Medicine, and Science Signaling, but only provided the following criteria are met.

1. If you are using figure(s)/table(s), permission is granted for use in print and electronic versions of your dissertation or thesis. 2. A full text article may be used only in print versions of a dissertation or thesis. AAAS does not permit the reproduction of full text articles in electronic versions of theses or dissertations. 3. The following credit line must be printed along with the AAAS material: "From [Full Reference Citation]. Reprinted with permission from AAAS." 4. All required credit lines and notices must be visible any time a user accesses any part of the AAAS material and must appear on any printed copies that an authorized user might make. 5. The AAAS material may not be modified or altered except that figures and tables may be modified with permission from the author. Author permission for any such changes must be secured prior to your use. 6. AAAS must publish the full paper prior to your use of any of its text or figures. 7. If the AAAS material covered by this permission was published in Science during the years 1974–1994, you must also obtain permission from the author, who may grant or withhold permission, and who may or may not charge a fee if permission is granted. See original article for author's address. This condition does not apply to news articles.

8. If you are an Original Author on the AAAS article being reproduced, please refer to your License to Publish for rules on reproducing your paper in a dissertation or thesis.

Permission covers the distribution of your dissertation or thesis on demand by a third party distributor (e.g. ProQuest / UMI), provided the AAAS material covered by this permission remains in situ and is not distributed by that third party outside of the context of your Thesis/Dissertation.

Permission does not apply to figures/photos/artwork or any other content or materials included in your work that are credited to non-AAAS sources. If the requested material is sourced to or references non- AAAS sources, you must obtain authorization from that source as well before using that material. You agree to hold harmless and indemnify AAAS against any claims arising from your use of any content in your work that is credited to non-AAAS sources.

By using the AAAS Material identified in your request, you agree to abide by all the terms and conditions herein.

AAAS makes no representations or warranties as to the accuracy of any information contained in the AAAS material covered by this permission, including any warranties of merchantability or fitness for a particular purpose.

Questions about these terms can be directed to the AAAS Permissions department [email protected].

182

From: Bella Kalderon To: An-Jey Su Re: use of your figure

Thank you for your inquiry. If you want to use the figure for your dissertation for a degree we are happy to comply, as long as the source of the figure is clearly stated.

Good luck

Dr. Bella Kalderon

Department of Microbiology and Molecular Genetics, Institute for Medical Research Israel-Canada (IMRIC), Hebrew University Medical School, Hadassah Ein Kerem, Jerusalem, Israel 91120.

…………………………………………………………………………………..………… Hey there I would like to use your figure 1 on the mechanism of dual targeting from Front Mol Biosci. 2014 Nov 25;1:23. doi: 10.3389/fmolb.2014.00023. eCollection 2014. in my dissertation. According to the Frontiers site the figure copyrights are retained by the author. Could I please have permission?

Sincerely,

An-Jey Andrew Su

Duquesne University Ph.D. Program in Biological Sciences 230 Mellon Hall Pittsburgh, PA 15282

412-396-1475 (tel)

183

REFERENCES

Akira, S. and K. Takeda (2004). "Toll-like receptor signalling." Nat Rev Immunol 4(7): 499-511.

Arron, J. R. and Y. Choi (2000). "Bone versus immune system." Nature 408(6812): 535- 536.

Asea, A., M. Rehli, E. Kabingu, J. A. Boch, O. Bare, P. E. Auron, M. A. Stevenson and S. K. Calderwood (2002). "Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4." J Biol Chem 277(17): 15028- 15034.

Babu, J. R., T. Geetha and M. W. Wooten (2005). "Sequestosome 1/p62 shuttles polyubiquitinated tau for proteasomal degradation." J Neurochem 94(1): 192-203.

Baeuerle, P. A. and D. Baltimore (1988). "I kappa B: a specific inhibitor of the NF-kappa B transcription factor." Science 242(4878): 540-546.

Baeuerle, P. A. and D. Baltimore (1989). "A 65-kappaD subunit of active NF-kappaB is required for inhibition of NF-kappaB by I kappaB." Genes Dev 3(11): 1689-1698.

Bai, S., H. Kitaura, H. Zhao, J. Chen, J. M. Muller, R. Schule, B. Darnay, D. V. Novack, F. P. Ross and S. L. Teitelbaum (2005). "FHL2 inhibits the activated osteoclast in a TRAF6-dependent manner." J Clin Invest 115(10): 2742-2751.

Bai, S., J. Zha, H. Zhao, F. P. Ross and S. L. Teitelbaum (2008). "Tumor necrosis factor receptor-associated factor 6 is an intranuclear transcriptional coactivator in osteoclasts." J Biol Chem 283(45): 30861-30867.

Baker, M. (2016). "Statisticians issue warning over misuse of P values." Nature 531(7593): 151.

Balkhi, M. Y., K. A. Fitzgerald and P. M. Pitha (2008). "Functional regulation of MyD88-activated interferon regulatory factor 5 by K63-linked polyubiquitination." Mol Cell Biol 28(24): 7296-7308.

184

Baud, V., Z. G. Liu, B. Bennett, N. Suzuki, Y. Xia and M. Karin (1999). "Signaling by proinflammatory cytokines: oligomerization of TRAF2 and TRAF6 is sufficient for JNK and IKK activation and target gene induction via an amino-terminal effector domain." Genes Dev 13(10): 1297-1308.

Beekman, J. M. and P. J. Coffer (2008). "The ins and outs of syntenin, a multifunctional intracellular adaptor protein." J Cell Sci 121(Pt 9): 1349-1355.

Beekman, J. M., S. J. Vervoort, F. Dekkers, M. E. van Vessem, S. Vendelbosch, A. Brugulat-Panes, J. van Loosdregt, A. K. Braat and P. J. Coffer (2012). "Syntenin- mediated regulation of Sox4 proteasomal degradation modulates transcriptional output." Oncogene 31(21): 2668-2679.

Beg, A. A., T. S. Finco, P. V. Nantermet and A. S. Baldwin (1993). "Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of I kappa B alpha: a mechanism for NF-kappa B activation." Mol Cell Biol 13(6): 3301-3310.

Berczi, I., A. Quintanar-Stephano and K. Kovacs (2009). "Neuroimmune regulation in immunocompetence, acute illness, and healing." Ann N Y Acad Sci 1153: 220-239.

Bergsland, M., M. Werme, M. Malewicz, T. Perlmann and J. Muhr (2006). "The establishment of neuronal properties is controlled by Sox4 and Sox11." Genes Dev 20(24): 3475-3486.

Blair, J. M., Y. Zheng and C. R. Dunstan (2007). "RANK ligand." Int J Biochem Cell Biol 39(6): 1077-1081.

Boch, J. A., Y. Yoshida, Y. Koyama, N. Wara-Aswapati, H. Peng, S. Unlu and P. E. Auron (2003). "Characterization of a cascade of protein interactions initiated at the IL-1 receptor." Biochem Biophys Res Commun 303(2): 525-531.

Boukerche, H., H. Aissaoui, C. Prevost, H. Hirbec, S. K. Das, Z. Z. Su, D. Sarkar and P. B. Fisher (2010). "Src kinase activation is mandatory for MDA-9/syntenin-mediated activation of nuclear factor-kappaB." Oncogene 29(21): 3054-3066.

Bowles, J., G. Schepers and P. Koopman (2000). "Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators." Dev Biol 227(2): 239-255.

185

Boyle, W. J., W. S. Simonet and D. L. Lacey (2003). "Osteoclast differentiation and activation." Nature 423(6937): 337-342.

Butcher, E. C., E. L. Berg and E. J. Kunkel (2004). "Systems biology in drug discovery." Nat Biotechnol 22(10): 1253-1259.

Cao, Z., J. Xiong, M. Takeuchi, T. Kurama and D. V. Goeddel (1996). "TRAF6 is a signal transducer for interleukin-1." Nature 383(6599): 443-446.

Chen, F., Y. Du, Z. Zhang, G. Chen, M. Zhang, H. B. Shu, Z. Zhai and D. Chen (2008). "Syntenin negatively regulates TRAF6-mediated IL-1R/TLR4 signaling." Cell Signal 20(4): 666-674.

Chen, L. Y., W. W. Pan, M. Chen, J. D. Li, W. Liu, G. Chen, S. Huang, T. J. Papadimos and Z. K. Pan (2009). "Synergistic induction of inflammation by bacterial products lipopolysaccharide and fMLP: an important microbial pathogenic mechanism." J Immunol 182(4): 2518-2524.

Chen, Y. Q., S. Ghosh and G. Ghosh (1998). "A novel DNA recognition mode by the NF-kappa B p65 homodimer." Nat Struct Biol 5(1): 67-73.

Cherukuri, A., M. Dykstra and S. K. Pierce (2001). "Floating the Raft Hypothesis: Lipid Rafts Play a Role in Immune Cell Activation." Immunity 14(6): 657-660.

Chia, P. H., M. R. Patel and K. Shen (2012). "NAB-1 instructs synapse assembly by linking adhesion molecules and F-actin to active zone proteins." Nat Neurosci 15(2): 234- 242.

Chow, J. C., D. W. Young, D. T. Golenbock, W. J. Christ and F. Gusovsky (1999). "Toll- like receptor-4 mediates lipopolysaccharide-induced signal transduction." J Biol Chem 274(16): 10689-10692.

Cierpicki, T., J. H. Bushweller and Z. S. Derewenda (2005). "Probing the supramodular architecture of a multidomain protein: the structure of syntenin in solution." Structure 13(2): 319-327.

Coornaert, B., I. Carpentier and R. Beyaert (2009). "A20: central gatekeeper in inflammation and immunity." J Biol Chem 284(13): 8217-8221.

186

Darnay, B. G. and B. B. Aggarwal (1999). "Signal transduction by tumour necrosis factor and tumour necrosis factor related ligands and their receptors." Ann Rheum Dis 58(Suppl 1): i2-i13.

Das, K. P., T. M. Freudenrich and W. R. Mundy (2004). "Assessment of PC12 cell differentiation and neurite growth: a comparison of morphological and neurochemical measures." Neurotoxicol Teratol 26(3): 397-406.

Das, S. K., S. K. Bhutia, U. K. Sokhi, B. Azab, Z. Z. Su, H. Boukerche, T. Anwar, E. L. Moen, D. Chatterjee, M. Pellecchia, D. Sarkar and P. B. Fisher (2012). "Raf kinase inhibitor RKIP inhibits MDA-9/syntenin-mediated metastasis in melanoma." Cancer Res 72(23): 6217-6226.

Davies, C. C., T. W. Mak, L. S. Young and A. G. Eliopoulos (2005). "TRAF6 is required for TRAF2-dependent CD40 signal transduction in nonhemopoietic cells." Mol Cell Biol 25(22): 9806-9819.

Davis, D. M. (2002). "Assembly of the immunological synapse for T cells and NK cells." Trends Immunol 23(7): 356-363. de Jong, S. J., J. C. Albrecht, F. Giehler, A. Kieser, H. Sticht and B. Biesinger (2013). "Noncanonical NF-kappaB activation by the oncoprotein Tio occurs through a nonconserved TRAF3-binding motif." Sci Signal 6(272): ra27. de Jong, S. J., J. C. Albrecht, M. Schmidt, I. Muller-Fleckenstein and B. Biesinger (2010). "Activation of noncanonical NF-kappaB signaling by the oncoprotein Tio." J Biol Chem 285(22): 16495-16503.

Dinkel, H., K. Van Roey, S. Michael, N. E. Davey, R. J. Weatheritt, D. Born, T. Speck, D. Kruger, G. Grebnev, M. Kuban, M. Strumillo, B. Uyar, A. Budd, B. Altenberg, M. Seiler, L. B. Chemes, J. Glavina, I. E. Sanchez, F. Diella and T. J. Gibson (2014). "The eukaryotic linear motif resource ELM: 10 years and counting." Nucleic Acids Res 42(Database issue): D259-266.

Diradourian, C., C. Le May, M. Cauzac, J. Girard, A. F. Burnol and J. P. Pegorier (2008). "Involvement of ZIP/p62 in the regulation of PPARalpha transcriptional activity by p38- MAPK." Biochim Biophys Acta 1781(5): 239-244.

187

Donaldson, K. M., W. Li, K. A. Ching, S. Batalov, C. C. Tsai and C. A. Joazeiro (2003). "Ubiquitin-mediated sequestration of normal cellular proteins into polyglutamine aggregates." Proc Natl Acad Sci U S A 100(15): 8892-8897.

Dowlatshahi, D. P., V. Sandrin, S. Vivona, T. A. Shaler, S. E. Kaiser, F. Melandri, W. I. Sundquist and R. R. Kopito (2012). "ALIX is a Lys63-specific polyubiquitin binding protein that functions in retrovirus budding." Dev Cell 23(6): 1247-1254.

Drubin, D. G., S. C. Feinstein, E. M. Shooter and M. W. Kirschner (1985). "Nerve growth factor-induced neurite outgrowth in PC12 cells involves the coordinate induction of microtubule assembly and assembly-promoting factors." J Cell Biol 101(5 Pt 1): 1799- 1807.

Dustin, M. L. (2009). "Modular design of immunological synapses and kinapses." Cold Spring Harb Perspect Biol 1(1): a002873.

Dustin, M. L., A. K. Chakraborty and A. S. Shaw (2010). "Understanding the structure and function of the immunological synapse." Cold Spring Harb Perspect Biol 2(10): a002311.

Dustin, M. L. and D. R. Colman (2002). "Neural and immunological synaptic relations." Science 298(5594): 785-789.

Dustin, M. L. and A. S. Shaw (1999). "Costimulation: building an immunological synapse." Science 283(5402): 649-650.

Dy, P., A. Penzo-Mendez, H. Wang, C. E. Pedraza, W. B. Macklin and V. Lefebvre (2008). "The three SoxC proteins--Sox4, Sox11 and Sox12--exhibit overlapping expression patterns and molecular properties." Nucleic Acids Res 36(9): 3101-3117.

Ely, K. R., R. Kodandapani and S. Wu (2007). "Protein-protein interactions in TRAF3." Adv Exp Med Biol 597: 114-121.

Fan, Y., X. Xiao, X. Shi, R. Ghobrial, L. Minze and X. Li (2015). "OX40 ligation recruits the E3 ubiquitin ligases TRAF6 and cIAP2 that cooperatively activate the non-canonical NF-κB pathway (IRM15P.608)." The Journal of Immunology 194(1 Supplement): 199.120.

188

Farr, C. J., D. J. Easty, J. Ragoussis, J. Collignon, R. Lovell-Badge and P. N. Goodfellow (1993). "Characterization and mapping of the human SOX4 gene." Mamm Genome 4(10): 577-584.

Ferrao, R., J. Li, E. Bergamin and H. Wu (2012). "Structural insights into the assembly of large oligomeric signalosomes in the Toll-like receptor-interleukin-1 receptor superfamily." Sci Signal 5(226): re3.

Funakoshi-Tago, M., N. Kamada, T. Shimizu, Y. Hashiguchi, K. Tago, Y. Sonoda and T. Kasahara (2009). "TRAF6 negatively regulates TNFalpha-induced NF-kappaB activation." Cytokine 45(2): 72-79.

Funakoshi-Tago, M., K. Tago, Y. Sonoda, S. Tominaga and T. Kasahara (2003). "TRAF6 and C-SRC induce synergistic AP-1 activation via PI3-kinase-AKT-JNK pathway." Eur J Biochem 270(6): 1257-1268.

Gamper, C., W. G. van Eyndhoven, E. Schweiger, M. Mossbacher, B. Koo and S. Lederman (2000). "TRAF-3 interacts with p62 nucleoporin, a component of the nuclear pore central plug that binds classical NLS-containing import complexes." Mol Immunol 37(1-2): 73-84.

Garcia, L., C. Castillo, J. Carballo, Y. Rodriguez, P. Forsyth, R. Medina, J. C. Martinez and M. Longart (2013). "ErbB receptors and PKC regulate PC12 neuronal-like differentiation and sodium current elicitation." Neuroscience 236: 88-98.

Geetha, T., J. Jiang and M. W. Wooten (2005). "Lysine 63 polyubiquitination of the nerve growth factor receptor TrkA directs internalization and signaling." Mol Cell 20(2): 301-312.

Geetha, T. and M. W. Wooten (2002). "Structure and functional properties of the ubiquitin binding protein p62." FEBS Lett 512(1-3): 19-24.

Geijsen, N., I. J. Uings, C. Pals, J. Armstrong, M. McKinnon, J. A. Raaijmakers, J. W. Lammers, L. Koenderman and P. J. Coffer (2001). "Cytokine-specific transcriptional regulation through an IL-5Ralpha interacting protein." Science 293(5532): 1136-1138.

Ghosh, S. and D. Baltimore (1990). "Activation in vitro of NF-kappa B by phosphorylation of its inhibitor I kappa B." Nature 344(6267): 678-682.

189

Glauner, H., D. Siegmund, H. Motejadded, P. Scheurich, F. Henkler, O. Janssen and H. Wajant (2002). "Intracellular localization and transcriptional regulation of tumor necrosis factor (TNF) receptor-associated factor 4 (TRAF4)." Eur J Biochem 269(19): 4819-4829.

Goodridge, H. S., C. N. Reyes, C. A. Becker, T. R. Katsumoto, J. Ma, A. J. Wolf, N. Bose, A. S. Chan, A. S. Magee, M. E. Danielson, A. Weiss, J. P. Vasilakos and D. M. Underhill (2011). "Activation of the innate immune receptor Dectin-1 upon formation of a 'phagocytic synapse'." Nature 472(7344): 471-475.

Gravallese, E. M., D. L. Galson, S. R. Goldring and P. E. Auron (2001). "The role of TNF-receptor family members and other TRAF-dependent receptors in bone resorption." Arthritis Res 3(1): 6-12.

Grech, A., R. Quinn, D. Srinivasan, X. Badoux and R. Brink (2000). "Complete structural characterisation of the mammalian and Drosophila TRAF genes: implications for TRAF evolution and the role of RING finger splice variants." Mol Immunol 37(12-13): 721- 734.

Grootjans, J. J., P. Zimmermann, G. Reekmans, A. Smets, G. Degeest, J. Durr and G. David (1997). "Syntenin, a PDZ protein that binds syndecan cytoplasmic domains." Proc Natl Acad Sci U S A 94(25): 13683-13688.

Gubbay, J., J. Collignon, P. Koopman, B. Capel, A. Economou, A. Munsterberg, N. Vivian, P. Goodfellow and R. Lovell-Badge (1990). "A gene mapping to the sex- determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes." Nature 346(6281): 245-250.

Guo, R., M. Yamashita, Q. Zhang, Q. Zhou, D. Chen, D. G. Reynolds, H. A. Awad, L. Yanoso, L. Zhao, E. M. Schwarz, Y. E. Zhang, B. F. Boyce and L. Xing (2008). "Ubiquitin ligase Smurf1 mediates tumor necrosis factor-induced systemic bone loss by promoting proteasomal degradation of bone morphogenetic signaling proteins." J Biol Chem 283(34): 23084-23092.

Gutierrez, H., G. W. O'Keeffe, N. Gavalda, D. Gallagher and A. M. Davies (2008). "Nuclear factor kappa B signaling either stimulates or inhibits neurite growth depending on the phosphorylation status of p65/RelA." J Neurosci 28(33): 8246-8256.

Ha, H., H. B. Kwak, S. W. Le, H. H. Kim and Z. H. Lee (2003). "Lipid rafts are important for the association of RANK and TRAF6." Exp Mol Med 35(4): 279-284.

190

Ha, H., H. B. Kwak, S. K. Lee, D. S. Na, C. E. Rudd, Z. H. Lee and H. H. Kim (2003). "Membrane rafts play a crucial role in receptor activator of nuclear factor kappaB signaling and osteoclast function." J Biol Chem 278(20): 18573-18580.

Hanke, J. H., J. P. Gardner, R. L. Dow, P. S. Changelian, W. H. Brissette, E. J. Weringer, B. A. Pollok and P. A. Connelly (1996). "Discovery of a novel, potent, and Src family- selective tyrosine kinase inhibitor. Study of Lck- and FynT-dependent T cell activation." J Biol Chem 271(2): 695-701.

Harley, V. R., R. Lovell-Badge and P. N. Goodfellow (1994). "Definition of a consensus DNA binding site for SRY." Nucleic Acids Res 22(8): 1500-1501.

Harrington, A. W., J. Y. Kim and S. O. Yoon (2002). "Activation of Rac GTPase by p75 is necessary for c-jun N-terminal kinase-mediated apoptosis." J Neurosci 22(1): 156-166.

Harris, B. Z. and W. A. Lim (2001). "Mechanism and role of PDZ domains in signaling complex assembly." J Cell Sci 114(Pt 18): 3219-3231.

Harrod, T. R. and L. B. Justement (2002). "Evaluating function of transmembrane protein tyrosine phosphatase CD148 in lymphocyte biology." Immunol Res 26(1-3): 153-166.

Hayden, M. S. and S. Ghosh (2004). "Signaling to NF-kappaB." Genes Dev 18(18): 2195-2224.

Heck, S., K. Bender, M. Kullmann, M. Göttlicher, P. Herrlich and A. C. Cato (1997). "I kappaB alpha-independent downregulation of NF-kappaB activity by glucocorticoid receptor." Embo J 16(15): 4698-4707.

Higuchi, M., K. Onishi, N. Masuyama and Y. Gotoh (2003). "The phosphatidylinositol-3 kinase (PI3K)-Akt pathway suppresses neurite branch formation in NGF-treated PC12 cells." Genes Cells 8(8): 657-669.

Hildebrand, J. M., Z. Yi, C. M. Buchta, J. Poovassery, L. L. Stunz and G. A. Bishop (2011). "Roles of tumor necrosis factor receptor associated factor 3 (TRAF3) and TRAF5 in immune cell functions." Immunol Rev 244(1): 55-74.

Hong, J. H., K. M. Noh, Y. E. Yoo, S. Y. Choi, S. Y. Park, Y. H. Kim and J. M. Chung (2003). "Iron promotes the survival and neurite extension of serum-starved PC12 cells in the presence of NGF by enhancing cell attachment." Mol Cells 15(1): 10-19.

191

Hostager, B. S. and G. A. Bishop (2013). "CD40-Mediated Activation of the NF-κB2 Pathway." Front Immunol 4: Article 376.

Hostager, B. S., I. M. Catlett and G. A. Bishop (2000). "Recruitment of CD40 and tumor necrosis factor receptor-associated factors 2 and 3 to membrane microdomains during CD40 signaling." J Biol Chem 275(20): 15392-15398.

Hur, E. H., W. Hur, J. Y. Choi, I. K. Kim, H. Y. Kim, S. K. Yoon and H. Rhim (2004). "Functional identification of the pro-apoptotic effector domain in human Sox4." Biochem Biophys Res Commun 325(1): 59-67.

Huse, M. and J. Kuriyan (2002). "The conformational plasticity of protein kinases." Cell 109(3): 275-282.

Jain, A., S. Kaczanowska and E. Davila (2014). "IL-1 Receptor-Associated Kinase Signaling and Its Role in Inflammation, Cancer Progression, and Therapy Resistance." Front Immunol 5: Article 553.

Jauch, R., C. K. Ng, K. Narasimhan and P. R. Kolatkar (2012). "The crystal structure of the Sox4 HMG domain-DNA complex suggests a mechanism for positional interdependence in DNA recognition." Biochem J 443(1): 39-47.

Jensen, L. E. and A. S. Whitehead (2003). "Ubiquitin activated tumor necrosis factor receptor associated factor-6 (TRAF6) is recycled via deubiquitination." FEBS Lett 553(1- 2): 190-194.

Jiang, Y., Q. Ding, X. Xie, R. T. Libby, V. Lefebvre and L. Gan (2013). "Transcription factors SOX4 and SOX11 function redundantly to regulate the development of mouse retinal ganglion cells." J Biol Chem 288(25): 18429-18438.

Jiang, Z., H. J. Johnson, H. Nie, J. Qin, T. A. Bird and X. Li (2003). "Pellino 1 is required for interleukin-1 (IL-1)-mediated signaling through its interaction with the IL-1 receptor- associated kinase 4 (IRAK4)-IRAK-tumor necrosis factor receptor-associated factor 6 (TRAF6) complex." J Biol Chem 278(13): 10952-10956.

Jiang, Z., T. W. Mak, G. Sen and X. Li (2004). "Toll-like receptor 3-mediated activation of NF-kappaB and IRF3 diverges at Toll-IL-1 receptor domain-containing adapter inducing IFN-beta." Proc Natl Acad Sci U S A 101(10): 3533-3538.

192

Jimi, E., K. Aoki, H. Saito, F. D'Acquisto, M. J. May, I. Nakamura, T. Sudo, T. Kojima, F. Okamoto, H. Fukushima, K. Okabe, K. Ohya and S. Ghosh (2004). "Selective inhibition of NF-kappa B blocks osteoclastogenesis and prevents inflammatory bone destruction in vivo." Nat Med 10(6): 617-624.

Jurdic, P., F. Saltel, A. Chabadel and O. Destaing (2006). "Podosome and sealing zone: Specificity of the osteoclast model." European Journal of Cell Biology 85(3–4): 195-202.

Kalderon, B. and O. Pines (2014). "Protein folding as a driving force for dual protein targeting in eukaryotes." Front Mol Biosci 1: Article 23.

Karin, M. (2008). "The IkappaB kinase - a bridge between inflammation and cancer." Cell Res 18(3): 334-342.

Katritch, V., V. Cherezov and R. C. Stevens (2012). "Diversity and modularity of G protein-coupled receptor structures." Trends Pharmacol Sci 33(1): 17-27.

Kaur, G., A. Delluc-Clavieres, I. K. Poon, J. K. Forwood, D. J. Glover and D. A. Jans (2010). "Calmodulin-dependent nuclear import of HMG-box family nuclear factors: importance of the role of SRY in sex reversal." Biochem J 430(1): 39-48.

Khursigara, G., J. R. Orlinick and M. V. Chao (1999). "Association of the p75 neurotrophin receptor with TRAF6." J Biol Chem 274(5): 2597-2600.

Kim, H. M., B. S. Park, J. I. Kim, S. E. Kim, J. Lee, S. C. Oh, P. Enkhbayar, N. Matsushima, H. Lee, O. J. Yoo and J. O. Lee (2007). "Crystal structure of the TLR4-MD- 2 complex with bound endotoxin antagonist Eritoran." Cell 130(5): 906-917.

Kisslov, I., A. Naamati, N. Shakarchy and O. Pines (2014). "Dual-targeted proteins tend to be more evolutionarily conserved." Mol Biol Evol 31(10): 2770-2779.

Knoll, B. and A. Nordheim (2009). "Functional versatility of transcription factors in the nervous system: the SRF paradigm." Trends Neurosci 32(8): 432-442.

Kollewe, C., A. C. Mackensen, D. Neumann, J. Knop, P. Cao, S. Li, H. Wesche and M. U. Martin (2004). "Sequential autophosphorylation steps in the interleukin-1 receptor- associated kinase-1 regulate its availability as an adapter in interleukin-1 signaling." J Biol Chem 279(7): 5227-5236.

193

Korpelainen, E. I., M. Karkkainen, Y. Gunji, M. Vikkula and K. Alitalo (1999). "Endothelial receptor tyrosine kinases activate the STAT signaling pathway: mutant Tie- 2 causing venous malformations signals a distinct STAT activation response." Oncogene 18(1): 1-8.

Kovalenko, A., C. Chable-Bessia, G. Cantarella, A. Israel, D. Wallach and G. Courtois (2003). "The tumour suppressor CYLD negatively regulates NF-kappaB signalling by deubiquitination." Nature 424(6950): 801-805.

Kuner, P., R. Schubenel and C. Hertel (1998). "Beta-amyloid binds to p57NTR and activates NFkappaB in human neuroblastoma cells." J Neurosci Res 54(6): 798-804.

Lamothe, B., A. Besse, A. D. Campos, W. K. Webster, H. Wu and B. G. Darnay (2007). "Site-specific Lys-63-linked tumor necrosis factor receptor-associated factor 6 autoubiquitination is a critical determinant of I kappa B kinase activation." J Biol Chem 282(6): 4102-4112.

Laudet, V., D. Stehelin and H. Clevers (1993). "Ancestry and diversity of the HMG box superfamily." Nucleic Acids Res 21(10): 2493-2501.

Layfield, R. and L. J. Hocking (2004). "SQSTM1 and Paget's disease of bone." Calcif Tissue Int 75(5): 347-357.

Lean, J. M., K. Matsuo, S. W. Fox, K. Fuller, F. M. Gibson, G. Draycott, M. R. Wani, K. E. Bayley, B. R. Wong, Y. Choi, E. F. Wagner and T. J. Chambers (2000). "Osteoclast lineage commitment of bone marrow precursors through expression of membrane-bound TRANCE." Bone 27(1): 29-40.

Lemmon, M. A. (2003). "Phosphoinositide recognition domains." Traffic 4(4): 201-213.

Li, X., M. Commane, Z. Jiang and G. R. Stark (2001). "IL-1-induced NFkappa B and c- Jun N-terminal kinase (JNK) activation diverge at IL-1 receptor-associated kinase (IRAK)." Proc Natl Acad Sci U S A 98(8): 4461-4465.

Li, X. and G. R. Stark (2002). "NFkappaB-dependent signaling pathways." Exp Hematol 30(4): 285-296.

Lin, J. J., H. Jiang and P. B. Fisher (1998). "Melanoma differentiation associated gene-9, mda-9, is a human gamma interferon responsive gene." Gene 207(2): 105-110.

194

Liu, A., P. Gong, S. W. Hyun, K. Z. Wang, E. A. Cates, D. Perkins, D. D. Bannerman, A. C. Puche, V. Y. Toshchakov, S. Fang, P. E. Auron, S. N. Vogel and S. E. Goldblum (2012). "TRAF6 protein couples Toll-like receptor 4 signaling to Src family kinase activation and opening of paracellular pathway in human lung microvascular endothelia." J Biol Chem 287(20): 16132-16145.

Lluis, J. M., F. Buricchi, P. Chiarugi, A. Morales and J. C. Fernandez-Checa (2007). "Dual role of mitochondrial reactive oxygen species in hypoxia signaling: activation of nuclear factor-{kappa}B via c-SRC and oxidant-dependent cell death." Cancer Res 67(15): 7368-7377.

Lobato, R. D. (2008). "Historical vignette of Cajal's work "Degeneration and regeneration of the nervous system" with a reflection of the author." Neurocirugia (Astur) 19(5): 456-468.

Locksley, R. M., N. Killeen and M. J. Lenardo (2001). "The TNF and TNF receptor superfamilies: integrating mammalian biology." Cell 104(4): 487-501.

Lomaga, M. A., W. C. Yeh, I. Sarosi, G. S. Duncan, C. Furlonger, A. Ho, S. Morony, C. Capparelli, G. Van, S. Kaufman, A. van der Heiden, A. Itie, A. Wakeham, W. Khoo, T. Sasaki, Z. Cao, J. M. Penninger, C. J. Paige, D. L. Lacey, C. R. Dunstan, W. J. Boyle, D. V. Goeddel and T. W. Mak (1999). "TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling." Genes Dev 13(8): 1015-1024.

Lorenzo, J., M. Horowitz and Y. Choi (2008). "Osteoimmunology: interactions of the bone and immune system." Endocr Rev 29(4): 403-440.

Louveau, A., I. Smirnov, T. J. Keyes, J. D. Eccles, S. J. Rouhani, J. D. Peske, N. C. Derecki, D. Castle, J. W. Mandell, K. S. Lee, T. H. Harris and J. Kipnis (2015). "Structural and functional features of central nervous system lymphatic vessels." Nature 532(7560): 337–341.

Luong le, A., M. Fragiadaki, J. Smith, J. Boyle, J. Lutz, J. L. Dean, S. Harten, M. Ashcroft, S. R. Walmsley, D. O. Haskard, P. H. Maxwell, H. Walczak, C. Pusey and P. C. Evans (2013). "Cezanne regulates inflammatory responses to hypoxia in endothelial cells by targeting TRAF6 for deubiquitination." Circ Res 112(12): 1583-1591.

Madrid, L. V., M. W. Mayo, J. Y. Reuther and A. S. Baldwin, Jr. (2001). "Akt stimulates the transactivation potential of the RelA/p65 Subunit of NF-kappa B through utilization of the Ikappa B kinase and activation of the mitogen-activated protein kinase p38." J Biol Chem 276(22): 18934-18940.

195

Malek, S., Y. Chen, T. Huxford and G. Ghosh (2001). "IkappaBbeta, but not IkappaBalpha, functions as a classical cytoplasmic inhibitor of NF-kappaB dimers by masking both NF-kappaB nuclear localization sequences in resting cells." J Biol Chem 276(48): 45225-45235.

Marfori, M., A. Mynott, J. J. Ellis, A. M. Mehdi, N. F. Saunders, P. M. Curmi, J. K. Forwood, M. Boden and B. Kobe (2011). "Molecular basis for specificity of nuclear import and prediction of nuclear localization." Biochim Biophys Acta 1813(9): 1562- 1577.

Maschhoff, K. L., P. Q. Anziano, P. Ward and H. S. Baldwin (2003). "Conservation of Sox4 gene structure and expression during chicken embryogenesis." Gene 320: 23-30.

McWhirter, S. M., S. S. Pullen, J. M. Holton, J. J. Crute, M. R. Kehry and T. Alber (1999). "Crystallographic analysis of CD40 recognition and signaling by human TRAF2." Proc Natl Acad Sci U S A 96(15): 8408-8413.

Medvedev, A. E. and S. N. Vogel (2003). "Overexpression of CD14, TLR4, and MD-2 in HEK 293T cells does not prevent induction of in vitro endotoxin tolerance." J Endotoxin Res 9(1): 60-64.

Medzhitov, R., P. Preston-Hurlburt and C. A. Janeway, Jr. (1997). "A human homologue of the Drosophila Toll protein signals activation of adaptive immunity." Nature 388(6640): 394-397.

Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh and C. A. Janeway, Jr. (1998). "MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways." Mol Cell 2(2): 253-258.

Meier, I. and D. E. Somers (2011). "Regulation of nucleocytoplasmic trafficking in plants." Curr Opin Plant Biol 14(5): 538-546.

Mercurio, F. and A. M. Manning (1999). "Multiple signals converging on NF-kappaB." Curr Opin Cell Biol 11(2): 226-232.

Meszaros, B., Z. Dosztanyi and I. Simon (2012). "Disordered binding regions and linear motifs--bridging the gap between two models of molecular recognition." PLoS One 7(10): e46829.

196

Miossec, P. (2003). "Interleukin-17 in rheumatoid arthritis: if T cells were to contribute to inflammation and destruction through synergy." Arthritis Rheum 48(3): 594-601.

Mizukami, J., G. Takaesu, H. Akatsuka, H. Sakurai, J. Ninomiya-Tsuji, K. Matsumoto and N. Sakurai (2002). "Receptor activator of NF-kappaB ligand (RANKL) activates TAK1 mitogen-activated protein kinase kinase kinase through a signaling complex containing RANK, TAB2, and TRAF6." Mol Cell Biol 22(4): 992-1000.

Monks, C. R., B. A. Freiberg, H. Kupfer, N. Sciaky and A. Kupfer (1998). "Three- dimensional segregation of supramolecular activation clusters in T cells." Nature 395(6697): 82-86.

Montani, L. and M. M. Petrinovic (2014). "Targeting axonal regeneration: the growth cone takes the lead." J Neurosci 34(13): 4443-4444.

Morrow, J. K., L. Du-Cuny, L. Chen, E. J. Meuillet, E. A. Mash, G. Powis and S. Zhang (2011). "Recent Development of Anticancer Therapeutics Targeting Akt." Recent Pat Anticancer Drug Discov 6(1): 146-159.

Mortier, E., G. Wuytens, I. Leenaerts, F. Hannes, M. Y. Heung, G. Degeest, G. David and P. Zimmermann (2005). "Nuclear speckles and nucleoli targeting by PIP2-PDZ domain interactions." EMBO J 24(14): 2556-2565.

Moscat, J., M. T. Diaz-Meco and M. W. Wooten (2007). "Signal integration and diversification through the p62 scaffold protein." Trends Biochem Sci 32(2): 95-100.

Muroi, M. and K. Tanamoto (2008). "TRAF6 distinctively mediates MyD88- and IRAK- 1-induced activation of NF-kappaB." J Leukoc Biol 83(3): 702-707.

Muroi, M. and K. Tanamoto (2012). "IRAK-1-mediated negative regulation of Toll-like receptor signaling through proteasome-dependent downregulation of TRAF6." Biochim Biophys Acta 1823(2): 255-263.

Nakagawa, N., M. Kinosaki, K. Yamaguchi, N. Shima, H. Yasuda, K. Yano, T. Morinaga and K. Higashio (1998). "RANK is the essential signaling receptor for osteoclast differentiation factor in osteoclastogenesis." Biochem Biophys Res Commun 253(2): 395-400.

197

Nakamura, I., Y. Kadono, H. Takayanagi, E. Jimi, T. Miyazaki, H. Oda, K. Nakamura, S. Tanaka, G. A. Rodan and L. T. Duong (2002). "IL-1 regulates cytoskeletal organization in osteoclasts via TNF receptor-associated factor 6/c-Src complex." J Immunol 168(10): 5103-5109.

Nath, D. and S. Shadan (2009). "The ubiquitin system." Nature 458(7237): 421-421.

Neduva, V. and R. B. Russell (2006). "Peptides mediating interaction networks: new leads at last." Curr Opin Biotechnol 17(5): 465-471.

Newton, K., M. L. Matsumoto, I. E. Wertz, D. S. Kirkpatrick, J. R. Lill, J. Tan, D. Dugger, N. Gordon, S. S. Sidhu, F. A. Fellouse, L. Komuves, D. M. French, R. E. Ferrando, C. Lam, D. Compaan, C. Yu, I. Bosanac, S. G. Hymowitz, R. F. Kelley and V. M. Dixit (2008). "Ubiquitin chain editing revealed by polyubiquitin linkage-specific antibodies." Cell 134(4): 668-678.

Ni, C. Z., K. Welsh, E. Leo, C. K. Chiou, H. Wu, J. C. Reed and K. R. Ely (2000). "Molecular basis for CD40 signaling mediated by TRAF3." Proc Natl Acad Sci U S A 97(19): 10395-10399.

Novack, D. V., L. Yin, A. Hagen-Stapleton, R. D. Schreiber, D. V. Goeddel, F. P. Ross and S. L. Teitelbaum (2003). "The IkappaB function of NF-kappaB2 p100 controls stimulated osteoclastogenesis." J Exp Med 198(5): 771-781.

Oeckinghaus, A., M. S. Hayden and S. Ghosh (2011). "Crosstalk in NF-kappaB signaling pathways." Nat Immunol 12(8): 695-708.

Okumura, F., K. Yoshida, F. Liang and S. Hatakeyama (2011). "MDA-9/syntenin interacts with ubiquitin via a novel ubiquitin-binding motif." Mol Cell Biochem 352(1-2): 163-172.

Ousman, S. S. and P. Kubes (2012). "Immune surveillance in the central nervous system." Nat Neurosci 15(8): 1096-1101.

Pankiv, S., T. H. Clausen, T. Lamark, A. Brech, J. A. Bruun, H. Outzen, A. Overvatn, G. Bjorkoy and T. Johansen (2007). "p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy." J Biol Chem 282(33): 24131-24145.

198

Park, Y. C., V. Burkitt, A. R. Villa, L. Tong and H. Wu (1999). "Structural basis for self- association and receptor recognition of human TRAF2." Nature 398(6727): 533-538.

Park, Y. S., H. S. Lee, M. H. Won, J. H. Lee, S. Y. Lee and H. Y. Lee (2002). "Effect of an exo-polysaccharide from the culture broth of Hericium erinaceus on enhancement of growth and differentiation of rat adrenal nerve cells." Cytotechnology 39(3): 155-162.

Paul, W. E. (2003). Fundamental immunology. Philadelphia, Lippincott Williams & Wilkins.

Pawson, T. and P. Nash (2000). "Protein-protein interactions define specificity in signal transduction." Genes Dev 14(9): 1027-1047.

Penzo-Mendez, A., P. Dy, B. Pallavi and V. Lefebvre (2007). "Generation of mice harboring a Sox4 conditional null allele." Genesis 45(12): 776-780.

Pham, L. V., H. J. Zhou, Y. C. Lin-Lee, A. T. Tamayo, L. C. Yoshimura, L. Fu, B. G. Darnay and R. J. Ford (2008). "Nuclear tumor necrosis factor receptor-associated factor 6 in lymphoid cells negatively regulates c-Myb-mediated transactivation through small ubiquitin-related modifier-1 modification." J Biol Chem 283(8): 5081-5089.

Poblenz, A. T., J. J. Jacoby, S. Singh and B. G. Darnay (2007). "Inhibition of RANKL- mediated osteoclast differentiation by selective TRAF6 decoy peptides." Biochem Biophys Res Commun 359(3): 510-515.

Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton and B. Beutler (1998). "Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene." Science 282(5396): 2085-2088.

Pool, M., J. Thiemann, A. Bar-Or and A. E. Fournier (2008). "NeuriteTracer: a novel ImageJ plugin for automated quantification of neurite outgrowth." J Neurosci Methods 168(1): 134-139.

Poulat, F., P. de Santa Barbara, M. Desclozeaux, S. Soullier, B. Moniot, N. Bonneaud, B. Boizet and P. Berta (1997). "The human testis determining factor SRY binds a nuclear factor containing PDZ protein interaction domains." J Biol Chem 272(11): 7167-7172.

199

Preiss, S., A. Argentaro, A. Clayton, A. John, D. A. Jans, T. Ogata, T. Nagai, I. Barroso, A. J. Schafer and V. R. Harley (2001). "Compound effects of point mutations causing campomelic dysplasia/autosomal sex reversal upon SOX9 structure, nuclear transport, DNA binding, and transcriptional activation." J Biol Chem 276(30): 27864-27872.

Pullen, S. S., M. E. Labadia, R. H. Ingraham, S. M. McWhirter, D. S. Everdeen, T. Alber, J. J. Crute and M. R. Kehry (1999). "High-affinity interactions of tumor necrosis factor receptor-associated factors (TRAFs) and CD40 require TRAF trimerization and CD40 multimerization." Biochemistry 38(31): 10168-10177.

Qian, Y., M. Commane, J. Ninomiya-Tsuji, K. Matsumoto and X. Li (2001). "IRAK- mediated translocation of TRAF6 and TAB2 in the interleukin-1-induced activation of NFkappa B." J Biol Chem 276(45): 41661-41667.

Rahighi, S. and I. Dikic (2012). "Selectivity of the ubiquitin-binding modules." FEBS Letters 586(17): 2705-2710.

Rajesh, S., R. Bago, E. Odintsova, G. Muratov, G. Baldwin, P. Sridhar, S. Rajesh, M. Overduin and F. Berditchevski (2011). "Binding to syntenin-1 protein defines a new mode of ubiquitin-based interactions regulated by phosphorylation." J Biol Chem 286(45): 39606-39614.

Randow, F. and B. Seed (2001). "Endoplasmic reticulum chaperone gp96 is required for innate immunity but not cell viability." Nat Cell Biol 3(10): 891-896.

Ransohoff, R. M. and B. Engelhardt (2012). "The anatomical and cellular basis of immune surveillance in the central nervous system." Nat Rev Immunol 12(9): 623-635.

Rao, V. S., K. Srinivas, G. N. Sujini and G. N. Kumar (2014). "Protein-protein interaction detection: methods and analysis." Int J Proteomics 2014: 147648.

Read, D. E. and A. M. Gorman (2009). "Involvement of Akt in neurite outgrowth." Cell Mol Life Sci 66(18): 2975-2984.

Regnier, C. H., C. Tomasetto, C. Moog-Lutz, M. P. Chenard, C. Wendling, P. Basset and M. C. Rio (1995). "Presence of a new conserved domain in CART1, a novel member of the tumor necrosis factor receptor-associated protein family, which is expressed in breast carcinoma." J Biol Chem 270(43): 25715-25721.

200

Restuccia, D. F. and B. A. Hemmings (2009). "Cell signaling. Blocking Akt-ivity." Science 325(5944): 1083-1084.

Revenu, C., R. Athman, S. Robine and D. Louvard (2004). "The co-workers of actin filaments: from cell structures to signals." Nat Rev Mol Cell Biol 5(8): 635-646.

Rhyasen, G. W. and D. T. Starczynowski (2015). "IRAK signalling in cancer." Br J Cancer 112(2): 232-237.

Rong, Z., L. Cheng, Y. Ren, Z. Li, Y. Li, X. Li, H. Li, X. Y. Fu and Z. Chang (2007). "Interleukin-17F signaling requires ubiquitination of interleukin-17 receptor via TRAF6." Cell Signal 19(7): 1514-1520.

Rousseau, A., M. C. Rio and F. Alpy (2011). "TRAF4, at the Crossroad between Morphogenesis and Cancer." Cancers (Basel) 3(2): 2734-2749.

Sanz, L., M. T. Diaz-Meco, H. Nakano and J. Moscat (2000). "The atypical PKC- interacting protein p62 channels NF-kappaB activation by the IL-1-TRAF6 pathway." EMBO J 19(7): 1576-1586.

Schimmelpfeng, J., K. F. Weibezahn and H. Dertinger (2004). "Quantification of NGF- dependent neuronal differentiation of PC-12 cells by means of neurofilament-L mRNA expression and neuronal outgrowth." J Neurosci Methods 139(2): 299-306.

Schneider, M., A. G. Zimmermann, R. A. Roberts, L. Zhang, K. V. Swanson, H. Wen, B. K. Davis, I. C. Allen, E. K. Holl, Z. Ye, A. H. Rahman, B. J. Conti, T. K. Eitas, B. H. Koller and J. P. Ting (2012). "The innate immune sensor NLRC3 attenuates Toll-like receptor signaling via modification of the signaling adaptor TRAF6 and transcription factor NF-kappaB." Nat Immunol 13(9): 823-831.

Seibenhener, M. L., J. R. Babu, T. Geetha, H. C. Wong, N. R. Krishna and M. W. Wooten (2004). "Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin proteasome degradation." Mol Cell Biol 24(18): 8055-8068.

Shaw G, M. S., Ararat M, Graham FL. (2002). "Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells." FASEB J 16(18): 869-871.

201

Shih, V. F., R. Tsui, A. Caldwell and A. Hoffmann (2011). "A single NFkappaB system for both canonical and non-canonical signaling." Cell Res 21(1): 86-102.

Shinohara, M., T. Koga, K. Okamoto, S. Sakaguchi, K. Arai, H. Yasuda, T. Takai, T. Kodama, T. Morio, R. S. Geha, D. Kitamura, T. Kurosaki, W. Ellmeier and H. Takayanagi (2008). "Tyrosine kinases BTK and Tec regulate osteoclast differentiation by linking RANK and ITAM signals." Cell 132(5): 794-806.

Smith, J. M. and P. A. Koopman (2004). "The ins and outs of transcriptional control: nucleocytoplasmic shuttling in development and disease." Trends Genet 20(1): 4-8.

Starczynowski, D. T., W. W. Lockwood, S. Delehouzee, R. Chari, J. Wegrzyn, M. Fuller, M. S. Tsao, S. Lam, A. F. Gazdar, W. L. Lam and A. Karsan (2011). "TRAF6 is an amplified oncogene bridging the RAS and NF-kappaB pathways in human lung cancer." J Clin Invest 121(10): 4095-4105.

Stashenko, P., F. E. Dewhirst, M. L. Rooney, L. A. Desjardins and J. D. Heeley (1987). "Interleukin-1 beta is a potent inhibitor of bone formation in vitro." J Bone Miner Res 2(6): 559-565.

Storz, P., H. Doppler and A. Toker (2004). "Protein kinase Cdelta selectively regulates protein kinase D-dependent activation of NF-kappaB in oxidative stress signaling." Mol Cell Biol 24(7): 2614-2626.

Sun, H., X. Li, L. Fan, G. Wu, M. Li and J. Fang (2014). "TRAF6 is upregulated in colon cancer and promotes proliferation of colon cancer cells." The International Journal of Biochemistry & Cell Biology 53: 195-201.

Sun, H., X. B. Li, Y. Meng, L. Fan, M. Li and J. Fang (2013). "TRAF6 upregulates expression of HIF-1alpha and promotes tumor angiogenesis." Cancer Res 73(15): 4950- 4959.

Sun, S. C. (2008). "Deubiquitylation and regulation of the immune response." Nat Rev Immunol 8(7): 501-511.

Sun, S. C. (2011). "Non-canonical NF-κB signaling pathway." Cell Res 21(1): 71-85.

202

Takahashi, N., H. Yamana, S. Yoshiki, G. D. Roodman, G. R. Mundy, S. J. Jones, A. Boyde and T. Suda (1988). "Osteoclast-like cell formation and its regulation by osteotropic hormones in mouse bone marrow cultures." Endocrinology 122(4): 1373- 1382.

Takayanagi, H. (2007). "Osteoimmunology: shared mechanisms and crosstalk between the immune and bone systems." Nat Rev Immunol 7(4): 292-304.

Takeuchi, M., M. Rothe and D. V. Goeddel (1996). "Anatomy of TRAF2. Distinct domains for nuclear factor-kappaB activation and association with tumor necrosis factor signaling proteins." J Biol Chem 271(33): 19935-19942.

Trioulier, Y., S. Torch, B. Blot, N. Cristina, C. Chatellard-Causse, J. M. Verna and R. Sadoul (2004). "Alix, a protein regulating endosomal trafficking, is involved in neuronal death." J Biol Chem 279(3): 2046-2052.

Trompouki, E., E. Hatzivassiliou, T. Tsichritzis, H. Farmer, A. Ashworth and G. Mosialos (2003). "CYLD is a deubiquitinating enzyme that negatively regulates NF- kappaB activation by TNFR family members." Nature 424(6950): 793-796.

Trudeau, T., R. Nassar, A. Cumberworth, E. T. Wong, G. Woollard and J. Gsponer (2013). "Structure and intrinsic disorder in protein autoinhibition." Structure 21(3): 332- 341.

Udagawa, N., N. Takahashi, T. Akatsu, H. Tanaka, T. Sasaki, T. Nishihara, T. Koga, T. J. Martin and T. Suda (1990). "Origin of osteoclasts: mature monocytes and macrophages are capable of differentiating into osteoclasts under a suitable microenvironment prepared by bone marrow-derived stromal cells." Proc Natl Acad Sci U S A 87(18): 7260-7264.

Unlu, S., A. Kumar, W. R. Waterman, J. Tsukada, K. Z. Wang, D. L. Galson and P. E. Auron (2007). "Phosphorylation of IRF8 in a pre-associated complex with Spi-1/PU.1 and non-phosphorylated Stat1 is critical for LPS induction of the IL1B gene." Mol Immunol 44(13): 3364-3379.

Verstrepen, L., T. Bekaert, T. L. Chau, J. Tavernier, A. Chariot and R. Beyaert (2008). "TLR-4, IL-1R and TNF-R signaling to NF-kappaB: variations on a common theme." Cell Mol Life Sci 65(19): 2964-2978.

203

Vervoort, S. J., R. van Boxtel and P. J. Coffer (2013). "The role of SRY-related HMG box transcription factor 4 (SOX4) in tumorigenesis and metastasis: friend or foe?" Oncogene 32(29): 3397-3409.

Vijayakumaran, S., M. B. Wong, H. Antony and D. L. Pountney (2015). "Direct and/or Indirect Roles for SUMO in Modulating Alpha-Synuclein Toxicity." Biomolecules 5(3): 1697-1716. von Mering, C., R. Krause, B. Snel, M. Cornell, S. G. Oliver, S. Fields and P. Bork (2002). "Comparative assessment of large-scale data sets of protein-protein interactions." Nature 417(6887): 399-403.

Walsh, M. C., G. K. Kim, P. L. Maurizio, E. E. Molnar and Y. Choi (2008). "TRAF6 autoubiquitination-independent activation of the NFkappaB and MAPK pathways in response to IL-1 and RANKL." PLoS One 3(12): e4064.

Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J. Inoue and Z. J. Chen (2001). "TAK1 is a ubiquitin-dependent kinase of MKK and IKK." Nature 412(6844): 346-351.

Wang, K. Z., D. L. Galson and P. E. Auron (2010). "TRAF6 is autoinhibited by an intramolecular interaction which is counteracted by trans-ubiquitination." J Cell Biochem 110(3): 763-771.

Wang, K. Z., N. Wara-Aswapati, J. A. Boch, Y. Yoshida, C. D. Hu, D. L. Galson and P. E. Auron (2006). "TRAF6 activation of PI 3-kinase-dependent cytoskeletal changes is cooperative with Ras and is mediated by an interaction with cytoplasmic Src." J Cell Sci 119(Pt 8): 1579-1591.

Wang, V. Y., W. Huang, M. Asagiri, N. Spann, A. Hoffmann, C. Glass and G. Ghosh (2012). "The transcriptional specificity of NF-kappaB dimers is coded within the kappaB DNA response elements." Cell Rep 2(4): 824-839.

Warren, J. T., C. A. Nelson, C. E. Decker, W. Zou, D. H. Fremont and S. L. Teitelbaum (2014). "Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members." Sci Signal 7(339): ra80.

Wawrzyniak, A. M., E. Vermeiren, P. Zimmermann and Y. Ivarsson (2012). "Extensions of PSD-95/discs large/ZO-1 (PDZ) domains influence lipid binding and membrane targeting of syntenin-1." FEBS Lett 586(10): 1445-1451.

204

Werner, M. H., M. E. Bianchi, A. M. Gronenborn and G. M. Clore (1995). "NMR spectroscopic analysis of the DNA conformation induced by the human testis determining factor SRY." Biochemistry 34(37): 11998-12004.

Wernimont, S. A., C. L. Cortesio, W. T. N. Simonson and A. Huttenlocher (2008). "Adhesions ring: a structural comparison between podosomes and the immune synapse." Eur J Cell Biol 87(8-9): 507-515.

West, A. P., I. E. Brodsky, C. Rahner, D. K. Woo, H. Erdjument-Bromage, P. Tempst, M. C. Walsh, Y. Choi, G. S. Shadel and S. Ghosh (2011). "TLR signalling augments macrophage bactericidal activity through mitochondrial ROS." Nature 472(7344): 476- 480.

Wetzel, S. A., T. W. McKeithan and D. C. Parker (2002). "Live-cell dynamics and the role of costimulation in immunological synapse formation." J Immunol 169(11): 6092- 6101.

Wilson, M. and P. Koopman (2002). "Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators." Curr Opin Genet Dev 12(4): 441-446.

Wojcik, S. (2013). "Crosstalk between autophagy and proteasome protein degradation systems: possible implications for cancer therapy." Folia Histochem Cytobiol 51(4): 249- 264.

Wong, B. R., D. Besser, N. Kim, J. R. Arron, M. Vologodskaia, H. Hanafusa and Y. Choi (1999). "TRANCE, a TNF family member, activates Akt/PKB through a signaling complex involving TRAF6 and c-Src." Mol Cell 4(6): 1041-1049.

Wooff, J., L. Pastushok, M. Hanna, Y. Fu and W. Xiao (2004). "The TRAF6 RING finger domain mediates physical interaction with Ubc13." FEBS Lett 566(1-3): 229-233.

Wooten, M. W., T. Geetha, J. R. Babu, M. L. Seibenhener, J. Peng, N. Cox, M. T. Diaz- Meco and J. Moscat (2008). "Essential role of sequestosome 1/p62 in regulating accumulation of Lys63-ubiquitinated proteins." J Biol Chem 283(11): 6783-6789.

Wooten, M. W., T. Geetha, M. L. Seibenhener, J. R. Babu, M. T. Diaz-Meco and J. Moscat (2005). "The p62 scaffold regulates nerve growth factor-induced NF-kappaB activation by influencing TRAF6 polyubiquitination." J Biol Chem 280(42): 35625- 35629.

205

Wu, H. and J. R. Arron (2003). "TRAF6, a molecular bridge spanning adaptive immunity, innate immunity and osteoimmunology." Bioessays 25(11): 1096-1105.

Xiao, X., S. Balasubramanian, W. Liu, X. Chu, H. Wang, E. J. Taparowsky, Y. X. Fu, Y. Choi, M. C. Walsh and X. C. Li (2012). "OX40 signaling favors the induction of T(H)9 cells and airway inflammation." Nat Immunol 13(10): 981-990.

Yamoah, K., T. Oashi, A. Sarikas, S. Gazdoiu, R. Osman and Z. Q. Pan (2008). "Autoinhibitory regulation of SCF-mediated ubiquitination by human cullin 1's C- terminal tail." Proc Natl Acad Sci U S A 105(34): 12230-12235.

Yang, L., C. Zhang and B. Peng (2009). "Immunolocalization of tumor necrosis factor receptor-associated factor 6 in rat periapical lesions." J Endod 35(6): 834-837.

Ye, H., J. R. Arron, B. Lamothe, M. Cirilli, T. Kobayashi, N. K. Shevde, D. Segal, O. K. Dzivenu, M. Vologodskaia, M. Yim, K. Du, S. Singh, J. W. Pike, B. G. Darnay, Y. Choi and H. Wu (2002). "Distinct molecular mechanism for initiating TRAF6 signalling." Nature 418(6896): 443-447.

Ye, H., M. Cirilli and H. Wu (2002). "The use of construct variation and diffraction data analysis in the crystallization of the TRAF domain of human tumor necrosis factor receptor associated factor 6." Acta Crystallogr D Biol Crystallogr 58(Pt 10 Pt 2): 1886- 1888.

Ye, H., Y. C. Park, M. Kreishman, E. Kieff and H. Wu (1999). "The structural basis for the recognition of diverse receptor sequences by TRAF2." Mol Cell 4(3): 321-330.

Yin, Q., B. Lamothe, B. G. Darnay and H. Wu (2009). "Structural basis for the lack of E2 interaction in the RING domain of TRAF2." Biochemistry 48(44): 10558-10567.

Yin, Q., S. C. Lin, B. Lamothe, M. Lu, Y. C. Lo, G. Hura, L. Zheng, R. L. Rich, A. D. Campos, D. G. Myszka, M. J. Lenardo, B. G. Darnay and H. Wu (2009). "E2 interaction and dimerization in the crystal structure of TRAF6." Nat Struct Mol Biol 16(6): 658-666.

Yiu, G. and Z. He (2006). "Glial inhibition of CNS axon regeneration." Nat Rev Neurosci 7(8): 617-627.

206

Yoshida, H., H. Jono, H. Kai and J. D. Li (2005). "The tumor suppressor cylindromatosis (CYLD) acts as a negative regulator for toll-like receptor 2 signaling via negative crosstalk with TRAF6 AND TRAF7." J Biol Chem 280(49): 41111-41121.

Yoshida, R., G. Takaesu, H. Yoshida, F. Okamoto, T. Yoshioka, Y. Choi, S. Akira, T. Kawai, A. Yoshimura and T. Kobayashi (2008). "TRAF6 and MEKK1 play a pivotal role in the RIG-I-like helicase antiviral pathway." J Biol Chem 283(52): 36211-36220.

Yoshida, Y., A. Kumar, Y. Koyama, H. Peng, A. Arman, J. A. Boch and P. E. Auron (2004). "Interleukin 1 activates STAT3/nuclear factor-kappaB cross-talk via a unique TRAF6- and p65-dependent mechanism." J Biol Chem 279(3): 1768-1776.

Zeisel, M. B., V. A. Druet, J. Sibilia, J. P. Klein, V. Quesniaux and D. Wachsmann (2005). "Cross talk between MyD88 and focal adhesion kinase pathways." J Immunol 174(11): 7393-7397.

Zimmermann, P., K. Meerschaert, G. Reekmans, I. Leenaerts, J. V. Small, J. Vandekerckhove, G. David and J. Gettemans (2002). "PIP(2)-PDZ domain binding controls the association of syntenin with the plasma membrane." Mol Cell 9(6): 1215- 1225.

Zimmermann, P., D. Tomatis, M. Rosas, J. Grootjans, I. Leenaerts, G. Degeest, G. Reekmans, C. Coomans and G. David (2001). "Characterization of syntenin, a syndecan- binding PDZ protein, as a component of cell adhesion sites and microfilaments." Mol Biol Cell 12(2): 339-350.

Zimmermann, P., Z. Zhang, G. Degeest, E. Mortier, I. Leenaerts, C. Coomans, J. Schulz, F. N'Kuli, P. J. Courtoy and G. David (2005). "Syndecan recycling [corrected] is controlled by syntenin-PIP2 interaction and Arf6." Dev Cell 9(3): 377-388.

Zotti, T., I. Scudiero, P. Settembre, A. Ferravante, P. Mazzone, L. D'Andrea, C. Reale, P. Vito and R. Stilo (2014). "TRAF6-mediated ubiquitination of NEMO requires p62/sequestosome-1." Mol Immunol 58(1): 27-31.

Zotti, T., P. Vito and R. Stilo (2012). "The seventh ring: exploring TRAF7 functions." J Cell Physiol 227(3): 1280-1284.

207